acta biologica nr 16 - Wydział Biologii | Uniwersytet Szczeciński

Komentarze

Transkrypt

acta biologica nr 16 - Wydział Biologii | Uniwersytet Szczeciński
UNIWERSYTET SZCZECIŃSKI
ZESZYTY NAUKOWE NR 581
ACTA BIOLOGICA NR 16
SZCZECIN
Rada Wydawnicza
Urszula Chęcińska, Inga Iwasiów, Danuta Kopycińska, Izabela Kowalska-Paszt
Piotr Niedzielski, Ewa Szuszkiewicz, Dariusz Wysocki
Edward Włodarczyk – przewodniczący Rady Wydawniczej
Aleksander Panasiuk – przewodniczący Senackiej Komisji ds. Wydawnictw
Edyta Łongiewska-Wijas – redaktor naczelna Wydawnictwa Naukowego
Rada Redakcyjna
Marian Ciaciura, Józef Domagała, Jan Głogowski (Instytut Rozrodu Zwierząt
i Badań Żywności PAN w Olsztynie), Ewa Kępczyńska, Zbigniew Mirek
(Instytut Botaniki PAN w Krakowie), Stanisława Rogalska, Maciej Rogalski,
Wojciech Święcicki (Instytut Genetyki PAN w Poznaniu),
Maria Zając (Instytut Botaniki UJ)
Recenzenci
prof. dr hab. Lucjan Agapow
dr hab. Wanda Bacieczko, prof. ZUT
dr hab. Julian Chmiel, prof. UAM
prof. dr hab. Czesław Hołdyński
prof. dr hab. Piotr Masojć
dr hab. Maria Olech
prof. dr hab. Antoni Przybył
prof. dr hab. Marianna Turkiewicz
prof. dr hab. Jan Udała
Redaktor naukowy
prof. dr hab. Józef Domagała
Redaktor Wydawnictwa
Hanna Naparty
Korektor
Renata Bacik
Skład komputerowy
Ewa Radzikowska-Król
© Copyright by Uniwersytet Szczeciński, Szczecin 2010
ISSN 1640-6818
ISSN 1230-3976
WYDAWNICTWO NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
Wydanie I. Ark. wyd. 9,5. Ark. druk. 13,5. Format B5.
Nakład 40 egz.
SPIS TREŚCI
Robert Czerniawski – Stan ilościowy Nematoda i larw Chironomidae
wynoszonych ze zbiorników przepływowych przez rzekę Płonię
w roku 2002 ............................................................................................
5
Robert Czerniawski, Józef Domagała, Małgorzata Pilecka-Rapacz
– Wstępne wyniki badań nad wpływem żywienia wylęgu troci wędrownej (Salmo trutta m. trutta L., 1758) żywym zooplanktonem i larwami
ochotki (Chironomidae) na jego przeżywalność i wzrost w ciekach ..... 17
Przemysław Czerniejewski – Zależność pomiędzy szerokością karapaksu
a masą i kondycją populacji krabika amerykańskiego, Rhithropanopeus
harrisii tridentatus (Maitland, 1874) w estuarium Odry ........................
31
Przemysław Czerniejewski, Agnieszka Rybczyk – Wybrane cechy biologiczne i morfometryczne spływającego węgorza europejskiego (Anguilla anguilla L.) ze zlewni rzeki Myśli ...................................................... 39
Anna Kalitkiewicz, Ewa Kępczyńska – Aktywacja szlaku fenoli u pomidora (Lycopersicon esculentum Mill.) z wykorzystaniem Pseudomonas
putida UW4 ............................................................................................ 47
Karolina Konopska – Wstępne wyniki badań flory roślin naczyniowych
części mezoregionu Równina Nowogardzka w północno-zachodniej
Polsce ...................................................................................................... 57
Małgorzata Pająk, Ewa Kępczyńska – Wpływ kwasu β-aminomasłowego
na wzrost grzybni oraz aktywność endoglukanaz u Fusarium oxysporum
f. sp. lycopersici ......................................................................................
71
Izabela Pasiecznik, Agnieszka Popiela – Materiały do flory Pojezierza
Myśliborskiego (NW Polska): Dzikowo i okolice ..................................
79
Bartosz Startek, Agnieszka Popiela – Materiały do flory naczyniowej
Puszczy Goleniowskiej (NW Polska) ..................................................... 103
Anna Szefner-Mirzołemska – Ocena wybranych parametrów hematologicznych bydła rasy holsztyńsko-fryzyjskiej ....................................... 119
Paweł Sznigir, Jan Kępczyński – Reakcja na regulatory wzrostu nasion
Amaranthus retroflexus L. inkubowanych w glebie przez okres zimowy 129
Marta Umiastowska – Flora i roślinność jezior zachodniej części Pojezierza Drawskiego ........................................................................................ 139
Anetta Wieczorek – Porosty rezerwatów Szczecińskiego Parku Krajobrazowego .................................................................................................... 155
Anetta Wieczorek, Arleta Durka – Ocena stanu środowiska przyrodniczego lewobrzeżnej części miasta szczecina na podstawie reakcji porostu
testowego Xanthoria parietina (L.) Th. Fr. ............................................ 167
Anna Wierzbicka, Józef Kur – Identyfikacja i izolacja genu kodującego
zaadaptowaną do zimna β-galaktozydazę Paracoccus sp. ..................... 177
Magdalena Zemlik, Agnieszka Popiela – Notatki florystyczne z Mostkowa i okolic (Pojezierze Myśliborskie, NW Polska) ................................ 185
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
ROBERT CZERNIAWSKI
Uniwersytet Szczeciński
STAN ILOŚCIOWY NEMATODA I LARW CHIRONOMIDAE
WYNOSZONYCH ZE ZBIORNIKÓW PRZEPŁYWOWYCH
PRZEZ RZEKĘ PŁONIĘ W ROKU 2002
Quantity of Nematoda and Chironomidae larvae removed
by the Płonia river from lakes in 2002
Słowa kluczowe: syrton, odpływy jezior, bezkręgowce wodne, Nematoda, larwy Chironomidae
Key words: syrton, outflows, water invertebrates, Nematoda, chironomids larvae
1. Wstęp
Odpływy zbiorników wodnych, zarówno sztucznych jak i naturalnych,
wynoszą znaczne ilości syrtonu, w którym spotyka się najczęściej fitoplankton,
planktonowe formy skorupiaków i wrotków, ale także przypadkowo oderwane
z prądem rzeki typowo litoralowe czy denne bezkręgowce (Szlauer 1977, 1985;
Ejsmont-Karabin, Węgleńska 1996; Czerniawski 2008a, b). Wyżej wymienieni
autorzy skupiali się w swoich pracach głównie na euplanktonie – przebywającym całe życie w toni wody i na tych zooplanktonowych skorupiakach niższych
czy wrotkach – przypadkowo znajdujących się w pelagialu, traktując z mniejszą
uwagą wynoszone ze zbiorników larwy ochotki i nicienie. Chociaż z powyższych
i innych prac wynika, że organizmy te w niektórych miesiącach osiągają stosunkowo znaczny udział w ogólnych wartościach parametrów ilościowych syrtonu,
a szczególnie w jego biomasie i ilości masy wynoszonej w ciągu jednostki czasu
(Czerniawski 2004; Wolska, Czerniawski 2006).
6
Robert Czerniawski
Za cel pracy przyjęto określenie stanu ilościowego wynoszonych ze zbiorników Nematoda i larw Chironomidae, wpływu zbiorników przepływowych na
ilość tych organizmów w rzece oraz zmian w ich liczebności w rzece w miarę
oddalania się od jeziora.
2. Teren badań
Badania prowadzono na rzece Płoni (NW Poland).
Rzeka Płonia wypływa z Jeziora Barlineckiego i przepływa przez kilka jezior północno-zachodniego regionu Polski: Płoń, Miedwie i Żelewko, po czym
uchodzi do Odry, przepływając przez jezioro Dąbie. Rzeka płynie w większości
przez łąki i grunty orne. Szyper i Gołdyn (1990) podają, że wody Płoni, na odcinku pomiędzy jeziorem Płoń a Miedwie, w 1986 roku pod względem czystości
należały do drugiej klasy.
Badania na rzece Płoni prowadzono na czterech stanowiskach (rys. 1).
Stanowisko pierwsze (st. 1) znajdowało się koło miejscowości Lubiatowo
w odległości ok. 100 m od wypływu rzeki z jeziora Płoń – 790,7 ha, przy moście drogowym, gdzie koryto rzeki ulega znacznemu zwężeniu. Z eutroficznego
jeziora Płoń (Filipiak, Raczyński 2000) rzeka Płonia wypływa sztucznie przekopanym kanałem o miękkim dnie, które sporadycznie porośnięte jest roślinnością
zanurzoną.
Stanowisko drugie (st. 2) obejmowało również miejsce zwężenia rzeki, przy moście drogowym, niedaleko od miejscowości Żelewo, w odległości
300 m od wypływu rzeki z mezotroficznego jeziora Miedwie – 3500 ha (Filipiak, Raczyński 2000). Powyżej tego stanowiska zbudowana jest tama piętrząca
wodę.
Stanowisko trzecie (st. 3) usytuowano przy moście drogowym w miejscowości Jezierzyce, poniżej zbiornika reolimnicznego, gęsto porośniętego roślinnością zanurzoną i wynurzoną. Zbiornik ten ma powierzchnię około 3 ha i średnią głębokość około 1 m.
Stanowisko czwarte (st. 4) znajdowało się w Szczecinie-Dąbiu, również
w okolicy mostu drogowego, przy torach kolejowych, położone było w odległości około 6 km od stanowiska trzeciego. Punkt ten stanowił rodzaj stanowiska kontrolnego, obrazującego skład ilościowy Nematoda i larw Chironomidae
w końcowym odcinku Płoni, tuż przed jej ujściem do jeziora Dąbie.
Plan rzeki Płoni wraz ze stanowiskami poboru prób przedstawia rysunek 1.
Stan ilościowy Nematoda...
7
3. Materiał i metody
Badania prowadzono w roku 2002, pobierając próby co miesiąc, z przedstawionych powyżej stanowisk na rzece Płoni (z wyjątkiem lutego).
Z każdego stanowiska pobierano próbę ilościową, przecedzając 100 dm3
wody przez siatkę z gazy młyńskiej o wielkości oczka 50 μm. Przeliczono osobniki należące do Nematoda i larw Chioronomidae. W każdej z prób mierzono
długość co najmniej 30 osobników każdej grupy. Dane z tych pomiarów posłużyły do obliczenia biomasy tych zwierząt. Przy przeliczaniu długości zwierząt
na ich ciężar posłużono się tabelami Bieriezinej (1940). Wyliczone wartości biomasy zooplanktonu oraz przepływu posłużyły do obliczenia tzw. wilgotnej masy
zooplanktonu wynoszonego przez rzekę, w kg/dobę.
Wykonywano pomiary temperatury, prędkości prądu oraz przepływu rzeki Płoni. Prędkość prądu mierzono za pomocą elektromagnetycznego czujnika
prędkości przepływu wody. Natężenie przepływu obliczono metodą rachunkową
na podstawie wyników pomiarów głębokości, szerokości i prędkości cieku.
Uzyskane wyniki liczebności, biomasy i masy wynoszonej z jezior opracowano statystycznie w programie Excel i Statistica. Istotność różnic badano za pomocą testu Scheffego (p < 0,01) i analizy wariancji (W) (dla wielu prób) (Stanisz
1998). Dodatkowo dla zobrazowania różnic w wybranych cechach pomiędzy poszczególnymi grupami organizmów użyto hierarchicznej metody aglomeracyjnej
(analiza aglomeracyjna), której miarą jest odległość euklidesowa obliczana według wzoru: (x, y) = [Σ1 (xi – yi)2]1/2, gdzie: x, y – obiekty, których odległość jest
obliczana. Wartość tego parametru wskazuje na odległość geometryczną (niepodobieństwo) w przestrzeni wielowymiarowej.
4. Wyniki
Odmienny charakter jezior, zbiornika reolimnicznego, z których wynoszone
były Nematoda i larwy Chironomidae, miał wpływ na stan ilościowy tych zwierząt na poszczególnych stanowiskach w rzece.
Wartości średniej rocznej liczebności i biomasy analizowanych organizmów okazały się najwyższe na stanowisku nr 1 – wypływie Płoni z jeziora
Lubiatowo, odpowiednio: 4,7 osob. · dm–3 (tab. 1) i 0,2408 mg · dm–3 (tabela 2).
Zanotowano tutaj także najwyższe odchylenie standardowe, co świadczy o stosunkowo dużej rozbieżności wyników w całym roku. Na tym stanowisku, zarówno pod względem liczebności jak i biomasy, przeważały Nematoda, osiągając
8
Robert Czerniawski
najwyższe wartości pierwszego parametru w maju – 25,2 osob. · dm–3 i drugiego w styczniu – 0,6000 mg · dm–3. Chociaż w maju biomasa okazała się równie
wysoka (0,5040 mg · dm–3), to jednak biomasa styczniowa zanotowana została
przy znacznie niższej liczebności – 1,8 osob. · dm–3, co świadczy o większych
rozmiarach osobników. Inne stanowiska charakteryzowały się niższymi liczebnościami nicieni; co prawda na stanowisku nr 3 stwierdzono 14,0 osob. · dm–3,
ale była to wartość znacznie niższa od majowej na stanowisku nr 1. Analizując
wszystkie stanowiska razem, Nematoda notowane były we wszystkich miesiącach w roku. Larwy Chironomidae spotykano w miesiącach od marca na stanowisku nr 4 (0,6 osob. · dm–3) do września na stanowisku nr 1 (5,0 osob. · dm–3,
kiedy osiągnęły najwyższą liczebność i biomasę – 0,5000 mg. · dm–3) i nr 4
(0,6 sob. · dm–3). Najniższą średnią roczną liczebności i biomasy Nematoda i larw Chironomidae charakteryzowało się stanowisko nr 4, odpowiednio:
1,6 osob. · dm–3 i 0,0869 mg · dm–3. Najwyższą średnią roczną przepływu masy
analizowanych zwierząt bezkręgowych cechowało się stanowisko nr 3 (Jezierzyce) – 278,10 kg · doba–1 (tabela 3), położone za niewielkim zbiornikiem reolimnicznym. W maju stwierdzono na tym stanowisku najwyższą masę wynoszonych
zwierząt – 2189,72 kg · doba–1, z czego 72% stanowiły Nematoda. Godna uwagi
jest również wartość tego parametru w styczniu na stanowisku nr 1, gdzie nicienie uzyskały 1555,52 kg · doba–1. Wartości przepływu wynoszonych organizmów były skorelowane z wartościami przepływów wody na poszczególnych
stanowiskach (tabela 3 i 4).
Analiza statystyczna (p < 0,01) wykazała brak różnic istotnych statystycznie pomiędzy wszystkimi rozpatrywanymi parametrami ilościowymi. Stwierdzono natomiast istotną statystycznie korelację w liczebności Nematoda i larw Chironomidae (p < 0,05) pomiędzy stanowiskiem nr 3 (Jezierzyce) i stanowiskiem
nr 4 (Dąbie). W biomasie i przepływie masy organizmów nie odnotowano istotnej
statystycznie korelacji pomiędzy badanymi stanowiskami. Analiza aglomeracyjna wykazała, że najbardziej podobne do siebie były stanowiska: pod względem
liczebności st. 3 i 4, a pod względem biomasy oraz przepływu masy zwierząt st. 2
i 4 (rys. 2, 3, 4). W każdym przypadku stwierdzano istotną statystycznie dodatnią
korelację pomiędzy wszystkimi ilościowymi parametrami wynoszonych zwierząt a wartościami prędkości przepływu wody (m/s) i przepływu wody (m3/s).
Stan ilościowy Nematoda...
9
5. Dyskusja
W kształtowaniu stosunków jakościowych i ilościowych zooplanktonu
w wypływach istotną rolę odegrały zapewne sezonowe zmiany składu i ilości
tych zwierząt w zbiornikach, z których wypływały. Podobnie uważają badacze
zajmujący się stworzeniem wynoszonym z jezior (Kaźmierczuk, Szlauer 1984;
Eismont-Karabin, Węgleńska 1996; Czerniawski 2008a). Największe ilości Nematoda i larw Chironomidae zostały stwierdzone na stanowiskach najbardziej bogatych troficznie. Jezioro Lubiatowo jest zbiornikiem eutroficznym (Szyper, Gołdyn 1990), a do reolimnicznego zbiornika w miejscowości Jezierzyce przez lata
zrzucane były nieoczyszczone ścieki (informacja ustna mieszkańców Jezierzyc),
co z pewnością wpłynęło na pogorszenie warunków środowiskowych zbiornika. Przełożyło się to prawdopodobnie na zwiększenie liczebności Nematoda
i larw Chironomidae uważanych za wskaźnik zanieczyszczenia i wysokiego zeutrofizowania wód (Soszka i in. 2001). Mezotroficzne jezioro Miedwie (Filipiak,
Raczyński 2000) cechowało się o ponad połowę niższą liczebnością zwierząt
niż położone wyżej stanowisko nr 1. Można zatem wnioskować, że wynoszone
z niego wody nie są w pełni preferowane przez badaną grupę bezkręgowców.
Najwyższe wartości liczebności i biomasy odnotowano przeważnie w miesiącach
wiosennych i letnich, co jest typowe dla zwierząt bezkręgowych, które osiągają
szczyt swojej liczebności zazwyczaj w miesiącach ciepłych (Szlauer 1977; Wolska, Czerniawski 2006, 2008a). Natomiast wyniki przepływu masy zwierząt były
skorelowane istotnie z jednostką objętości wody wypływającej z jeziora. Stąd
stosunkowo niewielkie wartości przepływu zwierząt w miesiącach letnich, pomimo ich dominacji ilościowej, kiedy poziom wody ulega spadkowi. Jak wspomniano w rozdziale „Wyniki badań”, nie stwierdzono istotnych statystycznie różnic
analizowanych parametrów pomiędzy wszystkimi rozpatrywanymi stanowiskami. Wykazano natomiast istotne statystycznie korelacje w liczebności pomiędzy
stanowiskami nr 3 i 4. Leżą one najbliżej siebie spośród wszystkich stanowisk,
nie są oddzielone żadnym zbiornikiem, który mógłby wpłynąć na zmiany środowiskowe pomiędzy nimi i w takim stanie hydrologicznym należy się dopatrywać
podobieństwa. Zbliżone rezultaty wykazała analiza aglomeracyjna. Czerniawski
(2008a) również odnotował wysokie podobieństwo w składzie syrtonu pomiędzy
blisko siebie położonymi na rzece stanowiskami. Podobieństwo pod względem
masy stanowisk 2 i 4 może wynikać ze zbliżonej na tych stanowiskach przejrzystości wody i tym samym zmieniającej się podobnie w ciągu roku wartości tego
10
Robert Czerniawski
parametru. Syrton jest chętnie wyjadany przez ryby (Szlauer 1977; Czerniawski
2004, 2008a), co może być powodem ograniczania liczebności dużych osobników bezkręgowców w wodzie o znacznej przejrzystości i tym samym gwałtownego spadku biomasy zwierząt. Stwierdzono także, co było istotne statystycznie,
dodatnią korelację pomiędzy wartościami wszystkich parametrów a prędkością
prądu wody i przepływu wody. Może to być związane z szybciej przemieszczającym się z prądem wody syrtonem, co czyni go mniej dostępnym dla zerujących
ryb.
Na podstawie wyników pracy można uznać, że na stan ilościowy nicieni
i larw ochotki istotny wpływ miał stan środowiskowy zbiorników, z których
zwierzęta te były wynoszone. Największe ilości analizowanych bezkręgowców
notowano w odpływach zbiorników o wyższym stopniu trofii, a najmniejsze
w najbardziej oddalonym punkcie, na co prawdopodobnie oddziaływały żerujące
ryby.
11
Stan ilościowy Nematoda...
Rys. 1. Lokalizacja stanowisk poboru prób na rzece Płoni
Fig. 1. Map of the study sites along the Płonia River
Pojedy nc z e wiąz anie
OdlegáoĞ ü euk lides owa
16
15
OdlegáoĞ ü wiąz aĔ
14
13
12
11
10
9
8
7
Dąbie
J ez ierzy c e
ĩelewo
Lubiatowo
Rys. 2. Analiza aglomeracyjna liczebności Nematoda i larw Chironomidae
Fig. 2. Agglomeration analysis of Nematoda and Chironomidae larvae abundance
12
Robert Czerniawski
Pojedyncze wiązanie
OdlegáoĞü euklidesowa
1,05
1,00
OdlegáoĞü wiązaĔ
0,95
0,90
0,85
0,80
0,75
Jezierzyce
Dąbie
ĩelewo
Lubiatowo
Rys. 3. Analiza aglomeracyjna biomasy Nematoda i larw Chironomidae
Fig. 3. Agglomeration analysis of Nematoda and Chironomidawe larvae biomass
Pojedyncze wiązanie
OdlegáoĞü euklidesowa
2000
1800
1600
OdlegáoĞü wiązaĔ
1400
1200
1000
800
600
400
200
0
Jezierzyce
Dąbie
ĩelewo
Lubiatowo
Rys. 4. Analiza aglomeracyjna przepływu masy Nematoda i larw Chironomidae
Fig. 4. Agglomeration analysis of Nematoda and Chironomidae larvae flow of mass
13
Stan ilościowy Nematoda...
Tabela 1. Liczebność Nematoda (N) i larw Chironomidae (Ch) w rzece Płoni w roku
2002 [osob. · dm–3]. SD – odchylenie standardowe, X – średnia
Table 1. Abundance of Nematoda and Chironomidae larvae in the Płonia River in 2002
N
St.
Ch
1
razem
I
III
1,8
0,3
1,8
0,3
N
St.
Ch
2
razem
St.
Ch
3
razem
St.
Ch
4
razem
V
VI
25,2
2,1
VII
VIII
IX
X
0,6
0
0,6
0,9
3,6
5
0,6
25,2
2,7
0,9
7,2
5
7,8
0
0
7,4
4,7
0,6
2,1
6,75
0
1,8
2,1
0
1,5
5,1
2,2
1,8
0,3
1,3
0,4
5,4
2,7
2,2
4,1
1,9
0,9
0,3
3,6
XI
X
7,5
3,7
1,7
1,0
0,6
6,3
6,75
0
1,8
2,1
0
14
1,2
0,6
0,9
1,2
0,45
0,3
3
0,5
0,3
5,1
14,5
1,2
0,6
0,9
1,2
0,45
4,3
2,2
3
5,4
0,6
1,5
0,5
0,45
0,75
0,6
1,6
1,2
0,9
0,9
0,6
0,5
0,4
3
6,6
0,6
2,4
1,4
1,05
0,75
0,6
1,9
1,6
0,6
0,6
1,2
1,5
SD
2,1
0,85
0,85
XI
7,8
4,2
N
N
IV
Tabela 2. Biomasa Nematoda (N) i larw Chironomidae (Ch) w rzece Płoni w roku 2002
[mg · dm–3]. SD – odchylenie standardowe, X – średnia
Table 2. Biomass of Nematoda and Chironomidae larvae in the Płonia River in 2002
I
N
St.
Ch
1
razem
III
0,60
V
VI
0,50
0,17
0,06
0,60
N
St.
Ch
2
razem
VII
VIII
IX
0,29
X
XI
0,06
0,09
0,32
0,50
0,09
0,06
0,50
0,23
0,61
0,50
0,04
0,19
0,47
0,16
0,17
0,12
0,16
0,17
0,12
0,05
0,08
0,04
0,61
0,47
0,08
0,05
0,11
1,26
0,03
0,30
0,05
0,03
0,41
1,31
0,08
0,04
0,05
0,08
0,03
0,21
0,04
0,04
0,09
0,03
0,02
0,05
0,08
0,09
0,05
0,17
0,12
0,08
0,07
0,05
0,07
0,05
0,11
0,21
0,15
0,04
0,04
XI
0,05
0,42
N
St.
Ch
3
razem
N
St.
Ch
4
razem
IV
0,00
X
0,15
0,17
0,09
0,26
0,24
0,41
0,17
0,14
0,03
0,13
0,04
0,44
0,22
0,20
0,37
0,15
0,03
0,05
SD
0,22
0,03
0,03
0,09
0,03
0,39
0,18
0,06
0,05
0,04
0,04
0,07
0,09
14
Robert Czerniawski
Tabela 3. Przepływ masy Nematoda (N) i larw Chironomidae (Ch) w rzece Płoni
w roku 2002 [kg · doba–1]. SD – odchylenie standardowe, X – średnia
Table 3. Flow of mass of Nematoda and Chironomidae larvae in the Płonia River
in 2002
St.
1
N
I
III
1555,5
0,8
1555,5
0,8
Ch
razem
St.
4
VI
8,8
3,2
21,1
94,1
98,1
14,6
116,7
12,0
21,1
177,7
98,1 128,4 0,0
456,2 193,2
28,6
93,8
162,9
16,7
38,0
0,0
9,9 148,7
61,2
10,9
62,6
19,9
16,7
38,0
0,0
9,9 159,6
99,6
65,3
39,2
62,2
8,2
Ch
Ch
36,2
36,2
razem
N
53,5
Ch
razem
VII
VIII
IX
83,6
X
XI
59,4
SD
X
461,6 172,2
0,0
37,8
21,0
45,3
28,6
302,1
162,9
161,7
1567,6
49,6
461,9
622,1
623,6
2189,7
49,6
50,5
39,2
62,2
8,2
0,0
659,1 278,1
198,3
28,9
16,0
12,8
4,3
5,0
8,1
5,1
57,9
30,2
11,6
12,8
12,0
0,0
28,1
16,2
24,4
17,1
17,0
8,1
60,0
46,4
59,4
53,5
XI
128,4
208,4
razem
N
St.
3
V
116,7
14,6
N
St.
2
IV
111,4
463,9 176,3
220,8 101,8
82,5
198,3
50,5
16,0
5,1
Tabela 4. Temperatura [°C], prędkość prądu [m/s] oraz przepływ wody [m3/s] na badanych stanowiskach
Table 4. Rates of temperature, velocity, discharge at the study sites
Styczeń
Marzec
Kwiecień
St. 1. Lubiatowo
[°C]
m/s
m3/s
4,7
1,00 3,00
5,2
0,77 2,51
13,0 1,00 2,81
St. 2. Żelewo
[°C]
m/s
m3/s
3,6
0,27
2,0
3,5
0,62 14,13
10,5 0,35
7,98
St. 3. Jezierzyce
[°C]
m/s
m3/s
4,8
0,71 7,27
5,0
0,75 13,95
10,7 0,90 17,82
St. 4. Dąbie
[°C]
m/s
m3/s
5,0
0,62 5,64
5,0
0,89 14,32
10,7 0,71 10,93
Maj
19,5
1,10
2,68
19,5
0,29
5,74
18,0
0,80
14,40
18,0
0,68
8,84
Czerwiec
19,0
0,27
0,60
19,5
0,19
3,99
18,5
0,57
6,84
19,0
0,49
4,41
Lipiec
22,3
0,71
2,70
20,7
0,10
1,12
22,3
1,42
13,91
20,3
0,33
1,65
Sierpień
21,8
1,28
3,36
17,3
0,10
1,19
18,2
0,90
10,00
20,1
0,33
1,65
2,57
Miesiąc
Wrzesień
12,4
1,21
2,27
12,8
0,22
2,62
13,2
0,90
8,56
13,2
0,65
Październik
5,5
1,21
2,72
10,0
0,17
0,40
7,0
0,28
3,52
7,0
0,52
2,08
Listopad
Grudzień
3,5
1,8
1,20
1,00
2,70
1,87
4,7
2,0
0,17
0,37
0,95
4,21
4,1
2,0
1,42
1,40
12,92
10,38
4,1
2,0
0,38
0,66
1,67
1,98
Stan ilościowy Nematoda...
15
BIBLIOGRAFIA
Bierezina N.A., 1940: Wiesowaja charaktieristika Chironomus plumosus. Tr Moskowskogo
Techn. Inst. Rybnoj Promyslennosti i Choziajstwa. Wyp. 3, s. 61–64.
Czerniawski R., 2004: Zooplankton exported from Lake Adamowo. Zool. Pol., 49/1 – 4,
s. 129–147.
Czerniawski R., 2008a: The effect of flow-through reservoirs on zooplankton of the Płonia
river. Pol. J. Nat. Sc., 23(3), s. 583–597.
Czerniawski R., 2008b: Zooplankton exported from retention reservoirs at the postproduction waste water treatment plant. EJPAU. Vol. 11, Issue 4, series Fisheries.
www.ejpau.pl.
Ejsmont-Karabin J., Węgleńska T. 1996: Przemiany struktury zooplanktonu w strefach
przejściowych rzeka – jezioro – rzeka (System rzeki Krutyni, Pojezierze Mazurskie).
Zesz. Nauk. Kom. „Człowiek i Środowisko”, 13, s. 263–289.
Filipiak J., Raczyński M. 2000: Jeziora zachodniopomorskie. (Zarys faktografii).
Akademia Rolnicza w Szczecinie, Szczecin.
Kaźmierczuk J., Szlauer B., 1984: Zooplankton w urządzeniach zakładu uzdatniania
wody z Jeziora Miedwie. Zesz. Nauk. AR w Szczecinie Seria Ryb. i Techn. Żywn.
XIV, 108, s. 45–56.
Soszka H., Kudelska D., Kownacki A., Fleituch T., 2001: Projekt: Metodyka badania
makrobezkregowców bentosowych na potrzeby biologicznej oceny jakości rzek
w Polsce. IOŚ, Warszawa.
Stanisz A., 1998: Przystępny kurs statystyki. StatSoft Polska, Kraków.
Szlauer B., 1977: The zooplankton removal from lakes by the River Płonia. Acta Ichthy.
Pisc., vol. VI, Fasc. 2, s. 39–53.
Szlauer B., 1985: Hydrobiologiczna charakterystyka zbiornika ściekowego Zakładów
Chemicznych „Police”. AR, Szczecin.
Szyper H., Gołdyn R., 1990: Studium ochrony jeziora Miedwie jako źródła wody do
picia dla Szczecina. Instytut Gospodarki Przestrzennej i Komunalnej, Oddział
w Poznaniu. Poznań.
Wolska M., Czerniawski R., 2006: Zooseston removed from lakes by river Drawa
and a forest stream as a food supply for juvenile fish. Acta Sc. Pol. Pisc., 5(1),
s. 115–128.
16
Robert Czerniawski
QUANTITY OF NEMATODA AND CHIRONOMIDAE LARVAE REMOVED
BY THE PŁONIA RIVER FROM LAKES IN 2002
Summary
The abundance, biomass and flow of mass of Nematoda and chronomids larvae
were studied. Examinations were performed in outflows of the river Płonia from lakes
Płoń, Miedwie and small floodplain. Additionally, samples were collected in site before
mouth of Płonia river into Dąbie lake. The highest amounts of chironomids larvae and
nematodes were observed at outflow from lake Płoń. Between all sites no significant differences in abundance, biomass and flow of mass of Nematoda and chronomids larvae
were stated.
Translated by Robert Czerniawski
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
ROBERT CZERNIAWSKI
JÓZEF DOMAGAŁA
MAŁGORZATA PILECKA-RAPACZ
Uniwersytet Szczeciński
WSTĘPNE WYNIKI BADAŃ NAD WPŁYWEM ŻYWIENIA
WYLĘGU TROCI WĘDROWNEJ (SALMO TRUTTA M.
TRUTTA L., 1758) ŻYWYM ZOOPLANKTONEM
I LARWAMI OCHOTKI (CHIRONOMIDAE)
NA JEGO PRZEŻYWALNOŚĆ I WZROST W CIEKACH
The effect of feeding sea trout (Salmo trutta m. trutta L., 1758)
hatch with alive zooplankton and chironomids (Chironomidae)
larvae on its survival and growth in watercourses – preliminary results
Słowa kluczowe: troć wędrowna, podchów wylęgu ryb, narybek, zarybienia, małe cieki
Key words: sea trout, fish rearing, fry, stocking, small streams
1. Wstęp
W ostatnich latach populacja ryb łososiowatych w Polsce, mierzona wielkością odłowów, ze względu na prowadzenie intensywnych zarybień wzrosła
(Bartel 2001), jednakże efekty tych zarybień są ograniczane wieloma czynnikami. Przede wszystkim są limitowane przez ograniczoną liczbę wypuszczanych
smoltów, a także przez niską przeżywalność wylęgu czy narybku, utrudnienia
w migracji ryb i nagłe zmiany w środowisku. Od lat próbuje się zwiększyć przeżywalność materiału zarybieniowego ryb łososiowatych, przez wcześniejszy podchów, najczęściej na paszy, przed wsiedleniem do cieku lub podchów w małych
18
Robert Czerniawski, Józef Domagała, Małgorzata Pilecka-Rapacz
ciekach, bez obecności drapieżników (Trzebiatowski, Domagała 1992; Domagała, Bartel 1997, 1999). Efekty są widoczne, ale nie są jednak do końca zadowalające. Autorzy niniejszej pracy wpadli na pomysł, aby wylęg troci wędrownej podchować na żywym zooplanktonie, pomimo zupełnego jego braku w naturalnym
środowisku młodych ryb łososiowatych. Wydaje się jednak, że podchów wylęgu
w kontrolowanych warunkach na żywym pokarmie naturalnym mógłby pozwolić
na wyższe przeżycie w ciekach ryb łososiowatych. Ryby, obcując z żywym, poruszającym się i uciekającym pokarmem, nabierają typowych dla drapieżników
zachowań i, co również jest ważne, wcześniej zaczynają pobierać pokarm. Fakt
ten jest istotny ze względu na naukę pobierania przez ryby łososiowate pokarmu.
Goryczko (1979, 2001) podaje, że brak paszy podczas podchowu wylęgu pstrąga
powoduje zahamowanie nauki pobierania pokarmu (żerowania) i gdyby nawet
zapewniono później jego obfitość, padnie z wycieńczenia, po uprzednim wykorzystaniu wszelkich rezerw. Wydaje się, że żywy zooplankton, pomimo jego
braku w małych i zimnych ciekach, może rozwiązać w okresie podchowu u ryb
łososiowatych instynkt łowiecki, który bezpośrednio wpłynie na przeżywalność
w ciekach. Z danych piśmiennictwa wynika, iż uzasadnione może się okazać
podchowywanie na żywym zooplanktonie wylęgu ryb, a w szczególności ryb drapieżnych (Szlauer, Winnicki 1980; Czerniawski, Czerniejewski 2007; Grudniewska i in. 2007). Zooplankton jest wartościowym źródłem białka, aminokwasów,
tłuszczów i enzymów (Munilla-Moran i in. 1990), a poziom białka w niektórych
wioślarkach wynosi nawet od 54 do 65% (Kibria i in. 1999). Yurkowski i Tabachek (1979) stwierdzili, że poziom aminokwasów w Daphnia pulex i Diaptomus
sp. jest równy lub wyższy od tego, który jest wymagany do wzrostu narybku.
Chociaż nie ulega wątpliwości, że nowoczesne, sztuczne pasze są zdecydowanie
lepsze pod względem energetycznym od żywego, naturalnego pokarmu (Poczyczyński 1996a; Kamler 2007). Sztuczne pokarmy zawierają związki potrzebne
do wzrostu w stosunkowo krótkim czasie (Brett 1971; Poczyczyński 1996b), co
jest zrozumiałe z uwagi na ekonomiczny wynik chowu. Jednak taki rodzaj pożywienia może się okazać gorszy w procesie przyuczania ryb do pobierania żywego
pokarmu i w rezultacie przeżycia w warunkach naturalnych. Ponadto według Łuczyńskiego (1992) przeżywalność, rozwój i kondycja ryb żywionych naturalnym
pokarmem są zdecydowanie lepsze, niż karmionych paszami sztucznymi. Szlauer
i Winnicki (1980) sądzą, że zarybiając cieki narybkiem podchowanym na zooplanktonie można osiągnąć lepsze wyniki niż w przypadku zarybiania wylęgiem
niepodchowanym lub podchowanym na paszy. Wiąże się to z przyzwyczajeniem
Wstępne wyniki badań...
19
narybku do odżywiania się pokarmem naturalnym. Jak widać, żywy zooplankton
może być ważnym elementem diety w odżywianiu się podchowywanego wylęgu
ryb łososiowatych czy też narybku hodowanego w celach zarybieniowych.
Głównym celem pracy było sprawdzenie wyników przeżywalności, parametrów wzrostu i kondycji ryb w ciekach, podchowanych wcześniej na żywym
zooplanktonie i żywych larwach ochotki. Założono bowiem, że wylęg troci karmiony wyłącznie żywym pokarmem osiągnie po zarybieniu wysoką przeżywalność i będzie się charakteryzował dobrym tempem wzrostu.
2. Metody badań
Materiał do zarybień stanowił narybek troci wędrownej podchowany
w zamkniętym obiegu recyrkulacyjnym w Katedrze Zoologii Ogólnej Uniwersytetu Szczecińskiego. Ryby, jako wylęg, zostały pozyskane z wylęgarni PZW
w Goleniowie. Zdecydowano się na zarybienia cieków rybami o różnej masie
i karmionych różnym pokarmem. W związku z tym pierwsza grupa zarybieniowa
karmiona była tylko żywym zooplanktonem, w 99% biomasy Cyclops vicinus
Uljanin, pozyskiwanym z pobliskiego wysoko zeutrofizowanego stawu. Podchów tej grupy trwał od 16.04.2007 r. (22 dni od wyklucia), przy średniej masie
0,127 g, do 6.06.2007 r., kiedy ryby osiągnęły masę 0,5482 g. Drugiej grupie ryb
podawano od 16 kwietnia, podobnie jak pierwszej, zooplankton, a od 7 czerwca
do 21 lipca 2007 r. wyłącznie żywą ochotkę pochodzącą ze sztucznych hodowli.
Druga grupa ryb w dniu zarybienia miała masę 1,4531 g.
Cieki wybrane do zarybień (Pniewa, Sitna i Pokrętna) charakteryzowały się
według badań bonitacyjnych i obserwacji własnych dobrymi warunkami do życia
ryb łososiowatych (Trzebiatowski i in. 1986, 1987; Raczyński i in. 2005). Ryby
odławiano z cieków jesienią 2007 r. elektrycznym urządzeniem przystosowanym
do połowu ryb niemieckiej firmy Hans Grassl GmbH. Odłowione ryby liczono,
mierzono i ważono.
Do określenia kondycji ryb wykorzystano współczynnik Fultona (1904):
K = 100000 · W/L3,
gdzie:
W – całkowita masa jednostkowa (g), czyli masa poszczególnych ryb;
L – długość ogonowa (l. caud.) (mm).
20
Robert Czerniawski, Józef Domagała, Małgorzata Pilecka-Rapacz
Aby określić dobowy przyrost średniej masy jednostkowej wylęgu (SGR
– Specyfic Growth Rate), zastosowano wzór:
SGR = (lnWf – lnWi · 100)/t,
gdzie:
lnWf – logarytm naturalny masy początkowej,
lnWi – logarytm naturalny masy końcowej,
t
– liczba dni pomiędzy lnWf i lnWi.
Istotność różnic badano za pomocą analizy wariancji (ANOVA), jako test
post-hoc zastosowano test Tuckeya dla prób o różnej liczebności.
3. Wyniki
Wyniki przeżywalności i wzrostu odłowionych ryb przedstawia tabela 1.
Wyniki wzrostu i przeżycia ryb od wsiedlenia do odłowów jesiennych okazały się satysfakcjonujące. W Sitnej przeżywalność wyniosła 58,6%, natomiast
w Pniewie 52%. W Pokrętnej uzyskano 12% przeżycia, jednak należy zaznaczyć,
że odłowy w Pokrętnej przeprowadzono na odcinku jedynie 300 m. Równie dobre wyniki zanotowano w Pniewie – 52%. Największą długością i masą charakteryzowały się ryby z Pniewy, które karmiono wcześniej zooplanktonem i ochotką.
Ryby karmione tylko zooplanktonem uzyskały podobne wyniki wzrostu, choć
różniące się statystycznie masą. Analiza statystyczna ANOVA wykazała istotne
różnice w długości ryb (df = 2, F = 67,51, P = 3,3295–26). Test post-hoc wskazał tutaj na istotną różnicę pomiędzy rybami z Pniewy i Pokrętnej (P < 0,0001).
W przypadku masy odłowionych ryb analiza statystyczna również wykazała
istotne różnice (df = 2, F = 256,89, P = 1,5421–35). Jednak masa ryb różniła się
istotnie pomiędzy wszystkimi rzekami: Sitna vs. Pokrętna (P = 0,00006), Sitna
vs. Pniewa (P = 0,00002) i Pokrętna vs. Pniewa (P = 0,00002). Najbardziej skorelowane ze sobą wyniki długości i masy stwierdzono u ryb złowionych w Sitnej
(r = 0,9929), następnie w Pokrętnej (r = 0,9881) i Pniewie (r = 0,9791) (rys. 1,
2, 3). O silnej zależności i małej rozbieżności wyników długości i masy ryb z Sitnej świadczy również niewielka wartość odchylenia standardowego tych dwóch
analizowanych parametrów. W Sitnej wartość wskaźnika kondycji była najwyższa – 1,47, w dalszej kolejności w Pniewie – 1,27 i najniższa w Pokrętnej – 1,12.
Analiza statystyczna także wykazała istotne różnice w wartościach wskaźnika
Wstępne wyniki badań...
21
kondycji (df = 2, F = 551,98, P = 2,1261–47). Podobnie jak w przypadku masy
ryb, test post-hoc wskazał na różnice w kondycji pomiędzy rybami ze wszystkich
rzek: Sitna vs. Pokrętna (P = 0,0085), Sitna vs. Pniewa (P = 0,00002) i Pokrętna
vs. Pniewa (P = 0,00002). Reasumując można powiedzieć, że ryby z każdej rzeki
charakteryzowały się bardzo dobrymi rezultatami wzrostu, kondycji i przeżycia
pomimo zanotowanych różnic statystycznych.
4. Dyskusja
W porównaniu z danymi literaturowymi można uznać, że jakość pokarmu
podczas podchowu może mieć wpływ na wzrost i przeżycie ryb w późniejszym
czasie, w warunkach naturalnych. Ryby w stadium wylęgu i narybku mające
kontakt z żywym, poruszającym się pokarmem uzyskały zadowalające wyniki
przeżywalności i wzrostu w ciekach. Minimalnie niższe przeżycie ryb w Pniewie
(ryb podchowanych na zooplanktonie i ochotce) niż w Sitnej mogło być spowodowane niekorzystnymi warunkami fizycznymi cieku. Powstałej różnicy można upatrywać w trudnościach związanych z odłowem ryb w Pniewie. Rzeka ta
w dolnym biegu kierowana jest na stawy hodowlane, przez co następuje piętrzenie wody w miejscach potencjalnych kryjówek wcześniej wsiedlonego narybku troci. W związku z powyższym w cieku istnieją znaczne wahania poziomu
i przepływu wody, a jak podają Tschaplinski i Hartman (1983), wysoki stan wód
może być przyczyną nawet wysokiej śmiertelności narybku ryb łososiowatych.
Dodatkowo ciek ten jest co roku eksploatowany w celach podchowowych, poprzez jego zarybianie setkami sztuk ryb łososiowatych. Natomiast rzeka Sitna
została użyta w celach zarybieniowych po raz pierwszy. Na całkiem niewielką
ilość odłowionych ryb z cieku Pokrętna wpłynął wysoki stan wód, zasadniczo
utrudniający odłów, co w matematycznej konsekwencji przełożyło się na niski
procent przeżywalności. Z tego względu odłów ryb w tym cieku odbywał się
tylko na 300-metrowym odcinku, a według naszych obserwacji i wyników bonitacyjnych ciek ten ma odpowiedni charakter dla ryb łososiowatych przynajmniej
na 3-kilometrowym odcinku (Trzebiatowski i in. 1986). Zatem 12% przeżycie
ryb w 300-metrowym odcinku tego cieku należy uznać za bardzo dobre.
Ryby z cieku Pniewa znacznie różniły się długością i masą od pozostałych
ryb, chociaż ryby w Sitnej i Pokrętnej również uzyskały odpowiednie w tym
wieku wartości badanych parametrów. Różnice mogły być spowodowane dostępnością pokarmową cieku i bogatszą fauną makrobezkręgową, stanowiącą po-
22
Robert Czerniawski, Józef Domagała, Małgorzata Pilecka-Rapacz
karm ryb. Poza tym ryby z Pniewy podchowywane były także na żywych larwach
ochotki, która w naturalnych warunkach jest składnikiem fauny bezkręgowej cieków. Być może ryby przyzwyczajone do tego typu pokarmu jeszcze w warunkach
sztucznych lepiej radziły sobie z jego odnajdywaniem w warunkach naturalnych.
Jako trzeci powód tych różnic można wskazać dłuższy okres podchowu ryb, co
sugeruje, że dłuższy podchów, a tym samym osiągniecie większych rozmiarów,
wpływa na lepsze rezultaty po zarybieniu.
Z danych piśmiennictwa wynika, iż wsiedlenie do cieków podchowanego
na suchej paszy materiału zarybieniowego pozwala na zwiększenie przeżywalności troci w pierwszym roku życia maksymalnie nawet do 45% (Chełkowski 1990;
Trzebiatowski, Domagała 1991, 1992), choć zazwyczaj przypadków wartości te
są znacznie niższe. Natomiast przeżycie troci od wsiedlenia wylęgu podchowanego do okresu smoltyzacji może się zawierać w zakresie tylko 9–11% (Chełkowski 1993; Domagała 1998). Niską, 9% przeżywalność zanotowali również
Cunjak i Therrien (1998) u zimowego narybku dzikich form łososia atlantyckiego. Zdecydowanie gorsze wyniki uzyskiwane są przez zarybienie wylęgiem
niepodchowanym. Śmiertelność jednorocznej troci wyrosłej z wsiedlonego do
niewielkich cieków wylęgu żerującego może wynosić aż 99% (Chełkowski,
Chełkowska 1981), na co może wpływać nieumiejętność pobierania pokarmu
lub mała ruchliwość i stosunkowo duży ciężar, niepozwalający na opieranie się
prądowi wody w cieku i na szukanie kryjówek (Trzebiatowski, Domagała 1991).
Przeżywalność oraz wzrost mogą być także limitowane obecnością ryb drapieżnych (Kennedy, Strange 1986). W niektórych przypadkach drapieżniki mogą być
powodem ponad 90% śmiertelności nawet podchowanego narybku (Kelly-Quin,
Bracken 1989). Zaznaczyć należy, że podczas odłowów ryb odzyskiwano także
drapieżniki.
W niniejszej pracy wyniki przeżywalności i wzrostu ryb, mających w okresie podchowu kontakt z żywym pokarmem, generalnie okazały się bardzo dobre.
Niektórzy autorzy badając zależności pomiędzy rybami chowanymi w sztucznych, całkowicie naturalnych czy półnaturalnych warunkach sugerują, że jak najbardziej zbliżone do naturalnego obchodzenie się z rybami oddziałuje dodatnio
na ich zachowanie behawioralne w ciekach (Mckeown, Bates 2003). Żywy, poruszający się pokarm zapewne miał wpływ na rozwój u ryb instynktu łowieckiego,
decydującego często o przeżyciu danego osobnika w ciekach, i względnie najlepsze przygotowanie do życia w warunkach naturalnych.
Wstępne wyniki badań...
23
Pomimo przeciwności, jakie wiążą się głównie ze zdobyciem żywego, słodkowodnego zooplanktonu w okresie zimowym, warto jest stosować taki rodzaj
pokarmu we wstępnym podchowie ryb łososiowatych. Chociaż podstawowym
składnikiem diety młodych ryb łososiowatych w warunkach naturalnych są bezkręgowce bentosowe (Amundsen, Gabler 2008), to niektórzy autorzy podają,
że również zooplankton jest pokarmem chętnie pobieranym przez te ryby, które
w porównaniu z rybami karmionymi paszą uzyskują optymalną do zarybień długość i masę (Czerniawski, Czerniejewski 2007). Szlauer (1976) karmiąc narybek
troci zooplanktonem stwierdziła, że ryby intensywnie żerowały przez cały okres
trwania doświadczenia, zjadały zimnolubne Cyclops vicinus i Cyclops kolensis.
Haugen i Rygg (1996) podają, iż dorosłe i juwenilne formy troci jeziorowej oraz
łososia atlantyckiego zamieszkujące pelagial zimnych jezior odżywiały się dużymi wioślarkami. Podobnie twierdzą Winfield i in. (2002). Langeland i Nost (1995)
uznają nawet ryby łososiowate żyjące powszechnie w jeziorach skandynawskich
za względnie planktonożerne. Ponadto Nilssen i Waervagen (2002) podają, że
w wielu jeziorach skandynawskich, które zarybia się wylęgiem troci, ważna jest
dostępność pokarmowa w postaci zooplanktonu lub innych bezkręgowców.
Wyniki badań niniejszej pracy pozwalają wstępnie wnioskować, iż rodzaj
pokarmu podawany wylęgowi ryb podczas podchowu ma prawdopodobnie
wpływ na jego dalsze przeżycie i wzrost w warunkach naturalnych. Przypuszczenie takie może zatem stanowić asumpt do dalszych, rozwiniętych doświadczeń
porównawczych z użyciem ryb podchowywanych na żywym oraz sztucznym pokarmie, wsiedlonych razem do jednego cieku.
24
Robert Czerniawski, Józef Domagała, Małgorzata Pilecka-Rapacz
Trocie z PokrĊtnej
Weight [g] = -28,26 + 3,9831 * Length [mm]
correlation: r = 0,98806, p< 0,05
20
10
Masa [g]
0
30
28
26
24
22
20
18
16
14
12
10
8
6
4
8
9
10
11
12
13
DáugoĞü [mm]
14 0
10
20
95% przedziaá ufnoĞci
Rys. 1. Wykres zależności pomiędzy długością kaudalną a masą ryb odłowionych z cieku
Pokrętna
Fig. 1. The relationship between fork length and weight of fish from stream Pokrętna
Trocie z Pniewy
Weight [g] = -50,31 + 6,0379 * Length [mm]
correlation: r = 0,97906, p < 0,05
20
10
0
70
60
Masa [g]
50
40
30
20
10
0
-10
6
8
10
12
14
DáugoĞü [mm]
16
18
20 0
10
20
95% przedziaá ufnoĞci
Rys. 2. Wykres zależności pomiędzy długością kaudalną a masą ryb odłowionych z cieku
Pniewa
Fig. 2. The relationship between fork length and weight of fish from stream Pniewa
25
Wstępne wyniki badań...
Trocie z Sitnej
Weight [g] = 0,24791 + 0,92296 * Length [mm]
correlation: r = 0,99287, p < 0,05
8
4
0
14
13
Masa [g]
12
11
10
9
8
7
7
8
9
10
11
12
13
14
15 0
4
8
95% przedziaá ufnoĞci
DáugoĞü [mm]
Rys. 3. Wykres zależności pomiędzy długością kaudalną a masą ryb odłowionych z cieku
Sitna
Fig. 3. The relationship between fork length and weight of fish from stream Sitna
Tabela 1. Wyniki uzyskane przed i po odłowieniu ryb z cieków. WP – wariant podchowu wylęgu, pochodzenie narybku: Z – na pokarmie żywym, zooplanktonie,
Z/Ch – na zooplanktonie i od 21.06. na ochotce (Chironomidae larva);
N – liczba ryb, W – średnia masa ryb, S – przeżywalność ryb, L – długość ryb,
F – współczynnik kondycji – Fultona odłowionych ryb
Table 1. Results achieved in stocking day and after fish capture from the wild.
WP – reared group; A – zooplankton-fed group only; Z/Ch – zooplanktonfed group, however from 21 July chironomid-fed group; N – amount of fish;
W – mean weight; S – survival rate; F – condition factor
Wsiedlanie narybku
Ciek
W
Date
N
[ind.]
W
[g]
Odłów ryb
Date
S
[%]
N
[ind.]
L
[mm]
W
[g]
F
Sitna
Z
6.06.07
500
0,5482
4.10.07
58,6
293
10,48
16,9
1,47
Pokrętna
Z
6.06.07
500
0,5482
22.10.07
12,0
59
11,1
16,1
1,12
Z/Ch
21.07.07
150
1,4531
9.10.07
52,0
78
13,39
30,5
1,27
Pniewa
26
Robert Czerniawski, Józef Domagała, Małgorzata Pilecka-Rapacz
BIBLIOGRAFIA
Amundsen P.A., Gabler H.M., 2008: Food consumption and growth of Atlantic salmon
parr in subarctic rivers: empirical support for food limitation and competition.
J. Fish Biol., 73, s. 250–261.
Bartel R., 2001: Return of salmon back to Polish waters. Ecohydrology and Hydrobiology,
1, 3, s. 337–392.
Brett J.R., 1971: Satiation time, appetite and maximum food intake of sockeye salmon
(Oncorhynchus nerka). J. Fish. Res. Bd. Can., 28, s. 409–415.
Chełkowski Z., 1990: Biological characteristics of one – year – old sea trout Salmo
trutta L. grown fry released into the stream Osówka. Acta Ichtyologica et Piscatoria,
XX(1), s. 45–58.
Chełkowski Z., 1993: Spływanie smoltów troci wędrownej wyrosłej z narybku w potoku
Osówka. Zesz. Nauk. AR Szczecin. Ryb. Morsk., 20, s. 156.
Chełkowski Z., Chełkowska D., 1981: Stopień przeżycia młodzieży troci (Salmo trutta L.)
od wsiedlenia wylęgu do smoltyzacji w zlewni Mołstowej. Streszczenia doniesień
sesji naukowej. „Główne kierunki badań Wydziału Rybactwa Morskiego i Technologii
Żywności w latach 1970–1980”. Szczecin, maj 1981, s. 105–107.
Cunjak R.A., Therrien J., 1998: Inter – stage survival of wild juvenile Atlantic salmon,
Salmo salar L. Fisheries Managament and Ecology, 5(3), s. 209–229.
Czerniawski R., Czerniawski P., 2007: Rearing sea trout (Salmo trutta L., 1758) fry for
stocking fed on zooplankton caught in the outlets of natural and artificial bodies
of water. Acta Sci. Pol. Pisc., 6, s. 15–30.
Domagała J., 1998: Zwiększenie przeżycia troci (Salmo trutta) w słodkowodnym okresie
życia metodą biomanipulacji. Materiały I Konferencji „Stan środowiska przyrodniczego Pomorza w badaniach WNP z 16.12.1996. Szczecin.
Domagała J., Bartel R., 1997: Przeżycie i wzrost podchowanego i żerującego wylęgu
łososia wypuszczanego do małych cieków. Kom. Ryb., 1, s. 34–38.
Domagała J., Bartel R., 1999: Summer fry – smolt survival of Salmon (Salmo salar)
stocked into River Gowienica. 87-th Stattor Meeting ICES, Stockholm, Sweden
ICES, CM 1999/ W: 02: 1–4, Heath of Walfare Cultivated Aquatic Animals.
Fulton T.W., 1904: The rate of growth of fishes. Fisheries Bard of Scotland Annual Report,
22, s. 141–241.
Goryczko K., 1979: Kwiecień w gospodarstwie pstrągowym. Gosp. Ryb. 3, s. 16–19.
Goryczko K., 2001: Pstrągi. Chów i hodowla. Poradnik hodowcy. IRŚ, Olsztyn.
Wstępne wyniki badań...
27
Grudniewska J., Dobosz S., Goryczko K., 2007: Podchów larw lipienia europejskiego
(Thymallus thymallus L.) przeprowadzony w Zakładzie Hodowli Ryb Łososiowatych
w Rutkach. Rocz. Nauk. PZW, 20, s. 127–136.
Haugen T.O., Rygg T.A., 1996: Food and habitat segregation in sympatric grayling and
brown trout. J. Fish Biol., 49, s. 301–318.
Kamler E., 2007: Czy jakość młodocianych osobników ryb karpiowatych w warunkach
kontrolowanych zależy od pokarmu?. Przegląd najnowszych prac Zakładu Rybactwa
Stawowego. Kom. Ryb., 6, s. 9–12.
Kelly-Quinn M., Bracken J.J., 1989: Survival of stocked hatchery – reared brown trout,
Salmo trutta L., fry in relation to the carrying capacity of a trout nursery stream.
Aqua. Res., 20(2), s. 211–226.
Kennedy G.J.A., Strange C.D., 1986: The effects of intra – and inter – specific competition
on the survival and growth of stocked juvenile Atlantic salmon, Salmo salar L., and
resident trout, Salmo trutta L., in an upland stream. J. Fish Biol., 28(4), s. 479–489.
Kibria G., Nugegoda D., Fairclough R., Lam P., Bradley A., 1999: Utilization
of wastewater-grown zooplankton: Nutritional quality of zooplankton and performance
of silver perch Bidyanus bidyanus (Mitchell 1838) (Teraponidae) fed on wastewatergrown zooplankton. Aqua. Nutr., 5(4), 1, s. 221–227.
Langeland A., Nost T., 1995: Gill raker structure and selective predation on zooplankton
by particulate feeding fish. J. Fish Biol., 47, s. 719–732.
Łuczyński M.J., 1992: Podchów wylęgu szczupaka żywionego paszą sztuczną. Komunikaty
Rybackie, 3, s. 9–10.
Mckeown B.A., Bates D.J., 2003: Growth in stream – stocked juvenile hatchery – reared
coastal cutthroat trout (Oncorhynchus clarki clarki) and the implications for wild
populations. Congres Salmonid Smoltification. International Workshop No6,
Westport, Irlande (03.09.2001), 222(1–4), s. 215–228.
Munilla-Moran R., Stark J.R., Barbout A., 1990: The role of exogenous enzymes
in digestion in cultured turbot larvae (Scophthalamus maximus L.). Aquaculture,
88, s. 337–350.
Nilssen J.P., Waervagen S.B., 2002: Intensive fish predation: an obstacle to biological
recovery following liming of acidified lakes?. J. Aqua. Eco. Stress Rec., 9, s. 73–84.
Poczyczyński P., 1996a: Żywienie larw ryb – podstawy energetyczne II. Procesy trawienne larw ryb. Kom. Ryb., 3, s. 7–8.
Poczyczyński P., 1996b: Żywienie larw ryb – podstawy teoretyczne I. Pasze sztuczne
w żywieniu larwy. Kom. Ryb., 4, s. 19–20.
28
Robert Czerniawski, Józef Domagała, Małgorzata Pilecka-Rapacz
Raczyński M., Czerniejewski P., Czerniawski R., 2005: Możliwości wykorzystania cieków zlewni jeziora Adamowo do podchowu ryb łososiowatych przeznaczonych
do zarybień wód Drawieńskiego Parku Narodowego. Kom. Ryb., 6, s. 15–21.
Szlauer B., 1976: Próba karmienia narybku troci i pstrąga tęczowego zimowym
zooplanktonem jeziornym. Gosp. Ryb., 9, s. 21.
Szlauer L., Winnicki A., 1980: Propozycja wykorzystania zimowego zooplanktonu
do podchowu narybku troci. Gosp. Ryb., 12, s. 9–10.
Tschaplinski P.J., Hartman G.F., 1983: Winter distribution of juvenile coho salmon
(Oncorhynchus kisutsch) before and after logging in Carnation Creek, British
Columbia, and some implications for overwinter survival. Can. J. Fish. Aqua. Sc.,
40(4), s. 452–481.
Trzebiatowski R., Chełkowski Z., Filipiak J., Chełkowska B., Domagała J., Lubieniecka I., Jarczak A., Klasa B., 1986: Inwentaryzacja dorzecza Drawy. Opracowanie
wykonane na podstawie umowy nr 677/86 z dnia 1986.03.01. zawartej pomiędzy
Urzędem Wojewódzkim – Wydziałem Ochrony Środowiska Gospodarki Wodnej
i Geologii w Gorzowie a Akademią Rolniczą w Szczecinie. I etap badań. Wydawnictwo
Akademii Rolniczej w Szczecinie, Szczecin.
Trzebiatowski R., Chełkowski Z., Filipiak J., Chełkowska B., Ciupiński M., Lubieniecka I., Klasa B., 1987: Bonitacja zlewni Dolnej Drawy. Opracowanie wykonane
na podstawie umowy nr 677/86 z dnia 1986.03.01. zawartej pomiędzy Urzędem
Wojewódzkim – Wydziałem Ochrony Środowiska Gospodarki Wodnej i Geologii
w Gorzowie a Akademią Rolniczą w Szczecinie. II etap badań. Wydawnictwo
Akademii Rolniczej w Szczecinie, Szczecin.
Trzebiatowski R., Domagała J., 1991: Zarybianie małych cieków wylęgiem podchowanym
troci (Salmo trutta L.) – sposobem na zwiększenie efektywności zarybiania. Materiały
sesji naukowej „XL Lat Wydziału Rybactwa Morskiego i Technologii Żywności.
Szczecin, 20–22 września 1991. AR, Szczecin, s. 67–68.
Trzebiatowski R., Domagała J., 1992: Możliwości zwiększenia efektywności zarybiania
cieków wylęgiem troci (Salmo trutta L.). Zesz. Nauk. AR Wroc., 37 (218), s. 41–44.
Winfield I.J., Bean C.W., Hewitt D.P., 2002: The relationship between spatial distribution
and diet of Arctic charr, Salvelinus alpinus, in Loch Ness, U.K. Environ. Biol. Fish.,
64 (1–3), s. 63–73.
Yurkowski M., Tabachek J.L.,1979: Proximate and amino acid composition of some
natural fish foods. W: Proceedings of the World Symposium on Finfish Nutrition and
Fish Feed Technology, Hamburg 20–23 June 1978 (Halver, J.E. & Tiews, K., eds.),
Vol. II. Heenemann, Hamburg, s. 435–448.
Wstępne wyniki badań...
29
THE EFFECT OF FEEDING SEA TROUT (SALMO TRUTTA M. TRUTTA L.,
1758) HATCH WITH ALIVE ZOOPLANKTON AND CHIRONOMIDS
(CHIRONOMIDAE) LARVAE ON ITS SURVIVAL AND GROWTH
IN WATERCOURSES – PRELIMINARY RESULTS
Summary
The survivability and growth of trout released to watercourses after the initial
period of growth in artificial conditions and fed on living zooplankton and Chironomidae larvae were studied. The expectation was that after release to watercourses the
fish would achieve satisfactory survivability and growth parameters. As expected, the
parameters were very good; survivability reached over 50%, the body lengths and masses
were appropriate for the fish age. The highest body length and mass were noted in the
fish that had earlier contact with living larvae of Chironomidae. The results support the
supposition that the type of food given in the initial period of growth influences the survivability and development of fish released into the watercourses.
Translated by Robert Czerniawski
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
PRZEMYSŁAW CZERNIEJEWSKI
Zachodniopomorski Uniwersytet Technologiczny
ZALEŻNOŚĆ POMIĘDZY SZEROKOŚCIĄ KARAPAKSU
A MASĄ I KONDYCJĄ POPULACJI KRABIKA AMERYKAŃSKIEGO,
RHITHROPANOPEUS HARRISII TRIDENTATUS (MAITLAND, 1874)
W ESTUARIUM ODRY
Width-weight relationship and condition in mud crab,
Rhithropanopeus harrisii tridentatus (Maitland, 1874)
population in the Odra estuary
Słowa kluczowe: kondycja, zależność pomiędzy szerokością karapaksu a masą
jednostkową, krabik amerykański, estuarium Odry
Key words: condition, the carapace width-weight relationship, mud crab,
the Odra estuary
1. Wstęp
Polskie wody zasiedla wiele gatunków zwierząt, które wskutek naturalnej
migracji lub działalności człowieka przedostały się niepostrzeżenie i zasiedliły
biocenozy lądowe oraz wodne. Najwięcej allochtonicznych gatunków zwierząt
występuje w wodach estuariowych. Przykładowo, jak podaje Jażdżewski i in.
(2005), wśród 56 gatunków skorupiaków wyższych (Malacostraca) blisko 20%
stanowią gatunki obce (11 gatunków). W estuarium Odry występuje 20 allochtonicznych gatunków skorupiaków, a wśród nich również notuje się sporadycznie
pojedyncze osobniki krabika amerykańskiego (Rhithropanapeus harrisi) (Gruszka 1999). Pierwsze dane na temat wybranych cech populacyjnych i biologicznych
oraz składu diety przedstawili Czerniejewski i Rybczyk (2008), jednakże dotych-
32
Przemysław Czerniejewski
czas nie określono kondycji tego skorupiaka, która jest jedną z ważniejszych
charakterystyk populacyjnych skorupiaków (Romaire i in. 1977; Olmi, Bishop
1983; Atar, Sucer 2002). Celem niniejszej pracy było oszacowanie parametrów
zależności pomiędzy szerokością karapaksu i masą jednostkową krabika amerykańskiego oraz ocena wartości współczynników kondycji Fultona i Le Crena.
2. Materiał i metody badań
W pierwszej dekadzie września 2007 roku przy użyciu żaków ustawionych
w południowej części Zalewu Szczecińskiego (rejon Trzebieży i Stepnicy) oraz
w jeziorze Dąbie pozyskano 77 żywych krabików amerykańskich. Odłowione
osobniki zważono (W) za pomocą elektronicznej wagi typu Axis 2000B z dokładnością ±0,01 g, określono ich płeć na podstawie struktur odwłoka oraz dokonano pomiaru szerokości karapaksu (Cw). Kraby mierzono elektroniczną suwmiarką (Helios) z dokładnością pomiaru ±0,01 mm.
Zależność pomiędzy szerokością karapaksu a masą obliczono za pomocą
funkcji (Romaire i in. 1977):
W = aCwb,
gdzie:
W – masa całkowita (g)
Cw – szerokość karapaksu (mm)
a, b – parametry charakterystyczne dla danego gatunku określone na podstawie danych empirycznych.
Ponadto obliczono kondycję krabików, stosując równanie Fultona oraz
Le Crena według ogólnie przyjętych wzorów (Atar, Secer 2002; Ewa-oboho,
Abby-kalio 2006).
Uzyskane wyniki pomiarów opracowano statystycznie, obliczając: średnią,
odchylenie standardowe oraz poddano analizie regresji, określając współczynnik
korelacji i determinacji, jak również przeprowadzono porównawczą analizę statystyczną za pomocą testu U Manna-Witneya (Sokal, Rohlf 1998) w programie
Statistica Pl.
33
Zależność pomiędzy szerokością karapaksu...
3. Wyniki
Krabiki amerykańskie z estuarium Odry charakteryzowały się zakresem
masy jednostkowej od 0,40 do 5,10 g, przy średniej 2,36 g. Największą rozpiętość tego parametru i średnią stwierdzono u samców (tabela 1).
Szerokość karapaksu badanych krabików mieściła się w zakresie od 7,69 do
22,86 mm dla całej populacji ze średnią 17,30 mm. Największą średnią szerokość
zanotowano u samców – 17,63 mm w zakresie od 7,69 do 22,86 mm, natomiast
samice charakteryzowały się mniejszym zakresem tego parametru oraz mniejszą
średnią (tabela 1).
Tabela 1. Średnia masa i szerokość karapaksu krabików amerykańskich
Table 1. Mean weight and carapace width in mud crab
Masa jednostkowa (g)
Płeć
Samice
Samce
Razem
*
Szerokość karapaksu (mm)
zakres
średnia ±SD
zakres
średnia ±SD
0,46–3,78
1,76* ±0,71
11,23–22,77
16,34 ±2,60
7,69–22,86
7,69–22,86
17,63 ±4,06
17,30 ±3,77
0,40–5,10
0,40–5,10
*
2,69 ±1,22
2,36 ±1,09
Różnice między samicami i samcami istotne statystycznie.
60
50
Samice
Samce
[%]
40
30
20
10
0
6.00-8.00
8.01-10.00
10.01-12.00
12.01-14.00 14.01-16.00
16.01-18.00 18.01-20.00
Klasy szerokoĞci karapaksu (mm)
Rys. 1. Struktura szerokości karapaksu krabików amerykańskich z estuarium Odry
Fig. 1. Carpace width distribution of the mund crag in the Odra estuary
34
Przemysław Czerniejewski
Struktura szerokości karapaksu i płci krabików amerykańskich zawiera
7 klas, przy czym aż 54,55% osobników tego gatunku stwierdzono w klasie 18,01–20,00 mm (rys. 1). Najwięcej samic – 14 sztuk zanotowano w klasie 16,01–18,00 mm, natomiast samce były najliczniejsze w klasie od 18,01
do 20 mm (41 sztuk).
Analiza regresji szerokości karapaksu i masy jednostkowej (CW-W) przedstawia się równaniem W = 0,0032CW2,282 (R = 0,918), natomiast po podziale na
płeć krzywe opisujące tę zależność przedstawiono na rysunku 2. Współczynniki
regresji dla samic i samców są istotne statystycznie (przy p < 0,01) i wynoszą
odpowiednio R = 0,92 i R = 0,97. Różnice w parametrach funkcji tych zależności
wskazują na wolniejszy wzrost masy samic w porównaniu z samcami.
6
Masa jednostkowa (g)
Samice
5
Samce
2,1705
y = 0,0046x
2
R = 0,8526
samce
4
3
2,8777
y = 0,0005x
2
R = 0,9339
samice
2
1
0
0
5
10
15
20
25
szerokoĞc
szerokoĞü karapaksu (mm)
Rys. 2. Zależność pomiędzy szerokością karapaksu a masą jednostkową krabika amerykańskiego z estuarium Odry
Fig. 2. Carapace width – individual weight relationship in mud crab from the Odra
estuary
W tabeli 2 podano wartości współczynników kondycji. Analiza statystyczna
wyników wykazała statystycznie istotnie lepszą kondycję samców w porównaniu
z samicami, mierzoną zarówno współczynnikiem Fultona jak i Le Crena. Należy przy tym zaznaczyć, iż wartości tego pierwszego współczynnika w poszczególnych klasach szerokości karapaksu nie różnią się istotnie statystycznie (przy
p < 0,05), podczas gdy wartości współczynnika Le Crena wykazują wyraźną
zmienność i nieznacznie rosną wraz ze wzrostem szerokości karapaksu (rys. 3).
35
Zależność pomiędzy szerokością karapaksu...
Tabela 2. Kondycja populacji krabików amerykańskich
Table 2. Condition of mud crabs population
KF
Płeć
Samica
Samiec
Razem
*
KL
zakres
średnia ±SD
zakres
średnia ±SD
3,20–5,79
3,45–5,24
3,20–5,79
3,76 ±0,59
4,27* ±0,40
4,11 ±0,52
18,44–32,87
28,88–41,49
18,44–41,49
27,44* ±3,92
35,22* ±3,11
32,84 ±4,92
*
Różnica między samicami i samcami istotne statystycznie
Wspóáczynniki kondycji
45
Fulton
Fultona
40
Le Crena
35
y = 0,151x + 28,247
30
25
20
15
10
y = -0,0186x + 4,3806
5
0
0
5
10
15
20
25
SzerokoĞü karapaksu (mm)
Rys. 3. Zmiany wartości współczynników kondycji krabika amerykańskiego w klasach
szerokości karapaksu
Fig. 3. Changes of condition coefficients of mud crab in carapace width classes
4. Dyskusja
W Zatoce Gdańskiej i estuarium Wisły zakres szerokości karapaksu poławianych krabików wynosił 2,9–26,1 mm dla samic oraz 1,9–19 mm dla samców
(Turoboyski 1973; Rychter 1999), przy czym dominowały osobniki w klasach
szerokości karapaksu 9,1–18,0 mm (Normant i in. 2004). Mimo iż osobniki
z estuarium Odry charakteryzowały się nieco mniejszym zakresem tego parametru, to największy liczebny udział miały krabiki w klasach szerokości karapaksu
od 16,01 do 20,00 mm. Prawdopodobnie wynikało to z faktu, iż badane krabiki
były łowione przez zawodowych rybaków żakami o stosunkowo dużym boku
oczka (7 mm), przez które przechodziły małe osobniki. Według badań Normant
i inl. (2004) oraz Roche i Torchina (2007) są to osobniki dojrzałe, gotowe do
36
Przemysław Czerniejewski
rozrodu. Mimo to wśród pozyskanych krabików nie stwierdzono samic noszących jaja. Prawdopodobnie wiązało się to z faktem, iż ten gatunek skorupiaka
przystępuje do rozrodu w okresie od czerwca do sierpnia (Turoboyski 1973),
a największą ilość samic noszących jaja obserwuje się w czerwcu (Rychter 1999;
Normant i in. 2004).
Z szerokością karapaksu skorelowana jest również masa jednostkowa krabika amerykańskiego (Turoboyski 1973; Normant i in. 2004). Zależność pomiędzy szerokością karapaksu a masą jednostkową u skorupiaków jest bardzo często
używana. Parametry tej zależności są wskaźnikami kondycji tych zwierząt (Ewaoboho, Abby-kalio 2006), ale też umożliwiają określenie masy jednostkowej
krabów, mając do dyspozycji szerokość karapaksu osobnika (Atar, Secer 2002).
Safran (1992) uważa, że wartość wykładnika potęgi b, jest ważniejszym wskaźnikiem kondycji w porównaniu z cechującym się większą zmiennością parametrem
liniowym k. U krabów wartość wykładnika potęgi n waha się w granicach od
2,4 do 3,24 (u Callinectes sapidus, Atar i Secer 2002), około 2,7 wynosi u Heterographsus erythraeus i H. elongatus, a nawet 4,311 u Brachynotus lucasi
(Ewa-oboho, Abby-kalio 2006). U krabika amerykańskiego w estuarium Odry
zależność tę przedstawia równanie potęgowe y = 0,0032x2,282 dla całej próby, dla
samców y = 0,0046x2,1705 i dla samic y = 0,0005x2,8777. W porównaniu z danymi
Normant i in. (2004) krabiki amerykańskie z estuarium Odry charakteryzują się
mniejszą masą jednostkową przy tej samej szerokości karapaksu. Wartość parametru n dla samic tego gatunku występujących w Martwej Wiśle wynosi 2,79,
natomiast dla samców 3,02 (Normant i in. 2004).
Należy przy tym podkreślić, iż wyższe usytuowanie krzywej tej zależności
świadczy o lepszej kondycji samców w porównaniu z samicami. Jest to zjawisko
często obserwowane u skorupiaków. Przykładowo samce kraba Callinectes sapidus charakteryzują się o blisko 10% wyższą wartością współczynnika Fultona
w porównaniu z samicami (Atar, Secer 2002). Większa masa samców, przy podobnej szerokości karapaksu w porównaniu z samicami, a co za tym idzie również lepsza kondycja osobników tej pierwszej płci, prawdopodobnie spowodowana jest zróżnicowaniem wielkości i masy szczypiec u obu płci. Przykładowo
u samców krabika amerykańskiego masa kleszczy dochodzi do 64,0% masy ciała, podczas gdy u samic tylko do 28,0% (Turoboyski 1973).
Zakres masy jednostkowej poławianych w Martwej Wiśle krabików amerykańskich wynosi 0,045–4,299 g (Normant i in. 2004) i nie różni się istotnie od
pochodzących z Zalewu Wiślanego (Turoboyski 1973). Stwierdzony zakres tego
Zależność pomiędzy szerokością karapaksu...
37
parametru dla populacji z estuarium Odry jest mniejszy od wyżej cytowanego,
co prawdopodobnie wynika z faktu, iż materiał badawczy został pozyskany za
pomocą standardowych żaków zalewowych, którymi rybacy poławiają ryby.
Pojawienie się większej ilości tych skorupiaków w estuarium Odry w roku
2007 wskazuje na zwiększanie się zasięgu występowania tych zwierząt, a biorąc pod uwagę skład diety tych skorupiaków (Czerniejewski, Rybczyk 2008),
w kolejnych latach należy przeprowadzić badania liczebności i biomasy krabików
amerykańskich w celu określenia wpływu tego gatunku na środowisko wodne.
BIBLIOGRAFIA
Atar H.H., Secer S., 2002: Width/length –weight relationships of the Blue crab (Callinectes
sabidus Tathburn 1896) population living in Beymelek lagoon lake. Turk. J. Vet.
Anim. Sci., 27, s. 443–447.
Czerniejewski P., Rybczyk A., 2008: Body weight, morphometry, and diet of the Mud
crab, Rhithropanopeus harrisii tridentatus (Maitland, 1874) in the Odra estuary,
Poland. Crustaceana, 81 (11), s. 1289–1299.
Ewa-oboho I., Abby-kalio N.J., 2006: Theoretical basis of allometric relationships in
juvenile Brachyura: data from West African Mangrove Swam crab population. West
Africa Journ. Appl. Ecol., 10, s. 35–46.
Gruszka P., 1999: The river Odra estuary as a gateway for alien species imigration to the
Baltic Sea Basin. Acta Hycrochem. et. Hydrobiol., 27, s. 374–382.
Jażdżewski, K., Konopacka A., Grabowski M., 2005: Native and alien malacostracan
crustacea along the Polish Baltic Sea coast in the twientieth century. Oceanological
and Hydrobiological Studies, 34, Supl. l, s. 176–193.
Normant M., Miernik J., Szaniawska A., 2005: Remarks on the morphology and the life
cycle of Rhithropanopeus harrisii sbsp. tridentatus (Maitland) from the Dead Vistula
river. Oceanological and Hydrobiological Studies, 33 (4), s. 93–102.
Olmi E.J., Bishop J.M., 1983: Total Width-Weight Relationships of the Blue Crab
Callinectes sapidus Rathbun from the Ashley River, South Carolina. J. Shellfish Res.,
3, s. 99.
Roche D.G., Torchin M.E., 2007: Established population of the North American Harris
mud crab, Rhithropanopeus harrisii (Gould 1841) (Crustacea: Brachyura: Xanthidae)
in the Panama Canal. Aquatic Invasions, 2 (3), s. 155–161.
Romaire R.P., John S.F., James W.A.J., 1977: Length-Weight Relationships of Two
Commercially Important Crayfishes of the Genus Procambarus. Freshwater Crayfish,
3, s. 463–470.
38
Przemysław Czerniejewski
Rychter A., 1999: Energy value and metabolism of the mud crab Rhithropanopeus harrisii
tridentatus (Crustacea, Decapoda) in relation to ecological condition. PhD Thesis,
Uniwersytet Gdański, Gdynia, s. 1–108.
Safran P., 1992: Theoretical analysis of the weight-length relationship in fish juveniles.
Mar. Biol., 112, s. 545–551.
Sokal R.R., Rohlf F.J., 1998: Biometry: the principles and practice of statistics in biological research. Third Edition. W.H. Freeman and Company, New York.
Turoboyski K., 1973: Biology and ecology of the crab Rhithropanopeus harrisii sbsp.
tridentatus. Mar. Biol., 23, s. 303–313.
WIDTH-WEIGHT RELATIONSHIP AND CONDITION IN MUD CRAB,
RHITHROPANOPEUS HARRISII TRIDENTATUS (MAITLAND, 1874)
POPULATION IN THE ODRA ESTUARY
Summary
In this study, the width-weight relationships by sex, combined with the condition
factors, of the Mud crab, Rhithropanopeus harrisii tridentatus (Maitland, 1874) population living in the Odra estuary (Poland) were examined. A total of 77 samples ranging
from 7,69 to 22,86 mm in width and weighing between 0,40 and 5,10 g were collected
and analyzed. The relationship between carapace width and weight was W = 0,0032CW2,282
with R = 0,918 (Females: W = 0,0005CW2,8777, Males: W = 0,0046CW2,1705). Fulton and
Le Cren condition factors were 4,11 and 32,84, respectively for all crabs, 3,76 and 27,44
for females, 4,27 and 35,22 for males.
Translated by Przemysław Czerniejewski
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
PRZEMYSŁAW CZERNIEJEWSKI
AGNIESZKA RYBCZYK
Zachodniopomorski Uniwersytet Technologiczny
WYBRANE CECHY BIOLOGICZNE I MORFOMETRYCZNE
SPŁYWAJĄCEGO WĘGORZA EUROPEJSKIEGO
(ANGUILLA ANGUILLA L.) ZE ZLEWNI RZEKI MYŚLI
Selected Biological and Morphometric Characters of Eel
(Anguilla anguilla L.) from The Myśla River Basin
Słowa kluczowe: węgorz, rzeka Myśla, cechy biologiczne i morfometryczne
Key words: eel, Myśla river, biologcal and morphometric characteristics
1. Wstęp
Węgorz europejski jest jednym z najcenniejszych gatunków ryb poławianych w polskich wodach śródlądowych oraz w Morzu Bałtyckim. Spowodowane
jest to jego dużą wartością użytkową i handlową, na którą składają się wysokie
walory smakowe i odżywcze, duża wytrzymałość na bodźce mechaniczne (związane z pozyskaniem i przetrzymywaniem tych ryb), a także nieograniczony popyt
na runku krajowym i międzynarodowym (Anonymus 1998). W ostatnich latach
w Polsce zauważalny jest duży spadek udziału węgorza w odłowach, co przekłada
się na obniżenie podaży na rynku. Wynika to przede wszystkim z nieprawidłowej
gospodarki tym gatunkiem oraz z zanieczyszczenia środowiska (Zommer 2007;
Czerniejewski, Wawrzyniak 2008). Najważniejszym jednak powodem jest zmiana sytuacji ekonomicznej w Polsce i ograniczenie zarybiania węgorzem, związane z bardzo niekorzystnym stosunkiem ceny użytkowej montée (węgorz szklisty)
40
Przemysław Czerniejewski, Agnieszka Rybczyk
do uzyskania z niego przychodów (Wrona 2004). W racjonalnej gospodarce rybackiej tym gatunkiem niezmiernie ważna jest znajomość cech biologicznych
i populacyjnych, co skłoniło autorów niniejszej pracy do przeprowadzenia badań,
mających na celu określenie niektórych ważniejszych cech biologicznych węgorza poławianego w zlewni rzeki Myśli.
2. Materiał i metody
Materiał do badań stanowiło 80 sztuk węgorza europejskiego, łowionego
za pomocą żaków w Jeziorze Myśliborskim oraz przestawami węgorzowymi
w rzece Myśla, łączącej jeziora: Łubie i Myśliborskie. Połowy prowadzono nocą
w okresie od 4 kwietnia do 11 maja 2007 roku. Pozyskane węgorze usypiano
w roztworze Propiscin, a następnie dokonywano pomiarów 10 parametrów morfometrycznych oraz pomiaru masy wagą elektroniczną typu Axis, z dokładnością do 0,1 g. Poszczególne cechy mierzalne, określone przy użyciu suwmiarki
elektronicznej sprzężonej z komputerem ukazuje rysunek 1 (według Bahnsawy
1989).
X1
X2
X3
X4
X5
X6
X7
X8
X9
X10
Rys. 1. Cechy morfometryczne węgorza
Fig. 1. Morphometric characters of ell
– dáugoĞü caákowita
– dáugoĞü ciaáa
– dáugoĞü gáowy
– dystans miĊdzy oczami
– szerokoĞü gáowy
– dáugoĞü czaszki
– pozioma szerokoĞü oka
– pionowa szerokoĞü oka
– odlegáoĞü przedanalna
– odlegáoĞü przedgrzbietowa
41
Wybrane cechy biologiczne...
Otrzymane pomiary opracowano statystycznie za pomocą programu Excel,
określając średnią arytmetyczną (X), odchylenie standardowe (S) oraz współczynnik zmienności (V). Ponadto, na podstawie współczynników: Fultona –
K (Ritterbusch-Nauwerck 1995) i Le Crena – KL (Szypuła 2002) oraz parametrów zależności pomiędzy długością całkowitą a masą jednostkową (L-W), oceniono kondycję ryb.
3. Wyniki
3.1. Cechy biologiczne
LiczebnoĞü (szt.)
Analizując strukturę długościową badanych węgorzy zaobserwowano
znaczny rozstęp w zakresie długości (39,5–91,2 cm). Średnia długość całkowita wyniosła 59,32 cm. Ryby podzielono na 11 klas długości (zakres co 5 cm)
(rys. 2). Największą liczbę osobników stwierdzono w klasie długości od 55,1 do
60,00 cm (25 sztuk). Natomiast najmniejszą liczebność miały ryby w klasach:
od 35,1 do 40 cm i od 90,1 do 95,00 cm – po 1 sztuk, oraz w klasie od 85,1 do
90 cm – 2 sztuki.
30
25
20
15
10
5
0
35-40
40,1-45 45,1-50
50,1-55 55,1-60 60,1-65 65,1-70 70,1-75 75,1-80
80,1-85 85,1-90 90,1-95
Klasy dáugoĞci (cm)
Rys. 2. Rozkład długości całkowitej węgorza
Fig. 2. Total length distribution of eel
42
Przemysław Czerniejewski, Agnieszka Rybczyk
Kondycję ryb oceniano na podstawie współczynników Fultona (K)
i Le Crena (KL). Średnia wartość współczynnika Fultona dla próby wyniosła
1,87 – w przedziale wartości od 1,20 do 2,85, natomiast współczynnika Le Crena
0,50 (zakres wartości od 0,32 do 0,77).
Opierając się na zmierzonych długościach i masach wykreślono zależność
pomiędzy długością a masą. Otrzymana funkcja potęgowa przyjęła następujące
parametry:
y = 0,0000005x 3,3263; R = 0,9443.
3.2. Cechy morfometryczne
W tabeli 1 przedstawiono wartości względne badanych cech morfometrycznych węgorza. Z uwagi na różnorodność długości oraz masy pozyskanych ryb
cechy morfometryczne charakteryzowały się dużym zróżnicowaniem. Świadczą
o tym wysokie wartości współczynnika zmienności (V). Spośród 9 analizowanych
cech, 4 (x4, x5, x7 i x8) uzyskały wartość współczynnika zmienności > 10%, natomiast tylko w przypadku 3 cech liniowych wartość omawianego współczynnika była niższa od 5%. Odchylenie standardowe dla wszystkich cech mieściło się
w granicach od 0,00 do 1,43.
Tabela 1. Wartości względne cech morfometrycznych węgorza z Jeziora Myśliborskiego,
wyrażone w proc. długości całkowitej.
Table 1. Relative (in % total length) morphometric characters of eel from Myśliborskie
Lake
Cechy
Max.
Min.
Średnia
Odchylenie
standardowe (S)
Współczynnik
zmienności (V)
X1
X2
X3
X4
X5
X6
100
99,30
15,07
2,99
6,40
13,69
100
92,73
11,01
1,32
3,10
9,48
100
98,24
12,93
2,21
4,67
11,81
0,00
1,08
0,95
0,38
0,75
0,90
0,00
1,10
7,34
16,99
16,12
7,62
X7
1,83
0,64
1,23
0,23
19,03
X8
X9
X10
1,79
48,30
34,53
0,64
37,80
27,09
1,22
43,28
31,17
0,26
1,62
1,43
21,29
3,74
4,60
43
Wybrane cechy biologiczne...
4. Dyskusja
Każdego roku, w okresie od listopada do czerwca, z ciepłym Prądem Zatokowym do północnych wybrzeży Afryki oraz południowych i zachodnich wybrzeży Europy przypływa od 20 do 50 tys. ton narybku szklistego węgorza europejskiego Anguilla anguilla. Tak duże różnice w ilości wędrującego narybku
powodowane są naturalną zmiennością w rekrutacji populacji, a także pogarszającymi się warunkami środowiska, w którym bytuje. W wyniku naturalnej fluktuacji w rekrutacji gatunku w ostatnich latach odnotowano wyraźny sezonowy
spadek ilości migrującego narybku z 50 tys. ton do 15–20 tys. ton rocznie (Robak
2005). Konsekwencją tego jest znaczny wzrost ceny materiału zarybieniowego
i zmniejszenie wielkości zarybień wód śródlądowych tym gatunkiem (Zommer
2007), a także odłowów węgorza (Czerniejewski, Wawrzyniak 2008). Większość
poławianych osobników tego gatunku w wodach śródlądowych stanowią samice (Bahnsawy 1989; Vollestad, Jonson 1988), mniejsze samce prawdopodobnie
zatrzymują się w zatokach morskich (Piątek 1970, Szczerbowski 1993). Średnia
długość wysrebrzonych, gotowych do wędrówki na tarliska samic węgorzy wynosi 56,9 cm w jeziorze Esrum (Rasmussen 1952), 64,5 cm w polskich wodach
(Piątek 1970), ale może dochodzić do niemal 80,0 cm w zatoce Dog (Bouillon,
Haedrich 1985) (tabela 2).
Tabela 2. Średnie długości poławianych węgorzy europejskich w różnych wodach
Table 2. Mean length of eel from waters
Nazwa zbiornika
Średnia długość (cm)
Autor
Jezioro Windermere
Jezioro Esrum
60,8
56,9
Frost 1945
Rasmussen 1952
Północne laguny Adriatyku
59,6
Rossi i Colombo 1979
Polskie wody
64,5
Piątek 1970
Zatoka Dog
77,8
Bouillon i Haedrich 1985
Zatoka Holyrood
72,2
Bouillon i Haedrich 1985
Jezioro Jeziorak, 1985
64,3
Bahnsawy 1989
Jezioro Jeziorak, 1986
70,0
Bahnsawy 1989
Zlewnia rzeki Myśli
59,32
Badania własne
44
Przemysław Czerniejewski, Agnieszka Rybczyk
Również w niektórych polskich wodach średnia długość poławianych osobników może dochodzić do ponad 80,0 cm, a zakres długości najczęściej pozyskiwanych węgorzy wynosi 40,0–90,0 cm (Bahnsawy 1989). Pozyskiwanie mniejszych niż 40 cm osobników nie jest praktykowane w racjonalnej gospodarce
rybackiej, ponieważ wymiar ochronny dla tego gatunku wynosi 40 cm. Fakt ten
pośrednio tłumaczy rozkład i zakres długości ryb pobranych do badań ze zlewni
rzeki Myśli, przy czym należy podkreślić, iż średnia długość całkowita jest nieco
mniejsza od danych podawanych przez Piątka (1970) i Bahnsawy (1989) dla wód
Polski. Z długością ryb skorelowana jest ich masa, co określa się funkcją y = kLn.
U węgorza parametr n przyjmuje wartość od 3,0975 do 3,3706 (Bahnsawy 1989),
a w zlewni rzeki Myśli wynosi 3,3263.
Wśród wartości względnych 10 cech wymierzalnych u węgorza za najbardziej stały parametr liniowy uważa się długość ciała, która wyrażona w procentach długości całkowitej wynosi średnio 98,4 (Pallacio 2008), a u ryb ze zlewni
rzeki Myśli 98,24 (zakres 92,73–99,30%). Natomiast największą zmiennością
charakteryzowały się cechy opisujące głowę węgorza: pionowa szerokość oka
– X8 (V = 21,29%), pozioma szerokość oka – X7 (19,03%), dystans między
oczami – X4 (16,99%), szerokość głowy – X5 (16,12%). Wartości te mieszczą
się w przedziale podawanym dla tego gatunku (Bogdan 1980, 1982; Bahnsawy
1989; Pallacio 2008). Pozostałe cechy mierzalne według prac Bogdana (1980,
1982), wyrażone w procentach długości całkowitej, kształtują się następująco:
X6 dla samców wynosi 11,7–12,6%, dla samic 11,5–12,7%; X9 dla samców wynosi 40,3–43,3%, dla samic 36,9–45,7%; X10 dla samców wynosi 28,6–31,2%,
dla samic 24,6–34,7%. W przypadku pomiarów tych parametrów dokonanych
na węgorzach ze zlewni rzeki Myśli otrzymano średnie wartości mieszczące się
w wyżej wymienionych zakresach, jednakże wyższe w porównaniu z danymi
podawanymi przez Pallacio (2008).
Niniejsze badania są częścią wstępną prowadzonych obecnie analiz mających na celu określenie oprócz cech biologicznych i populacyjnych również
wielkości zasobów węgorza występującego w jeziorach zlewni rzeki Myśli,
a także opracowania planu gospodarowania tym gatunkiem na terenie województwa zachodniopomorskiego.
Wybrane cechy biologiczne...
45
BIBLIOGRAFIA
Anonymus, 1998: Przełowienie gatunku? Przegl. Ryb., 2, s. 64–65.
Bahnsawy M.H., 1989: Variability of the growth of eel (Anguilla anguilla) in relation
to the feeding behaviour, gonad development and morphology in Lake Jeziorak,
Mazurian Lake District. Praca doktorska. IRS, Olsztyn.
Bogdan E., 1980: Zmienność biometryczna węgorza (Anguilla anguilla) w jeziorach polskich. Praca magisterska. AR, Olsztyn.
Bogdan E., 1982: Biometria, wzrost i kondycja węgorza (Anguilla anguilla) ze zróżnicowanych ekologicznie zbiorników wodnych. Praca doktorska. IRS, Olsztyn.
Bouillon D.R., Haedrich R.L., 1985: Growth of silver eels (Anguilla anguilla) in two
areas of Newfunland. J. Northwest Atl. Fish. Sci., G, s. 95–100.
Czerniejewski P., Wawrzyniak W., 2008: Dynamika zmian wieloletnich połowów węgorza, Anguilla anguilla w dolnym biegu Odry w latach 1952–2001. Ekol. Pol., Ser.
Monografie, s. 150–156.
Frost W.E., 1945: The age and growth of eels (Anguilla anguilla) from the Windermere
catchment area. J. Anim. Ecol., 14, s. 26–36.
Pallacio A., Morphometrics of Anguilla anguilla. http://www.fishbase.org/physiology/
MorphMetSummaryV2.php?picname=Anang_u5.jpg&genusname=Anguilla&
speciesname=anguilla&id=35.
Piątek M., 1970: Wiek, wzrost i zmiany stosunków wagowych oraz składu chemicznego
węgorza w czasie życia w wodach Polski. Acta Ichthyol. Pisc., 1, s. 73–96.
Rasmussen G., 1952: Food, growth and production of Anguilla anguila L. in small Danish
stream. Rap. Reun. Cons. Int. Explor. Mer., 174, s. 32–40.
Ritterbusch-Nauwerck B., 1995: Condition or corpulence, fitness or fatness: a discusion
of terms. Arch. Hydrobiol. Spec. Issues Advanc. Limnol., 46, s. 109–112.
Robak S., 2005: Węgorz – dlaczego narybek podchowany? I. Uwarunkowania biologiczne. Kom. Ryb., 3, s. 24–27.
Rossi R., Colombo G., 1979: Some observations on age, sex, and growth of silver eels
(Anguilla anguilla) in North Adriatic Lagoons. Rap. Reun. Cons. Int. Explor. Mer.,
174, s. 64–69.
Szczerbowski J.A., 1993: Rybactwo śródlądowe. IRS, Olsztyn.
Szypuła J., 2002: The length-weight relationship and condition of pike and perch in Lake
Miedwie. Acta Ichthyol. Piscat., 32 (1), s. 93–106.
46
Przemysław Czerniejewski, Agnieszka Rybczyk
Vollestad L.A., Jonson B., 1988, A 13-year study of population dynamics d growth
of the European eel, Anguilla anguilla in a Norwegian river: evidence for a model
for predicting yield. J. Anim. Ecol., 57, s. 983–997.
Wrona J., 2004: Co dalej z węgorzem? Przegl. Ryb., 1, s. 42–45.
Zommer J., 2007: Założenia restrukturyzacji zasobów węgorza w polskich jeziorach,
rzekach i zalewach przymorskich jako propozycja planu zrównoważonej gospodarki tymi zasobami. W: Rybackie perspektywy pobrzeża południowego Bałtyku, t. II.
Rybactwo śródlądowe Pomorza Zachodniego w świetle nowych przepisów polityki
wspólnotowej. Szczecin, s. 95–102.
SELECTED BIOLOGICAL AND MORPHOMETRIC CHARACTERS
OF EEL (ANGUILLA ANGUILLA L.) FROM THE MYŚLA RIVER BASIN
Summary
In 2007 selected biological and morphometric characters of eel from the Myśla river
basin were analysed. Variability of total length, condition and 10 morphometric parametrs
were caried out on 80 eels. Mean total length was 59,32 cm (range 39,5–91,2 cm). The
higher number of eels was observed in range from 55,1 to 60,0 cm. Mean Fulton’s condition was 1,87, and Le C’s factor was 0,50. Out of a total of 10 linear parameters, showed
high coefficients of variation in head’s measurement.
Translated by Przemysław Czerniejewski
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
ANNA KALITKIEWICZ
EWA KĘPCZYŃSKA
Uniwersytet Szczeciński
AKTYWACJA SZLAKU FENOLI U POMIDORA
(LYCOPERSICON ESCULENTUM MILL.)
Z WYKORZYSTANIEM PSEUDOMONAS PUTIDA UW4
Activation of phenol pathway in tomato (Lycopersicon esculentum Mill.)
using Pseudomonas putida UW4
Słowa kluczowe: stymulacja wzrostu roślin, ryzobakterie, odporność systemiczna, indukcja fenylopropanoidów, ekspresja genów
Key words: plant growth promoting, rhizobacteria, systemic resistance, phenylpropanoid, induction gene exspression
1. Wstęp
PGPR są wolno żyjącymi bakteriami bytującymi na powierzchni korzeni
roślinnych lub w strefie przykorzeniowej, korzystającymi z uwalnianych przez
roślinę składników odżywczych. Bakterie te stymulują wzrost w dwojaki sposób
– bezpośredni i pośredni (tabela 1) (Glick 1995; Hontzeas i in. 2006; Li i in.
2000; Kalitkiewicz, Kępczyńska 2008).
48
Anna Kalitkiewicz, Ewa Kępczyńska
Tabela 1. Stymulacja wzrostu roślin przez PGPR
Table 1. Plant’s growth stimulation by PGPR
DZIAŁANIE BEZPOŚREDNIE
DZIAŁANIE POŚREDNIE
• Produkcja fitohormonów:
giberelin,
auksyn,
cytokinin
• Obniżanie poziomu etylenu w roślinach
przez bakteryjną deaminazę ACC
• Zwiększenie pobierania związków mineralnych:
ułatwianie pobierania azotu,
rozpuszczanie związków fosforu, cynku,
wiązanie żelaza przez siderofory
• Biologiczne zwalczanie patogenów:
konkurencja o miejsce na korzeniu,
ograniczenie dostępności żelaza dla patogenów przez wiązanie w siderofory,
synteza metabolitów przeciwgrzybowych,
produkcja antybiotyków,
produkcja enzymów lizujących ściany
komórkowe grzybów
• Indukowanie odporności systemicznej
(ISR)
Bardzo interesujące jest wykorzystanie PGPR do indukcji systemicznej odporności roślin (ISR) na patogeny. Aktualnie dobrze udokumentowano indukcję
tej odporności u co najmniej 15 gatunków roślin (Van Loon, Bakker 2006). Polega ona między innymi na uruchamianiu w roślinach szlaku biosyntezy związków
fenolowych, które często zaliczane są do wtórnych metabolitów. Różnią się one
strukturą, ale wszystkie posiadają pierścień aromatyczny. Spośród nich fenylopropanoidy (flawonoidy, izoflawonoidy, stilbeny, monolignole i lignany) charakteryzują się szczególną aktywnością przeciwko mikroorganizmom chorobotwórczym (Dixon 2001). Kluczowym enzymem w szlaku biosyntezy fenylopropanoidów jest amoniakoliaza fenyloalaninowa (E.C.4.3.1.5., PAL) (rys. 1).
flawonoidy
PAL
CHS
C4H
ligniny
kwas cynamonowy
L-fenyloalanina
p-kumarat
kwas chlorogenowy
?
BA2H
kwas salicylowy
kwas benzoesowy
Rys. 1. Szlak biosyntezy fenylopropanoidów. PAL – amoniakoliaza fenyloalaniny,
C4H – 4-hydroksylaza kwasu cynamonowego, CHS – synteza chalkonu, BA2H
– 2-hydroksylaza kwasu benzoesowego
Fig. 1. Biosynthesis of phenylpropanoids pathway. PAL – phenylalanine ammonia-lyase,
C4H – cinnamate 4-hydroxylase, CHS – chalcone synthase, BA2H – benzoil acid
2-hydroxylase
Aktywacja szlaku fenoli...
49
Celem pracy było sprawdzenie, czy niepatogeniczne dla roślin bakterie
Pseudomonas putida UW4 wykazują zdolność do aktywacji biosyntezy związków fenolowych u pomidora oraz czy mają wpływ na ekspresję genu PAL
w siewkach wyrosłych z nasion inokulowanych zawiesiną tych bakterii.
2. Materiały i metody
2.1. Mikroorganizmy i materiał roślinny
Do badań użyto szczepu Pseudomonas putida UW4 otrzymanego z Departamentu Biologii (Waterloo, Kanada), pierwotnie wyizolowanego z ryzosfery
trzciny (Glick i in. 1995). Bakterie hodowano na pożywce TBS (Tryptic Soy
Broth) w inkubatorze z wytrząsaniem w stałej temperaturze wynoszącej 28ºC
do osiągnięcia OD600 0,6 nm (Spektrofotometr UV-VIS, Shimadzu). Następnie
bakterie odwirowywano (8000 x g/ 4ºC/ 10 min) i zawieszano w pożywce DF
(Dworkin i Foster) z dodatkiem 3 mM ACC, który stanowił jedyne źródło azotu.
Po 24 h bakterie ponownie odwirowano i zawieszono w 5 ml 10 mM MgSO4.
Materiał roślinny stanowiły nasiona oraz 14-dniowe siewki pomidora
(Lycopersicon esculentum Mill.) odmiany BETA (Polan Sp. z o.o., Kraków). Jest
to polowa odmiana pomidora, którą cechuje mała wrażliwość na niekorzystne
warunki atmosferyczne i stosunkowo niska odporność na patogeny.
2.2. Inokulacja bakteriami
Do inokulacji nasion oraz mieszanki „glebowej” (sterylny perlit, wermikulit
i piasek w proporcjach 1 : 1 : 1) przygotowano zawiesinę komórek bakteryjnych
w 10 mM MgSO4 o OD600 wynoszącym 1,2 nm ± 0,05 nm.
Przygotowano dwie kontrole: kontrolę wodną (nasiona moczone przez godzinę w wodzie) i kontrolę z 10 mM MgSO4 (nasiona moczone przez godzinę
w 10 mM MgSO4). Bakterie zastosowano w dwojaki sposób: nasiona moczono przez godzinę w zawiesinie bakterii oraz mieszano z „glebą” w proporcjach
12 ml zawiesiny na 100 g mieszanki glebowej.
Dodatkowo do sprawdzania aktywności genów przygotowano partię nasion,
które umieszczono na szalkach z bibułą nasączoną 1 ml H2O. Szalki przechowywano w ciemności przez 4 doby, po tym czasie do szalek dodawano po 1 ml H2O
lub 10 mM MgSO4 lub zawiesiny bakterii i pozostawiono na świetle. Po 24 h
izolowano RNA z hipokotyli i całych siewek.
50
Anna Kalitkiewicz, Ewa Kępczyńska
2.3. Analiza zawartości związków fenolowych mtodą HPLC
Analizę zawartości związków fenolowych przeprowadzono metodą wysokosprawnej chromatografii cieczowej (HPLC) na kolumnie Phenomenex
GE-MINI C18 przy długości fali 280 nm. Wcześniej przygotowano standardy
związków fenolowych w 100% metanolu i analizowano za pomocą oprogramowania ChemStation LC Rev. (Agilent Technologies).
100 mg tkanki roślinnej homogenizowano z 500 μl 100% metanolu i mieszano w wytrząsarce przy 100 rpm przez 2 godziny. 400 μl ekstraktu pobrano do
probówki i mieszano z 400 μl 4N HCl. Ekstrakt inkubowano w bloku grzejnym
w temperaturze 50°C przez 45 min. Następnie dodano 400 μl 100% metanolu
i ekstrakt odwirowano (10 000 x g/10 min). Supernatant przeniesiono do nowej
probówki i ponownie zwirowano, a następnie przefiltrowano przez filtry 0,22 μl,
umieszczono w 1 ml probówkach do HPLC i oznaczono na zawartość kwasów
fenolowych i flawonoidów.
2.4. Analiza ekspresji genu amoniakoliazy fenyloalaniny (PAL)
IZOLACJA RNA
TRIZOL+KIT INVITROGEN
Ok. 100 mg tkanki
0,5 ug RNA
cDNA
RT
(Roche)
TOM 51gen referencyjny
WydajnoĞü ok. 0,2-0,4 ug/ul
ANALIZA PCR
TRAWIENIE DNAzą:
PAL
- Ambion po izolacji
Rys. 2. Metody molekularne zastosowane do analizy ekspresji genu PAL
Fig. 2. Molecular methods of PAL gene expresion analysis
Do izolacji RNA użyto hipokotyli z 7-dniowych siewek hodowanych
w doniczkach oraz hipokotyli i całych siewek z nasion hodowanych na szalkach.
Izolację przeprowadzono metodą trizolową (TRIzol® Reagent, Invitrogent)
51
Aktywacja szlaku fenoli...
modyfikowaną, połączoną z kolumienkami wiążącymi RNA (Invitrogen). Do
izolacji odważono po ok. 100 mg hipokotyli i całych siewek i zhomogenizowano
w ciekłym azocie. Następnie na 100 mg tkanki utartej na proszek dodano 1 ml
trizolu i dalej prowadzono zgodnie z protokołem. Tak wyizolowane RNA poddano trawieniu DNazą (Ambion) w celu pozbycia się resztek DNA. Jakość i ilość
RNA sprawdzono spektrofotometrycznie przy λ = 260 nm i 280 nm oraz dokonując rozdziału w 1,2% żelu agarozowym. W celu otrzymania cDNA przeprowadzono odwrotną transkrypcję (RT), wykorzystując startery oligo-dT i odwrotną
transkryptazę (Roche). Reakcję prowadzono w termocyklerze (Biometra) w 55ºC
przez 30 min. Dezaktywacji odwrotnej transkryptazy dokonano poprzez inkubację w 85ºC przez 5 min. Uzyskane cDNA zostało użyte do dalszych analiz.
Do analizy ekspresji amoniakoliazy fenyloalaniny (PAL) użyto specyficznych starterów – tabela 2 (Sheoran i in. 2006). Konieczne było zastosowanie
cDNA genu referencyjnego TOM 51. Jest to gen, który koduje aktynę, a poziom
jego ekspresji jest na stałym poziomie.
Tabela 2. Startery użyte do amplifikacji cDNA genów PAL i TOM51
Table 2. Primers used for amplification of cDNA of PAL and TOM51 genes
Nazwa genu
Startery
Wielkość
produktu
PAL (amoniakoliaza fenyloalaniny)
F 5’- ATTGTGAAACTTGGGGGTGA
R 5’- TGCCATAGCAGAACCAACTG
654
TOM 51 (gen kodujący aktynę)
F 5’- CTCGCCACACTGGTGTTATG
R 5’- TCAGCAGTGGTGGTGAACAT
502
Sporządzono mieszaninę reakcyjną w objętości 25 μl, zawierającą: cDNA,
1 x bufor reakcyjny, 0,1 mM każdego z dNTP-ów (dATP, dTTP, dCTP, dGTP),
0,2 mM każdego ze starterów, 1 jednostkę Taq DNA polimerazy (Promega).
Amplifikację fragmentów cDNA przeprowadzono w termocyklerze (Biometra) w następujących warunkach: 1) denaturacja wstępna w 95ºC przez 5 min,
2) denaturacja właściwa w 95ºC przez 30 s, 30 przyłączanie starterów w 54ºC,
4) wydłużanie łańcucha w 72ºC przez 1 min, 5) wydłużanie końcowe w 72ºC
przez 5 min. Etapy od 2 do 4 przeprowadzono w 20 cyklach.
Analiza względnej zmiany poziomu ekspresji genu PAL wykonana została
po rozdziale elektroforetycznym w 1,5% żelu agarozowym w odniesieniu do poziomu ekspresji genu referencyjnego TOM 51.
52
Anna Kalitkiewicz, Ewa Kępczyńska
3. Wyniki badań
3.1. Zawartość związków fenolowych
Poziom związków fenolowych w siedmiodniowych siewkach kontrolnych
wyrosłych z nasion inkubowanch przez 1 godzinę w wodzie lub 10 mM MgS04
był na tym samym poziomie i wynosił średnio około 170 ng/g świeżej masy
(rys. 3). Siewki zawierały podobną ilość kwasu kawowego, kwasu salicylowego,
naryngeniny i kampferolu.
600
kampferol
naryngenina
ng/g ĞwieĪej masy
500
kwercetyna
400
kwas salicylowy
rutyna
300
kwas kawowy
200
100
0
H2O
MgSO4
UW-N
UW-G
Rys. 3. Zawartość związków fenolowych w 7-dniowych siewkach pomidora. H2O – kontrola, nasiona traktowane wodą, MgSO4 – kontrola, nasiona traktowane 10 mM
MgSO4, UW-N – nasiona traktowane zawiesiną bakterii, UW-G – gleba inokulowana zawiesiną bakterii
Fig. 3. Content of phenolic compounds in 7-days old tomato seedling. H2O – control, seed
treated with water, MgSO4 – control, seed treated with 10 mM MgSO4, UW-N
– seed treated with bacteria suspension, UW-G – soil inoculated bacteria suspension
Inokulacja nasion zawiesiną bakterii bezpośrednio poprzez ich godzinne
moczenie lub pośrednio poprzez ich kontakt z zainokulowaną glebą spowodowała wzrost zawartości związków fenolowych w wyrosłych z tych nasion siewkach
odpowiednio o około 3 (530 ng/g świeżej masy) i 2 razy (300 ng/g świeżej masy).
Największy wzrost poziomu w porównaniu z siewkami kontrolnymi zaobserwowano dla kwasu salicylowego (około 3 razy). W siewkach nasion inkubowanych
53
Aktywacja szlaku fenoli...
w zawiesine bakteryjnej wzrósł znacznie (2 razy) poziom kwasu kawowego. Pojawiły się też związki fenolowe niewystępujące w kontrolach – rutyna i kwertycyna. Zawartość kwertycyny w siewkach pochodzących z nasion moczonych
była około 4 razy większa niż w siewkach z nasion wysianych do inokulowanego
podłoża.
3.2. Ekspresja genu amoniakoliazy fenyloalaniny (PAL)
Analiza poziomu ekspresji genu PAL nie wykazała istotnych różnic pomiędzy siewkami pochodzącymi z nasion moczonych w wodzie lub MgSO4 a tymi
z nasion traktowanych bakteriami (rys. 4). Słabo zauważalne różnice w hipokotylach siewek 1-dniowych kontrolnych i tych wyrosłych z nasion traktowanych
bakteriami mogą sugerować indukcję ekspresji genu PAL we wczesnych etapach
rozwoju siewek.
B.
A.
W
M
N
W
M
N
W
M
N
G
PAL
TOM 51
25 S rRNA
hypokotyl
siewka
hypokotyl
Rys. 4. Analiza ekspresji genu PAL. A – siewki hodowane na szalkach i analizowane
24 h po inokulacji, B – siewki hodowane w doniczkach i analizowane 7 dni po
inokulacji, W – kontrola wodna, M – kontrola z MgSO4, N – inokulacja nasion,
G – inokulacja gleby
Fig. 4. PAL gene expression analysis. A – seedings raised on scales and analised 24h
after inoculation, B – seedings raised in pots and analised 7 days after inoculation, W – water control, M – control with MgSO4, N – seed inoculation, G – soil
inoculation
4. Wnioski
Na podstawie przeprowadzonych analiz można stwierdzić, że bakterie
Pseudomonas putida UW4 należące do grupy PGPR aktywują szlak fenylopropanoidów i przyczyniają się do wzrostu zawartości wybranych związków
fenolowych w siewkach pomidora dwukrotnie w przypadku traktowania zawie-
54
Anna Kalitkiewicz, Ewa Kępczyńska
siną bakteryjną gleby oraz trzykrotnie w przypadku inokulacji nasion. Bakterie
te przyczyniają się do indukcji biosyntezy kwasu salicylowego, co może wskazywać na aktywację procesów wywołujących odporność systemiczną, a w szczególności nabytą odporność systemiczną (SAR). Znikoma indukcja ekspresji genu
PAL pod wpływem działania bakterii w hypokotylach siewek po 24 h od inokulacji oraz brak indukcji ekspresji w siewkach 7-dniowych wskazuje na niewystępowanie lub niewielką regulację szlaku fenylopropanoidów na poziomie mRNA
(ekspresja genu), a raczej na regulację poprzez zmiany aktywności enzymu amoniakoliazy fenyloalaniny oraz na poziomie kolejnych enzymów tego szlaku, np.
syntazy chalkonu. W dalszych badaniach konieczne jest przeprowadzenie analiz zmian aktywności enzymu amoniakoliazy fenyloalaniny (PAL) oraz syntazy
chalkonu (CHS), a także analiza poziomu ekspresji genu PAL, w szczególności
zaś CHS z wykorzystaniem techniki PCR w czasie rzeczywistym (Real-Time
PCR), która jest znacznie dokładniejsza od tradycyjnej metody PCR.
BIBLIOGRAFIA
Dixon R.A., 2001: Natural products and disease resistance. Nature, 411, s. 843–847.
Glick B.R., 1995: The enhancement of plant growth by freeliving bacteria. Canadian
Journal Microbiology, 41, s. 109–117.
Glick B.R., Karaturovýc D., Newell P., 1995: A novel procedure for rapid isolation
of plant growth-promoting rhizobacteria. Canadian Journal Microbiology, 41,
s. 533–536.
Hontzeas N., Hontzeas C.E., Glick B.R., 2006: Reaction mechanisms of the bacterial
enzyme 1-aminocyclopropane-1-carboxylate deaminase. Biotechnology Advances,
24, s. 420–426.
Kalitkiewicz A., Kępczyńska E., 2008: Wykorzystanie ryzobakterii do stymulacji wzrostu
roślin. Biotechnologia, 81, s. 102–114.
Li J., Ovakim D.H., Charles T.C., Glick B.R., 2000: An ACC deaminase minus mutant of Enterobacter cloacae UW4 no longer promotes root elongation. Current
Microbiology, 41, s. 101–105.
Sheoran I.S., Dumonceaux T., Datla R., Sawhney V.K., 2006: Anthocyanin accumulation
in the hypocotyl of an ABA-over producing male-sterile tomato (Lycopersicon esculentum) mutant. Physiologia Plantarum, 127, s. 681–689.
Van Loon L.C., Bakker P.A.H.M., 2006: Root-associated bacteria including systemic
resistance. W: S.S. Gnanamanickam (red.): Plant-associated bacteria. Springer, The
Netherlands, s. 269–316.
55
Aktywacja szlaku fenoli...
ACTIVATION OF PHENOL PATHWAY IN TOMATO
(LYCOPERSICON ESCULENTUM MILL.)
USING PSEUDOMONAS PUTIDA UW4
Summary
Free-living bacteria (PGPR) because of plant growth stimulation possibility and
activation of anti-pathogens systemic resistance pathways, are being considered as an
alternative for artificial fertilizer and pesticides. This review presents the first results
of phenols pathways activation by PGPR, and possibility of plants systemic resistance
induction.
Translated by Ewa Kępczyńska
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
KAROLINA KONOPSKA
Uniwersytet Szczeciński
WSTĘPNE WYNIKI BADAŃ FLORY ROŚLIN NACZYNIOWYCH
CZĘŚCI MEZOREGIONU RÓWNINA NOWOGARDZKA
W PÓŁNOCNO-ZACHODNIEJ POLSCE
Vascular plant flora of the Równina Nowogardzka region
(NW Poland) – Preliminary results
Słowa kluczowe: rośliny naczyniowe, flora, Równina Nowogardzka
Key words: phytogeography, Western Pomerania, protected vascular plants species
1. Wstęp
Florę stanowi ogół gatunków roślin na określonym obszarze, w wyznaczonym biotopie czy też w formacji roślinnej. Wraz z roślinnością określającą
ogół zbiorowisk roślinnych danego terenu tworzy szatę roślinną będącą składnikiem geosystemu o zmiennym charakterze w czasie i przestrzeni, uzależnioną
od wszystkich składników środowiska przyrodniczego oraz wpływu działalności
człowieka (Kornaś, Medwecka-Kornaś 2002).
Stan poznania flory północno-zachodniej Polski jest niejednorodny i wybiórczo odnosi się do poszczególnych określonych obszarów – głównie rezerwatów
przyrody, parków krajobrazowych i parków narodowych. Mezoregion Równina
Nowogardzka, będący częścią Pobrzeża Szczecińskiego (Kondracki 2000), jest
obszarem, którego zasoby florystyczne opisane są wyrywkowo. Równina Nowogardzka ma charakter typowo rolniczy. Znajduje się tu rezerwat przyrody nieożywionej „Ozy Kiczarowskie” w gminie Stara Dąbrowa, dwa planowane rezer-
58
Karolina Konopska
waty przyrody w gminie Osina: „Krzywicki Mszar” i „Wrzosiec” oraz kolejny
– „Obniżenia Rożnowskie” w gminie Maszewo (Borówka 2003; Waloryzacja
przyrodnicza... 1998, 2001). W dostępnej literaturze znajdują się opracowania
dotyczące zróżnicowania mokradeł Pomorza Zachodniego (Kochanowska, Rygielski 1996), budowy i roślinności torfowisk Pomorza Szczecińskiego (Jasnowski 1962) oraz opracowania roślin rzadkich i chronionych w szacie roślinnej
stawów wiejskich na Pomorzu Szczecińskim (Bacieczko 1984), które pośrednio
odnoszą się również do opisywanego mezoregionu. Z tego obszaru pochodzą też
opracowania i doniesienia florystyczne Ćwiklińskiego (1969, 1974, 1981) i Ciaciury (2005). Badane były niektóre śródpolne zbiorniki wodne (Bosiacka, Pieńkowski 2004). Znane są też opracowania dla niektórych miast tego terenu: Maszewa (Bacieczko, Małycha 2004), Stargardu Szczecińskiego (Banaś i in. 2000).
Głównym celem badań przewidzianych na czas kilku sezonów wegetacyjnych jest analiza stosunków fitogeograficznych Równiny Nowogardzkiej poprzez
poznanie różnorodności gatunkowej, ze szczególnym uwzględnieniem rozmieszczenia flory naczyniowej gatunków rzadkich i zagrożonych. Niniejsze opracowanie przedstawia wyniki badań prowadzonych w 2008 roku w zachodniej części
omawianego mezoregionu.
2. Teren badań
Równina Nowogardzka obejmuje głównie obszary wysoczyzn morenowych
wznoszących się do wysokości 50–80 m n.p.m. Północną granicę tego regionu stanowi krawędź Pradoliny Pomorskiej, a południowo-zachodnią krawędź
doliny Iny. Najmniej wyraźna jest granica wschodnia, oddzielająca Równinę
Nowogardzką od Wysoczyzny Łobeskiej i Pojezierza Ińskiego. Obszar wysoczyznowy jest tutaj zajęty głównie przez pole drumlinów nazywane nowogardzkim polem drumlinowym. Na jego powierzchni naliczono ponad 3 tys. regularnie rozmieszczonych drumlinów, zorientowanych ku północy. Na opisywanym
obszarze występują też liczne rynny glacjalne i ozy. Rynny glacjalne są wąskie
i prostolinijne, osiągają znaczne długości, np. Rynna Maszewska do 25 km. W ich
obrębie pojawiają się jeziora rynnowe, z których największe są Jezioro Lechickie
i Jezioro Grabowskie. Spotykane tutaj ozy powstały nie tylko wskutek akumulacyjnej działalności wód roztopowych płynących w tunelach i szczelinach pod
lądolodem, ale też w wyniku wciskania się do tych szczelin plastycznej gliny
zwałowej, dlatego cechują się skomplikowaną budową i zaburzonym układem
Wstępne wyniki badań flory...
59
warstw (Borówka 2003). Teren równiny przecięty jest przez kilka niewielkich
rzek (Krąpiel, Gowienica, Sąpólna), jedyną większą rzeką jest Rega. Znajdują
się tutaj także kompleksy leśne, przede wszystkim lasy mieszane. Na polach
uprawnych dominują gleby bielicowe i płowe. Równina Nowogardzka zbudowana jest przede wszystkim z piasków i żwirów lodowcowych oraz miejscami
płatów glin zwałowych występujących wydłużonymi pasmami w okolicy Jenikowa, Mokrego, Nastazina, Maszewa i Maciejewa (Waloryzacja przyrodnicza...
2001). Pod względem pochodzenia rzeźby terenów, procesów rzeźbotwórczych
oraz ich struktury i genezy obszar ten należy zaliczyć do form subarealnych, plejstoceńskich, lodowcowych moreny dennej (Kondracki 2000). Dzisiejszy krajobraz uformował się przede wszystkim w okresie ostatnich 16–15 tys. lat, podczas
stopniowego wytapiania się lądolodu, a zarazem przesuwania się jego krawędzi
ku północy (Borówka 2003). Właśnie z tego okresu zachowały się do dzisiaj liczne nieprzekształcone moreny, żwirowiska i jeziora polodowcowe. Powierzchnia
morfologiczna wysoczyzny polodowcowej uległa jedynie niewielkim zmianom
związanym z erozyjną działalnością płynących tutaj małych cieków powierzchniowych (Leśniak 2002).
Równina Nowogardzka należąca do Regionu Zachodniopomorskiego charakteryzuje się łagodnym klimatem z dość znaczną liczbą dni słonecznych oraz
dni bez opadów. Względnie rzadziej pojawiają się również dni przymrozkowe
oraz mroźne (Borówka 2003). Specyficzną cechą regionu jest stosunkowo częstsze występowanie dni z pogodą przymrozkową umiarkowanie zimną z niewielkim
zachmurzeniem i bez opadu, oraz rzadkie dni z pogodą przymrozkową umiarkowanie zimną z dużym zachmurzeniem nieba i opadem. Notuje się najmniej dni
z pogodą przymrozkową umiarkowanie zimną z opadem (10 dni w ciągu roku)
oraz mało dni z pogodą umiarkowanie mroźną z opadem (7 dni w ciągu roku)
(Woś 1999). Obszar Pomorza Zachodniego odznacza się najdłuższym okresem
wegetacyjnym, co sprzyja rozwojowi roślinności. Oprócz regionalnego zróżnicowania warunków klimatycznych obserwuje się także bardzo dużą zmienność mikroklimatyczną, uwarunkowaną przede wszystkim rzeźbą terenu oraz pokryciem
obszaru przez szatę roślinną. Cała Równina Nowogardzka jest słabo zalesiona,
cechuje się typowym krajobrazem rolniczym (Borówka red. 2003).
W sezonie 2008 badaniami terenowymi objęto zachodnią część mezoregionu o powierzchni 100 km2. Obszar ten administracyjnie mieści się w gminie
Maszewo.
60
Karolina Konopska
Rys. 1. Równina Nowogardzka na tle mapy mezoregionów fizycznogeograficznych
Polski według Kondrackiego (2000). Czarnym kwadratem oznaczono badany
obszar
Fig. 1. Równina Nowogardzka on background of physico-geographical regions map
of Poland according to Kondracki (2000). Studied area was marked black square
3. Metody badań
Badania flory naczyniowej opierają się na wszelkich dostępnych danych
florystycznych zebranych od początków XIX wieku oraz na obserwacjach terenowych i wykonanych zdjęciach florystycznych. W pracach terenowych korzysta
się z dostępnych map (drogowych, turystycznych, leśnych) i zdjęć satelitarnych.
W miejscach obserwacji sporządzane są notatki terenowe, a współrzędne geograficzne stanowisk roślin chronionych i rzadkich odczytuje się z GPS. W trakcie badań uwzględniano siedliska słabo przekształcone przez człowieka, takie
Wstępne wyniki badań flory...
61
jak las, łąki i pastwiska, oraz siedliska synantropijne: pola uprawne, nieużytki,
przydroża, przychacia, przypłocia, wysypiska śmieci, torowiska i żwirowiska.
Do badań zastosowano metodę kartogramu o regularnej sieci kwadratowych pól
(o bokach 2,5 km) – ATPOL (Zając, Zając 2001). Zebrane dotychczas okazy
roślin oznaczono za pomocą kluczy: Klucz do oznaczania roślin naczyniowych
Polski niżowej (Rutkowski 2007), Rośliny polskie, cz. I i II (Szafer i in. 1986)
oraz atlasu Exkursionsflora von Deutschland, t. 3 (Rothmaler 2000), a następnie
sporządzono zielnik. Nazewnictwo gatunków oparto na opracowaniu Mirka i in.
(2002). Florę wstępnie scharakteryzowano pod względem struktury systematycznej (Rutkowski 2007), przynależności do form życiowych Raunkiaera (Zarzycki i in. 2002) i grup geograficzno-historycznych (Kornaś 1968; Chmiel 1993).
Status gatunków chronionych wskazano na podstawie Rozporządzenia Ministra
Środowiska (DzU z 2004 r., nr 168, poz. 1764). Wykaz rozpoznanych gatunków,
w porządku alfabetycznym, zawiera tabela 2. Gatunki chronione zostały wykazane w tabeli 1, a ich rozmieszczenie przedstawia rysunek 2.
4. Wstępne wyniki badań
W sezonie wegetacyjnym 2008 roku na zbadanym obszarze zachodniej części Równiny Nowogardzkiej stwierdzono występowanie 474 gatunków roślin
naczyniowych, reprezentujących 82 rodziny. Liczebność Dicotyledones wynosiła 380 gatunków, co stanowi 80,16% flory. Najliczniej reprezentowane były
rodziny: Asteraceae (64 gatunki), Poaceae (42 gatunki), Fabaceae (31 gatunków),
Rosaceae (25 gatunków). Z analizy form życiowych wynika, że najliczniejszą
grupą są hemikryptofity – 44,9% i terofity – 21,3%. Zanotowano łącznie 103 gatunki obcego pochodzenia (antropofitów), co stanowi około 22% całej flory.
Stwierdzono obecność 19 gatunków objętych ochroną gatunkową: Vinca
minor, Hedera helix, Menyanthes trifoliata, Nuphar lutea, Nymphaea alba, Frangula alnus, Aquilegia vulgaris, Galium odoratum, Ribes nigrum, Ornithogalum
umbellatum, Convallaria majalis, Polypodium vulgare, Helichrysum arenarium,
Hepatica nobilis, Epipactis helleborine, Centaurium erythraea, Carex arenaria,
Ononis spinosa, Viburnum opulus. 5 gatunków objętych jest ochroną ścisłą, pozostałe 14 gatunków ochroną częściową (DzU z 2004 r., nr 168, poz. 1764).
62
Karolina Konopska
Tabela 1. Lista gatunków roślin chronionych stwierdzonych na zbadanym obszarze
w 2008 roku
Table 1. List of protected plants species that were recorded on research area in vegetative season 2008
Nr
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
Nazwa gatunkowa
Aquilegia vulgaris
Carex arenaria
Centaurium erythraea
Convallaria majalis
Epipactis helleborine
Frangula alnus
Galium odoratum
Hedera helix
Helichrysum arenarium
Hepatica nobilis
Menyanthes trifoliata
Nuphar lutea
Nymphaea alba
Ononis spinosa
Ornithogalum umbellatum
Polypodium vulgare
Ribes nigrum
Viburnum opulus
Vinca minor
Rodzina
Ranunculaceae
Cyperaceae
Gentianaceae
Liliaceae
Orchidaceae
Rhamnaceae
Rubiaceae
Araliaceae
Asteraceae
Ranunculaceae
Menyanthaceae
Nymphaeaceae
Nymphaeaceae
Fabaceae
Liliaceae
Polypodiaceae
Grossulariaceae
Caprifoliaceae
Apocynaceae
Ochrona
całkowita
Ochrona
częściowa
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Do taksonów chronionych często spotykanych w szacie roślinnej tego
obszaru należą: Hedera helix, Galium odoratum i Helichrysum arenarium.
Poniżej zamieszczono pełną listę florystyczną gatunków roślin naczyniowych stwierdzonych na badanym obszarze w 2008 roku.
Wstępne wyniki badań flory...
63
Rys. 2. Stanowiska roślin chronionych na badanym terenie według numeracji zastosowanej w tabeli 1
Fig. 2. Location of protected species in the study area according to numbering applied
in table 1
64
Karolina Konopska
Tabela 2. Lista gatunków roślin naczyniowych stwierdzonych na zbadanym obszarze
w 2008 roku
Table 2. List of vascular plants species that were recorded on research area in vegetative
season 2008
Lp.
1
2
3
4
5
6
7
8
9
10
Nazwa gatunkowa
Acer campesrte
Acer negundo
Acer platanoides
Acer pseudoplatanus
Achillea millefolium
Acinos arvensis
Acorus calamus
Adoxa moschatellina
Aegopodium
podagraria
Aesculus
hippocastanum
Aesculus x carnea
Aethusa cynapium
Agrimonia eupatoria
Agropyron repens
Agrostemma githago
Agrostis capillaris
Agrostis gigantea
11
12
13
14
15
16
17
18 Agrostis stolonifera
19 Ajuga reptans
20 Alisma
plantago-aquatica
21 Alliaria petiolata
22 Allium oleraceum
23 Allium vineale
24 Alnus glutinosa
25 Alnus incana
26 Alopeturus geniculatus
27 Alopeturus pratensis
28 Amaranthus retroflexus
29 Anagalis arvensis
30 Anchusa arvensis
31 Anchusa officinalis
32 Anemone nemorosa
33 Anemone
ranunculoides
34 Angelica sylvestris
35 Anthemis arvensis
36 Anthemis cotula
37 Anthemis tinctoria
38 Anthoxanthum
odoratum
39 Anthriscus sylvestris
40 Apera spica-venti
41 Aphanes arvensis
42 Aquilegia vulgaris
43 Arabidopsis thaliana
44 Arctium lappa
45 Arctium minus
46 Arctium tomentosum
47 Arenaria serpyllifolia
48 Armeria maritima
49 Armoracia rusticana
50 Arrhenatherum elatius
51 Artemisia absinthium
52 Artemisia campestris
53 Artemisia vulgaris
54 Asparagus officinalis
55 Astragalus glycyphyllos
56 Athyrium filix-femina
57 Atriplex patula
58 Atriplex prostrata
59 Ballota nigra
60 Batrachium circinatum
61 Bellis perennis
62 Berberis vulgaris
63 Berteroa incana
64 Berula erecta
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
Betula pendula
Betula pubescens
Bromus arvensis
Bromus erectus
Bromus hordeaceus
Bromus sterilis
Bromus tectorum
Calamagrostis
canescens
Calamagrostis epigejos
Calla palustris
Calluna vulgaris
Caltha palustris
Calystegia sepium
Camelina microcarpa
Campanula patula
Campanula persicifolia
Campanula
rapunculoides
Campanula
rotundifolia
Campanula trachelium
Capsella
bursa-pastoris
Cardamine amara
Cardamine pratensis
Cardaminopsis arenosa
Carduus acanthoides
Carduus crispus
Carex arenaria
Carex gracilis
Carex hirta
Carex lasiocarpa
Carex nigra
Carex pseudocyperus
65
Wstępne wyniki badań flory...
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
Carex remota
Carex vulpina
Carpinus betulus
Centaurea cyanus
Centaurea jacea
Centaurea scabiosa
Centaurea stoebe
Centaurium erythraea
Cerastium arvense
Cerastium caespitosum
Chaerophyllum
temulum
Chamaenerion
angustifolium
Chamomilla recutita
Chamomilla suaveolens
Chelidonium majus
Chenopodium album
Chrysosplenium
alternifolium
Cichorium intybus
Cicuta virosa
Circaea lutetiana
Cirsium arvense
Cirsium palustre
Cirsium vulgare
Comarum palustre
Convallaria majalis
Convolvulus arvensis
Conyza canadensis
Cornus sanguinea
Coronilla varia
Corylus avellana
Corynephorus
canescens
Crataegus monogyna
Crepis biennis
Crepis paludosa
Crepis setosa
Crepis tectorum
Cuscuta europaea
133 Dactylis glomerata
134 Daucus carota
135 Deschampsia
caespitosa
136 Deschampsia flexuosa
137 Descurainia sophia
138 Dianthus deltoides
139 Digitalis purpurea
140 Dryopteris filix-mas
141 Echinochloa crus-galli
142 Echinops
sphaerocephalus
143 Echium vulgare
144 Eleocharis palustris
145 Epilobium hirsutum
146 Epilobium montanum
147 Epilobium parviflorum
148 Epipactis helleborine
149 Equisetum arvense
150 Equisetum fluviatile
151 Equisetum hyemale
152 Equisetum palustre
153 Equisetum pratense
154 Erigeron acris
155 Erigeron annuus
156 Eriophorum
angustifolium
157 Erodium cicutarium
158 Erophila verna
159 Euonymus europaeus
160 Euphorbia cyparissias
161 Euphorbia helioscopia
162 Euphorbia peplus
163 Fagus sylvatica
164 Fallopia convolvulus
165 Festuca ovina
166 Festuca pratensis
167 Ficaria verna
168 Filago arvensis
169 Filago minima
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
Filipendula ulmaria
Fragaria vesca
Frangula alnus
Fraxinus excelsior
Fumaria officinalis
Gagea lutea
Galeobdolon luteum
Galeopsis bifida
Galeopsis speciosa
Galeopsis tetrahit
Galinsoga ciliata
Galinsoga parviflora
Galium aparine
Galium mollugo
Galium odoratum
Galium palustre
Galium uliginosum
Galium verum
Genista tinctoria
Geranium molle
Geranium palustre
Geranium pratense
Geranium pusillum
Geranium robertianum
Geum rivale
Geum urbanum
Glechoma hederacea
Glyceria fluitans
Glyceria maxima
Gnaphalium
uliginosum
Gymnocarpium
dryopteris
Hedera helix
Helichrysum arenarium
Hepatica nobilis
Heracleum
sphondylium
Hieracium lachenalii
Hieracium laevigatum
66
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
Karolina Konopska
Hieracium murorum
Hieracium pilosella
Holcus lanatus
Holcus mollis
Hottonia palustris
Humulus lupulus
Hydrocharis
morsus-ranae
Hypericum perforatum
Hypericum tetrapterum
Hypochoeris glabra
Hypochoeris radicata
Impatiens noli-tangere
Impatiens parviflora
Iris pseudacorus
Jasione montana
Juncus bufonius
Juncus conglomeratus
Juncus effusus
Juncus inflexus
Knautia arvensis
Lactuca serriola
Lamium album
Lamium amplexicaule
Lamium maculatum
Lamium purpureum
Lapsana communis
Larix decidua
Lathyrus palustris
Lathyrus pratensis
Lathyrus sativus
Lathyrus sylvestris
Lemna minor
Lemna trisulca
Leontodon autumnalis
Lepidium ruderale
Leucanthemum vulgare
Ligustrum vulgare
Linaria vulgaris
Lithospermum arvense
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
Lolium multiflorum
Lolium perenne
Lotus corniculatus
Lupinus polyphyllus
Luzula multiflora
Luzula pilosa
Lychnis flos-cuculi
Lycopus europaeus
Lysimachia nemorum
Lysimachia
nummularia
Lysimachia vulgaris
Lythrum salicaria
Maianthemum bifolium
Malus domestica
Malus sylvestris
Malva alcea
Malva neglecta
Malva pusilla
Malva sylvestris
Matricaria maritima
Medicago falcata
Medicago lupulina
Medicago sativa
Melampyrum pratense
Melandrium album
Melica nutans
Melilotus alba
Melilotus officinalis
Mentha aquatica
Mentha arvensis
Menyanthes trifoliata
Milium effusum
Moehringia trinervia
Molinia coerulea
Mycelis muralis
Myosotis arvensis
Myosotis palustris
Myosotis stricta
Myosotis sylvatica
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
Myosoton aquaticum
Nardus stricta
Nuphar lutea
Nymphaea alba
Oenanthe aquatica
Oenothera biennis
Oenothera rubricaulis
Ononis spinosa
Ornithogalum
umbellatum
Oxalis acetosella
Oxalis stricta
Padus avium
Papaver argemone
Papaver dubium
Papaver rhoeas
Petasites hybridus
Peucedanum
oreoselinum
Peucedanum palustre
Phacelia tanacetifolia
Phalaris arundinacea
Philadelphus
coronarius
Phleum pratense
Phragmites australis
Picea abies
Pimpinella saxifraga
Pinus sylvestris
Plantago lanceolata
Plantago major
Plantago media
Poa annua
Poa nemoralis
Poa palustris
Poa pratensis
Poa trivialis
Polygonatum
multiflorum
Polygonum amphibium
Polygonum aviculare
67
Wstępne wyniki badań flory...
322 Polygonum bistorta
323 Polygonum hydropiper
324 Polygonum
lapathifolium
325 Polygonum persicaria
326 Polypodium vulgare
327 Populus alba
328 Populus nigra
329 Populus tremula
330 Potamogeton natans
331 Potentilla anserina
332 Potentilla arenaria
333 Potentilla argentea
334 Potentilla erecta
335 Potentilla reptans
336 Prunella vulgaris
337 Prunus cerasus
338 Prunus domestica
339 Prunus spinosa
340 Pteridium aquilinum
341 Pyrus communis
342 Quercus petraea
343 Quercus robur
344 Quercus rubra
345 Ranunculus acris
346 Ranunculus arvensis
347 Ranunculus bulbosus
348 Ranunculus
lanuginosus
349 Ranunculus repens
350 Ranunculus sceleratus
351 Raphanus
raphanistrum
352 Reseda lutea
353 Reseda luteola
354 Rhamnus catharticus
355 Ribes nigrum
356 Ribes spicatum
357 Ribes uva-crispa
358 Robinia pseudoacacia
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
Rorippa amphibia
Rorippa palustris
Rosa canina
Rosa rugosa
Rubus caesius
Rubus idaeus
Rubus plicatus
Rumex acetosa
Rumex acetosella
Rumex crispus
Rumex hydrolapathum
Rumex obtusifolius
Salix alba
Salix caprea
Salix cinerea
Salix fragilis
Salix viminalis
Sambucus nigra
Sambucus racemosa
Saponaria officinalis
Sarothamnus scoparius
Schoenoplectus
lacustris
Scirpus sylvaticus
Scleranthus annuus
Scutellaria galericulata
Sedum acre
Sedum maximum
Senecio congestus
Senecio jacobaea
Senecio vernalis
Senecio viscosus
Senecio vulgaris
Setaria viridis
Silene vulgaris
Sinapis arvensis
Sisymbrium loeseli
Sisymbrium officinale
Sium latifolium
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
Solanum dulcamara
Solidago canadensis
Solidago gigantea
Solidago virgaurea
Sonchus arvensis
Sonchus oleraceus
Sorbus aucuparia
Sparganium erectum
Spergula arvensis
Spergularia rubra
Spirodela polyrhiza
Stachys palustris
Stachys sylvatica
Stellaria graminea
Stellaria holostea
Stellaria media
Stellaria nemorum
Stellaria palustris
Symphoricarpos albus
Symphytum officinale
Symphytum tuberosum
Syringa vulgaris
Tanacetum vulgare
Taraxacum officinale
Teesdalea nudicaulis
Thelypteris palustris
Thlaspi arvense
Thymus serpyllum
Tilia cordata
Tilia platyphyllos
Torilis japonica
Tragopogon pratensis
Trientalis europaea
Trifolium arvense
Trifolium campestre
Trifolium dubium
Trifolium hybridum
Trifolium medium
Trifolium pratense
68
436
437
438
439
440
441
442
443
444
445
446
447
448
449
Karolina Konopska
Trifolium repens
Tunica prolifera
Tussilago farfara
Typha angustifolia
Typha latifolia
Ulmus glabra
Ulmus laevis
Urtica dioica
Urtica urens
Vaccinium myrtillus
Valeriana officinalis
Verbascum nigrum
Verbascum phlomoides
Veronica arvensis
450
451
452
453
454
455
456
457
458
459
460
461
462
Veronica beccabunga
Veronica chamaedrys
Veronica hederifolia
Veronica longifolia
Veronica officinalis
Veronica persica
Veronica pollita
Veronica serpyllifolia
Viburnum opulus
Vicia angustifolia
Vicia cracca
Vicia dumetorum
Vicia grandiflora
463
464
465
466
467
468
469
470
471
472
473
474
Vicia hirsuta
Vicia sepium
Vicia tetrasperma
Vicia villosa
Vinca minor
Viola arvensis
Viola canina
Viola odorata
Viola reichenbachiana
Viola riviniana
Viola tricolor
Viscum album
BIBLIOGRAFIA
Bacieczko W., 1984: Rośliny rzadkie i chronione w szacie roślinnej stawów wiejskich
na Pomorzu Szczecińskim. Zeszyty Naukowe Akademii Rolniczej w Szczecinie, 107,
t. 34, s. 3–8.
Bacieczko W., Małycha E., 2004: Flora naczyniowa Maszewa na tle warunków siedliskowych i oddziaływań antropogenicznych. Acta Sci. Pol., Biologia, 3 (1), s. 3–26.
Banaś U., Wołejko L., Bacieczko W., 2000: Rzadkie i chronione gatunki roślin naczyniowych gminy i miasta Stargard Szczeciński. Folia Univ. Agric. Stetin. 213 Agricultura,
85, s. 43–58.
Borówka R. (red.), 2003: Przyroda Pomorza Zachodniego, Wydawnictwo Oficyna
InPlus.
Bosiacka B., Pieńkowski P., 2004: Analiza przekształceń oczek wodnych oraz ocena
walorów przyrodniczych śródpolnych zbiorników w centralnej części Równiny
Nowogardzkiej. Woda – Środowisko – Obszary Wiejskie, t. 4, z. 2a (11), s. 335–
349.
Chmiel J., 1993: Flora roślin naczyniowych wschodniej części Pojezierza Gnieźnieńskiego
i jej antropogeniczne przeobrażenia w XIX i XX wieku. Pr. Zakł. Takson. Rośl. UAM,
1, 2.
Ciaciura M., 2005: Rozmieszczenie Lathyrus palustris L. (Fabaceae) na Pomorzu Zachodnim. Badania Fizjograficzne nad Polską Zachodnią, Ser. B Bot., 54, s. 105–112.
Wstępne wyniki badań flory...
69
Ciaciura M., Wilhelm M., Michałek M., 2007: Bibliografia roślin naczyniowych Pomorza
Zachodniego. Instytut Botaniki im. W. Szafera, PAN, Kraków.
Ćwikliński E., 1974: Flora i zbiorowiska roślinne terenów kolejowych województwa
szczecińskiego. Rozpr. AR Szczecin, 1.
Ćwikliński E., 1969: Notatki florystyczne z województwa szczecińskiego. Badania
Fizjograficzne nad Polską Zachodnią, Ser. B Biol., 23, s. 261–263.
Ćwikliński E., 1981: Notatki florystyczne z województwa szczecińskiego. Cz. III. Badania
Fizjograficzne nad Polską Zachodnią, Ser. B Bot., 32, s. 213–219.
Dzwonko Z., 2007: Przewodnik do badań fitosocjologicznych. Poznań–Kraków.
Jasnowski M., 1962: Budowa i roślinność torfowisk Pomorza Szczecińskiego. Szcz. Tow.
Nauk., Wydz. Nauk Przyr.-Rol., 10, s. 1–340.
Kochanowska R., Rygielski T., 1996: Zróżnicowanie mokradeł Pomorza Zachodniego.
Zeszyty Naukowe Akademii Rolniczej w Szczecinie, Ser. Przyrodnicza 173, 6,
s. 25–30.
Kondracki J., 2000: Geografia regionalna Polski. PWN, Warszawa.
Kornaś J., 1968: Geograficzno-historyczna klasyfikacja roślin synantropijnych. Materiały
Zakładu Fitosocjologii Stosowanej Uniwersytetu Warszawskiego, 25, s. 33–41.
Kornaś J., Medwecka-Kornaś A., 2002: Geografia roślin. Wyd. II. PWN, Warszawa.
Leśniak T., 2002: Materiały pomocnicze do terenowych zajęć geologicznych w rejonie
nadmorskim. Uczelniane Wydawnictwa Naukowowo-Dydaktyczne, Kraków.
Mirek Z., Piękoś-Mirkowa H., Zając A., Zając M., 2002: Vascular plants of Poland.
A checklist, Kraków.
M. Podgórska, 2008: Zagadnienia fitogeograficzne i flora naczyniowa Garbu
Gielniowskiego. Kraków.
Rothmaler W., 2000: Exkursionsflora von Deutschland, t. 3. Gefäßpflanzen: Atlasband.
Spektrum Akademischer Verlag, Heidelberg–Berlin.
Rozporządzenie Ministra Środowiska z dnia 9 lipca 2004 r. w sprawie gatunków dziko
występujących roślin objętych ochroną (DzU z 2004 r., nr 168, poz. 1764).
Rutkowski L., 2007: Klucz do oznaczania roślin naczyniowych Polski niżowej. PWN,
Warszawa.
Szafer W., Kulczyński S., Pawłowski B., 1986: Rośliny polskie, cz. I i II. Wyd. V. PWN,
Warszawa.
Waloryzacja przyrodnicza Gminy Maszewo. (Operat generalny), 2001: Biuro Konserwacji
Przyrody w Szczecinie, Szczecin.
70
Karolina Konopska
Waloryzacja przyrodnicza Gminy Osina. (Operat generalny), 1998: Biuro Konserwacji
Przyrody w Szczecinie, Szczecin.
Woś A., 1999: Klimat Polski. PWN, Warszawa.
Zając A., Zając M., 2001: Atlas rozmieszczenia roślin naczyniowych w Polsce. –
Distribution Atlas of Vascular Plants in Poland. Nakładem Pracowni Chorologii
Komputerowej Instytutu Botaniki Uniwersytetu Jagiellońskiego, Kraków.
Zarzycki K., Trzcińska-Tacik H., Szeląg Z., Wołek J., Korzeniak U., 2002: Ekologiczne
liczby wskaźnikowe roślin naczyniowych Polski. Inst. Bot. PAN, Kraków.
Ziarnek K., Ziarnek M., Wołłejko L., 2003: Bibliografia botaniczna Pomorza. Rośliny
naczyniowe i ochrona przyrody. Publikacje z lat 1945–2000. Szczecin.
VASCULAR PLANT FLORA OF THE RÓWNINA NOWOGARDZKA REGION
(NW POLAND) – PRELIMINARY RESULTS
Summary
Typically agricultural landscape of the Równina Nowogardzka region was investigated. In vegetative season 2008, 474 vascular plant species were recorded, representing
82 families mainly: Asteraceae (64 sp.), Poaceae (42 sp.), Fabaceae (31 sp.), Rosaceae
(25 sp.). Hemicryptophytes and therophytes are dominated. 19 protected species were
recorded there are: Vinca minor, Hedera helix, Menyanthes trifoliata, Nuphar lutea,
Nymphaea alba, Frangula alnus, Aquilegia vulgaris, Galium odoratum, Ribes nigrum,
Ornithogalum umbellatum, Convallaria majalis, Polypodium vulgare, Helichrysum arenarium, Hepatica nobilis, Epipactis helleborine, Centaurium erythraea, Carex arenaria,
Ononis spinosa, Viburnum opulus.
Translated by Karolina Konopska
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
MAŁGORZATA PAJĄK
EWA KĘPCZYŃSKA
Uniwersytet Szczeciński
WPŁYW KWASU β-AMINOMASŁOWEGO NA WZROST GRZYBNI
ORAZ AKTYWNOŚĆ ENDOGLUKANAZ U
FUSARIUM OXYSPORUM F. SP. LYCOPERSICI
The Effect of β-aminobutyric Acid on the Growth of Mycelium
and the Activity of Endoglucanases of Fusarium oxysporum f. sp. lycopersici
Słowa kluczowe: rozwój grzybni, aktywność endoglukanaz
Key words: fungal development, endoglucanase activity
1. Wstęp
Grzyby z rodzaju Fusarium są pasożytami polifagicznymi porażającymi wiele gatunków roślin, powodując różne choroby (np. zgorzel siewek, pleśń śniegową, więdnięcie fuzaryjne), oraz produkującymi niebezpieczne dla zdrowia ludzi
i zwierząt mykotoksyny (np. zearalenon, fumonizyny i trichoteceny) (Chełkowski i in., 1991). Podczas patogenezy wytwarzają liczne enzymy, m.in. endoglukanazy, które rozkładają elementy ściany komórkowej gospodarza, umożliwiając
penetrację do wnętrza rośliny. Endoglukanazy rozkładają łańcuch celulozowy
na celulosacharydy, powodują także rozkład ksyloglukanu do oligosacharydów
(De Vries i Visser 2001).
Kwas β-aminomasłowy (BABA) indukuje odporność przeciwko szerokiemu spektrum patogenów, tj. grzybom, wirusom, bakteriom i nicieniom, wykazując duży zasięg aktywności (Baider i in., 1999). Większość badań opisujących
72
Małgorzata Pająk, Ewa Kępczyńska
fenomen indukcji odporności przez BABA było przeprowadzanych na roślinach
jednorocznych, takich jak Arabidopsis, bawełna, kalafior i słonecznik. Zajmowano się gatunkami należącymi do rodziny Solanaceace (pomidory, ziemniaki)
oraz Cucurbitaceae (tytoń, pieprz, ogórki i melony). BABA może też indukować
odporność w roślinach zdrewniałych, takich jak np. winorośl.
Sposób działania BABA podczas indukcji odporności roślin nie jest w pełni wyjaśniony. Prawdopodobnie działa on poprzez aktywację kumulacji białek
związanych z patogenezą (PR). Dla przykładu, BABA indukuje kumulację białka
PR-1a, enzymu chitynazy oraz β-1,3-glukanazy w pieprzu, pomidorze i tytoniu
(Baider i in., 1999). Z drugiej strony, chociaż BABA indukuje odporność np.
u kalafiora, Arabidopsis, nie przyczynia się do kumulacji białek (PR). A zatem
aktywacja kumulacji powyższych białek nie jest jedyną drogą działania kwasu
β-aminomasłowego (Cohen 2002).
Celem pracy było sprawdzenie wpływu kwasu β-aminomasłowego na aktywność endoglukanaz (endo-β-1,4-glukanazy i β-1,3-glukanazy) u Fusarium
oxysporum f. sp. lycopersici.
2. Materiały i metody
2.1. Materiał biologiczny
Materiałem biologicznym wykorzystanym do badań były:
– nasiona pomidora (Lycopersicon esculentum Mill) odmiany Beta,
– grzyb wyizolowany z nasion pomidora Fusarium oxysporum f. sp. lycopersici.
Aby sprawdzić wpływ BABA na wzrost grzybni oraz wydzielanie i aktywność endoglukanaz, do kultur grzybowych w płynnej pożywce Czapka dodano
odpowiednią objętość roztworu BABA. W ten sposób uzyskano pożądane stężenia (0,01 mM; 0,1 mM; 1 mM). Kultury zakładano z zachowaniem warunków
sterylności, w komorze z laminarnym przepływem powietrza. Wszystkie warianty wykonano w trzech powtórzeniach. Próby o objętości 1 ml pobierano co
24 godziny, filtrowano za pomocą filtrów Milipore 0,22 μm i zamrażano w ciekłym azocie, a następnie przechowywano w –80°C.
Wpływ kwasu ß-aminomasłowego...
73
Dynamika wzrostu grzybni
W celu określenia wpływu BABA na dynamikę wzrostu grzybni w warunkach in vitro prowadzono hodowlę kultur grzybowych na pożywce stałej PDA
o pH 6,0 z różnymi stężeniami BABA przez 7 dni. Co 24 h mierzono średnicę
grzybni. Wszystkie doświadczenia wykonano w trzech powtórzeniach.
Oznaczanie suchej masy grzybni
Dla określenia wpływu BABA na wzrost grzybni w warunkach in vitro mierzono suchą masę grzybni po 7 dniu płynnych hodowli kultur grzybowych w pożywce Czapka z odpowiednimi stężeniami BABA. Przesączano przez wysuszone
i zważone sączki bibułowe pożywkę wraz z grzybnią z wykorzystaniem lejka
Buchnera. Następnie sączki z grzybnią umieszczono w suszarce w temp. 74°C
na 24 godziny. Po tym czasie zważono sączki i obliczano suchą masę grzybni.
Aktywność endo-β-1,4-glukanazy
Aktywność endo-β-1,4-glukanazy określano za pomocą metody PAH-BAH
(Lever 1972). Próby inkubowano wraz z substratem – ksyloglukanem, po czym
przeprowadzano reakcję PAH-BAH w celu określenia aktywności hydrolitycznej
enzymu w stosunku do ksyloglukanu.
Aktywność β-1,3-glukanazy
Aby określić aktywności β-1,3-glukanazy, zastosowano metodę kolorymetryczną z wykorzystaniem laminaryny wg (Velazhahan 2004). Próby inkubowano wraz z substratem – laminaryną, a następnie przeprowadzano reakcję
z mieszaniną DNS w celu określenia aktywności hydrolitycznej enzymu w stosunku do laminaryny.
Analiza wyników
Wyniki uzyskane we wszystkich doświadczeniach poddano analizie statystycznej, wykorzystując program Microsoft Excel.
74
Małgorzata Pająk, Ewa Kępczyńska
3. Wyniki badań i dyskusja
3.1. Wpływ BABA na dynamikę wzrostu grzybni
Dynamika wzrostu grzybni [cm]
Kwas β-aminomasłowy działa hamująco na rozwój grzybni w warunkach
in vitro. Inhibicyjny wpływ BABA zaobserwowano od drugiego dnia trwania
hodowli (rys. 1).
10
BABA, mM
8
6
4
0
0,01
0,1
1
2
0
1
2
3
4
Czas hodowli [DzieĔ]
5
6
7
Rys. 1. Wpływ BABA na dynamikę wzrostu F. oxysporum na stałej pożywce PDA
Fig. 1. The influence of BABA on the growth dynamics of F. oxysporum on the solid
PDA medium
BABA efektywnie ogranicza rozwój grzybni Fusarium oxysporum. Podobne wnioski wynikały z pracy nad Penicillum digitatum u grejpfruta prowadzonych przez zespół Cohen i wsp. (2003). Porównywalne wyniki uzyskano także
w badaniach nad Plasmopara viticola u winorośli według Baider i in. (1999).
3.2. Wpływ BABA na masę grzybni
Kwas β-aminomasłowy ma hamujący wpływ na wzrost grzybni kultur
płynnych w pożywce Czapka w warunkach in vitro. Minimalny wpływ na rozwój grzybni miał BABA o stężeniu 0,01 mM. Natomiast sucha masa grzybni F.
oxysporum, hodowana w obecności 1 mM BABA, była dwukrotnie niższa niż
w kontroli (rys. 2).
75
Sucha masa grzybni [mg]
Wpływ kwasu ß-aminomasłowego...
40
30
20
10
0
0
0,01
0,1
1
BABA [mM]
Rys. 2. Wpływ BABA na wzrost F. oxysporum w pożywce płynnej Czapka w 7 dniu hodowli in vitro
Fig. 2. The influence of BABA on the growth of F. oxysporum on the Czapka liquid
medium in 7th day of in vitro culture
3.3. Aktywność endo-β-1,4-glukanazy w kulturach Fusarium oxysporum
AktywnoĞü endo-beta-1,4-glukanazy
[U/mg biaáka]
BABA obecny w płynnej pożywce stymulował aktywność endo-β-1,4-glukanazy (rys. 3). Aktywność ta rosła zwłaszcza w obecności 1 mM BABA. Już
w drugiej dobie była dziesięciokrotnie większa w porównaniu z kontrolą i w piątym dniu osiągnęła maksymalną wartość (2,23 U/mg białka).
Zaobserwowano, że im wyższe jest stężenie BABA, tym większa jest również aktywność endo-β-1,4-glukanazy w kulturach grzybowych.
2,5
2
1,5
1
BABA, mM
0
0,01
0,1
1
0,5
0
0
1
2
3
4
5
6
Czas hodowli [DzieĔ]
Rys. 3. Wpływ BABA na aktywność endo-β-1,4-glukanazy F. oxysporum w zależności
od wieku kultury
Fig. 3. The influence of BABA on the endo-β-1,4-glucanase activity F. oxysporum
in relation to the age of the culture
76
Małgorzata Pająk, Ewa Kępczyńska
3.4. Aktywność β-1,3-glukanazy w kulturach Fusarium oxysporum
AktywnoĞü beta-1,3-glukozaminy
[U/mg biaáka]
BABA stymulował aktywność β-1,3-glukanazy w płynnej pożywce Czapka.
Do 3. doby zaobserwowano niewielki wzrost aktywności glukanazy, po czym
w 4. dniu nastąpił jej gwałtowny wzrost, osiągając najwyższą wartość, szczególnie w obecności 0,1 mM BABA, 0,425 U/mg białka (rys. 4).
BABA zwiększa aktywność β-1,3-glukanazy w kulturach F. oxysporum.
Podobne wyniki uzyskali Zimmerli i in. (2001), którzy zaobserwowali, że na
skutek porażenia patogenami grzybowymi w roślinach gromadzi się ten enzym
oraz białka PR.
0,5
0,4
BABA, mM
0,3
0,2
0
0,01
0,1
1
0,1
0
0
1
2
3
4
5
6
Czas hodowli [DzieĔ]
Rys. 4. Wpływ BABA na aktywność β-1,3-glukanazy F. oxysporum w zależności od wieku kultury
Fig. 4. The influence of BABA on the endo-β-1,3-glucanase activity F. oxysporum
in relation to the age of the culture
4. Wnioski
Na podstawie przeprowadzonych badań można stwierdzić, że BABA jest
inhibitorem rozwoju grzybni F. oxysporum w warunkach in vitro. Im wyższe stężenie BABA, tym większe jest zahamowanie rozwoju. BABA ogranicza rozwój
grzyba, ale równocześnie zwiększa aktywność endo-β-1,4-glukanazy i β-1,3-glukanazy, które biorą istotny udział we wnikaniu do tkanek gospodarza, rozkładając
cukrowe elementy ściany komórkowej. Aby określić, czy kwas β-aminomasłowy
można wykorzystywać do indukcji odporności, w kolejnych badaniach należało-
Wpływ kwasu ß-aminomasłowego...
77
by sprawdzić, jakie enzymy i mechanizmy odpornościowe aktywuje w roślinie
w celu podniesienia odporności przeciw badanemu patogenowi.
BIBLIOGRAFIA
Baider A., Cohen Y., Reuveni M., 1999: Local and systemic activity of BABA (DL-3-aminobutric acid) against Plasmopara viticola in grapevines. Europ. J. Plant Pathol.,
105, s. 351–361.
Chełkowski J., Kwaśna H., Zajkowski P., 1991: Grzyby (Mycota), T. XXII. Polska
Akademia Nauk, Kraków.
Cohen L., Daus A., Droby S., Goldschmidt E., Porat R., Vinokur V., Weiss B., 2003:
Induction of resistanse to Penicillium digitatum in grapefruit by β-aminobutric acid.
Europ. J. Plant Pathol., 109, s. 901–907.
Cohen Y., 2002: β-aminobutric acid – induced resistance against plant pathogens. Plant
Dies., 86 (5), s. 448–458.
De Vries R.,Visser J., 2001: Aspergillus enzymes involved in degradation of plant cell
wall polysaccharides. Mikrob. Molecul. Biol. Rev., 65.4, s. 497–522.
Lever M., 1972: A new reaction for colorymetric determination of carbohydrates. Anal.
Biochem., 47, s. 273–279.
Velazhahan R., 2004: Induction of early blight resistanse in tomato by Quercus infectoria
Gall extrack in association of phenolics and defense-related enzyme. APP, 26.3.
Zimmerli L., Cottier V., Jakab G., Mauch-Mani B., Métraux J., Rigoli G., Toquin V.,
2001: β-Aminobutric acid- inducend resistanse in plants. Europ. J. Plant Pathol., 107,
s. 29–37.
THE EFFECT OF Β-AMINOBUTYRIC ACID ON THE GROWTH
OF MYCELIUM AND THE ACTIVITY OF ENDOGLUCANASES
OF FUSARIUM OXYSPORUM F. SP. LYCOPERSICI
Summary
The β-aminobutyric acid (BABA, DL-3-amino-n-butyric acid) induces the resistance directed at the wide spectrum of pathogens, which is fungi, viruses, bacteria and
nematodes. It’s common usage as an alternative to fungicides usage will be available
78
Małgorzata Pająk, Ewa Kępczyńska
after precise knowledge of mechanisms during the plant – microorganism interactions.
The preliminary results of the studies whose aim was to answer the question if BABA
can have influence on the activity of cellulolytic enzymes of Fusarium oxysporum f. sp.
lycopersici are provided in this paper.
Translated by Ewa Kępczyńska
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
IZABELA PASIECZNIK
AGNIESZKA POPIELA
Uniwersytet Szczeciński
MATERIAŁY DO FLORY POJEZIERZA MYŚLIBORSKIEGO
(NW POLSKA): DZIKOWO I OKOLICE
Data re the vascular flora of the Pojezierze Myśliborskie Lakeland
(NW Poland): the neighbourhood of Dzikowo
Słowa kluczowe: Pomorze, stanowiska roślin naczyniowych, mapa, chorologia
Key words: Pomerania, sites of vascular flora, map, chorology
1. Wstęp
Północno-zachodnia Polska należy do terenów niezbyt dobrze zbadanych
pod względem florystycznym. Istnieje wprawdzie szereg opublikowanych
opracowań poświęconych florze i roślinności miejsc szczególnie interesujących
bądź też terenów chronionych (por. Ziarnek i in. 2003), brakuje jednak kompleksowych prac dotyczących flory naczyniowej Pomorza Zachodniego, zawierających zarówno historyczne jak i współczesne dane florystyczne. Do wyjątków
należą flory roślin naczyniowych m.in. Wolina i Uznamu (Piotrowska 1966),
Wyspy Chrząszczewskiej (Ćwikliński 1988), Zaodrza (Zając i in. 1993) czy fragmentów pojezierzy zachodniopomorskich (Więcław 2002, Myśliwy 2004).
Dzikowo jest małą miejscowością w zachodniej części gminy Barlinek, na
wschodnich peryferiach Pojezierza Myśliborskiego. Jest to teren bardzo słabo
poznany pod względem florystycznym. Poza danymi syntetycznymi zawartymi na mapach ATPOL (Zając, Zając 2001) opublikowano wyłącznie dendroflo-
80
Izabela Pasiecznik, Agnieszka Popiela
rę parków podworskich (Bacieczko i in. 2000). Przed II wojną światową pojedyncze daty florystyczne z tego obszaru publikowal Libbert (1932), jednak nie
z bezpośrednich okolic Dzikowa.
Celem niniejszych badań było zebranie danych florystycznych z Dzikowa
i najbliższej okolicy, a zarazem uzupełnienie materiałów do przygotowywanego
opracowania flory naczyniowej wschodniej części Pojezierza Myśliborskiego.
2. Teren i metoda badań
Badany teren pod względem fizyczno-geograficznym należy do prowincji
Niżu Środkowoeuropejskiego, prowincji Pojezierze Południowobałtyckie i mezoregionu Pojezierze Myśliborskie (Kondracki 2000). Obejmuje obszar w okolicach miejscowości Dzikowo, Dzikówko, Strąpie i Pustać, położonych w rolniczym terenie w zachodniej części gminy Barlinek. Współczesny obraz ukształtowania powierzchni zarówno terenu gminy jak i terenów sąsiednich powstał
przede wszystkim pod wpływem działalności lądolodów trzech zlodowaceń,
jednak znaczenie modelujące przypisuje się procesowi deglacjacji ostatniego
zlodowacenia, a szczególnie deglacjacji lądolodu fazy pomorskiej. Na badanym
terenie dominują gleby brunatne i bielicowe, wykształcone głównie z materiałów
morenowych (por. Borówka i in. 2002). Największą powierzchnię zajmują pola
uprawne, natomiast na południe od Dzikowa rozciąga się kompleks mieszanych
lasów sosnowo-dębowych, miejscami z licznymi śródleśnymi oczkami wodnymi.
Dzikowo to niewielka wieś położona w odległości 4,5 km na południowy
zachód od Barlinka, zamieszkana przez kilkadziesiąt osób. Zachodni fragment
wsi zajmuje zaniedbany teren pałacowo-parkowy, w granicach którego znajdują
się budynki mieszkalne i dawny cmentarz. Strąpie jest małą osadą rolniczą leżącą w odległości 4 km w kierunku północnym od Dzikowa, nad jeziorem Trojak,
składającym się z trzech basenów połączonych ze sobą wąskimi przesmykami.
Na terenie wsi znajduje się park, dobrze utrzymany i pielęgnowany, ze stawem
wokół którego rosną pojedyncze stare drzewa iglaste. Poza wsią Dzikowo i Strąpie badaniami objęto także Pustać i Dzikówko. Są to małe wioski usytuowane
wśród pól uprawnych.
Badania terenowe prowadzone były w miesiącach letnich 2007 roku.
Wykorzystano w nich kartowanie gatunków metodą kartogramu przyjętą dla
ATPOL. Zgodnie z tą metodyką teren badań wpisuje się w pola: AC26, AC27,
Materiały do flory Pojezierza Myśliborskiego...
81
AC36 i AC37, które dla celów niniejszej pracy zostały podzielone na cztery
mniejsze kwadraty, oznaczone kolejno: 00, 01, 10, 11 (rys. 1). Nazewnictwo
gatunków przyjęto za Mirkiem i in. (2002). Rodziny, a także gatunki roślin
w rodzinach ułożono w porządku alfabetycznym. Gwiazdką [*] zaznaczono antropofity (za: Zając, Zając 2001).
Rys. 1. Lokalizacja terenu badań na tle siatki ATPOL
Fig. 1. Localization of investigated area
82
Izabela Pasiecznik, Agnieszka Popiela
3. Wykaz stanowisk
Alismataceae:
Alisma plantago aquatica L. – AC2611: jezioro w parku w Strąpiu; AC3601:
jezioro w parku w Dzikowie, jezioro Nierybno; AC3601: oczko wodne na
polu we wsi Pustać; AC3700: jezioro w lesie w Dzikowie, oczko wodne na
polu we wsi Dzikówko.
Amaranthaceae:
* Amaranthus retroflexus L. – AC3601: park w Dzikowie przy drodze na Swadzim.
Amarylidaceae:
* Galanthus nivalis L. – AC3601: las w Dzikowie przy jeziorze.
Apiaceae:
Aegopodium podagraria L. – AC2611: park w Strąpiu, las w stronę Swadzimia; AC3601: na przydrożach w Dzikowie; AC3700: przy drodze Strąpie
– Ożar.
Angelica sylvestris L. – AC3601: na łące przy lesie w stronę Swadzimia.
Anthriscus sylvestris (L.) Hoffm. – AC2611: Strąpie; AC2710: w pobliżu jeziora
Mostkowo; AC3601: Pustać; AC3700: przy drodze Strąpie – Ożar.
Daucus carota L. – AC2611: park w Strąpiu; AC3601: przy drodze na Pustać;
AC3700: przy drodze Strąpie – Ożar.
Heracleum sphondylium L. – AC2611, Strąpie, park; AC2710: w pobliżu jeziora
Mostkowo; AC3601: skraj lasu przy drodze do Rychnowa; AC3700: w lesie
w pobliżu drogi Rychnów – Barlinek.
Oenanthe aquatica (L.) Poiret. – AC2611: oczko wodne w lesie w kierunku Swadzimia.
Sium latifolium L. – AC3700: Dzikowo w lesie w pobliżu jeziora.
Araceae:
* Acorus calamus L. – AC2611: park w Strąpiu.
Araliaceae:
Hedera helix L. – AC2611: las w stronę Swadzimia; AC3701: las w Dzikowie.
* Heracleum sosnowskyi Manden. – AC3700: przy jeziorze Nierybno.
Asteraceae:
Achillea millefolium L. – AC2611: przy drodze do lasu w stronę Swadzimia;
AC2710: przy polach w pobliżu jeziora Moskowo; AC3601: przy drodze na
Pustać; AC3700: przydroża w okolicy Dzikówka.
Materiały do flory Pojezierza Myśliborskiego...
83
* Agrostemma githago L. – AC3601: ugór przy drodze w stronę Strąpia.
Anthemis tinctoria L. – AC2611: przy polach uprawnych w pobliżu lasu w stronę
Swadzimia; AC2710: przy polach w pobliżu jeziora Moskowo; AC3601:
przy drodze Dzikowo – Wiewiórki, ugór przy drodze w stronę Strąpia;
AC3700: przy polach w pobliżu Dzikówka.
Arctium tomentosum Mill. – AC2611: przy polach w pobliżu lasu w stronę Swadzimia; AC2710: przy polach w pobliżu jeziora Moskowo; AC3601: przy
polach w pobliżu wsi Pustać; AC3700: las w Dzikowie.
Artemisia campestris L. – AC3700: przy polach w lesie w pobliżu drogi Rychnów – Barlinek.
Artemisia vulgaris L. – AC2611: przy polach uprawnych w Strąpiu; AC2710:
przy polach w pobliżu jeziora Moskowo; AC3601: przy polach uprawnych
w pobliżu wsi Pustać; AC3700: na skraju lasu w Dzikowie.
* Aster novi-belgii L. – AC3601: przy polu w pobliżu lasu w kierunku Swadzimia.
Bellis perennis L. – AC2611: park w Strąpiu na polanie; AC3601: park w Dzikowie; AC3700: plac sportowy w Dzikowie.
* Carduus acanthoides L. – AC2611: park w Strąpiu; AC2710: przydroże
na drodze Strąpie – Ożar w pobliżu jeziora Moskowo; AC3601: przy polach
w pobliżu wsi Pustać; AC3700: las w Dzikowie przy drodze leśnej.
* Centaurea cyanus L. – AC3601: wokół pól uprawnych przy drodze Dzikowo
– Wiewiórki; AC3700: wokół pól przy drodze Dzikowo – Strąpie.
Centaurea scabiosa L. – AC3601: przy polach uprawnch przy drodze Dzikowo
– Wiewiórki; AC3700: wokół pól przy drodze Dzikowo – Strąpie.
Centaurea stoebe L. – AC3601: przy polach w pobliżu wsi Rychnów; AC3700:
przy polach w pobliżu wsi Dzikówko.
* Chamomilla recutita (L.) Rauschert. – AC3601: przy polach uprawnych w pobliżu drogi Dzikowo – Rychnów; AC3700: wokół pól przy drodze Dzikowo
– Strąpie.
* Chamomilla suaveolens (Pursh.) Rydb. – AC2611: przy polach uprawnych
w pobliżu lasu w strone Swadzimia; AC2710: przy polach uprawnych
w pobliżu jeziora Moskowo; AC3601: wokół pól uprawnych przy drodze
Dzikowo – Pustać; AC3700: wokół pól w Dzikówku.
* Cichorium intybus L. – AC3700: w Dzikowie w pobliżu przystanku autobusowego.
84
Izabela Pasiecznik, Agnieszka Popiela
Cirsium arvense (L.) Scop. – AC2710: przy polach uprawnych w pobliżu jeziora
Moskowo; AC3601: wokół pól uprawnych przy drodze Dzikowo – Pustać;
AC3700: przy polach uprawnych w Dzikówku.
* Conyza canadensis (L.) Conquist – AC3601: przydroże na drodze Dzikowo
– Pustać.
Eupatorium cannabinum L. – AC2611: park w Strąpiu przy jeziorze; AC2710:
na łące w Dzikowie przy lesie w stronę Swadzimia; AC3700: nad jeziorem
Nierybno.
* Galinsoga ciliata (Raf.) S. F. Blade – AC3601: park w Dzikowie; AC3700:
przy zabudowach domów w Dzikowie.
* Galinsoga parviflora Cav. – AC3601: park w Dzikowie; AC3700: przydroża
w pobliżu drogi Strąpie – Ożar.
Helichrysum arenarium L. – AC3700: park w Dzikowie przy drodze do Swadzimia.
Hieracium murorum L. – AC3700: w Dzikowie, przy drodze Dzikowo – Dzikówko.
Leontodon autumnalis L. – AC3700: las w Dzikowie przy drodze w pobliżu
Rychnowa.
* Marticaria maritima L. subsp. indora (L.) Dostal – AC3700: Dzikowo w pobliżu placu sportowego.
* Onopordum acanthium L. – AC2611: park w Strąpiu.
Senecio jacobaea L. – AC3601: przy drodze Dzikowo – Wiewiórki; AC3700:
park w Dzikowie przy drodze do Swadzimia i przy drodze Dzikowo – Rychnów.
* Senecio vernalis Waldst. & Kit. – AC3601: przy drodze Dzikowo – Wiewiórki;
AC3700: wokół pól w pobliżu Ożar.
* Solidago canadensis L. – AC3700: w Dzikowie przy drodze Dzikowo – Dzikówko.
Solidago virgaurea L. – AC3700: podawana z Dzikowa bez stanowiska (Baciczko i in. 2000).
Tanacetum vulgare L. – AC2611: przy polach uprawnych w pobliżu lasu w stronę Swadzimia; AC2710: przy polach uprawnych w pobliżu jeziora Moskowo; AC3601: skraj lasu przy drodze do Rychnowa; AC3700: plac sportowy
w Dzikowie.
Materiały do flory Pojezierza Myśliborskiego...
85
Taraxacum officinale F. H. Wigg. – AC2611: przy polach uprawnych w pobliżu
lasu w stronę Swadzimia; AC2710: w pobliżu jeziora Moskowo; AC3601:
przy drodze do Rychnowa; AC3700: Dzikowo, przy zabudowach.
Tussilago farfara L. – AC2611: park w Strąpiu.
Balsaminaceae:
* Impatiens glandulifera Royle. – AC3700: w parku w Dzikowie przy jeziorze.
* Impatiens parviflora D.C. – AC2611: Strąpie, park; AC2710: w pobliżu jeziora
Mostkowo; AC3601: skraj lasu przy drodze do Rychnowa; AC3700: w lesie
w pobliżu drogi Rychnów – Barlinek.
Betulaceae:
Betula pendula Roth. – AC2611: las w stronę Swadzimia; AC3601: las w Dzikowie.
Carpinus betulus L. – AC2611: las w stronę Swadzimia; AC3601: las w Dzikowie.
Boraginaceae:
[*] Anchusa officinalis L. – AC3601: przy drodze do Rychnowa; AC3700: skraj
lasu w Dzikowie.
Echium vulgare L. – AC3601: wokół pól uprawnych przy drodze Dzikowo
– Wiewiórki; AC3700: przy polach uprawnych w pobliżu Pustaci, przy polach w pobliżu Dzikówka.
* Myosotis arvensis (L.) Hill. – AC3700: na obrzeżach pól w pobliżu stacji kolejowej w Dzikowie.
Myosotis palustris (L.) L. Emend. Rchb. – AC3700: przy jeziorze Nierybno; Gostyń.
Myosotis sylvatica Ehrh. Ex Hoffm. – AC3700: las w Dzikowie.
Pulmonaria officinalis L. – AC36 01: las w kierunku Swadzimia.
Symphytum officinale L. – AC3700: na skraju lasu w Dzikowie w pobliżu przystanku autobusowego.
Brassicaceae:
* Agrimonia eupatoria L. – AC3700: las w Dzikowie.
Allaria petiolata (M. Biebs.) Cavara & Grande – AC2611: park w Strąpiu;
AC3601: park w Dzikowie; AC3700: las w Dzikowie; przy drodze Dzikowo – Dzikówko.
* Armoracia rusticana P. Gaertn., B. Mey. & Scherb. – AC2611: park w Strąpiu
przy jeziorze.
86
Izabela Pasiecznik, Agnieszka Popiela
Barbarea vulgaris R. Br. – AC2611: skraj lasu w stronę Swadzimia; AC2710:
przy polach w pobliżu jeziora Moskowo; AC3601: przydroża w pobliżu wsi
Pustać, Rychnów; AC3700: przydroża w pobliżu wsi Dzikówko; Ożar.
[*] Berteroa incana L. – AC3700: przydroże w Dzikowie w pobliżu przystanku
autobusowego, przydroże przy wsi Dzikówko.
* Capsella bursa-pastoris (L.) Medik. – AC2611: skraj lasu w stronę Swadzimia; AC2710: przy polach w pobliżu jeziora Moskowo; AC3601: Rychnów;
AC3700: na całym terenie, głównie na obrzeżach pól.
Rorippa amphibia (L.) Besser. – AC3601: Dzikówko, oczko wodne na polu
w pobliżu drogi Dzikówko – Dzikowo.
Rorippa sylvestris (L.) Besser – AC3601: na torach kolejowych przy drodze
Dzikowo – Rychnów.
* Sinapsis arvensis L. – AC2710: przy polach w pobliżu jeziora Moskowo;
AC3601: wokół pól przy drodze Dzikowo – Rychnów; AC3700: na obrzeżach pól w pobliżu wsi Strąpie, Ożar, Dzikówko.
* Sisymbrum officinale (L.) Scop. – AC2611: przy polach w pobliżu lasu w stronę
Swadzimia; AC3700: przydroże na drodze Strąpie – Ożar; AC3600: przy
drodze Dzikowo – Pustać, przydroże na drodze Dzikowo – Rychnów.
* Thlaspi arvense L. – AC2611: przy polach w pobliżu lasu w stronę Swadzimia;
AC2710: przydroże w pobliżu jeziora Moskowo; AC3601: wokół pól przy
drodze Dzikowo – Pustać; AC3700: przy zabudowach domów w Dzikowie.
Campanulaceae:
Campanula rotundifolia L. – AC3700: ugór przy drodze Dzikowo – Strąpie.
Jasione montana L. – AC3700: skraj lasu w Dzikowie.
Canabaceae:
Humulus lupulus L. – AC2611: las w stronę Swadzimia; AC3700: na łące w parku w Dzikowie; AC3601: Pustać przy jeziorku przy drodze Pustać – Podgórze.
Capriofoliaceae:
Lonicera xylosteum L. – AC3700: skraj lasu w Dzikowie w pobliżu drogi Dzikowo – Rychnów.
Sambucus nigra L. – AC3601: przy lesie przy drodze Dzikowo – Rychnów;
AC2611: park w Strąpiu, las w stronę Swadzimia; AC3700: przydroże
na drodze Strąpie – Ożar.
Materiały do flory Pojezierza Myśliborskiego...
87
Sambucus racemosa L. – AC3700: las w Dzikowie.
Viburnum opulus L. – AC3601: Pustać na polu w pobliżu zabudowy domów.
Caryophyllaceae:
Arenaria serpyllifolia L. – AC3700: Dzikowo – przydroże w pobliżu przystanku
autobusowego.
Cerastium holosteoides Fr. Emend. Hyl. – AC2611: Strąpie park; AC2710: przydroża w pobliżu jeziora Moskowo; AC3601: przydroża na drodze Dzikowo
– Rychnów; AC3700: przydroże na drodze Dzikowo – Dzikówko.
Cucubalus baccifer L. – AC3601: na skraju lasu przy drodze Dzikowo – Rychnów.
Dianthus cartusianorum L. – AC3601: przy polach w pobliżu lasu w kierunku
Swadzimia; AC3700: ugór przy drodze Dzikowo – Strąpie.
Lychnis flos-cuculi L. – AC3700: Dzikowo – skraj lasu w pobliżu przystanku
autobusowego.
Melandrium rubrum (Weigel) Garcke – AC2611: park w Strąpiu.
Silene alba L. – AC3600: przydroże w pobliżu wsi Pustać; przy polach na drodze
Dzikowo – Wiewiórki; AC3700: przydroże na drodze Dzikowo – Dzikówko.
Stellaria graminea L. – AC2611: Dzikowo na łące w pobliżu lasu w stronę Swadzimia; AC3601: Dzikowo w pobliżu stacji kolejowej; AC3700: Dzikówko
przy zabudowach domów.
Stellaria nemorum L. – AC2710: zarośla w pobliżu jeziora Moskowo; AC3600:
zarośla w pobliżu wsi Pustać; AC3700: Dzikowo w pobliżu placu sportowego.
Celastraceae:
Eonymus europeus L. – AC3700: las w Dzikowie.
Ceratophyllaceae:
Ceratophyllum submersum L. – AC3700: na jeziorze Nierybno.
Chenopodiaceae:
Chenopodium album L. – AC2611: przy polach w pobliżu lasu w stronę Swadzimia; AC3601: przydroże na drodze Dzikowo – Dzikówko; AC3700: park
w Dzikowie, przydroże na drodze Dzikowo – Dzikówko.
Convolvulaceae:
Calystegia sepium (L.) R. Br. – AC3601: na polach uprawnych w pobliżu wsi
Pustać; AC3700: na polach uprawnych w pobliżu wsi Dzikówko.
88
Izabela Pasiecznik, Agnieszka Popiela
Convolvulus arvensis L. – AC3601: Dzikowo na łące w pobliżu przystanku autobusowego; AC3700: ugór przy drodze Dzikowo – Strąpie.
Cornaceae:
Cornus alba L. – Podawany z cmentarza w Strąpiu [33].
Cornus sanguinea L. – AC2611: Strąpie cmentarz; AC3700: park w Dzikowie.
Corylaceae:
Corylus avellana L. – AC2611: park w Strąpiu; AC3700: park w Dzikowie, las
w Dzikowie.
Crassulaceae:
Sedum acre L. – AC3700: Dzikowo na torach kolejowych przy stacji kolejowej.
Cucurbitaceae:
* Echinocystis lobata (F. Michx.) Torr. & A. Gray – AC3601: park w Dzikowie.
Cyperaceae:
Carex flava L. – AC3700: las w Dzikowie w pobliżu jeziora.
Carex gracilis Curtis – AC3700: las w Dzikowie, łąka w parku w Dzikowie
w pobliżu rowu.
Carex hirta L. – AC2611: park w Strąpiu na polanie.
Carex paniculata L. – AC3700: oczko wodne na polu w Dzikowcu w pobliżu
drogi Dzikówko – Dzikowo.
Carex pilulifera L. – AC2611: park w Strąpiu na polanie; AC3700: las w Dzikowie w pobliżu drogi Rychnów – Barlinek.
Carex pseudocyperus L. – AC2611: park w Strąpiu przy jeziorze; AC3700: przy
jeziorze Gostyń; Moskowo.
Carex riparia Curtis. – AC2611: park w Strąpiu przy jeziorze; AC3700: las
w Dzikowie przy jeziorze.
Carex rostrata Sotkes. – AC3700: park w Dzikowie przy jeziorze.
Carex sylvatica Huds. – AC3700: las w Dzikowie przy jeziorze.
Carex vesicaria L. – AC3700: las w Dzikowie przy jeziorze.
Carex vulpina L. – AC3700: jeziorko na polu w Dzikówku w pobliżu drogi
Dzikowo – Dzikówko.
Eleocharis palustris (L.) Roemer et Schult. – AC3700: przy jeziorze Nierybno.
Scirpus sylvaticus L. – AC3700: w pobliżu jeziora Gostyń.
Dipsacaceae:
Knautia arvensis (L.) J. M. Coult. – AC3601: przy polach w pobliżu drogi Dzikowo – Wiewiórki; AC3700: ugór przy drodze Dzikowo – Strąpie.
Materiały do flory Pojezierza Myśliborskiego...
89
Scabiosa canescens Waldst. et Kit. – AC3700: las w Dzikowie w pobliżu drogi
Rychnów – Barlinek.
Scabiosa columbaria L. – AC3601: przy polach w pobliżu drogi Dzikowo – Wiewiórki; AC3700: ugór przy drodze Dzikowo – Strąpie.
Dryopteridaceae:
Dryopteris filix-mas L. – AC2611: las w stronę Swadzimia; AC3700: park
w Dzikowie, las w Dzikowie.
Dryopteris spinulosa L. – AC3601: park w Dzikowie w pobliżu jeziora.
Equisetaceae:
Equisetum arvense L. – AC3601: przy polach w pobliżu drogi Dzikowo – Wiewiórki; AC3700: Dzikowo – przydroże w pobliżu przystanku autobusowego, ugór przy drodze Dzikowo – Strąpie.
Equisetum fluviatile L. – AC2611: jeziorko na polu w lesie w kierunku Strąpia.
Equisetum palustre Ehrh. – AC3700: park w Dzikowie przy jeziorze.
Equisetum sylvaticum L. – AC3700: skraj lasu w Dzikowie.
Euphorbiaceae:
* Euphorbia helioscopia L. – AC3700: Dzikowo w pobliżu placu sportowego.
Euphorbia cyparissias L. – AC3700: Dzikowo na torach kolejowych w stronę
Wiewiórek.
Fabaceae:
Coronilla varia L. – AC3601: przy polach w pobliżu drogi Dzikowo – Mostkowo; AC3700: ugór przy drodze Dzikowo – Strąpie, na łące w Dzikowie
w pobliżu placu sportowego.
Genista tinctoria L. – AC3700: las w Dzikowie w pobliżu drogi Rychnów – Barlinek.
Lathyrus pratensis L. – AC3700: łąka w parku w Dzikowie przy rowie.
Lotus corniculatus L. – AC3601: przy polach w pobliżu stacji kolejowej w Dzikowie; AC3700: przydroże na drodze Dzikowo – Dzikówko.
* Lupinus polyphyllus Lindl. – AC3601: przydroże na drodze Dzikowo – Mostkowo; AC3700: las w Dzikowie.
Medicago falcata (L.) Arcangeli. – AC3601: przy polach w pobliżu lasu w kierunku Swadzimia.
* Medicago sativa L. – AC3601: przydroże na drodze Dzikowo – Wiewiórki.
Melilotus alba Medik. – AC3601: przydroże na drodze Dzikowo – Pustać.
Trifolium pratense L. – AC3700: ugór przy drodze Dzikowo – Strąpie; AC3601:
łąka w Dzikowie w pobliżu lasu przy drodze na Swadzim.
90
Izabela Pasiecznik, Agnieszka Popiela
Trifolium repens L. – AC2611: przy polach w pobliżu lasu w kierunku Swadzimia; AC3601: przy polach w pobliżu drogi Dzikowo – Mostkowo; AC3700:
Dzikowo – plac sportowy, przy zabudowach domów.
Vicia angustifolia L. – AC3700: Dzikowo – przy polach w pobliżu drogi Dzikowo – Stąpie.
Vicia cracca L. – AC3601: przy polach w pobliżu drogi Dzikowo – Swadzim;
AC3700: przydroże na drodze Dzikowo – Dzikówko.
* Vicia grandiflora Scop. – AC3601: przy polach w pobliżu wsi Pustać; AC3700:
przydroże na drodze Strąpie – Ożar.
* Vicia villosa Roth – AC3700: łąka w Dzikowie w pobliżu placu sportowego,
ugór przy drodze Dzikowo – Strąpie.
Fumariaceae:
* Fumaria vaillantii Loisel. – AC3601: łąka w Dzikowie w pobliżu placu sportowego; AC3700: przydroża w pobliżu wsi Ożar i Dzikówko.
Geraniaceae:
* Geranium molle L. – AC3601: przy zabudowach domów w Dzikowie.
Geranium palustre L. – AC3601: park w Dzikowie przy rowie.
Geranium robertianum L. – AC2611: park w Strąpiu; AC3601: przy zabudowach
domów w pobliżu placu sportowego w Dzikowie; AC3700: przydroże na
drodze Strąpie – Ożar.
Hallorhagidaceae:
Myriophyllum verticillatum L. – AC3700: na jeziorze Nierybno.
Hydrocharitaceae:
Hydrocharis morsus-ranae L. – AC3700: jezioro Nierybno.
Stratiotes aloides L. – AC37 00: jezioro Nierybno.
Hypericaceae:
Hypericum perforatum L. – AC3601: ugór w pobliżu lasu w kierunku Swadzimia
w Dzikowie.
Hypericum tetrapteum Fr. – AC3700: ugór przy drodze Dzikowo – Strapie.
Iridaceae:
Iris pseudoacorus L. – AC2611: park w Strąpiu przy jeziorze; AC3601: przy rowie w pobliżu lasu w kierunku Swadzimia; AC3700: bagno przy drodze
Rychnow – Barlinek w pobliżu Moczkowa.
Juncaceae:
Materiały do flory Pojezierza Myśliborskiego...
91
Juncus articulatus L. – AC3601: park w Dzikowie.
Juncus conglomeratus L. – AC3700: przy jeziorze Nierybno, Gostyń, las w Dzikowie przy jeziorze.
Juncus effusus L. – AC3601: oczko wodne na polu w pobliżu drogi w kierunku
Strąpia; AC3700: przy jeziorze Nierybno.
Lamiaceae:
Ajuga reptans L. – AC3601: polana w lesie w kierunku Swadzimia; AC3700:
przydroże w lesie w Dzikowie.
* Ballota nigra L. – AC2611: park w Strąpiu; AC3601: las w Dzikowie, przy
zabudowach domów w Dzikowie, przydroże na drodze Dzikowo – Pustać,
Dzikowo – Rychnów, przy zabudowach domów w Dzikówku; AC3700:
przydroże przy drodze Dzikowo – Strąpie.
Galeopsis pubescens Besser. – AC2611: park w Strąpiu; AC3601: las w Dzikowie
w pobliżu przystanku autobusowego; AC3700: przy zabudowach domów
w Dzikowie w pobliżu placu sportowego.
Glechoma hederacea L. – AC2611: las w stronę Swadzimia; AC3601: las w Dzikowie; AC3700: przy zabudowach domów w Dzikowie.
* Lamium album L. – AC2611: park w Strąpiu; AC3601: przydroże na drodze
Dzikowo – Rychnów; AC3700: przydroże przy drodze Rychnów – Barlinek.
Lamium maculatum L. – AC2611: las w stronę Swadzimia; AC3601: las w Dzikowie przy drodze na Swadzim.
* Lamium purpureum L. – AC2611: przy zabudowach domów w Strąpiu; AC2710:
zarośla w pobliżu jeziora Moskowo; AC3601: przydroże na drodze Dzikowo – Rychnów; AC3700: przydroże na drodze Dzikowo – Dzikówko.
Lycopus europaeus L. – AC2611: park w Strąpiu przy jeziorze w pobliżu drogi
Strąpie – Dziedzice; AC3601: park w Dzikowie przy jeziorze.
Mentha aquatica L. – AC2611: park w Strąpiu przy jeziorze; AC3601: park
w Dzikowie przy jeziorze; AC3700: przy jeziorze Nierybno, Moskowo.
Mentha arvensis L. – AC3601: Dzikowo w pobliżu placu sportowego.
Mentha x verticillata L. – AC3601: park w Dzikowie przy jeziorze.
Prunella vulgaris L. – AC2611: park w Strąpiu; AC36 01: park w Dzikowie.
Salvia pratensis L. – AC3601: przy polach w Dzikowie w pobliżu lasu przy drodze Dzikowo – Strąpie.
92
Izabela Pasiecznik, Agnieszka Popiela
Stachys palustris L. – AC2611: park w Strąpiu; AC2710: w pobliżu jeziora Moskowo; AC3601: park w Dzikowie przy rowie; AC3700: przy oczku wodnym na polu we wsi Ożar.
Stachys sylvatica L. – AC3601: las w Dzikowie w pobliżu jeziora, przy jeziorze
w pobliżu drogi Pustać – Podgórze; AC3700: przy jeziorku na polu we wsi
Dzikówko w pobliżu drogi Dzikówko – Dzikowo.
Thymus pulegioides L. – AC3700: ugór przy drodze Dzikowo – Strąpie.
Lemnaceae:
Lemna minor L. – AC2611: na jeziorze w parku w Strąpiu; AC2710: na jeziorze Moskowo w pobliżu drogi Strąpie – Barlinek; AC3601: rów w pobliżu
lasu koło Swadzimia; AC3700: na jeziorku w Dzikówku w pobliżu drogi
Dzikówko – Dzikowo.
Lemna trisulca L. – AC2611: na jeziorze w parku w Strąpiu; AC2710: na jeziorze
Moskowo w pobliżu drogi Strąpie – Barlinek; AC3601: rów w Dzikowie
przy drodze w pobliżu lasu w kierunku Swadzimia; AC3700: na jeziorku
w Dzikówku w pobliżu drogi Dzikówko – Dzikowo.
Liliaceae:
Anthericum ramosum L. – AC3700: las w Dzikowie przy torach kolejowych
w pobliżu przystanku autobusowego.
Convallaria majalis L. – AC3601: łąka w Dzikowie w pobliżu placu sportowego.
Loranthaceae:
Viscum album L. – AC3700: na drzewach w lesie w Dzikowie, na drzewach rosnących w pobliżu przystanku autobusowego, na drzewach przy drodze
w kierunku placu sportowego.
Lythraceae:
Lythrum salicaria L. – AC2611: park w Strąpiu przy jeziorze; AC3601: park
w Dzikowie przy jeziorze w pobliżu rowu; AC3700: przy jeziorze Nierybno, Gostyń.
Malvaceae:
* Malva alcea L. – AC3700: ugór przy drodze Dzikowo – Strąpie.
* Malva neglecta Wallr. – AC3601: przy zabudowach domów w Dzikowie,
na Pustaci; AC3700: przy torach kolejowych w pobliżu wsi Dzikówko.
* Malva sylvestris L. – AC3700: Dzikówko – przy zabudowach domów.
Materiały do flory Pojezierza Myśliborskiego...
93
Nymphaeceae:
Nuphar lutea (L.) Sibth & Sm. – AC3700: na jeziorze Nierybno i Gostyń,
na stawach hodowlanych w pobliżu drogi Dzikowo – Strąpie.
Nymphaea alba L. – AC3700: jezioro Nierybno, Gostyń, stawy hodowlane
w pobliżu drogi Dzikowo – Strąpie.
Oenotheraceae:
Oenothera biennis L. – AC3601: Dzikowo w pobliżu torów kolejowych.
Onagraceae:
Chamaenerion angustifolium (L.) Scop. – AC3601: park w Dzikowie przy rowie;
AC3700: ugór przy drodze Dzikowo – Strąpie.
Epilobium hirsutum L. – AC2611: park w Strąpiu; AC2710: w pobliżu jeziora
Moskowo; AC3601: park w Dzikowie przy rowie; AC3700; las w Dzikowie
przy jeziorze.
Oxalidaceae:
Oxalis acetosella L. – AC2611: las w kierunku Swadzimia w pobliżu Dziedzic;
AC3700: las w Dzikowie, przy zabudowach domów w Dzikowie w pobliżu
placu sportowego.
Papaveraceae:
Chelidonium majus L. – AC2611: park w Strąpiu, las w stronę Swadzimia;
AC2710: przydroże w pobliżu jeziora Moskowo; AC3601: przydroże na
drodze Dzikowo – Rychnów; AC3700: las w Dzikowie przy drodze.
* Papaver rhoeas L. – AC2611: przy zabudowach domów w Strąpiu; AC2710:
przy polach w pobliżu jeziora Moskowo; AC3601: na polach uprawnych
przy drodze Dzikowo – Pustać, Dzikowo – Mostkowo; AC3700: plac sportowy w Dzikowie, łąka w Dzikowie w pobliżu placu sportowego, przydroże
na drodze Dzikowo – Dzikówko.
Pinaceae:
Pinus sylvestris L. – AC2611: las w kierunku Swadzimia; AC3601: las w kierunku Swadzimia; AC3700: las w Dzikowie.
Plantaginaceae:
Plantago lanceolata L. – AC3601; park w Dzikowie polana; AC3700: przydroże
w pobliżu przystanku autobusowego w Dzikowie.
Plantago major L. – AC2611: przy zabudowach domów w Strąpiu; AC2710:
przydroża w pobliżu jeziora Moskowo; AC3601: przy zabudowach domów
w Dzikowie; AC3700: przydroże na drodze Strąpie – Ożar.
94
Izabela Pasiecznik, Agnieszka Popiela
Poaceae:
Agropyron repens (L.) P. Beauv. – AC2611: park w Strąpiu; AC2710: przydroże
w pobliżu jeziora Moskowo; AC3601: przy polach w pobliżu drogi Dzikowo – Rychnów; AC3700: ugór przy drodze Dzikowo – Strąpie.
Alopecurus geniculatus L. – AC3601: park w Dzikowie, na łące w pobliżu
rowu.
Alopecurus pratensis L. – AC2611: park w Strąpiu; AC3601: Pustać przy zabudowach domów; AC3700: przydroże na drodze Dzikowo – Dzikówko.
Anthoxanthum odoratum L. – AC3601: park w Dzikowie.
Arrhenatherum elatius (L.) P. Beauv. ex J. Presl & C. Presl. – AC2611: przydroże
na drodze Strąpie – Dziedzice; AC2710: przydroże na drodze w pobliżu jeziora Moskowo; AC3601: przydroże na drodze Dzikowo – Pustać; AC3700:
przy polach w Dzikówku.
Bromus hordeaceus L. – AC3700: przydroże na drodze Rychnów – Barlinek, łąka
w pobliżu placu sportowego w Dzikowie.
[*] Bromus inermis Leyss. – AC3601: park w Dzikowie; AC3700: Dzikowo – na
łące w pobliżu drogi Dzikowo – Strąpie.
* Bromus sterilis L. – AC2611: park w Strąpiu w pobliżu jeziora; AC3700: Dzikowo – przy zabudowach domów w pobliżu placu sportowego.
* Bromus tectorum L. – AC3601: las w kierunku Swadzimia; AC2710: zarośla
w pobliżu jeziora Moskowo.
Dactylis glomerata L. – AC2611: park w Strąpiu w pobliżu jeziora; AC2710:
w pobliżu jeziora Moskowo; AC3601: park w Dzikowie; AC3700: plac
sportowy w Dzikowie.
Deschampsia caepitosa (L.) P. Beauv. – AC3601: przydroże na drodze Dzikowo
– Pustać; AC3700: przy zabudowach domów w Dzikówku.
* Echinochloa crus-galli (L.) P. Beauv. – AC3700: las w Dzikowie.
Festuca arundinacea Schreb. – AC2611: park w Strąpiu; AC2710: w pobliżu jeziora Moskowo; AC3601: park w Dzikowie w pobliżu rowu; AC3700: przy
oczku wodnym na polu w Dzikówku.
Festuca pratensis Huds. – AC3601: park w Dzikowie na łące w pobliżu rowu.
Festuca rubra L. s. s. – AC2611: park w Strąpiu w pobliżu polany; AC3601: park
w Dzikowie, na łące w pobliżu rowu; AC3700: plac sportowy w Dzikowie.
Glyceria maxima (Hartm.) Holmb. – AC3601: Pustać, oczko wodne na polu.
Materiały do flory Pojezierza Myśliborskiego...
95
Holcus lanatus L. – AC3700: oczko wodne na polu w pobliżu drogi Strąpie
– Ożar; AC2611: park w Strąpiu; AC2710: przydroże w pobliżu jeziora
Moskowo; AC3601: park w Dzikowie; AC3700: las w Dzikowie, przydroże
na drodze Strąpie – Ożar.
Lolium perenne L. – AC2611: przydroże na drodze Strąpie – Dziedzice; AC3601:
przydroże na drodze Dzikowo – Pustać; AC3700: przydroże na drodze
Dzikowo – Dzikówko.
Phalaris arundinacea L. – AC3601: oczkach wodne na polach w pobliżu drogi
Dzikowo – Mostkowo.
Phleum pratense L. – AC2611: park w Strąpiu; AC3601: park w Dzikowie
w pobliżu rowu.
Phragmites australis (Cav.) Trin. ex Steud. – AC2611: park w Strąpiu przy
jeziorze; AC2710: przy jeziorze Moskowo; AC3601: oczko wodne na polu
na Pustaci; AC3700: przy jeziorze Nierybno.
Poa annua L. – AC2611: park w Strąpiu; przy zabudowach domów w Strąpiu; AC2710: przydroża w pobliżu jeziora Moskowo; AC3601: przydroże
na drodze Dzikowo – Pustać; AC3700: przy zabudowach domów w Dzikowie.
Poa pratensis L. – AC3601: łąka w parku w Dzikowie; AC3700: łąka w Dzikowie w pobliżu drogi Dzikowo – Strąpie.
Poa trivialis L. – AC2611: park w Strąpiu; AC3601: przydroże na drodze Dzikowo – Pustać; AC3700: przy zabudowach domów we wsi Dzikówko.
Polygonaceae:
Polygonum amphibium L. – AC3700: jezioro Nierybno.
Polygonum aviculare L. – AC2710: przydroże w pobliżu jeziora Moskowo;
AC3601: przydroże na drodze Dzikowo – Dzikówko; AC3700: Dzikowo
– przy placu sportowym.
Polygonum persicaria L. – AC3601: ugór w parku przy drodze Dzikowo – Swadzim; AC3700: Dzikowo w pobliżu placu sportowego.
* Reynoutria japonica Houtt. – AC3601: park w Dzikowie.
Rumex acetosa L. – AC2711: przy polach w pobliżu jeziora Moskowo; AC3601:
przydroże na drodze Dzikowo – Rychnów; AC3700: przydroże na drodze
Strąpie – Ożar.
Rumex acetosella L. – AC3600: przydroże na drodze Dzikowo – Pustać; AC3700:
przydroże na drodze Dzikowo – Dzikówko.
Rumex conglomeratus Murray. – AC3700: las w Dzikowie, na drodze.
96
Izabela Pasiecznik, Agnieszka Popiela
Rumex crispus L. – AC3700: przydroże na drodze Strąpie – Ożar.
Rumex hydrolapathum Huds. – AC2611: park w Strąpiu przy jeziorze; AC3601:
park w Dzikowie przy rowie.
Polypodiaceae:
Polypodium vulgare L. – AC3601: las w kierunku Swadzimia.
Primulaceae:
Hottonia palustris L. – AC3700: las w Dzikowie, przy jeziorze.
Lysimachia nummularia L. – AC2611: park w Strąpiu przy jeziorze; AC2710:
przy jeziorze Moskowo; AC3601: przy rowie w pobliżu lasu w kierunku
Swadzimia; AC 3700: przy jeziorze Nierybno.
Lysimachia vulgaris L. – AC2611: park w Strąpiu przy jeziorze; AC2710: przy
jeziorze Moskowo; AC3601: park w Dzikowie przy jeziorze; AC3700: przy
jeziorze Nierybno.
Primula elatior (L.) Hill. – AC3601: las w kierunku Swadzimia.
Primula veris L. – AC3700: las w Dzikowie.
Ranunculaceae:
Anemone nemorosa L. – AC3601: park w Dzikowie przy drodze Dzikowo
– Mostkowo.
Anemone ranunculoides L. – AC3601: park w Dzikowie przy drodze Dzikowo
– Mostkowo.
Caltha palustris L. – AC3601: łąka w parku w Dzikowie; AC3700: las w Dzikowie.
* Consolida regalis L. – AC3601: przydroże w pobliżu wsi Pustać.
Hepatica nobilis Schreb. – AC3700: las w Dzikowie.
Ranunculus acris L. s. s. – AC2611: park w Strąpiu; AC2710: przydroże w pobliżu drogi Strąpie – Ożar; AC3601: park w Dzikowie; AC3700: przydroże
na drodze Rychnów – Barlinek w pobliżu Moczkowa.
Ranunculus bulbosus L. – AC3700: przydroże na drodze Strąpie – Ożar.
Ranunculus ficaria A. Kern. – AC2611: park w Strąpiu; AC3601: przydroże
na drodze Dzikowo – Rychnów w pobliżu stacji kolejowej; AC3700: przy
zabudowach domów w Dzikówku.
Ranunculus lingua L. – AC3700: przy jeziorku na polu w Dzikówku.
Ranunculus repens L. – AC2611: park w Strąpiu w pobliżu drogi Strąpie – Dziedzice; A2710: przydroże w pobliżu jeziora Moskowo; AC3601: przydroże
na drodze Dzikowo – Rychnów; AC3700: przy drodze w lesie w Dzikowie.
Materiały do flory Pojezierza Myśliborskiego...
97
Resedaceae:
Reseda lutea L. – AC3601: przy torach kolejowych w Dzikowie w kierunku
Mostkowa; AC3700: przy torach kolejowych w pobliżu Dzikówka.
Rhamnaceae:
Frangula alnus Mill. – AC3700: las w Dzikowie.
Rosaceae:
Cerasus avium (L.) Moench. – AC2710: na polu w pobliżu jeziora Moskowo;
AC3601: na polu przy torach w pobliżu wsi Wiewiórki.
Crataegus laevigata (Poir.) DC. – AC 3601: park w Dzikowie przy polanie.
Crataegus monogyna Jacq. – AC2611: park w Strąpiu; AC3601: Dzikowo –
w pobliżu przystanku autobusowego na skraju lasu; AC3700: Dzikówko,
przy zabudowaniach.
Geum urbanum L. – AC2611: las w pobliżu Dziedzic; AC2710: przydroża w pobliżu jeziora Moskowo; AC3601: Dzikowo – las w pobliżu drogi; AC3700:
przydroże na drodze Rychnów – Barlinek w pobliżu Moczkowa.
Filipendula ulmaria (L.) Maxi – AC3601: łąka w parku przy rowie w Dzikowie.
Fragaria vesca L. – AC2611: las w pobliżu Dziedzic; AC2710: ugór w pobliżu
jeziora Moskowo; AC3601: park w Dzikowie; AC3700: przydroże na drodze Ruchnów – Barlinek w pobliżu lasu.
* Padus serotina L. – AC3601: las w pobliżu Swadzimia.
Padus avium L. – AC3700: las w Dzikowie.
Potentilla anserina L. – AC3601: przydroże na drodze Dzikowo – Mostkowo.
Potentilla collina Wibel. – AC3601: przy polach w pobliżu lasu w kierunku Swadzimia.
Potentilla reptans L. – AC2611: las w pobliżu Dziedzic; AC3601: przydroże na
drodze Dzikowo – Mostkowo; AC3700: ugór przy drodze Dzikowo – Strąpie.
Rosa canina L. – AC3601: przydroże na drodze Dzikowo – Rychnów; AC3700:
ugór przy drodze Dzikowo – Strąpie.
Rubiaceae:
Galium aparine L. – AC3601: przydroże na drodze Dzikowo – Mostkowo;
AC3700: Dzikowo – w pobliżu placu sportowego na łące.
Galium mollugo L. – AC2611: park w Strąpiu; AC3601: przy polach na drodze
Dzikowo – Pustać; AC3700: skraj lasu przy drodze Dzikowo – Rychnów.
Galium odoratum (L.) Scop. – AC2611: park w Strąpiu przy jeziorze.
98
Izabela Pasiecznik, Agnieszka Popiela
Salicaceae:
Salix alba L. – AC3601: przy oczku wodnym na polu w pobliżu drogi Dzikowo
– Mostkowo.
Salix aurita L. – AC2710: przy jeziorze Moskowo.
Salix caprea L. – AC3601: przy jeziorku na polu w pobliżu stacji kolejowej
w Dzikowie.
Salix cinerea L. – AC2611: park w Strąpiu; AC2710: przy jeziorze Moskowo;
AC3601: park w Dzikowie; AC3700: przy jeziorze Nierybno.
Salix purpurea L. – AC2710: przy jeziorze Moskowo; AC3601: przy oczku wodnym na polu w pobliżu drogi Dzikowo – Mostkowo.
Salix viminalis L. – AC3601: przy oczku wodnym w pobliżu drogi Dzikowo
– Mostkowo.
Scrophulariaceae:
* Digitalis purpurea L. – AC3601: przydroże na drodze Dzikowo – Mostkowo
w pobliżu stacji kolejowej.
Linaria vulgaris Mill. – AC3601: przy torach kolejowych w kierunku Mostkowa;
AC3700: przy torach kolejowych w kierunku Dzikówka.
Verbascum lychnitis L. – AC3700: skraj lasu w Dzikowie w pobliżu przystanku
autobusowego.
Veronica chamaedrys L. – AC3601: park w Dzikowie; AC3700: skraj lasu w pobliżu przystanku autobusowego w Dzikowie.
Veronica officinalis L. – AC3700: las w Dzikowie.
* Veronica opaca Fries. – AC3601: przydroże na drodze Dzikowo; AC3700: Dzikowo – w pobliżu placu sportowego.
* Veronica persica Poir. – AC2611: park w Strąpiu; AC3601: przy zabudowach
domów w Dzikowie; AC3700; przydroże w Dzikowie w pobliżu placu
sportowego, przy zabudowach domów w Dzikówku, przydroże w pobliżu
Moczkowa, przydroże na drodze Strąpie – Ożar.
* Veronica triphyllos L. – AC3601: park w Dzikowie w pobliżu polany.
Solanaceae:
Solanum dulcamara L. – AC2611: park w Strąpiu przy jeziorze; AC2710: przy
jeziorze Moskowo; AC3601: park w Dzikowie przy jeziorze, przy jeziorze w pobliżu drogi Pustać – Podgórze; AC3700: przy jeziorze Nierybno,
Gostyń.
Materiały do flory Pojezierza Myśliborskiego...
99
Sparganiaceae:
Sparganium erectum L. Emend.-Rchb. s.s. – AC3700: jezioro Nierybno, Gostyń,
przy stawach hodowlanych w pobliżu drogi Dzikowo – Strąpie.
Typhaceae:
Typha angustifolia L. – AC 3700: jezioro Nierybno.
Typha latifolia L. – AC26 11: park w Strąpiu przy jeziorze; AC2710: przy jeziorze Moskowo; AC3601: jeziorko w pobliżu drogi Dzikowo – Mostkowo;
AC3700: stawy hodowlane przy drodze Dzikowo – Strąpie.
Urticaceae:
Urtica dioica L. – AC2611: w Strąpiu przy jeziorze; AC2710: przy jeziorze
Moskowo; AC3601: w pobliżu drogi Dzikowo – Mostkowo; AC3700: przy
drodze Dzikowo – Strąpie.
Violace:
Viola biflora L. – AC3700: las w Dzikowie.
Viola hirta L. – AC3700: las w Dzikowie.
[*] Viola odorata L. – AC2611: park w Strąpiu; AC3601: przy zabudowach
domów w Dzikowie; AC3700: las w Dzikowie w pobliżu przystanku autobusowego.
Viola reichenbachiana Jord. ex Boreau. – AC3700: las w Dzikowie.
Viola riviniana Rchb. – AC3700: las w Dzikowie.
Viola tricolor L. s. s. – AC2710: na polu przy jeziorze Moskowo.
4. Podsumowanie wyników badań
Praca zawiera 554 daty florystyczne dla 272 gatunków z okolic miejscowości Dzikowo. Liczba gatunków flory roślin naczyniowych jest zwykle związana
z położeniem danego terenu, jego ukształtowaniem (zróżnicowanie siedlisk), historią, wielkością oraz z metodyką prowadzenia badań. Biorąc pod uwagę niewielką powierzchnię rozpatrywanego tutaj obszaru, jego słabe zróżnicowanie
siedliskowe (ok. 70% to pola uprawne), a także zakres prowadzonych prac, należy stwierdzić, że odnalezione gatunki stanowią najprawdopodobniej około 80%
spodziewanych. Zdecydowana większość odnalezionych gatunków to gatunki
pospolite. Do gatunków rzadkich w skali regionu należą odnotowane: Impatiens grandulifera, Cucubalus baccifer, Ceratophyllum submersum, Stratioides
aloides, Anthericum ramosum, Hepatica nobilis, Ranunculus lingua, Veronica
opaca.
100
Izabela Pasiecznik, Agnieszka Popiela
BIBLIOGRAFIA
Bacieczko W., Przybylski G., Jurzyk S., 2000: Drzewa i krzewy parków i cmentarzy
w gminie Barlinek (województwo zachodniopomorskie). Rocznik Dendrologiczny,
48, s. 143–158.
Borówka R., Friedrich S., Heese T., Jasnowska J., Kochanowska R., Opechowski M.,
Stanecka E., Zyska W., 2002: Przyroda Pomorza Zachodniego. Oficyna in plus,
Szczecin.
Ćwikliński E., 1988: Rośliny naczyniowe Wyspy Chrząszczewskiej. Monografie 6, Wyższa
Szkoła Rolniczo-Pedagogiczna im. Georgi Dymitrowa w Siedlcach.
Kondracki J., 2000: Geografia regionalna Polski. PWN, Warszawa.
Libbert W., 1932: Die Vegetationseinheiten der neumärkischen Staubeckenlandschaft
unter Berücksichtigung der angrenzenden Landschaften. 1. Verh. Bot. Ver. Prov.
Brandenburg, 74/75, s. 10–93.
Mirek Z., Piękoś-Mirkowa H., Zajac A., Zając M., 2002: Flowering plants and petridophytes of Poland a checklist. W. Szafer Institute of Botany. Polish Academy
of Sciences, Kraków.
Myśliwy M., 2004: Flora roślin naczyniowych Barlinecko-Gorzowskiego Parku
Krajobrazowego w warunkach atropogenicznych przemian środowiska przyrodniczego. Praca doktorska wykonana na Wydziale Nauk Przyrodniczych Uniwersytetu
Szczecińskiego (manuskrypt).
Piotrowska H., 1996: Rośliny naczyniowe wysp Wolina i południowo-wschodniego
Uznamu. Poznańskie Towarzystwo Przyjaciół Nauk, Wydział Matematyczno-Przyrodniczy Prace Komisji Biologicznej 30 (4), Poznań.
Więcław H., 2002: Flora roślin naczyniowych Ińskiego Parku Krajobrazowego i jej
antropogeniczne przeobrażenia, cz. I, II. Wydawnictwo Naukowe Uniwersytetu
Szczecińskiego, Szczecin.
Zając A., Ciaciura M., Zając M., 1993: Rośliny naczyniowe Zaodrza (na zachód od
Szczecina). Wydawnictwo Naukowe Uniwersytetu Szczecińskiego, Szczecin.
Zając A., Zając M. (red.), 2001: Atlas rozmieszczenia roślin naczyniowych w Polsce.
Nakładem Pracowni Chronologii Komputerowej Instytutu Botaniki Uniwersytetu
Jagiellońskiego, Kraków.
Ziarnek K., Ziarnek M., Wołejko L., 2003: Bibliografia botaniczna Pomorza. Rośliny
naczyniowe i ochrona przyrody. Publikacje z lat 1945–2000. Fundacja Akademii
Rolniczej w Szczecinie, Szczecin.
Materiały do flory Pojezierza Myśliborskiego...
101
DATA RE THE VASCULAR FLORA OF THE POJEZIERZE MYŚLIBORSKIE
LAKELAND (NW POLAND): THE NEIGHBOURHOOD OF DZIKOWO
Sumary
554 new sites of 272 vascular plant species of the neighourhood of Dzikowo, small
village situated in the eastern part of the Pojezierze Myśliborskie Lakeland are given.
Up to now no floristic data have been published from this area.
Translated by Agnieszka Popiela
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
BARTOSZ STARTEK
AGNIESZKA POPIELA
Uniwersytet Szczeciński
MATERIAŁY DO FLORY NACZYNIOWEJ
PUSZCZY GOLENIOWSKIEJ (NW POLSKA)
Data re vascular flora of the Puszcza Goleniowska Primeval Forest
(NW Poland)
Słowa kluczowe: Pomorze, chorologia, mapy, torfowiska
Key words: Pomerania, chorology, maps, peatlands
1. Wstęp
Aktualny stopień poznania flory roślin naczyniowych Pomorza Zachodniego nie jest zadowalający. Po 1945 roku powstało wiele opracowań flory i roślinności miejsc szczególnie interesujących (i najczęściej objętych ochroną prawną), a także szereg prac obejmujących kompleksowo różne aspekty flory/szaty
roślinnej północno-zachodniej Polski (Czubiński 1950; Piotrowska 1966 a, b;
Jasnowski 1962; Zając i in. 1993; Ziarnek 2002; Bacieczko 1995; Popiela 2004;
Więcław 2006), niemniej znaczna część Pomorza Zachodniego pozostaje florystycznie niewystarczająco zbadana. Do takich „białych plam” w rozpoznaniu
florystycznym należy Puszcza Goleniowska, a szczególnie jej północna część.
Opublikowane dotychczas dane dotyczą głównie środkowej i południowej części
tego obszaru (Jasnowski 1962; Jasnowski i in. 1965; Friedrich 1984, 1985; Fudali
1991, 1994; Banaś-Stankiewicz 2007 a, b, c, d, e), jakkolwiek w większości są
to informacje na temat flory i ekologii roślin niższych. Niniejsza notatka dołącza
104
Bartosz Startek, Agnieszka Popiela
do skromnego dorobku prac botanicznych poświęconych północnej części Puszczy Goleniowskiej (Jasnowski 1962; Jasnowski i in. 1965; Fudali 1993; Król
1998; Grinn-Gofroń, Ciaciura 2000, 2002), a jej celem jest przedstawienie wykazu stanowisk cennych gatunków roślin naczyniowych zanotowanych przede
wszystkim w ekosystemach torfowiskowych, stwierdzonych podczas badań
siedlisk nieleśnych.
2. Teren i metody badań
Puszcza Goleniowska jest rozległym, zwartym kompleksem leśnym, położonym na wschód od jeziora Dąbie i Zalewu Szczecińskiego. Drzewostan
tworzy tu niemal wyłącznie sosna. Puszcza porasta Równinę Goleniowską oraz
południowo-zachodni kraniec Równiny Gryfickiej. Oba mezoregiony należą
do regionu Pobrzeży Południowobałtyckich (Kondracki 2002). Teren badań obejmował północną część Puszczy Goleniowskiej tj. fragment Równiny Gryfickiej
i północne peryferie Równiny Goleniowskiej (Nadleśnictwo Rokita).
Badania terenowe prowadzono w czerwcu i lipcu 2007 roku. Sporządzono
ponad 40 spisów florystycznych w nieleśnych siedliskach, głównie w ekosystemach torfowiskowych. Do orientacji w terenie używano map leśnych w skali
1 : 10 000. Podczas badań prowadzono dokumentację zielnikową i fotograficzną
(zielnik został zdeponowany w Katedrze Botaniki i Ochrony Przyrody Uniwersytetu Szczecińskiego). Nomenklaturę roślin naczyniowych podano za Mirkiem
i in. (2002). Dla 14 gatunków sporządzono mapy rozmieszczenia odnalezionych
stanowisk (rys. 1–14). Zgodnie z metodyką ATPOL podstawową jednostką kartogramu jest kwadrat o boku 2,5 km (Zając, Zając 2001).
3. Wykaz stanowisk
Poniżej przedstawiono wykaz stanowisk cennych gatunków roślin stwierdzonych w wyniku przeprowadzonych badań terenowych. Dla każdego stanowiska podano numer jednostki kartogramu, typ siedliska oraz określono przybliżoną lokalizację.
Andromeda polifolia L. (rys. 1). AB3531: torfowisko przejściowe, 2,5 km E od
Ostrowic. AB4412: żywe torfowisko wysokie, 2 km SW od Siniechowa. AB4433:
torfowisko przejściowe, 2 km S od Zabierzowa. AB4622: torfowisko przejściowe, 0,5 km S od Łęgna; AB5502: torfowisko wysokie, 4 km S od Rokity.
Materiały do flory naczyniowej...
105
Carex limosa L. (rys. 2). AB4530: śródleśne torfowisko przejściowe, 1 km SW
od Przybiernowa.
Drosera intermedia Hayne (rys. 3). AB4602: żywe torfowisko wysokie, 2,5 km
NE od Drzewicy.
Drosera rotundifolia L. (rys. 4). AB3531: torfowisko przejściowe, 2,5 km E
od Ostrowic. AB3532: torfowisko przejściowe, 1 km SW od Wysokiej Kamieńskiej. AB4602: żywe torfowisko wysokie, 2,5 km NE od Drzewicy. AB4412:
żywe torfowisko wysokie, 2 km SW od Siniechowa. AB4433: torfowisko przejściowe, 2 km S od Zabierzewa, 2 km S od Miodowic. AB4530: żywe torfowisko
wysokie, 1 km SW od Przybiernowa. AB4622: torfowisko przejściowe, 0,5 km
S od Łęgna. AB4700: torfowisko przejściowe nad jeziorkiem, 2 km S od Uniborza.
Erica tetralix L. (rys. 5). AB4433: torfowisko przejściowe, 2 km S od Miodowic.
AB4530: żywe torfowisko wysokie, 1 km SW od Przybiernowa. AB4622: żywe
torfowisko wysokie, 0,5 km S od Łęgna.
Eriophorum angustifolium Honck (rys. 6). AB3531: torfowisko przejściowe,
2,5 km E od Ostrowic. AB3533: torfowisko przejściowe, 2 km SW od Baczysławia. AB4403: torfowisko przejściowe, 2 km S od Wiejkówka. AB4433: torfowisko przejściowe, 2 km S od Miodowic. AB4530: żywe torfowisko wysokie, 1 km
SW od Przybiernowa. AB4602: torfowisko przejściowe, 2,5 km NE od Drzewicy.
AB4612: żywe torfowisko wysokie, 3 km SE od Kłębów. AB4622: torfowisko
przejściowe, 0,5 km S od Łęgna.
Eriophorum vaginatum L. (rys. 7). AB3531: torfowisko przejściowe, 2 km W
od Wysokiej Kamieńskiej. AB3532: torfowisko przejściowe, 1 km SW od Wysokiej Kamieńskiej. AB4402: torfowisko przejściowe, 2 km S od Wiejkówka.
AB4403: torfowisko przejściowe, 2 km S od Wiejkówka. AB4412: żywe torfowisko wysokie, 2 km SW od Siniechowa. AB4433: torfowisko przejściowe,
2 km S od Zabierzewa, 2 km S od Miodowic. AB4530: torfowisko przejściowe,
1 km SW od Przybiernowa. AB4602: żywe torfowisko wysokie, 2,5 km NE od
Drzewicy. AB4612: żywe torfowisko wysokie, 3 km SE od Kłębów. AB4622:
torfowisko przejściowe, 0,5 km S od Łęgna. AB5502: torfowisko wysokie, 4 km
S od Rokity.
106
Bartosz Startek, Agnieszka Popiela
Ledum palustre L. (rys. 8). AB4412: żywe torfowisko wysokie, 2 km SW od
Siniechowa. AB4433: torfowisko przejściowe, 2 km S od Zabierzowa. AB4602:
żywe torfowisko wysokie, 2,5 km NE od Drzewicy. AB4612: żywe torfowisko
wysokie, 3 km SE od Kłębów. AB4622: żywe torfowisko wysokie, 0,5 km S od
Łęgna.
Menyanthes trifoliata L. (rys. 9). AB3531: torfowisko przejściowe, 2,5 km E od
Ostrowic. AB3533: torfowisko przejściowe, 2 km SW od Baczysławia. AB3532:
torfowisko przejściowe, 1 km SW od Wysokiej Kamieńskiej. AB4412: żywe torfowisko wysokie, 2 km SW od Siniechowa. AB4530: żywe torfowisko wysokie, 1 km SW od Przybiernowa. AB4622: torfowisko przejściowe, 0,5 km S od
Łęgna. AB4700: torfowisko przejściowe nad jeziorkiem, 2 km S od Uniborza.
Rhynchospora alba (L.) Vahl (rys. 10). AB4433: torfowisko przejściowe, 2 km S
od Zabierzewa, 2 km S od Miodowic. AB4602: torfowisko przejściowe, 2,5 km
NE od Drzewicy. AB4700: torfowisko przejściowe nad jeziorkiem, 2 km S od
Uniborza.
Scheuchzeria palustris L. (rys. 11). AB4433: torfowisko przejściowe, 2 km S od
Zabierzowa. AB4602: torfowisko przejściowe, 2,5 km NE od Drzewicy. AB4622:
torfowisko przejściowe, 0,5 km S od Łęgna.
Utricularia vulgaris L. AB3531: śródleśne oczko dystroficzne, 2 km W od Wysokiej Kamieńskiej. AB4503: środleśne oczko dystroficzne, 0,5 km SW od Leszczna.
Oxycoccus palustris L. (rys. 12). AB3531: torfowisko przejściowe, 2 km W od
Wysokiej Kamieńskiej. AB3532: torfowisko przejściowe, 1 km SW od Wysokiej
Kamieńskiej. AB4402: torfowisko przejściowe, 2 km S od Wiejkówka. AB4403:
torfowisko przejściowe, 2 km S od Wiejkówka. AB4412: żywe torfowisko wysokie, 2 km SW od Siniechowa. AB4530: żywe torfowisko wysokie, 1 km SW
od Przybiernowa. AB4602: żywe torfowisko wysokie, 2,5 km NE od Drzewicy.
AB4612: żywe torfowisko wysokie, 3 km SE od Kłębów. AB4622: torfowisko
przejściowe, 0,5 km S od Łęgna. AB4700: torfowisko przejściowe nad jeziorkiem, 2 km S od Uniborza.
Materiały do flory naczyniowej...
107
Vaccinium uliginosum L. (rys. 13). AB3531: torfowisko przejściowe, 2 km
W od Wysokiej Kamieńskiej. AB4403: torfowisko przejściowe, 2 km S od Wiejkówka. AB4412: żywe torfowisko wysokie, 2 km SW od Siniechowa. AB4433:
torfowisko przejściowe, 2 km S od Zabierzewa, 2 km S od Miodowic. AB4530:
żywe torfowisko wysokie, 1 km SW od Przybiernowa. AB4602: żywe torfowisko
wysokie, 2,5 km NE od Drzewicy. AB4612: żywe torfowisko wysokie, 3 km SE
od Kłębów. AB4622: żywe torfowisko wysokie, 0,5 km S od Łęgna. AB5502:
torfowisko wysokie, 4 km S od Rokity.
Wolffia arrhiza (L.) Horkel ex Wimmer (rys. 14). AB4403: śródleśne stawy
eutroficzne, jeziorko dystroficzne, 3 km S od Mierzęcina.
4. Podsumowanie
Północne krańce Puszczy Goleniowskiej są miejscem występowania wielu cennych roślin naczyniowych. Gatunki: Ledum palustre L., Erica tetralix L.,
Drosera rotundifolia L., Scheuchzeria palustris L., Drosera intermedia Hayne
są w Polsce objęte całkowitą ochroną prawną. Dwa ostatnie, są ponadto (w skali
Polski) krytycznie zagrożone wyginięciem (Mirek i in. 2006). Na uwagę zasługują również nowe stanowiska Wolffia arrhiza (L.) Horkel ex Wimmer, najmniejszej rośliny naczyniowej Polski.
108
Bartosz Startek, Agnieszka Popiela
Rys. 1. Nowe stanowiska Andromeda polifolia L. w Puszczy Goleniowskiej
Fig. 1. New sites of Andromeda polifolia L. in the Puszcza Goleniowska forest
Rys. 2. Nowe stanowiska Carex limosa L. w Puszczy Goleniowskiej
Fig. 2. New sites of Carex limosa L. in the Puszcza Goleniowska forest
Materiały do flory naczyniowej...
Rys. 3. Nowe stanowiska Drosera intermedia Hayne w Puszczy Goleniowskiej
Fig. 3. New sites of Drosera intermedia Hayne in the Puszcza Goleniowska forest
Rys. 4. Nowe stanowiska Drosera rotundifolia L. w Puszczy Goleniowskiej
Fig. 4. New sites of Drosera rotundifolia L. in the Puszcza Goleniowska forest
109
110
Bartosz Startek, Agnieszka Popiela
Rys. 5. Nowe stanowiska Erica tetralix L. w Puszczy Goleniowskiej
Fig. 5. New sites of Erica tetralix L. in the Puszcza Goleniowska forest
Rys. 6. Nowe stanowiska Eriophorum angustifolium Honck w Puszczy Goleniowskiej
Fig. 6. New sites of Eriophorum angustifolium Honck in the Puszcza Goleniowska
forest
Materiały do flory naczyniowej...
Rys. 7. Nowe stanowiska Eriophorum vaginatum L. w Puszczy Goleniowskiej
Fig. 7. New sites of Eriophorum vaginatum L. in the Puszcza Goleniowska forest
Rys. 8. Nowe stanowiska Ledum palustre L. w Puszczy Goleniowskiej
Fig. 8. New sites of Ledum palustre L. in the Puszcza Goleniowska forest
111
112
Bartosz Startek, Agnieszka Popiela
Rys. 9. Nowe stanowiska Menyanthes trifoliata L. w Puszczy Goleniowskiej
Fig. 9. New sites of Menyanthes trifoliata L. in the Puszcza Goleniowska forest
Rys. 10. Nowe stanowiska Rhynchospora alba (L.) Vahl w Puszczy Goleniowskiej
Fig. 10. New sites of Rhynchospora alba (L.) Vahl in the Puszcza Goleniowska forest
Materiały do flory naczyniowej...
Rys. 11. Nowe stanowiska Scheuchzeria palustris L. w Puszczy Goleniowskiej
Fig. 11. New sites of Scheuchzeria palustris L. in the Puszcza Goleniowska forest
Rys. 12. Nowe stanowiska Oxycoccus palustris L. w Puszczy Goleniowskiej
Fig. 12. New sites of Oxycoccus palustris L. in the Puszcza Goleniowska forest
113
114
Bartosz Startek, Agnieszka Popiela
Rys. 13. Nowe stanowiska Vaccinium uliginosum L. w Puszczy Goleniowskiej
Fig. 13. New sites of Vaccinium uliginosum L. in the Puszcza Goleniowska forest
Rys. 14. Nowe stanowisko Wolffia arrhiza (L.) Horkel ex Wimmer w Puszczy Goleniowskiej
Fig. 14. New sites of Wolffia arrhiza (L.) Horkel ex Wimmer. in the Puszcza Goleniowska
forest
Materiały do flory naczyniowej...
115
BIBLIOGRAFIA
Bacieczko W., 1995: Studia porównawcze nad szatą roślinną występującą aktualnie w dolinie Płoni w stosunku do badań W. Libberta z 1938 r. Akademia Rolnicza, Szczecin,
166, s. 3–146.
Banaś-Stankiewicz U., 2007a: Roślinność torfowisk mszarnych Specjalnego Obszaru
Ochrony „Ostoja Goleniowska” na Pomorzu Zachodnim. Cz. I. Zbiorowiska wodne
z klas: Potametea R. TX. ET PRSG 1942 i Littorelletea uniflorae BR.-BL. et R.TX.
1943. Folia Univ. Agric. Stetin., Ser. Agric., Aliment., Pisc., Zootech. A, 253 (1),
s. 19–26.
Banaś-Stankiewicz U., 2007b: Roślinność torfowisk mszarnych Specjalnego Obszaru
Ochrony „Ostoja Goleniowska” na Pomorzu Zachodnim. Cz. II. Zbiorowiska torfowisk przejściowych ze związku Rhynchosporion albae W. KOCH 1926 B. Folia Univ.
Agric. Stetin., Ser. Agric., Aliment., Pisc., Zootech., 255 (2), s. 5–16.
Banaś-Stankiewicz U., 2007c: Roślinność torfowisk mszarnych Specjalnego Obszaru
Ochrony„Ostoja Goleniowska” na Pomorzu Zachodnim. Cz. III. Zbiorowiska torfowisk przejściowych, ze związków Caricion lasiocarpae VANDEN BERGHEN
IN LEBRUN AL. 1949 i Caricion nigrae. W. KOCH 1926. Folia Univ. Agric. Stetin.,
Ser. Agric., Aliment., Pisc., Zootech., 255 (2), s. 17–32.
Banaś-Stankiewicz U., 2007d: Roślinność torfowisk mszarnych Specjalnego Obszaru
Ochrony„Ostoja Goleniowska” na Pomorzu Zachodnim. Cz. IV. Zbiorowiska torfowisk wysokich z klasy Oxycocco-Sphagnetea Br.-Bl. et R. Tx. 1943. Folia Univ.
Stetin., Ser. Agric., Aliment., Pisc., Zootech., 257 (3), s. 23–38.
Banaś-Stankiewicz U., 2007e: Roślinność torfowisk mszarnych Specjalnego Obszaru
Ochrony„ Ostoja Goleniowska” na Pomorzu Zachodnim. Cz. V. Zbiorowiska leśne
z klas Alnetea Glutinosae Br.-Bl. et R. Tx. 1943 i Vaccinio-Piceetea Br.-Bl. 1939.
Folia Univ. Stetin., Ser. Agric., Aliment., Pisc., Zootech., 259 (4), s. 7–18.
Borówka R., Friedrich S., Heese T., Jasnowska J., Kochanowska R., Opechowski M.,
Stanecka E., Zyska W., 2002: Przyroda Pomorza Zachodniego. Oficyna in plus.
Szczecin.
Ćwikliński E., 1988: Rośliny naczyniowe Wyspy Chrząszczewskiej. Monogr. Wyższej
Szkoły Rolniczo-Pedagogicznej w Siedlcach, 6, s. 1–86.
Czubiński Z., 1950: Zagadnienia geobotaniczne Pomorza. Bad. Fizjogr. Pol. Zach., 2 (4),
s. 439–658.
Friedrich S., 1984: Mikroflora Puszczy Goleniowskiej. Acta Mycol., 20, 2, s. 173–208.
Friedrich S., 1985: Macromycetes na tle zespołów leśnych Puszczy Goleniowskiej. Acta
Mycol., 21 (1), s. 43–76.
116
Bartosz Startek, Agnieszka Popiela
Fudali E., 1991: Zbiorowiska roślinne okrajka i potorfii torfowiska mszarnego Wrzosiec
(Puszcza Goleniowska). Zesz. Nauk. AR Szczecin, Roln., 149, 51, s. 139–155.
Fudali E., 1993: Materiały do znajomości flory i zbiorowisk mszaków Puszczy Goleniowskiej. II. Lasy Nadleśnictw Goleniów i Rokita. Zesz. Nauk. AR Szczecin,
Roln., 149, 51, s. 139–155.
Fudali E., 1993: Materiały do znajomości flory i zbiorowisk mszaków Puszczy
Goleniowskiej (Nizina Szczecińska). I. Torfowisko mszarne Wrzosiec. Bad. Fizjogr.
Pol. Zach., Ser. B Bot., 43, s. 171–186.
Fudali E. Popiela A., 1994: Przemiany roślinności okrajka i potorfii torfowiska mszarnego „Wrzosiec” (Puszcza Goleniowska). Prz. Przyr., Ser. Przyr., 155, 54, s. 217–236.
Grinn-Gofroń A., Ciaciura M., 2000: Nowe stanowisko długosza królewskiego Osmunda
regalis w Nadleśnictwie Rokita. Chrońmy Przyr. Ojczystą, 56, 5, s. 18–21.
Grinn–Gofroń A., Ciaciura M., 2002: Stanowiska naparstnicy purpurowej Digitalis purpuera na Pomorzu Zachodnim. Chrońmy Przyr. Ojczystą, 58, 4, s. 103–105.
Jasnowski M., 1962: Budowa i roślinność torfowisk Pomorza Zachodniego. Szczecińskie
Wydawnictwo Naukowe, Wydz. Nauk Przyr.- Rol., 10, s. 3–340.
Jasnowski M., Jasnowska J., Markowski S. 1965: Rośliny naczyniowe torfowisk Pomorza
Szczecińskiego. Uzupełnienie I. Fragm. Flor. Geobot., 11 (1), s. 13–22.
Kondracki J., 2002: Geografia regionalna Polski. PWN, Warszawa.
Król S., 1991: Progresja cisa pospolitego Taxus baccata L. w Nadleśnictwie Rokita
na Pomorzu Szczecińskim. Chrońmy Przyr. Ojczystą, 54, 6, s. 52–60.
Mirek Z., Piękoś-Mirkowa H., Zając A., Zając M., 2002: Flowering plants and pteridophytes of Poland. A checklist. W. Szafer Institute of Botany, Polish Academy
of Sciences, Kraków.
Mirek Z., Zarzycki K., Wojewoda W., Szeląg Z. (red.), 2006: Red list of plants and fungi
in Poland. Czerwona lista roślin i grzybów Polski. Instytut Botaniki im. W. Szafera,
Polska Akademia Nauk, Kraków.
Piotrowska H., 1966a: Rośliny naczyniowe wysp Wolina i południowo-wschodniego
Uznamu. PTPN, Wydz. Matemat.-Przyr., Prace Kom. Biol., 30 (4), s. 1–283.
Piotrowska H., 1966b: Stosunki geobotaniczne wysp Wolina i południowo-wschodniego
Uznamu. Monogr. Bot., 22, s. 1–156.
Popiela A., 2004: Phytogeographical aspects of distribution of forest species in the
Pomerania region (NW Poland). Bot. Jahr., 125 (2), s. 97–228.
Więcław H., 2006: Flora roślin naczyniowych Ińskiego Parku Krajobrazowego i jej antropogeniczne przeobrażenia, cz. I. Wyd. Nauk. US, Szczecin.
117
Materiały do flory naczyniowej...
Zając A., Zając M., Ciaciura M., 1993: Rośliny naczyniowe zaodrza (na zachód od
Szczecina). Szczecin, s. 1–151.
Zając A., Zając M. (red.), 2001: Atlas rozmieszczenia roślin naczyniowych w Polsce.
– Distribution Atlas of Vascular Plants in Poland. Pracownia Chorologii
Komputerowej Instytutu Botaniki Uniwersytetu Jagiellońskiego, Kraków.
Ziarnek K., 2002: Dynamika flory roślin naczyniowych Puszczy Bukowej pod Szczecinem.
Praca doktorska. Instytut Biologii Środowiska UAM, Poznań (maszynopis).
DATA RE VASCULAR FLORA OF THE PUSZCZA GOLENIOWSKA
PRIMEVAL FOREST (NW POLAND)
Summary
New sites of 15 rare vascular plants species in the western part of Pomerania
associated mainly with peat ecosystem are given, among other: Scheuchzeria palustris
L., Drosera intermedia Hayne, Wolffia arrhiza (L.). Distribution maps of the discussed
species are provided.
Translated by A. Popiela
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
ANNA SZEFNER-MIRZOŁEMSKA
Uniwersytet Szczeciński
OCENA WYBRANYCH PARAMETRÓW HEMATOLOGICZNYCH
BYDŁA RASY HOLSZTYŃSKO-FRYZYJSKIEJ
The estimation of chosen hematological parameters of the cattle
of the Holstein-Frisian breed
Słowa kluczowe: bydło, rasa holsztyńsko-fryzyjska, parametry hematologiczne
Key words: cattle, Holstein-Frisian race, hematological parameters
1. Wstęp
Pomorze Zachodnie ma sprzyjające warunki do chowu i hodowli bydła.
Dogodne położenie tego regionu, a także dobre połączenia komunikacyjne z innymi miastami oraz bliskość Niemiec stwarzają duże możliwości związane z rynkiem zbytu produktów pochodzenia mlecznego i mięsnego (Szymańska 2002).
Rasa krów holsztyńsko-fryzyjska (hf) jest najbardziej rozpowszechniona
w Polsce. Jej udział w ogólnym pogłowiu krów użytkowanych mlecznie stanowi
ponad 90% (Litwińczuk i in. 2006). Holsztyno-fryzy są bydłem wcześnie dojrzewającym. Umaszczenie zwierząt może być czarno-białe lub czerwono-białe.
Rzadziej niż u innych odmian rasy czarno-białej (cb) obserwuje się stany zapalne
wymienia (mastitis). Wymiona są dobrze przystosowane do doju mechanicznego
(Szymańska 2002). Według danych Krajowego Centrum Hodowli Zwierząt za
rok 2004, krowy tej rasy charakteryzuje wysoka wydajność mleczna (6186 kg)
przy stosunkowo dużej zawartości tłuszczu (4,21%). Coraz większej wydajności
krów towarzyszy zwykle pogorszenie zdrowotności, wskaźników rozrodu, częst-
120
Anna Szefner-Mirzołemska
sze występowanie chorób metabolicznych, w konsekwencji czego dochodzi do
skrócenia okresu użytkowania krów i pogorszenia opłacalności produkcji mleka
(Mordak 2008). Szczególnie na fermach bydła, uzyskujących wysoki poziom produkcji, obserwuje się częste występowanie wielu problemów zdrowotnych (Mordak 2008). Rozwój nauk technicznych oraz biochemii pozwolił poznać budowę
i czynności podstawowych elementów tworzących żywe organizmy. Poznano
funkcję białek, cukrów i tłuszczów jako zasadniczych składników budulcowych
i energetycznych. W kontrolowaniu zagrożeń dobrostanu i zdrowia zwierząt
istotną rolę odgrywają zarówno badania kliniczne, jak i analizy laboratoryjne.
Wśród rozmaitych analiz duże znaczenie diagnostyczne mają badania krwi, stanowiące element ułatwiający diagnozę lub o niej rozstrzygający (Mordak 2008;
Zaremba 1973).
Krew jest najbardziej cennym materiałem w badaniach laboratoryjnych;
jest płynem ustrojowym spełniającym wiele zadań. Składa się z części płynnej
i z elementów upostaciowanych. Do elementów upostaciowanych należą: krwinki czerwone (erytrocyty), krwinki białe (leukocyty), płytki krwi (trombocyty).
Ich rola w ustroju jest bardzo różnorodna, a liczba waha się w zależności od rozmaitych czynników wpływających pobudzająco lub hamująco na układ krwionośny (Woschnagg, Wolfgang 2000; Zaremba 1973). Badanie stosunku między
poszczególnymi składnikami krwi oraz oznaczenie ich ogólnej zawartości ma
duże znaczenie w diagnozowaniu schorzeń, pozwala zobrazować stan różnych
gatunków zwierząt, w tym przeżuwaczy (Mordak 2008; Sobiech i in. 2005). Oddziałujące na zwierzęta czynniki środowiskowe decydują nie tylko o ich produkcyjności, ale też w znacznym stopniu o ich zdrowiu, co objawia się w wartościach parametrów hematologicznych krwi. Krew jest bowiem bardzo czułym
wskaźnikiem zmian metabolicznych, zarówno w warunkach fizjologicznych, jak
i patologicznych zwierząt (Wójcik i in. 2004a).
Prawidłowo prowadzona profilaktyka w dużej mierze pozwala ograniczyć
występowanie w wysoko produkcyjnych stadach chorób, które mają swoje podłoże w błędach żywieniowych. Od kilkunastu lat trwają badania nad szybkim,
tanim, skutecznym profilaktycznym sposobem diagnozowania stanu zdrowia
stad bydła. Często stosowana przez lekarzy weterynarii ocena stanu zdrowotnego
krów na podstawie wskaźników hematologicznych (profil metaboliczny) odbywa
się najczęściej w trakcie trwania choroby i przez to ma mniejsze znaczenie w profilaktyce występowania chorób metabolicznych (Szewczyk i in. 2006). W skład
badania hematologicznego wchodzą oznaczenia dotyczące morfologii krwi, które
Ocena wybranych parametrów hematologicznych...
121
stanowią najczęściej wykonywany profil badań diagnostycznych. Podstawą oceny zasadniczych parametrów hematologicznych jest analiza liczby erytrocytów,
leukocytów i trombocytów, a także poziomu hemoglobiny, wskaźnika hematokrytowego i wskaźników czerwonokrwinkowych (Szymańska 2002).
Celem pracy była analiza wskaźników hematologicznych krwi bydła rasy
holsztyńsko-fryzyjskiej w zależności od wieku i parametrów hodowlano-produkcyjnych.
2. Materiały i metody badań
Badaniem objęto 90 krów rasy holsztyńsko-fryzyjskiej klinicznie zdrowych
w różnym wieku. Przebadano: 30 cieląt (od 15. do 29. tygodnia życia), 30 jałówek (od 11. do 24. miesiąca życia), 30 krów dorosłych (od 2. do 6. roku życia).
Zwierzęta pochodziły z trzech gospodarstw Spółdzielczej Agrofirmy w Witkowie
w województwie zachodniopomorskim. W okresie badań krowy były karmione
dwa razy dziennie kiszonką przygotowaną (według systemu TMR) z kukurydzy, traw, lucerny, roślin zbożowych z użyciem preparatów Labacsil Bakterie
i Labacsil Acid, Lactoma, Protamilk oraz mieszankami witaminowo-mineralnymi Camisan, Profisan lub Topian. Krew do badań pobrano w okresie jesiennym
przed rannym karmieniem, z żyły szyjnej, do małych próbówek (2 ml) z antykoagulantem.
Zakres przeprowadzonych badań obejmował oznaczenie liczby leukocytów (WBC), trombocytów (PLT), stężenia hemoglobiny (Hb), wskaźnika hematokrytowego (Hct) oraz średniego stężenia hemoglobiny w krwince czerwonej
(MCHC). Dodatkowo, tabelę 1 uzupełniono wynikami badań subpopulacji leukocytów z podziałem na dwie grupy. Mianowicie w wierszu oznaczonym symbolem GRANS zestawiono wartości granulocytów (sumarycznej zawartości: eozynofilii, neutrofilii oraz bazofilii), natomiast w wierszu oznaczonym symbolem
L/M – wartości subpopulacji agranulocytów, tj. sumarycznego udziału limfocytów i monocytów.
Wszystkie uzyskane wyniki liczbowe opracowano statystycznie za pomocą
programu Statistica 5.1, metodą jednoczynnikowej analizy wariancji, a istotność
różnic oszacowano metodą porównania Post hoc w dwóch testach:
1) NIR (najmniejszej istotnej różnicy),
2) Newmana-Keulsa
(oba testy dały zgodność szacowania istotności).
122
Anna Szefner-Mirzołemska
Po analizie statystycznej badania uzupełniono o wyliczenie stosunku granulocytów i agranulocytów.
3. Wyniki badań i omówienie
Uzyskane wyniki badań scharakteryzowano w tabeli 1 za pomocą podstawowych wielkości statystyki opisowej: średniej arytmetycznej, odchylenia standardowego oraz wartości minimalnej i maksymalnej w próbie.
Analiza wariancji zmiennej grupującej, za którą uznano badane bydło pogrupowane w klasy: cielęta, jałówki i krowy, wykazuje bardzo małe wartości
poziomów istotności, które są mniejsze od p < 0,000001, dla wszystkich podstawowych wskaźników hematologicznych badanego bydła (Mańczak 1976).
Oznacza to silną zależność między podstawowymi wskaźnikami hematologicznymi a wiekiem bydła. Rysunki 1–3 przedstawiają położenie wartości średniej
dla poszczególnego wskaźnika hematologicznego względem średniej wartości
referencyjnej wyrażonej w procentach. Podstawowe wskaźniki czerwonokrwinkowe w populacji badanego bydła (tabela 1, rys. 1 i 2) mieszczą się w przedziałach przyjmowanych wartości referencyjnych. W tym stężenie hemoglobiny (Hb)
oraz wskaźnik hematokrytowy (Hct) badanych cieląt i jałówek jest nieznacznie
mniejszy od przedziału wartości referencyjnych (patrz rys. 1 i 2) i nie przekracza
(–12%) wartości oczekiwanej. Dla krów dorosłych wartości średnie tych wskaźników są niższe o 20% wartości oczekiwanej, ale, jak zaznaczono poprzednio,
mieszczą się w przyjętych zakresach wartości referencyjnych. Podobnie wskaźnik PLT (rys. 3) nie odbiega więcej niż ±20% przedziału referencyjnego, zarówno dla cieląt (–20%), jałówek (–12%), jak i krów dorosłych (+6%).
W ogólnej diagnostyce klinicznej szczególnie ważne są zmiany zachodzące
w obrazie krwinek białych. Warunkiem ich oceny jest znajomość wartości prawidłowych i rozpiętości wahań fizjologicznych. Już ogólna liczba leukocytów ma
pewne znaczenie w diagnostyce (Begemann 1985). Średnia liczba leukocytów
we krwi badanego bydła wahała się w przedziale 7,9÷15,6 [G/L]. Wartości średnie dla badanej grupy jałówek (9,6 G/L) i krów (7,9 G/L) mieszczą się w zakresie
wartości referencyjnych. Z kolei liczba leukocytów we krwi wszystkich objętych
badaniem cieląt była podobna i wynosiła 15,6 [G/L] (na rys. 3 odchylenie to
wynosi +95% względem wartości oczekiwanej przedziału referencyjnego) oraz
znacznie przekraczała wartości referencyjne podawane przez Winnicką (2004)
i LABO-WET. Podwyższoną liczbę leukocytów spotykamy w prawie wszystkich
chorobach zakaźnych, jako wyraz ostrego procesu zapalnego, nie otrzymując
jednak na tej podstawie żadnych wskazówek (Begemann 1985).
Ocena wybranych parametrów hematologicznych...
123
Tabela 1. Wartości parametrów hematologicznych bydła rasy holsztyńsko-fryzyjskiej
w gospodarstwach „Witkowo” w województwie zachodniopomorskim
Table 1. Values of hematological parameters of cattle of the Holstein-Frisian race
in farms „Witkowo” in Westpomeranian province
Badana próba
Stężenie
hemoglobiny
(HGB)
(Hb)
[g/dL]
Wskaźnik
hematokrytowy
Hct
[L/L]
Średnie
stężenie
hemoglobiny
w krwince
MCHC
[g/dL]
Liczba
leukocytów
parametr
WBC
[G/L]
w tym
GRANS
[G/L]
Liczba
trombocytów
w tym
L/M
[G/L]
PLT
[G/L]
Wartości statystyki opisowej
Statystyczna
istotność
różnic
między
grupami
bydło
średnia
odchylenie
standardowe
Cielęta
9,6
1,1
7,8
11,4
a
Jałówki
10,1
0,9
8,4
11,8
a
Krowy
8,97
0,8
7,8
10,6
b
Cielęta
0,305
0,033
0,246
0,380
a
Jałówki
0,306
0,025
0,257
0,356
a
Krowy
0,267
0,025
0,231
0,325
b
Cielęta
31,5
0,9
29,2
33,6
a
Jałówki
32,8
0,6
31,6
34,2
b
Krowy
33,5
0,9
30,9
35,9
c
Cielęta
15,6
2,8
10,7
20,8
a
Jałówki
9,6
2,4
4,8
15,7
b
Krowy
7,9
1,4
6,0
11,3
c
Cielęta
3,4
2,1
0,9
10,6
a
Jałówki
2,9
1,1
1,4
5,9
b
Krowy
2,3
0,9
1,1
4,6
b
Cielęta
12,2
2,3
8,8
18,2
a
Jałówki
6,7
1,6
3,4
9,8
b
Krowy
5,6
0,9
4,1
7,6
c
Cielęta
269
111
390
808
a
Jałówki
296
66
124
422
b
Krowy
358
72
237
528
c
min.
max.
Wartości
referencyjne
8,00÷14,00*
8,0÷14,0**
0,24÷0,46*
0,25÷0,42**
30÷36***
27,0÷34,9**
4,00÷12,00*
4,0÷12,0**
2,0÷6,0**
3,0÷7,5**
150÷650***
175÷500**
Objaśnienia: * – wartości referencyjne według Winnickiej (2004), ** – wartości referencyjne według katalogu firmy „LABO-WET” w Szczecinie, *** – wartości referencyjne według
Janeczek i in. 1991, a, b, c – różnymi literami zaznaczono (efekty) różnice średnich
między grupami istotne statystycznie przy p < 0,05.
124
Anna Szefner-Mirzołemska
Z dodatkowych badań subpopulacji leukocytów WBC wynika, że na znaczny
wzrost liczby leukocytów u badanych cieląt ma wpływ duża (względem wartości
referencyjnych) liczba agranulocytów, czyli sumaryczna zawartość limfocytów
i monocytów (tabela 1). Z rysunku 3 można odczytać, że wskaźnik L/M dla cieląt
wynosi +132% i przekracza ponad dwukrotnie ogólnie przyjęte wartości referencyjne. Uzyskana średnia wartość liczby granulocytów w badanej grupie cieląt
kształtowała się nieco poniżej przedziału wartości referencyjnych. Na podstawie
przeprowadzonych analiz można stwierdzić, że wszystkie średnie wartości badanych parametrów u jałówek i krów mieściły się w granicach normy fizjologicznej
podawanych dla zdrowego bydła przez Winnicką (2004).
50
40
30
Odchylenie, %
20
10
HGB
0
Hct
CielĊta
-10
Jaáówki
Krowy
ref max
ref min
-20
-30
-40
-50
Rys. 1. Odchylenie wskaźników czerwonokrwinkowych od wartości średniej przedziału
referencyjnego (wartości oczekiwanej) według LABO-WET dla badanej populacji bydła rasy holsztyńsko-fryzyjskiej w gospodarstwach „Witkowo” w województwie zachodniopomorskim
Fig. 1. Deviation of coefficients of red blood corpuscles from the mean value of interval section of reverence according to LABO-WET for the examined population
of cattle bloods of the Holstein-Frisian breed in farms „Witkowo” Westpomeranian
province
125
Ocena wybranych parametrów hematologicznych...
15
10
Odchylenie, %
5
MCHC
ref max
0
CielĊta
Jaáówki
Krowy
ref min
-5
-10
-15
Rys. 2. Odchylenie wskaźnika MCHC od wartości średniej przedziału referencyjnego dla badanej populacji bydła rasy holsztyńsko-fryzyjskiej w gospodarstwach
„Witkowo” w województwie zachodniopomorskim
Fig. 2. Deviation of coefficient of MCHC from the mean value of interval section of reverence for the examined population of cattle bloods of the Holstein-Frisian breed
in farms „Witkowo” Westpomeranian province
150
100
Odchylenie, %
WBC
50
GRANS
L/M
PLT
ref max
0
CielĊta
Jaáówki
Krowy
ref min
-50
-100
Rys. 3. Odchylenie wskaźników białokrwinkowych i PLT od wartości średniej przedziału referencyjnego dla badanej populacji bydła rasy holsztyńsko-fryzyjskiej w gospodarstwach „Witkowo” w województwie zachodniopomorskim
Fig. 3. Deviation of coefficients of white blood corpuscles and PLT from the mean value
of interval section of reverence for the examined population of cattle bloods of the
Holstein-Frisian breed in farms „Witkowo” Westpomeranian province
126
Anna Szefner-Mirzołemska
Należy podkreślić, że badania były prowadzone jesienią, a w okresie letnim
krowy i jałówki często przebywały na pastwisku. Pobierały z runi prawie całą
dzienną dawkę suchej masy, dostarczając tym samym zgodną z zapotrzebowaniem ilość energii, białka oraz składników mineralnych (Wójcik i in. 2004b).
Niepokojące wysokie wskaźniki WBC zaobserwowano we krwi badanych cieląt
(urodzonych latem). Chociaż Baumgartner (Mordak 2008) podaje szeroki zakres
wartości referencyjnych dla cieląt, to jednak w badaniach własnych ilość leukocytów znacznie je przekraczała. Możliwe, iż sezon urodzenia miał wpływ na stan
zdrowia badanych cieląt. Do podobnych wniosków doszli Szewczuk i in. (2006),
którzy stwierdzili największy procent zwierząt chorych wycielonych w okresie
jesienno-zimowym, natomiast najmniejszy latem. To tłumaczyłoby podwyższoną ilość leukocytów. Trzeba pamiętać, że wychów cieląt stanowi jeden z najistotniejszych etapów w cyklu produkcji mleka i mięsa wołowego. Najtrudniejszym
okresem są pierwsze miesiące życia cieląt. Młode zwierzęta są podatne na choroby, których przebycie rzutuje na późniejszą użytkowość i opłacalność produkcji
(Szulc, Zachwieja 1996). Systematycznie prowadzona opieka nad stadem przynosi poprawę ogólnej zdrowotności zwierząt, ich płodności i wydajności mlecznej, a także pozwala stwierdzić odpowiednio wcześnie zagrożenia wynikające
z wpływu negatywnych czynników (Losandi i in. 2004). Należy pamiętać, że
wyniki badań laboratoryjnych krwi powinny być oceniane w kontekście badań
klinicznych, kondycji krów, ich wydajności, składu dawki pokarmowej oraz analizy mleka, moczu i kału (Szulc, Zachwieja 1996).
4. Wnioski
Przedstawiona ocena wybranych parametrów hematologicznych krwi krów
rasy holsztyńsko-fryzyjskiej ma dużą wartość diagnostyczną w praktyce weterynaryjnej. Na podstawie przeprowadzonych badań można stwierdzić, że:
1) wszystkie średnie wartości badanych parametrów u jałówek i krów mieściły
się w granicach wartości referencyjnych,
2) niepokojąco wysokie wskaźniki WBC zaobserwowano we krwi badanych
cieląt (urodzonych latem),
3) dysproporcje wskaźników można tłumaczyć tym, że hodowcy więcej uwagi
poświęcali jałówkom i krowom jako materiałowi reprodukcyjnemu (badania
prowadzono jesienią – po letnim wypasie krów i jałówek).
Ocena wybranych parametrów hematologicznych...
127
BIBLIOGRAFIA
Begemann H., 1985: Hematologia praktyczna. PZWL, Warszawa, s. 17–79.
Berleć K., Traczykowski A., 2004: Wpływ wybranych probiotyków na kształtowanie się
makroelementów w surowicy krwi cieląt. „Zootechnika Li”, 501.
Janeczek W., Chudoba-Drozdowska B., Rojkowski A., Szulc T, 1991: Kształtowanie się
poziomów wybranych wskaźników krwi krów dokarmianych przed porodem różnymi
dodatkami paszowymi. Zesz. Nauk. Rol. Wrocław, XXXV, s. 17–31.
Kupczyński R., Adamski M., 2004: Kształtowanie się wybranych parametrów krwi cieląt
w zależności od stanu ich zdrowia. „Zootechnika Li”, 501.
Litwińczuk A., Barłowska J., Król J., Sawiska W., 2006: Porównanie składu chemicznego i zawartości mocznika w mleku krów czarno-białych i simentalskich z okresem żywienia letniego i zimowego. Annales Universitatis Mariae Curie-Skłodowska,
vol. XXIV, s. 10.
Losandi B., Czerniewska-Piątkowska E., Kamieniecki H., 2004: Wpływ sezonu odchowu
jałówek rasy holsztyńsko-niemieckiej z terenów Pomorza Przedniego na ich wzrost
i rozwój. Zootechnika Li, 501.
Mańczak K., 1976: Technika planowania eksperymentu. Towarzystwo Naukowo-Techniczne, Warszawa.
Mordak R., 2008: Podstawowe parametry biochemiczne i hematologiczne w monitorowaniu zdrowia bydła. Życie Weterynaryjne, 83 (7).
Sobiech P., Zbanyszek M., Kuleta Z., 2005: Wskaźniki krzepnięcia krów rasy h-f. Annales
Universitatis Mariae Curie-Skłodowska, vol. LX, s. 19.
Szewczuk M., Kamieniecki H., Czerniawska-Piątkowska E., Szatkowska I., 2006: Wpływ
sezonu urodzenia na zdrowotność i wyniki cieląt. Acta Sci. Pol., Zootechnica, 5 (2),
s. 119–124.
Szulc T., Zachwieja A., 1996: Możliwości sterowania składem siary krów. IV Szkoła
Zimowa, Wydaw. AR, Kraków, s. 56–65.
Szymańska A., 2002: Użytkowanie krów holsztyńsko-fryzyjskich w warunkach polskich.
Negatyw, Warszawa.
Winnicka A., 2004: Wartości referencyjne podstawowych badań laboratoryjnych w weterynarii. Wydawnictwo SGGW, Warszawa.
Woschnagg H., Wolfgang E., 2000: Jak interpretować wyniki badań. Bertelsmann,
Warszawa, s. 20–37.
128
Anna Szefner-Mirzołemska
Wójcik A., Mituniewicz T., Iwańczuk-Czernik K., Sowińska J., Witkowska D., 2004a:
Analiza wskaźników krwi bydła mięsnego rasy charolaise i limousine w aspekcie
dobrostanu. Zootechnika Li, 501.
Wójcik A., Mituniewicz T., Iwańczuk-Czernik K., Sowińska J., Witkowska D., 2004b:
Ocena dobrostanu bydła mięsnego ras charolaise i limousin w okresie pastwiskowym na podstawie analizy warunków utrzymania oraz wyników produkcyjnych.
Zootechnika Li, 501.
Zaremba B., 1973: Lekarski poradnik domowy. PZWL, Warszawa, s. 763–764.
THE ESTIMATION OF CHOSEN HEMATOLOGICAL PARAMETERS
OF THE CATTLE OF THE HOLSTEIN-FRISIAN BREED
Summary
The race of cows of Holstein-Frisian of the breed black and white is most widespread in Poland. The more and more greater efficiency of cows accompanies among
other things the worsening of the wholesomeness, indicators of the reproduction, more
and more frequent cases of metabolic illnesses, and a consequence is this the shortening
of the useful life of cows and the worsening of the profitability of the production of the
milk. In the paper one made estimations hematological parameters the cattle depen-ding
on the age and his good-condition. With the investigation one embraced 90 pieces
of the cattle (calves, heifers and cows), come from three farms „Agrofirma” in Witkowo.
Received in research of the value of hematological parameters at calves were indeed
higher with relation to of received values for adult individuals.
Translated by Anna Szefner-Mirzołemska
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
PAWEŁ SZNIGIR
JAN KĘPCZYŃSKI
Uniwersytet Szczeciński
REAKCJA NA REGULATORY WZROSTU NASION
AMARANTHUS RETROFLEXUS L. INKUBOWANYCH
W GLEBIE PRZEZ OKRES ZIMOWY
Reaction to plant growth regulators of Amaranthus retroflexus L.
seeds buried in soil for winter period
Słowa kluczowe: Amaranthus retroflexus L., spoczynek pierwotny nasion, regulatory
wzrostu, spoczynek-środowisko
Key words: Amaranthus retroflexus L., primary seed dormancy, plant growth regulators,
dormancy-environment
1. Wstęp
Nasiona po zbiorze lub opuszczeniu roślin macierzystych mogą się znajdować w stanie spoczynku pierwotnego, który umożliwia im przetrwanie niekorzystnych warunków środowiska (Baskin, Baskin 1998). Spoczynek bywa
zaindukowany w nasionach w trakcie ich rozwoju. Istnieje możliwość, że po
wytworzeniu się nasion będą one niespoczynkowe. W nasionach pierwotnie spoczynkowych oraz w niespoczynkowych może zostać zaindukowany spoczynek
wtórny przez niekorzystne czynniki zewnętrzne (Bewley, Black 1994).
Po opuszczeniu rośliny macierzystej nasiona są przenoszone w różne miejsca lub zasilają glebowy bank nasion. W nasionach znajdujących się w glebowym banku nasion spoczynek pełni funkcję regulatora, w odpowiednich warunkach do kiełkowania ustępuje, a w niekorzystnych się utrzymuje. Indukcja oraz
130
Paweł Sznigir, Jan Kępczyński
ustępowanie spoczynku są kontrolowane przez czynniki środowiska, m.in. przez
temperaturę, światło, azotany etc. (Baskin, Baskin 1998; Finch-Savage, Leubner-Metzger 2006).
Regulatory wzrostu odgrywają istotną rolę podczas ustępowania spoczynku
i kiełkowania nasion (Bewley, Black 1994). Ustąpienie spoczynku jest możliwe
po obniżeniu zawartości inhibitorów w nasionach – np. kwasu abscysynowego
– oraz zwiększeniu syntezy stymulatorów, takich jak gibereliny, cytokininy czy
etylen. Nasiona można wyprowadzić ze spoczynku traktując je odpowiednimi
fitohormonami. Do tej pory opublikowano niewiele prac dotyczących oceny
wrażliwości na egzogenne fitohormony nasion inkubowanych w glebie przez kilka lub kilkanaście miesięcy.
Celem badań było określenie wrażliwości na giberelinę A3 (GA3), etefon
(ETH) oraz kwas abscysynowy nasion Amaranthus retroflexus L. inkubowanych
w glebie od listopada do czerwca.
2. Materiał i metody
Nasiona Amaranthus retroflexus L. zostały zebrane w Lubniewicach w województwie lubuskim we wrześniu 2006 roku z areału około 100 m2. Następnie odważono 36 prób po 12 gram i wsypano do nylonowych woreczków, po
czym umieszczono je w drewnianych skrzynkach powleczonych zbrojoną siatką
zabezpieczającą nasiona przed gryzoniami. Skrzynki zakopano w glebie w ten
sposób, by woreczki z nasionami znajdowały się na głębokości 10 cm. Doświadczenie rozpoczęto 6 listopada 2006 roku, a trwało do 15 czerwca 2007 roku. Pomiaru temperatury dokonywano dwa razy w tygodniu w południe na głębokości
10 cm. Próbki nasion pobierano w miesięcznych odstępach czasu, zabezpieczając
je przed naświetleniem, gdyż są wrażliwe na światło.
Nasiona odliczano w ciemni, przy zielonym świetle, które nie wpływa na
ich kiełkowanie. Po odliczeniu nasiona wkładano do szalek wyłożonych bibułą,
wysyconą 1,5 ml wody, roztworu gibereliny A3, etefonu lub kwasu abscysynowego. Szalki z nasionami umieszczono w cieplarce w temperaturze 25°C bez dostępu światła. W doświadczeniach stosowano 50 nasion w trzech powtórzeniach.
Liczbę skiełkowanych nasion określano po 1, 4 i 9 dniach inkubacji. Wykresy oraz statystyka zostały wykonane w programie MS OFFICE 2000 – Excel.
Reakcja na regulatory wzrostu...
131
3. Wyniki badań i dyskusja
Nasiona Amaranthus retroflexus L. bezpośrednio po zbiorze skiełkowały
w niewielkim stopniu; stwierdzono tylko 1% skiełkowanych nasion w temperaturze 25°C (rys. 1). Wcześniej wykazano, że nasiona Amaranthus retroflexus L.
nie kiełkują w temperaturze poniżej 35°C, ponieważ znajdują się w spoczynku
pierwotnym (Kępczyński i in. 1996). Spoczynek ten ustępował w wyniku przechowywania nasion w stanie powietrznie suchym w temperaturze 25°C przez
kilka miesięcy.
Nasiona Amaranthus retroflexus L. inkubowane w glebie na głębokości
10 cm od listopada do grudnia skiełkowały w 25°C w około 55% (rys. 2). W miarę upływu czasu przebywania w glebie procent skiełkowanych nasion zwiększał
się, osiągając maksymalną wartość w marcu, a więc po 4 miesiącach. Po tym
czasie skiełkowało około 90% nasion, co wskazuje na prawie całkowite ustąpienie spoczynku. Zwiększanie się zdolności do kiełkowania nasion było skorelowane z temperaturą 5°C panującą w glebie, utrzymującą się od grudnia do marca. Jest to zgodne z zasadą, że spoczynek nasion tzw. roślin letnich (summer
annuals) ustępuje w miesiącach zimowych (Baskin, Baskin 1998). Derkx i Karssen (1993), wykorzystując nasiona Sissymbrium officinale, wykazali, że głównym
czynnikiem regulującym spoczynek jest temperatura. W wyniku oddziaływania
temperatury spoczynek nasion ustępuje lub jest indukowany w nasionach niespoczynkowych. Podwyższanie temperatury od marca wiązało się z obniżaniem
zdolności do kiełkowania nasion. Nasiona przetrzymywane w glebie do czerwca
skiełkowały w około 40% (rys. 2). Może to sugerować indukcję wtórnego spoczynku u części nasion.
Stwierdzono, że GA3 nie wpływała na kiełkowanie nasion spoczynkowych,
a etefon nieznacznie podwyższał procent nasion skiełkowanych (rys. 1). Brak lub
słaba reakcja na wymienione regulatory sugeruje wyjątkowo głęboki spoczynek
nasion zebranych w 2006 roku. Nasiona zebrane w latach 1987, 1989 i 1992
wykazały znacznie większą wrażliwość na giberelinę i etefon (Kępczyński i in.
1996).
Etefon stymulował kiełkowanie nasion inkubowanych w glebie przez miesiąc (rys. 3). Spowodował on skiełkowanie 90% nasion już po jednym dniu inkubacji. Wysoka wrażliwość na etefon utrzymywała się do marca, w kolejnych
miesiącach nasiona charakteryzowały się brakiem wrażliwości na ten związek.
Etylen, a także etefon, związek uwalniający etylen, stymulują kiełkowanie znaj-
132
Paweł Sznigir, Jan Kępczyński
dujących się w spoczynku pierwotnym lub wtórnym nasion Amaranthus paniculatus, Helianthus annuus, Rumex crispus (Kępczyński, Kępczyńska 1997).
Nasiona Amaranthus retroflexus L. są bardzo wrażliwe na etylen, nawet niewielkie jego stężenie oraz bardzo krótki czas traktowania powodowały ustąpienie
spoczynku (Schonbeck, Egley 1981). Etylen stymuluje również kiełkowanie nasion w niekorzystnych dla tego procesu warunkach, na przykład supraoptymalnej
i suboptymalnej temperaturze, zasoleniu lub deficycie wody (Kępczyński, Kępczyńska 1997).
Od dawna znany jest fakt, że gibereliny indukują ustępowanie pierwotnego i wtórnego spoczynku nasion wielu gatunków roślin, np. Amaranthus caudatus (Kępczyński i in. 2006), Chenopodium bonus-henricus L. (Khan, Karssen
1980), Sissymbrium officinale L. (Derkx, Karssen 1993) oraz Malus domestica
(Smoleńska, Lewak 1974). Giberelinami można zastąpić światło wymagane do
ustąpienia spoczynku nasion tytoniu (Leubner-Metzger 2003). Stwierdzono, że
giberelina A3 nie wpływała na szybkość kiełkowania nasion Amaranthus retroflexus L. inkubowanych przez miesiąc w glebie, natomiast podwyższała końcowy
procent skiełkowanych nasion; w kombinacji kontrolnej skiełkowało około 55%,
a w wyniku inkubacji w obecności gibereliny 80% nasion (rys. 4). GA3 stymulowała proces kiełkowania nasion inkubowanych w glebie przez kolejne dwa miesiące. Nasiona, które przebywały w glebie od marca do czerwca, charakteryzowały się brakiem wrażliwości na giberelinę.
Kwas abscysynowy jest odpowiedzialny za stan spoczynku pierwotnego
nasion (Bewley, Black 1994). Nadekspresja genu odpowiedzialnego za syntezę ABA powoduje wzrost jego endogennej zawartości oraz zwiększona zostaje
głębokość spoczynku (Frey i in. 1999; Thompson i in. 2000). Natomiast brak
ekspresji genu odpowiedzialnego za syntezę ABA w trakcie rozwoju nasion spowodował, że spoczynek pierwotny nie został zaindukowany (Karssen i in. 1983).
Za spoczynek wtórny nasion Amaranthus caudatus (Kępczyński, Bihun 2001)
najprawdopodobniej odpowiedzialny jest również ABA. Zablokowanie biosyntezy ABA poprzez zastosowanie jego inhibitora – fluridonu, spowodowało skiełkowanie wtórnospoczynkowych nasion Amaranthus caudatus (Kępczyński, Bihun
2001). Badano również wpływ ABA na kiełkowanie nasion Amaranthus retroflexus L. po różnym okresie ich inkubacji w glebie. Hormon ten hamował kiełkowanie nasion Amaranthus retroflexus L. przetrzymywanych od listopada do
kwietnia (rys. 3). Po 7 miesiącach przebywania w glebie, czyli od maja, nasiona
charakteryzowały się niską wrażliwością na ABA.
133
Reakcja na regulatory wzrostu...
4. Podsumowanie
Nasiona Amaranthus retroflexus L. bezpośrednio po zbiorze nie kiełkowały
w temperaturze 25ºC, ponieważ znajdowały się w głębokim spoczynku. Spoczynek ten ustępuje częściowo po miesiącu, a całkowicie po 4 miesiącach inkubowania w glebie. Obniżanie zdolności do kiełkowania po 7 miesiącach prawdopodobnie wiąże się z indukcją spoczynku wtórnego. Takie zachowanie nasion jest
typowe dla tzw. roślin letnich, których spoczynek ustępuje w okresie zimowym
(Baskin, Baskin 1998). Nasiona wykazały zróżnicowaną wrażliwość na regulatory w zależności od czasu inkubowania w glebie. Bezpośrednio po zbiorze
charakteryzowały się niską wrażliwością na etylen oraz brakiem wrażliwości
na giberelinę A3. Zapotrzebowanie na stymulatory wzrostu etylen i giberelinę
A3 było największe u nasion inkubowanych do marca, a więc znajdujących się
w częściowym spoczynku pierwotnym. Być może wynika to ze zbyt niskiej intensywności produkcji giberelin i etylenu. Nasiona inkubowane od 1 do 6 miesięcy są bardziej wrażliwe na ABA niż nasiona wtórnospoczynkowe – przebywające
w glebie przez 7 miesięcy.
Kieákowanie, %
100
Regulator, M
kontrola
0
GA
GA3 10–3
ETH
ETH 10–4
80
60
40
20
0
0
1
4
9
Czas, dni
Rys. 1. Wpływ gibereliny A3 (GA3) i etefonu (ETH) na kiełkowanie nasion spoczynkowych Amaranthus retroflexus L. w temperaturze 25°C
Fig. 1. Effect of gibberellin A3 (GA3) and ethephone (ETH) on primary dormant
Amaranthus retroflexus L. seeds germination at 25°C
134
25
80
20
60
15
40
10
20
5
Kieákowanie, %
100
0
Tempratura, °C
Paweł Sznigir, Jan Kępczyński
Kieákowanie
ĝrednia
temperatura
0
L
G
S
L
M
K
M
C
L
Czas, miesiące
Rys. 2. Wpływ inkubowania nasion Amaranthus retroflexus L. w glebie od listopada do
lipca na ich kiełkowanie
Fig. 2. Effect of soil burial of Amaranthus retroflexus L. seeds from November to June
on their germination
GrudzieĔ
100
Regulator, M
Kieákowanie, %
80
0kontrola
–3
GA
GA3 10
60
–4
ETH
ETH 10
40
ABA 10–4
ABA
20
0
0
1
4
9
Czas, dni
StyczeĔ
100
Regulator, M
80
Kieákowanie, %
0
kontrola
60
40
20
0
0
1
4
Czas, dni
9
GA3
GA
10–3
ETH
ETH
10–4
ABA
ABA
10–4
135
Reakcja na regulatory wzrostu...
Luty
100
80
Kieákowanie, %
Regulator, M
0
kontrola
60
GA3 10–3
GA
ETH 10–4
40
ETH
ABA 10–4
ABA
20
0
0
1
4
9
Czas, dni
Marzec
100
Kieákowanie, %
80
60
Regulator, M
kontrola
0
40
–3
GA
GA 3 10
ETH
ETH
10–4
20
ABA
ABA
10–4
0
0
1
4
9
Czas, dni
KwiecieĔ
100
Kieákowanie, %
80
Regulator, M
0kontrola
60
–3
GA
GA 3 10
ETH
10–4
ETH
40
ABA
ABA
10–4
20
0
0
1
4
Czas, dni
9
136
Paweł Sznigir, Jan Kępczyński
Maj
100
Kieákowanie, %
80
Regulator, M
60
kontrola
0
–3
GA
GA 3 10
40
ETH
ETH
10–4
ABA
ABA
10–4
20
0
0
1
4
9
Czas, dni
Czerwiec
100
Kieákowanie, %
80
Regulator, M
kontrola
0
60
–3
GA
GA 3 10
40
ETH
ETH
10–4
ABA
ABA
10–4
20
0
0
1
4
9
Czas, dni
Rys. 3. Wpływ regulatorów wzrostu na kiełkowanie nasion Amaranthus retroflexus L.
przetrzymywanych w glebie od listopada 2006 do czerwca 2007 roku
Fig. 3. Effect of plant growth regulators on Amaranthus retroflexus L. seeds germination
buried in soil from November to June
Reakcja na regulatory wzrostu...
137
BIBLIOGRAFIA
Baskin C.C., Baskin J.M., 1998: Seeds. Ecology, biogeography and evolution of dormancy
and germination. Academic Press, San Diego.
Bewley J.D., Black M., 1994: Seeds. Physiology of development and germination.
2nd edition. Plenum Press, New York–London.
Derkx M.P.M., Karssen C.M., 1993: Changing sensitivity to light and nitrate but not to
gibberellins regulates seasonal dormancy patterns in Sisymbrium officinale seeds.
Plant, Cell and Environment, 16, s. 469–479.
Finch-Savage W.E, Leubner-Metzger G., 2006: Seed dormancy and control of germination.
New Phytologist, 171, s. 501–520.
Frey A., Audran C., Marin E., Sotta B., Marion-Poll A., 1999: Engineering seed dormancy
by the modification of zeaxanthin epoxidase gene expression. Plant Molecular
Biology, 39, s. 1267–1274.
Karssen C.M., Brinkhorst-van der Swan D.L.C., Breekland A.E., Koornneef M., 1983:
Induction of dormancy during seed development by endogenous abscisic acid: Studies
on abscisic acid deficient genotypes of Arabidopsis thaliana (L.) Heynh. Planta, 157,
s. 158–165.
Kępczyński J., Bihun M., 2001: Wtórny spoczynek nasion Amaranthus caudatus –
znaczenie etylenu i kwasu abscysynowego. W: S.M. Rogalska, J. Domagała (red.):
Człowiek i środowisko przyrodnicze Pomorza Zachodniego. II Ogólnopolskie
Sympozjum, Szczecin, s. 240–244.
Kępczyński J., Bihun M., Kępczyńska E., 2006: Implication of ethylene in the release
of secondary dormancy in Amaranthus caudatus L. seeds by gibberellins or cytokinin.
Plant Growth Regulation 48, s. 119–126.
Kępczyński J., Corbineau F., Come D., 1996: Responsiveness of Amaranthus retroflexus
seeds to ethephon, 1-aminocyclopropane-1-carboxylic acid and gibberellic acid
in relation to temperature and dormancy. Plant Growth Regulation, 20, s. 259–265.
Kępczyński J., Kępczyńska E., 1997: Ethylene in seed dormancy and germination.
Physiologia Plantarum, 101, s. 720–726.
Khan A.A., Karssen C.M., 1980: Induction of secondary dormancy in Chenopodium bonus-henricus L. seeds by osmotic and high temperature treatments and its prevention
by light and growth regulators. Plant Physiology, 66, s. 175–181.
Leubner-Metzger G., 2003: Functions and regulation of ß-1,3-glucanase during seed
germination, dormancy release and after-ripening. Seed Science Research, 13,
s. 17–34.
138
Paweł Sznigir, Jan Kępczyński
Schonbeck M.W, Egley G.H., 1981: Phase sequence of redroot pigweed seed germination
responses to ethylene and other stimuli. Plant Physiology, 68, s. 175–179.
Smoleńska G., Lewak S., 1974: The role of lipases in the germination of dormant apple
embryos. Planta 116, s. 361–370.
Thompson A.J., Jackson A.C., Symonds R.C., Mulholland B.J., Dadswell A.R., Blake P.S.,
Burbidge A., Taylor I.B., 2000: Ectopic expression of a tomato 9-cisepoxycarotenoid
dioxygenase gene causes over-production of abscisic acid. Plant Journal, 23, s. 363–
374.
REACTION TO PLANT GROWTH REGULATORS
OF AMARANTHUS RETROFLEXUS L. SEEDS BURIED
IN SOIL FOR WINTER PERIOD
Summary
Seeds of Amaranthus retroflexus L. after harvest were buried 10 cm deep in soil
for winter period to study their sensitivity changes to exogenous plant growth regulators.
Seeds after harvest were in vdeep primary dormancy. This dormancy can be break in part
after one month of buried, and completely after 4 months. Germination decrease after
7 months it is propably related with induction of secondary dormancy. Seeds show
diverse sensitivity to phytohormones in relation of buried period. Requirement to growth
stimulators ethylene and gibberellin A3 of buried seeds was greatest until march, when
they were partly dormant. Seeds buried in soil from 1 to 6 months are more sensitive
to ABA than seeds in secondary dormancy – buried up to 7 months.
Translated by Jan Kępczyński, Paweł Sznigir
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
MARTA UMIASTOWSKA
Uniwersytet Szczeciński
FLORA I ROŚLINNOŚĆ JEZIOR ZACHODNIEJ CZĘŚCI
POJEZIERZA DRAWSKIEGO
Flora and vegetation of the lakes of western part of Drawsko Lakeland
Słowa kluczowe: rośliny naczyniowe, zbiorowiska roślinne, jeziora, Pojezierze Drawskie
Key words: vascular plant, plant communities, lakes, Drawsko Lakeland
1. Wstęp
Niniejsza praca, oparta na wynikach badań florystycznych i fitosocjologicznych, przedstawia wykaz flory naczyniowej oraz opis zbiorowisk roślinnych
15 jezior zachodniej części Pojezierza Drawskiego. Badany obszar odznacza się
bardzo dużymi wartościami przyrodniczymi, co zawdzięcza między innymi bogactwu gatunków florystycznych.
Zachodnia część Pojezierza Drawskiego obejmuje obszar o powierzchni
około 4000 ha, położony w Nadleśnictwie Złocieniec. Badany teren w około
90% pokrywają lasy. Pozostałą część stanowią torfowiska (2%) i jeziora (8%),
w tym największe jezioro Siecino (729,7 ha) oraz dwa jeziora lobeliowe – Kapka
i Czarnówek. To ostatnie oraz otoczone rozległym torfowiskiem jezioro Morzysław Mały są rezerwatami przyrody.
Zgodnie z regionalizacją fizyczno-geograficzną Polski badany teren leży
w obrębie mezoregionu Pojezierza Drawskiego (Kondracki 1981), natomiast według podziału geobotanicznego Szafera (1972) jest zaliczany do Okręgu Wałecko-Drawskiego – krainy Pojezierze Pomorskie.
140
Marta Umiastowska
2. Metody i materiał badań
Badania florystyczne i fitosocjologiczne jezior oraz ich brzegu przeprowadzono w latach 2006–2008. Wykonano 87 zdjęć florystycznych i 164 zdjęcia fitosocjologiczne. Zdjęcia florystyczne sporządzono przy zastosowaniu map
kartogramowych, opartych o sieć kwadratów ATPOL (Zając 1978), które w celu
większej dokładności prowadzonych prac dodatkowo podzielono na mniejsze
kwadraty o boku 1 km (rys. 1). Zdjęcia fitosocjologiczne wykonano klasyczną metodą Braun-Blanqueta. W tabeli fitosocjologicznej (tabela 1) zestawiono
122 zdjęcia dokumentujące zbiorowiska ze związków: Lemnion gibbae, Riccio
fluitantis-Lemnion trisulcae, Potamion, Nymphaeion, Hottonion, Sphagno-Utricularion, Lobelion, Phragmition i Magnocaricion. Pozostałych 40 zdjęć posłużyło do ogólnej charakterystyki innych fitocenonów. Przy charakterystyce zespołów
określono częstość występowania zbiorowisk (tabela 2) na podstawie współczynnika frekwencji (Kf) zaproponowanego przez Chmiela (1993).
Materiał zielnikowy zdeponowano w zbiorach Katedry Taksonomii Roślin
i Fitogeografii Uniwersytetu Szczecińskiego.
Nazwy gatunków roślin naczyniowych podano według Mirka i in. (1995).
Nomenklaturę oraz systematykę zbiorowisk roślinnych przedstawiono według
Matuszkiewicza (2001). Stopień zagrożenia zbiorowisk roślinnych określono
według kategorii sformułowanych dla Wielkopolski (Brzeg, Wojterska 1996).
3. Wyniki
SYSTEMATYCZNY WYKAZ ZBIOROWISK ROŚLINNYCH
Lemnetea minoris R. Tx. 1995
Lemnetalia minoris R. Tx. 1955
Lemnion gibbae R.Tx. et A. Schwabe 1974 in R.Tx. 1974
1. Spirodeletum polyrhizae (Kelhofer 1915) W. Koch 1954 em. R.Tx. et
A. Schwabe 1974 in R.Tx. 1974
Riccio fluitantis-Lemnion trisulcae R.Tx. et A. Schwabe 1974 in R.Tx. 1974
2. Lemnetum trisulcae (Kelhofer 1915) Knapp et Stoffers 1962
Potametea R. Tx. et Prsg. 1950
Potametalia Koch 1926
Potamion Koch 1926 em. Oberd. 1957
Grupa Potametum pectinati
3. Potametum nitensis Koch 1926
Flora i roślinność jezior...
4. Potametum pectinati Carstensen 1955
Grupa Potametum lucentis
5. Ranunculetum circinati (Bennema et West. 1943) Regal 1965
6. Elodeetum canadensis (Pign. 1953) Pass. 1964
7. Ceratophylletum demersi Hild. 1956
8. Myriophylletum spicati Soe 1927
9. Potametum compressi Tomasz. 1978
10. Potametum lucentis Hueck 1931
11. Potametum perfoliati Koch 1926 em. Pass. 1964
Nymphaeion Oberd. 1953
12. Hydrocharitetum morsus-ranae Langendonck 1935
13. Potametum natantis Soó 1923
14. Nupharo-Nymphaeetum albae Tomasz. 1977
15. Nymphaeetum candidae Miljan 1958
16. Polygonetum natansis Soó 1927
17. Potametum obtusifolii (Carst. 1954) Segal 1965
Hottonion Segal 1964
18. Hottonietum palustris R. Tx. 1973
Utricularietea intermedio-minoris Den Hartog et Segal 1964 em. Pietsch 1965
Utricularietalia intermedio-minoris Den Hartog et Segal 1964 em. Pietsch 1965
Sphagno-Utricularion Müll. et Görs 1960
19. Scorpido-Utricularietum minoris Müll. et Görs 1960
Littorelletea uniforae Br. – Bl. et R. Tx. 1943
Littorelletalia uniflorae Koch 1926
Lobelion (Van den Berghen 1944) R. Tx. et Dierss. ap. Dierss. 1972
20. Lobelietum dortmannae (Oswald 1923) R. Tx. ap. Dierss. 1972
Phragmitetea R. Tx. et Prsg. 1942
Phragmitetalia Koch 1926
Phragmition Koch 1926
Grupa szuwarów typowych z udziałem roślin wodnych
21. Scirpetum lacustris (Allorge 1922) Chouard 1924
22. Typhetum angustifoliae (Allorge 1922) Soó 1927
23. Sagittario-Sparganietum emersi R. Tx. 1953
24. Sparganietum erecti Roll. 1938
Grupa szuwarów typowych z pojawem gatunków z Magnocaricion
25. Eleocharitetum palustris Šennikow 1919
26. Equisetetum fluviatilis Steffen 1931
27. Phragmitetum australis (Gams 1927) Schmale 1939
141
142
Marta Umiastowska
28. Typhetum latifoliae Soó 1927
29. Acoretum calami Kobendza 1948
Grupa szuwarów właściwych o zmiennym poziomie wody
30. Oenatho-Rorippetum Lohm. 1950
31. Glycerietum maximae Hueck 1931
Magnocaricion Koch 1926
Zbiorowiska należące do dynamicznego kręgu olsów
32. Thelypteridi-Phragmitetum Kuiper 1957
33. Cicuto-Caricetum pseudocyperi Boer et Siss. In Boer 1942
34. Iridetum pseudacori Eggler 1933
Zbiorowiska wysokich turzyc kępkowych lub o grubych rozłogach
35. Caricetum ripariae Soó 1928
36. Caricetum acutiformis Sauer 1937
37. Cariceum paniculatae Wangerin 1916
Zbiorowiska turzyc kępkowych lub rozłogowych, przeważnie torfotwórcze
38. Caricetum rostrae Rübel 1912
Zbiorowiska o charakterze łąk turzycowych
39. Caricetum vesicariae Br-Bl. Et Denis 1926
Nietorfotwórcze szuwary turzycowe lub trawiaste terenów zalewowych
40. Caricetum vulpinae Nowiński 1928
41. Phalaridetum arundinaceae (Koch 1926 n.n.) Lib. 1931
CHARAKTERYSTYKA NIEKTÓRYCH ZESPOŁÓW
W prezentowanej pracy opisano jedynie zbiorowiska występujące najczęściej i najrzadziej oraz zagrożone wyginięciem.
Phragmitetum australis
Szuwar trzcinowy jest najpospolitszym zbiorowiskiem roślin zanotowanym na badanym obszarze, nie zaobserwowano go tylko na pięciu stanowiskach
(rys. 2). Zarasta niemal całkowicie brzeg jezior, w wielu miejscach otoczony
wąskim pasem zarośli o charakterze antropogenicznym. Zwarty łan trzcinowy,
do 2 m wysokości, pokrywa przeciętnie 80–100% powierzchni zdjęć. Liczba
gatunków roślin w badanej fitocenozie ogółem wynosi 15.
Iridetum pseudacori
Zbiorowisko kosaćca żółtego występuje na mulistym dnie akwenu na
26 stanowiskach. Tworzy niewielkie, zwarte płaty ze stałym, licznym udziałem
Flora i roślinność jezior...
143
gatunków z klasy Phragmitetea. W 10 zdjęciach zanotowano pojedyncze występowanie gatunku Iris pseudacorus.
Phalaridetum arundinaceae
Wysoki szuwar mozgowy wykształcił się na 25 stanowiskach. Z wyjątkiem trzech stanowisk, na których zanotowano pojedyncze występowanie gatunku Phalaris arundinacea, zespół ten tworzy pas roślinności graniczący z wodą
i charakteryzujący się niewielkim udziałem hydrofitów. Ogółem w badanych fitocenozach zanotowano 47 gatunków roślin naczyniowych.
Ranunculetum circinati
Zespół jaskra krążkolistnego jest rozpowszechnionym zbiorowiskiem wodnym na badanym obszarze, jednak we wszystkich zdjęciach zanotowano pojedyncze występowanie gatunku Ranunculus circinatus. Zespołowi temu towarzyszą liczne gatunki hydrofitów z klas Potametea i Lemnetea.
Myriophylletum spicati
Zespół wywłócznika kłosowego zanotowano na 19 stanowiskach. Powierzchnia występowania tego zespołu jest niewielka i w większości przypadków ogranicza się do pojedynczego występowania gatunku Myriophyllum spicatum. Zespołowi często towarzyszą zbiorowiska hydrofitów z klasy Lemnetea
i Potametea.
Potametum perfoliati
Zespół rdestnicy przeszytej należy do najpospolitszych fitocenoz z klasy
Potametea, występujących na 18 stanowiskach. Tworzy zwarte zbiorowiska, zajmujące 25–70% powierzchni zdjęcia. Zespołowi temu towarzyszą liczne gatunki
hydrofitów.
Lobelietum dortmannae
Zespół lobelii jeziornej (rys. 3) jest zbiorowiskiem typowym dla tzw. jezior lobeliowych, ograniczonych w Polsce wyłącznie do Pojezierza Pomorskiego. Na badanym obszarze zbiorowisko to wystąpiło na 4 stanowiskach, w jeziorach Kapka i Czarnówek. Jeziora te były bardzo ubogie w pozostałe zbiorowiska
hydrofitów z klas Lemnetea i Potametea.
Nymphaeetum candidae
Zespół grzybieni północnych (rys. 4), charakterystyczny dla zbiorników
ubogich w składniki pokarmowe i silnie wypłyconych, zanotowano tylko na
144
Marta Umiastowska
1 stanowisku. W badanym zdjęciu zanotowano pojedyncze występowanie gatunku Nymphaea candida.
Thelypteridi-Phragmitetum
Płaty zespołu Thelypteridi-Phragmitetum mają charakter uginającego się
pła, występującego na 11 stanowiskach. Zbiorowisko to przyczynia się do stopniowego lodowacenia się zbiorników wodnych.
Sagittario-Sparganietum emersi
Zespół strzałki wodnej i jeżogłówki pojedynczej tworzy niski szuwar tylko
na 1 stanowisku. Granicząca z wodą fitocenoza reprezentowana jest wyłącznie
przez Sparganium emersum. W badanym płacie zanotowano 9 gatunków roślin
naczyniowych.
Caricetum vesicariae
Zbiorowisko turzycowo-szuwarowe o charakterze eutroficznym występuje
na 17 stanowiskach. Dominująca turzyca pęcherzykowata (rys. 5) nadaje szuwarom kształt stosunkowo niskiej i zwartej łąki. Zespół zajmuje zewnętrzny pas
roślinności akwenu, w trzech zdjęciach pokrywając około 90% powierzchni.
Łączna liczba gatunków roślin w zbadanych płatach wynosi 66, od 12 do 27
w zdjęciu.
4. Podsumowanie i wnioski
Na podstawie 164 zdjęć fitosocjologicznych, wykonanych na obszarze jezior zachodniej części Pojezierza Drawskiego, wyróżniono 41 zespołów roślinnych. Zgodnie z kategoriami zagrożenia zbiorowisk roślinnych sformułowanymi
dla Wielkopolski, jeden zespół – Nymphaeetum candidae należy do kategorii V,
skupiającej zbiorowiska narażone, cechujące się rzadką i bardzo rzadką stabilnością, oraz trzy zespoły: Sagittario-Sparganietum emersi, Thelypteridi-Phragmitetum i Caricetum vesicariae należą do kategorii I, skupiającej zbiorowiska
o bardzo różnym stopniu faktycznego zagrożenia i słabo poznanych tendencjach
dynamicznych (Brzeg, Wojterska 1996).
Na obszarze jezior zachodniej części Pojezierza Drawskiego nie zaobserwowano żadnego stanowiska, na którym wystąpiłby tylko jeden zespół. Na badanym
terenie zanotowano od 2 do 17 zbiorowisk roślinnych na jednym stanowisku. Do
bardzo specyficznych akwenów wodnych można zaliczyć jezioro Małe. Na jego
Flora i roślinność jezior...
145
obszarze i brzegu nie stwierdzono żadnego zbiorowiska skupiającego gatunki
roślinności wodnej oraz szuwarowej.
W obrębie badanych zbiorowisk wystąpił strefowy układ roślinności. Najbardziej zewnętrzny pas roślinności tworzą zbiorowiska szuwarów wysokoturzycowych ze związku Magnocaricion. Do najczęściej spotykanych zespołów należą: Iridetum pseudacori (27 stanowisk) i Phalaridetum arundinaceae
(25 stanowisk). Bliżej środka akwenu występują szuwary właściwe ze związku
Phragmition, z których najczęstszym jest zespół Phragmitetum australis (48 stanowisk). Najbardziej wewnętrzny pas roślinności tworzą fitocenozy ze związku
Potamion, gdzie wśród najczęściej spotykanych zbiorowisk pojawia się zespół
Ranunculetum circinati (19 stanowisk), Myriophylletum spicatum (19 stanowisk)
i Potametum perfoliati (17 stanowisk).
Pomiędzy zbiorowiskami szuwarowymi znaleziono także ubogie florystycznie zbiorowiska pleustonowe z klasy Lemnetea oraz zbiorowiska hydrofitów należące do klasy Potametea.
Obszar jezior zachodniej części Pojezierza Drawskiego, pomimo zmian, jakie zaszły w jego florze, ma dużą wartość przyrodniczą, naukową i dydaktyczną.
Świadczy o tym m.in. bogata, licząca 322 taksony, flora roślin naczyniowych,
w tym 20 gatunków chronionych (Carex chordorhiza, Convalaria majalis, Drosera rotundifolia, Eriophorum gracile, Frangula alnus, Galium odoratum, Hedera helix, Helichrysum arenarium, Ledum palustre, Lobelia dortmana, Lycopodium annotinum, Menyanthes trifoliata, Nuphar lutea, Nymphaea alba, Nymphaea candida, Ononis spinosa, Polypodium vulgare, Primula veris, Ribes nigra,
Viburnum opulus), 6 zagrożonych wymarciem (Lobelia dortmana, Potamogeton
nitens, Potamogeton obtusifolius, Utricularia australis, Utricularia intermedia,
Utricularia vulgaris, Viburnum opulus) oraz 3 znajdujące się w Polskiej Czerwonej Księdze Roślin (Carex chordorhiza, Lobelia dortmana, Nymphaea candida).
146
Marta Umiastowska
S
CM
Kp
M
MM
Ma
C
L Kl
KM
D
Sk
K
St
Ka
Rys. 1. Zachodnia część Pojezierza Drawskiego w obrębie sieci kwadratów ATPOL
Fig. 1. The West part of Drawski Lakeland on ATPOL grid square map
S – Siecino, K – Kańsko, Ka – Kacper, Kl – Kleszczno, St – Stawno, Sk – Skąpe,
D – Dłusko, M – Morzysław, C – Czarnówek, L – Leśniówek, Kp – Kapka, CM – Czarne
Małe, MM – Morzysław Mały, KM – Kleszczno Małe, Ma – Małe
Flora i roślinność jezior...
147
Rys. 2. Rozmieszczenie trzciny pospolitej Phragmites australis w sieci kwadratów
ATPOL
Fig. 2. The distribution of common reed Phragmites australis on ATPOL grid square
map
148
Marta Umiastowska
Rys. 3. Rozmieszczenie lobelii jeziornej Lobelia dormanna w sieci kwadratów ATPOL
Fig. 3. The distribution of water lobelia Lobelia dormanna on ATPOL grid square map
Flora i roślinność jezior...
149
Rys. 4. Rozmieszczenie grzybieni północnych Nymphaea candida w sieci kwadratów
ATPOL
Fig. 4. The distribution of small water lily Nymphaea candida on ATPOL grid square
map
150
Marta Umiastowska
Rys. 5. Rozmieszczenie turzycy pęcherzykowatej Carex vesicaria w sieci kwadratów
ATPOL
Fig 5. The distribution of blister sedge Carex vesicaria on ATPOL grid square map
151
Flora i roślinność jezior...
Tabela 1. Zbiorowiska związku: Lemnion gibbae, Riccio fluitantis-Lemnion trisulcae, Potamion, Nymphaeion, Hottonion, Sphagno-Utricularion, Lobelion,
Phragmition i Magnocaricion (część 1)
Table 1. The communities of alliances: Lemnion gibbae, Riccio fluitantis-Lemnion trisulcae, Potamion, Nymphaeion, Hottonion, Sphagno-Utricularion, Lobelion,
Phragmition and Magnocaricion (part 1)
Zbiorowisko roślinne
(The plant community)
Nazwa jeziora
(The name of lake)
Liczba
Częstość
stanowisk
występowania
(Number
(Taxon presence)
of sites)
Związek Lemnion gibbae (The alliance Lemnion gibbae)
S, Ka, Kl, St, M
dość częsty
I. Ch. Ass. Spirodeletum polyrhizae
Związek Riccio fluitantis-Lemnion trisulcae (The alliance Riccio fluitantis-Lemnion trisulcae)
S, Ka, Kl, D, M
dość częsty
II. Ch. Ass. Lemnetum trisulcae
Związek Potamion (The alliance Potamion)
S, K, Kl, D, M, Kp, CM
dość częsty
III. Ch. Ass. Potametum nitensis
S, K, Ka, Kl, St, Sk, M, C,
częsty
IV. Ch. Ass. Potametum pectinati
Kp, CM, MM, KM
S
bardzo rzadki
V. Ch. Ass. Ranunculetum circinati
S, K, Ka, Sk, M, C, MM
dość częsty
VI. Ch. Ass. Elodeetum canadensis
S, K, Kl, Sk, D, C, Kp, CM
częsty
VII. Ch. Ass. Ceratophylletum demersi
S, Kl, St, Sk, M, C, MM
dość częsty
VIII. Ch. Ass. Myriophylletum spicati
S, K, Ka, Kl, St, Sk, D, M, bardzo pospolity
IX. Ch. Ass. Potametum compressi
C, Kp, CM
S, K, Ka, Kl, St, Sk, D, M,
częsty
X. Ch. Ass. Potametum lucentis
C, Kp, CM, MM. KM
S, D, MM, KM
dość rzadki
XI. Ch. Ass. Potametum perfoliati
Związek Nymphaeion (The alliance Nymphaeion)
S. K, Kl, St, Sk, D, M, CM,
częsty
XII. Ch. Ass. Hydrocharitetum morsus-ranae
MM, KM
S, Kl, Sk, CM, MM, KM
rozpowszechXIII. Ch. Ass. Potametum natantis
niony
S, K, Kl, St, Sk, M, CM,
dość częsty
XIV. Ch. Ass. Nupharo-Nymphaeetum albae
MM, K, Kl, St, Sk, M,
MM
MM
bardzo rzadki
XV. Ch. Ass. Nymphaeetum candidate
S, Kl, Sk, CM, MM, KM
dość częsty
XVI. Ch. Ass. Polygonetum natansis
S
bardzo rzadki
XVII. Ch. Ass. Potametum obtusifolii
Związek Hottonion (The alliance Hottonion)
K, Kl, St
dość rzadki
XVIII. Ch. Ass. Hottonietum palustris
Związek Sphagno-Utricularion (The alliance Sphagno-Utricularion)
bardzo rzadki
XIX. Ch. Ass. Scorpido-Utricularietum minoris MM
Związek Lobelion (The alliance Lobelion)
C, Kp
rzadki
XX. Ch. Ass. Lobelietum dortmannae
12
12
15
22
1
15
22
16
51
30
6
25
9
17
1
14
2
5
1
3
Objaśnienia (Explanations): S – Siecino, K – Kańsko, Ka – Kacper, Kl – Kleszczno, St –
Stawno, Sk – Skąpe, D – Dłusko, M – Morzysław, C – Czarnówek,
L – Leśniówek, Kp – Kapka, CM – Czarne Małe, MM – Morzysław
Mały, KM – Kleszczno Małe, Ma – Małe
152
Marta Umiastowska
Tabela 1. Zbiorowiska związku: Lemnion gibbae, Riccio fluitantis-Lemnion trisulcae, Potamion, Nymphaeion, Hottonion, Sphagno-Utricularion, Lobelion,
Phragmition i Magnocaricion (część 2)
Table 1. The communities of alliances: Lemnion gibbae, Riccio fluitantis-Lemnion trisulcae, Potamion, Nymphaeion, Hottonion, Sphagno-Utricularion, Lobelion,
Phragmition and Magnocaricion (part 2)
Zbiorowisko roślinne
(The plant community)
Jezioro (Lake)
Częstość
występowania
(Taxon
presence)
Związek Phragmition (The alliance Phragmition)
S, K, Kl, D, M, Kp, CM
dość częsty
XXI. Ch. Ass. Scirpetum lacustris
S, K, Ka, Kl, St, Sk, M,
częsty
XXII. Ch. Ass. Typhetum angustifoliae
C, Kp, CM, MM, KM
S
bardzo rzadki
XXIII. Ch. Ass. Sagittario-Sparganietum emersi
S, K, Ka, Sk, M, C, MM
dość częsty
XXIV. Ch. Ass. Sparganietum erecti
S, K, Kl, Sk, D, C, Kp,
częsty
XXV. Ch. Ass. Eleocharitetum palustris
CM
S, Kl, St, Sk, M, C, MM
dość częsty
XXVI. Ch. Ass. Equisetetum fluviatilis
S, K, Ka, Kl, St, Sk, D,
bardzo
XXVII. Ch. Ass. Phragmitetum australis
M, C, Kp, CM
pospolity
S, K, Ka, Kl, St, Sk, D,
częsty
XXVIII. Ch. Ass. Typhetum latifoliae
M, C, Kp, CM, MM.
KM
S, D, MM, KM
dość rzadki
XXIX. Ch. Ass. Acoretum calami
S, M
dość częsty
XXX. Ch. Ass. Oenatho-Rorippetum
S, K, Kl, Sk, D, M, C,
dość częsty
XXXI. Ch. Ass. Glycerietum maximae
Kp, KM
Związek Magnocaricion (The alliance Magnocaricion)
K, Kl, St, Sk, D, CM,
dość częsty
XXXII. Ch. Ass. Thelypteridi-Phragmitetum
KM
częsty
XXXIII. Ch. Ass. Cicuto-Caricetum pseudocyperi S, K, Ka, Kl, St, Sk, D,
M, C, Kp, MM, KM
S, K, Ks, Kl, St, M
częsty
XXXIV. Ch. Ass. Iridetum pseudacori
S, K, Kl, Sk, KM
rozpowszechXXXV. Ch. Ass. Caricetum ripariae
niony
S, K, Kl, Sk, L, Kp
częsty
XXXVI. Ch. Ass. Caricetum acutiformis
S, Kl, KM
dość rzadki
XXXVII. Ch. Ass. Cariceum paniculatae
S, K, Ka, Kl, Sk, M, L,
dość częsty
XXXVIII. Ch. Ass. Caricetum rostrae
Kp
S, K, Kl, Sk, D, L, Kp,
dość częsty
XXXIX. Ch. Ass. Caricetum vesicariae
KM
S
bardzo rzadki
XXXX. Ch. Ass. Caricetum vulpinae
S, K, Sk, C, Kp, MM
częsty
XXXXI. Ch. Ass. Phalaridetum arundinaceae
Liczba
stanowisk
(Number
of sites)
15
22
1
15
22
16
51
30
6
13
18
11
28
27
9
22
6
13
17
1
25
Objaśnienia (Explanations): S – Siecino, K – Kańsko, Ka – Kacper, Kl – Kleszczno, St –
Stawno, Sk – Skąpe, D – Dłusko, M – Morzysław, C – Czarnówek,
L – Leśniówek, Kp – Kapka, CM – Czarne Małe, MM – Morzysław
Mały, KM – Kleszczno Małe, Ma – Małe
153
Flora i roślinność jezior...
Tabela 2. Zestawienie kryteriów pozwalających określić przynależność zbiorowisk
do klas frekwencji (KF)
Table 2. Frequency coefficients used to characterise communities presence by occurrence classes (KF)
KF
I
II
III
Częstość zbiorowiska
Symbol
(Community presence) (Symbol)
Bardzo rzadki
(very rare)
Rzadki
(rare)
Dość rzadki
(fairly rare)
IV
Rozpowszechniony
(widespread)
V Dość częsty
(fairly frequent)
VI Częsty
(frequent)
VII Pospolity
(common)
VIII Bardzo popspolity
(very common)
Współczynnik frekwencji (F) [%] Liczba stanowisk
(Frequency coefficient (F) [%]) (Number of sites)
b rz
≤ 0,50
1–2
rz
0,51–2,00
3–4
d rz
2,01–5,00
5–6
rozp
5,01–10,00
7–10
d cz
10,01–20,00
11–20
cz
20,01–35,00
21–31
posp
35,01–50,00
32–42
b posp
≥ 50,01
≥ 43
BIBLIOGRAFIA
Brzeg A., Wojterska M., 1996: Przegląd systematyczny zbiorowisk roślinnych Wielkopolski wraz z oceną stopnia ich zagrożenia. Bad. Fizjogr. nad Pol. Zach. B, 45, s. 7–40.
Chmiel J., 1993: Flora roślin naczyniowych wschodniej części Pojezierza Gnieźnieńskiego
i jej antropogeniczne przeobrażenia w wieku XIX i XX. Cz. I. Pr. Zakł. Taks. Rośl.
UAM w Poznaniu, Wydawnictwo Sorus, Poznań, s. 52–53.
Kondracki J., 1981: Geografia fizyczna Polski. PWN, Warszawa.
Matuszkiewicz W., 2001: Przewodnik do oznaczania zbiorowisk roślinnych Polski.
Wydawnictwo Naukowe PWN, Warszawa.
Mirek Z., Piękoś-Mirkowa H., Zając A., Zając M., 1995: Vascular plants of Poland.
A checklist. Pol. Bot. Stud., 15. PAN, Kraków.
Szafer W., 1972: Szata roślinna Polski niżowej. [W:] W. Szafer, K. Zarzycki (red.): Szata
roślinna Polski. 1. PWN, Warszawa, s. 17–188.
Zając A., 1978: Założenia metodyczne atlasu rozmieszczenia roślin naczyniowych
w Polsce. Wiad. Bot., 22, 3. Kraków, s. 145–155.
154
Marta Umiastowska
FLORA AND VEGETATION OF THE LAKES OF WESTERN PART
OF DRAWSKO LAKELAND
Summary
The study, based on floral and phytosociological research results, presents vascular
flora register as well as plant communities description taking into consideration 15 lakes
of western part of Drawsko Lakeland. There was made 87 floral lists and 164 phytosociological surveys. Cartogram maps based on ATPOL cube network were used in making floral surveys. Classical Braun-Blanquet method was implemented to do phytosociological
surveys. On the basis of floral survey there was distinguished 41 plant associations. The
most frequently encountered groups are the following: Phragmitetum australis, Iridetum
pseudacori and Phalaridetum arundinaceae, whereas groups represented by communities Sagittario-Sparganietum emersiand and Nymphaeetum candidae were rarely spotted.
On the area of western part of Drawsko Lakeland there were noted 322 vascular plants
taxa, including 20 protected species, 6 endangered species as well as 3 species six species
which were located in Polish Red Data Book of Plants.
Translated by Jolanta Umiastowska
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
ANETTA WIECZOREK
Uniwersytet Szczeciński
POROSTY REZERWATÓW
SZCZECIŃSKIEGO PARKU KRAJOBRAZOWEGO
Lichens of nature reserves of the Szczecin Landscape Park
Słowa kluczowe: rezerwat przyrody, rzadkie i interesujące gatunki, Puszcza Bukowa
Key words: nature reserve, rare and interesting species, Bukowa Forest
1. Wstęp
Szczeciński Park Krajobrazowy zwany Puszczą Bukową położony jest na
południe od granic prawobrzeżnej części Szczecina. Ogólna powierzchnia Parku wynosi 20 tys. ha, z czego 9 tys. ha stanowi zwarty kompleks leśny. Krajobraz Puszczy Bukowej odznacza się bardzo bogatą rzeźbą terenu. Składa się
na nią system starych wzniesień z licznie spiętrzonymi wzgórzami o wysokościach dochodzących do 130 m n.p.m. (Musielak 1993). Dodatkowo rzeźbę terenu urozmaicają dolinki schodzące aż do podnóża wzgórz z bujnie rozwiniętą
szatą roślinną, liczne malownicze jeziorka morenowe, głęboko wcięte wąwozy
i jary o stromo nachylonych zboczach i niewyrównanym dnie. Większość z nich
to suche dolinki, nieliczne tylko zajęte są przez cieki wodne zasilane małymi
źródełkami. Na terenie Szczecińskiego Parku Krajobrazowego stwierdzono występowanie 86 zespołów roślinnych, w tym 14 zespołów unikatowych (Celiński
1962). Na szczególną uwagę zasługuje żyzna buczyna pomorska Melico-Fagetum, zajmująca blisko 60% ogółu powierzchni leśnej, wiele dobrze zachowanych
fragmentów gradów, łęgów, a także jedyny w swoim rodzaju zespół źródliskowej
156
Anetta Wieczorek
buczyny Merucuriali-Fagetum. Obszar ten wyróżnia się również dużą wilgotnością powietrza ze względu na sporą ilość opadów w ciągu roku, bliskość dużych
zbiorników wodnych i masy napływającego powietrza atlantyckiego. Wyjątkowe wartości przyrodnicze tego obszaru były podstawą utworzenia w 1956 roku
na terenie Szczecińskiego Parku Krajobrazowego pięciu rezerwatów celem
ochrony cennych zbiorowisk leśnych. Łączna powierzchnia rezerwatów wynosi
469,39 ha, w tym rezerwat Buczynowe Wąwozy – 39,94 ha, Źródliskowa Buczyna – 121,02 ha, Bukowe Zdroje – 205,90 ha, Trawiasta Buczyna – 78,52 ha
i Kołowskie Parowy – 24,01 ha (Stachak 1970). Celem niniejszej pracy była
analiza składu gatunkowego porostów występujących w rezerwatach w odniesieniu do bioty porostów stwierdzonych na całym obszarze Szczecińskiego Parku
Krajobrazowego.
2. Materiał i metody badań
Podstawą do przeprowadzenia analizy bioty porostów rezerwatów Szczecińskiego Parku Krajobrazowego były dane zebrane podczas prac terenowych
w latach 1996–2004. Wszystkie gatunki zestawiono w porządku alfabetycznym
(tabela 1). Nomenklaturę taksonomiczną przyjęto za Diederich i in. (2009). Kategorie zagrożenia (CR, EN, VU, NT, LC, DD) podano według Czerwonej listy
porostów wymarłych i zagrożonych w Polsce (Cieśliński i in. 2003).
3. Wyniki badań
Rezerwaty Szczecińskiego Parku Krajobrazowego rozmieszczone są na
terenie Puszczy Bukowej wyspowo pośród intensywnie użytkowanych lasów
gospodarczych. Obecnie zajmują ok. 7% powierzchni Puszczy Bukowej (rys. 1).
Obszar, jaki zajmują, charakteryzuje bogactwo bioty porostów. Z 207 gatunków
stwierdzonych na całym terenie Puszczy Bukowej (Wieczorek 2005) 125 taksonów występuje w rezerwatach (rys. 2).
Na obszarze rezerwatów stwierdzono występowanie 16 gatunków wyłącznych, niespotykanych poza ich granicami. Należą do nich: Arthonia bysscea,
Arthonia didyma, Arthonia punctiformis, Bacidia beckhausii, Bacidina arnoldiana, Buellia schaereri, Chaenotheca phaeocephala, Lecania cyrtella, Lecidea
huxariensis, Mycoblastus sanguinarius, Nephroma parile, Pertusaria hymenea,
Pertusaria pseudocoralina, Pyrenula nitidella, Trapeliopsisi viridescens, Usnea
Porosty rezerwatów Szczecińskiego Parku Krajobrazowego
157
subfloridiana. Spośród wyżej wymienionych gatunków większość to taksony bardzo rzadkie i rzadkie w skali całego Pomorza Zachodniego (Fałtynowicz 1992).
W warunkach Puszczy Bukowej gatunki te utrzymują się w formie kilku słabo
rozwiniętych osobników tylko na terenie rezerwatów.
Na szczególną uwagę w biocie porostów zasługują gatunki uznawane za
relikty puszczańskie (Cieśliński, Czyżewska 1996). Spośród 18 gatunków puszczańskich stwierdzonych na obszarze Puszczy Bukowej 13 taksonów występuje
w rezerwatach. Należą do nich: Arthonia bysscea, Bacidina arnoldiana, Bryoria
implexa, Buellia disciformis, Calicium viride, Loxospora elatina, Menegazzia
terebrata, Mycoblastus sanguinarius, Nephroma parille, Opegrapha vermicellifera, Pertusaria pertusa, Pyrenula nitida, Pyrenula nitidella. Gatunki te uznawane są powszechnie za wskaźniki naturalności ekosystemów leśnych. Wśród
nich są taksony występujące sporadycznie poza granicami rezerwatów. Trwanie
tych porostów w rezerwatach jest najlepszym dowodem niewielkich zmian, jakie
zachodzą w ekosystemach tych obszarów.
Z ogólnej liczby gatunków stwierdzonych na terenie rezerwatów blisko 78% bioty porostów stanowią taksony epifityczne, co wiąże się z typowo
leśnym charakterem obszaru. Większość z nich to porosty skorupiaste, znajdujące optimum rozwoju w cienistych buczynach. Na gładkiej korze buków i dębów
najczęściej spotykamy takie gatunki, jak: Arthonia radiata, Coenogonium pineti,
Graphis scripta, Hypogymnia physodes, Melanelixia fuliginosa subsp. fuliginosa, Phlyctis argena, Pyrenula nitida, Porina aenea, Opegrapha viridis. Wysoka
frekwencja tych taksonów świadczy o stosunkowo dobrze zachowanym układzie
ekologicznym. Za dobrą kondycją tych porostów przemawia również duża liczba
plech osobników młodych. Taki stan jest zapewne efektem prowadzonej tu od
blisko 50 lat polityki ochronnej, która zapewnia właściwe warunki ekologiczne
we wnętrzu lasu, umożliwiając tym samym odpowiedni rozwój wielu gatunkom
rzadkim i wrażliwym.
Liczba gatunków w poszczególnych rezerwatach zależy przede wszystkim od bogactwa i różnorodności siedlisk i nie wiąże się z wielkością rezerwatu
(rys. 3).
W biocie porostów rezerwatów Puszczy Bukowej znajduje się 50 taksonów umieszczonych na Czerwonej liście porostów wymarłych i zagrożonych
w Polsce (Cieśliński i in. 2003). Stanowi to około 28% wszystkich odnotowanych gatunków porostów na obszarach rezerwatów. Rozkład poszczególnych
158
Anetta Wieczorek
kategorii zagrożenia we florze porostów rezerwatów Puszczy Bukowej przedstawia rysunek 4. Wśród obecnie stwierdzonych gatunków 5 to taksony podlegające
kategorii „na granicy wymarcia”, 16 to porosty wymierające, 19 taksonów należy do kategorii „narażone”, 9 znalazło się w kategorii „bliskie zagrożeniu” oraz
1 gatunek w kategorii o niedostatecznych danych.
4. Wnioski
Rezerwaty Szczecińskiego Parku Krajobrazowego charakteryzują się dużą
różnorodnością gatunkową porostów. Ze względu na prowadzoną od blisko
50 lat politykę ochronną na tych terenach nie uległy zmianie warunki ekologiczne niezbędne dla rozwoju i utrzymywania się gatunków stenotypowych. Rezerwaty stanowią swoiste refungium Puszczy Bukowej, co jest szczególnie ważne
w warunkach wzrastającej antropopresji. Perspektywą dla zachowania niezwykle
cennych gatunków jest wprowadzanie nowych zasad gospodarowania na obszarach leśnych, polegających przede wszystkim na podniesieniu wieku rębności
drzew oraz ograniczeniu zrębów częściowych.
Porosty rezerwatów Szczecińskiego Parku Krajobrazowego
159
pozostaáa czĊĞü puszczy
remaining part of forest
rezerwaty
reserves
0
20
40
60
80
100
%
Rys. 1. Procentowy udział powierzchni rezerwatów w całym obszarze Puszczy Bukowej
Fig. 1. Percentage of the area of the whole area of Bukowa Forest
poza rezerwatami
altitude with
reserves
w rezerwatach
in reserves
0
50
100
150
200
liczba gatunków
number of species
Rys. 2. Liczba gatunków występujących na obszarze Puszczy Bukowej
Fig. 2. Number of species which occur in the Forest Bukowa area
Trawiasta Buczyna
Buczynowe Wąwozy
ħródliskowa Buczyna
Bukowe Zdroje
Koáowskie Parowy
liczba gatunków
number of species
Rys. 3. Udział porostów w rezerwatach Puszczy Bukowej
Fig. 3. Number of lichens species in the reserves of Bukowa Forest
160
Anetta Wieczorek
gatunki nie ujĊte
w Czerwonej LiĞcie
non-listed
lichens
60%
Rys. 4. Procentowy udział gatunków o różnym stopniu zagrożenia w rezerwatach Puszczy
Bukowej
CR – na granicy wymarcia, EN – wymierające, VU – narażone, NT – bliskie zagrożenia, DD – niedostateczne dane
Fig. 4. Percentage of lichen species of different threat status in the nature reserves Forest
Bukowa
CR – criticall endangered, EN – endangered, VU – vulnerable, NT – near
threatened, DD – data deficient
161
Porosty rezerwatów Szczecińskiego Parku Krajobrazowego
Tabela 1. Występowanie porostów w rezerwatach Szczecińskiego Parku Krajobrazowego
Table 1. Occurrence of lichen on Szczecin Landscape Park
Frekwencja (frequency): + – gatunek rzadki (rare species), ++ – częsty (frequent),
+++ – pospolity (common); grupa biologiczno – ekologiczna (biological – ecological
group): Ep – epifit (epiphyt), Ek – epiksyl (epixylit), Eg – epigeit (epigeic), El – epilit
(epilithic).
Kategorie zagrożenia
The threat categories
Kołowskie
Parowy
Bukowe
Zdroje
Źródliska
Buczyna
Buczynowe
Wąwozy
Trawiasta
Buczyna
1
Acarospora fuscata
A. veronensis
Acrocordia gemmata
Anaptychia ciliaris
Arthonia byssacea
A. didyma
A. dispersa
A. exilis
A. punctiformis
A. radiata
A. ruana
A. spadicea
A. vinosa
Aspicilia caesiocinerea
Bacidia beckhausii
B. incompta
B. rosella
Bacidina arnoldiana
Baeomyces rufus
Bryoria implexa
Buellia disciformis
B. griseovirens
B. schaereri
Calicium salicinum
C. viride
Grupa biologiczno-ekologiczna
Biological-ecological
group
Gatunek
Species
Rezerwaty
Reserves
2
3
4
5
6
7
8
El
El
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
El
Ep
Ep
Ep
Ep
Eg
Ep
Ep
Ep
Ep
Ek
Ek
.
.
VU
EN
EN
EN
VU
VU
EN
–
–
–
NT
–
VU
EN
EN
NT
–
CR
VU
EN
EN
VU
VU
.
.
.
.
.
+
+
.
.
++
.
.
.
.
.
.
+
.
.
.
.
.
.
.
.
+
+
+
.
.
.
+
.
.
++
+
.
.
+
.
.
+
.
++
.
.
.
.
.
.
.
.
.
+
+
.
+
+
.
+++
.
.
.
.
.
.
.
+
.
+
+
+
+
+
+
++
.
+
+
.
.
.
.
+
++
.
+
+
.
+
.
.
.
+
.
.
.
.
.
.
.
.
+
.
.
.
.
.
.
++
.
+
.
+
.
+
.
.
+
.
.
.
.
+
.
162
Anetta Wieczorek
1
Caloplaca citrina
C. holocarpa
Candelariella aurella
C. xanthostigma
Chaenotheca chrysocephala
C. ferruginea
C. furfuracea
C. phaeocephala
C. trichialis
Cladonia cenotea
C. chlorophaea
C. coniocraea
C. cornuta
C. digitata
C. fimbriata
C. furcata
C. pyxidata
C. subulata
Coenogonium pineti
Dibaes baeomyces
Evernia prunastri
Graphis scripta
Hypocenomyce caradocensis
H. scalaris
Hypogymnia physodes
Lecania cyrtella
Lecanora albella
L. argentata
L. campestris
L. carpinea
L. chlarotera
L. conizaeoides
L. dispersa
L. expallens
L. hagenii
L. muralis
L. polytropa
L. symmicta
L. umbrina
L. varia
Lecidea huxariensis
Lecidella elaeochroma
Lepraria elobata
L. incana
L. lobificans
Loxospora elatina
2
3
4
5
6
7
8
El
Ek
El
Ep
Ep
Ep
Ep
Ep
Ep
Ek
Eg, Ek
Ep, Eg
Eg
Ek, Eg
Eg, El, Ep
Eg
Ek, Ep
Eg, Ek
Ep
Ep
Ep
Ep
Ep
Ep, Ek
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
El
Ep
Ep
Ep
Ep
Ep, Ek
Ep
Ep
Ep, Ek
Ep
Ep
–
–
–
–
–
–
NT
EN
NT
–
–
–
–
–
–
–
–
–
–
NT
NT
NT
–
–
–
–
EN
–
–
–
–
–
–
–
–
–
–
–
–
–
DD
–
–
–
–
EN
.
.
+
.
.
.
.
.
.
.
++
++
.
.
++
.
.
++
++
.
.
+
.
++
++
.
.
.
.
.
.
++
.
.
.
+
.
.
.
.
.
.
.
++
.
.
++
+
++
++
.
++
.
.
+
++
++
++
.
+
+++
++
.
++
++
++
+
+++
.
+++
++
.
.
.
+
+
+
+++
++
++
.
+
+
.
.
+
.
+
.
+++
.
.
+
.
.
.
.
++
+
.
.
.
++
++
.
+
++
.
.
.
++
.
+
++
.
++
++
+
.
+
.
.
.
++
+
+
+
+
.
+
+
.
.
.
+
++
.
+
.
.
+
.
+
++
.
+
.
.
++
.
.
++
++
.
+
+
++
.
.
++
.
++
++
.
+
+
.
.
+
.
++
+
+
.
+
.
.
.
.
.
+
.
+++
.
.
.
+
.
.
++
.
.
.
.
++
++
+
++
+++
.
.
.
++
.
.
++
+
+++
++
.
.
++
.
+
.
+++
++
.
.
+
.
.
.
.
+
.
.
++
+
.
163
Porosty rezerwatów Szczecińskiego Parku Krajobrazowego
1
Melanelixia fuliginosa ssp.
glabratula
Melanohalea exasperatula
Menegazzia terebrata
Micarea denigrata
M. prasina
Mycoblastus fucatus
M. sanguinarius
Myxobilimbia sabuletorum
Nephroma parile
Ochrolechia androgyna
Opegrapha culmigena
O. rufescens
O. varia
O. vermicellifera
O. viridis
O. vulgata
Parmelia saxatilis
P. sulcata
Parmeliopsis ambigua
Pertusaria albescens
P. amara
P. coronata
P. hemisphaerica
P. hymenea
P. leioplaca
P. pertusa
P. pseudocorallina
Phaeophyscia orbicularis
Phlyctis argena
Physcia dubia
P. tenella
Physconia distorta
Placynthiella icmalea
P. uliginosa
Platismatia glauca
Pleurostica acetabulum
Porpidia crustulata
Porina aenea
Pseudevernia furfuracea
Punctelia subrudeca
Pyrenula nitida
P. nitidella
Ramalina fastigiata
R. pollinaria
Rinodina pyrina
Scoliciosporum chlorococcum
2
3
4
5
6
7
8
Ep
Ep
Ep
Ek
Ek
Ep
Ep
Ek
El
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep
El
Ep
Ep
Ep
Ep
Ep
Ep
Ep
Ep, El
Ep
Ep
Ep
Ek, Eg, Ep
Ep
Ep
Ep
Ep
Ep
Ep
–
–
CR
–
–
–
VU
–
CR
VU
–
VU
NT
EN
VU
VU
–
–
–
–
–
VU
VU
CR
NT
VU
CR
–
–
–
–
–
–
–
–
EN
–
–
–
VU
VU
EN
EN
VU
–
–
+
.
.
.
+
+
.
.
.
.
.
.
+
.
.
.
.
.
++
.
+
.
.
.
.
+
+
.
+
.
.
.
.
.
.
.
+
++
+
.
+
.
.
.
.
+
+
+
.
+
+
+
.
.
.
.
+
+
+
+
.
+
.
+
++
+
++
.
.
.
.
++
.
+
++
+
.
+
+
+
++
.
+
++
+
.
++
+
.
+
.
++
.
.
+
.
+
+
.
.
.
+
.
.
+
.
.
.
+
+
++
.
++
.
.
.
+
.
.
.
++
.
+
.
+
.
.
.
.
++
.
.
++
.
.
.
.
++
+
.
+
.
.
+
+
.
.
.
.
.
+
+
.
.
.
.
++
++
.
+
+
+
+
.
+
.
.
++
.
.
.
+
.
++
.
.
+
++
+
+
.
+
.
+
+
.
.
.
.
+
+
+
+
+
.
.
+
.
+
.
.
++
++
.
+
.
.
.
.
.
.
.
++
.
+
.
+
.
++
+
.
++
.
.
+
.
.
+
.
+
164
Anetta Wieczorek
1
S. umbrinum
Trapelia coarctata
T. placodioides
Trapeliopsis flexuosa
T. granulosa
T. viridescens
Usnea hirta
U. subfloridiana
Razem – Total
2
3
4
5
6
7
8
Ep
El
El
Ek, Eg
Ek
Ep
Ep
Ep
–
–
–
–
–
–
VU
EN
.
.
.
.
+
.
.
.
.
.
.
+
+
.
+
.
+
.
.
.
+
.
.
.
+
.
+
.
.
+
.
+
.
.
+
.
+
+
.
.
31
71
54
57
50
BIBLIOGRAFIA
Celiński F., 1962: Zespoły leśne Puszczy Bukowej pod Szczecinem. Monographiae
Botanicae, 13 (supl.), s. 208.
Cieśliński S., Czyżewska K., 1996: Relikty lasu puszczańskiego. Zjawiska reliktowe.
Phytocoenosis, Vol. 8 (N.S), s. 47–64.
Cieśliński S., Czyżewska K., Fabiszewski J., 2003: Czerwona lista porostów wymarłych
i zagrożonych w Polsce. Monographiae Botanicae, 91, s. 13–49.
Diederich P., Ertz D., Stapper N., Sérusiaux E., Ries C., 2009: The lichens and lichenicolous fungi of Belgium, Luxembourg and northern France. URL: http://www.
lichenology.info.
Fałtynowicz W., 1992: The lichens of Western Pomerania (NW Poland) an ecogeographical
Study. Polish Botanical Studies, Kraków, Vol. 4.
Musielak S., 1993: Rzeźba i budowa geologiczna Puszczy Bukowej. Chrońmy Przyrodę
Ojczystą, 6, s. 93–100.
Stachak A., 1970: Rezerwaty przyrody Puszczy Bukowej pod Szczecinem i problem ochrony całego jej obszaru. Przegląd Zachodniopomorski, t. XIV, z. 3, s. 77–90.
Wieczorek A., 2005: Biota porostów Szczecińskiego Parku Krajobrazowego. Fragmenta
Floristica Geobotanica Polonica, 12 (1), s. 143–156.
Porosty rezerwatów Szczecińskiego Parku Krajobrazowego
165
LICHENS OF NATURE RESERVES
OF THE SZCZECIN LANDSCAPE PARK
Summary
The Szczecin Landscape Park (so called „Bukowa Forest”) is placed in the southeastern part of Szczecin. Its covers 20 Th ha and nearly 9 Th ha of them are compact
forest-complex. In the Bukowa Forest the occurrence of 86 plant associations have been
classified as unique ours (Celiński 1962). Special attention has been paid to the Melico-Fagetum-Ass. which occupies 60% of whole area of forest, as well as the Carici remotae-Fraxinetum-Ass. and Merucuriali-Fagetum-Ass. Extraordinary natural values caused
setting up the five reserves in 1956. Joint area of reserves carries out 469,39 ha. Area,
which the reserves occupy, characterizes a biodiversity of lichen flora. Special attention should be paid to name as relicts of primeval forest (Cieśliński, Czyżewska 1996).
Among 18 relicts of primeval forests found out, 13 species are present in reserves: Arthonia bysscea, Bacidina arnoldiana, Bryoria implexa, Buellia disciformis, Calicium viride,
Loxospora elatina, Menegazzia terebrata, Mycoblastus sanguinarius, Nephroma parille,
Opegrapha vermicelifera, Pertusaria pertusa, Pyrenula nitida, Pyrenula nitidella.
From general numbers of lichens species which has been ascertained in the area
of the reserves nearly 78% are epiphytes. Number of species in each has been is noted
on the varieties of habitations and has been depended size of the areas of reserves. 50 species placed in the „RedList of extinct and threatened lichens in Poland” (Cieśliński et al.
2003) are found the flora lichens which make 28% of the all recorded taxa.
The conclusion could be accepted that the reserves are specific refugiuns for lichens
what is especially important in the circumstances of the increasing anthropopression.
Translated by Anetta Wieczorek
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
ANETTA WIECZOREK
ARLETA DURKA
Uniwersytet Szczeciński
OCENA STANU ŚRODOWISKA PRZYRODNICZEGO
LEWOBRZEŻNEJ CZĘŚCI MIASTA SZCZECINA
NA PODSTAWIE REAKCJI POROSTU TESTOWEGO
XANTHORIA PARIETINA (L.) Th. Fr.
Evaluation of the quality of natural environment in the left-bank part
of the city of Szczecin based on response of test lichen
Xanthoria parietina (L.) Th. Fr.
Słowa kluczowe: bioindykacja, martwe i żywe komórki glonowe, nekrozy
Key words: bioindindication, dead and live algal cells, necroses
1. Wstęp
Porosty mają bardzo duże znaczenie w ocenie skażenia środowiska przyrodniczego. Reakcja, jaką wykazują w bezpośrednim zetknięciu z substancją toksyczną, pozwala na zaliczenie tych organizmów do grupy bioindykatorów skażenia środowiska przyrodniczego. Ujemny wpływ substancji fitotoksycznych na
wegetację porostów zauważono już w drugiej połowie XIX wieku. Wrażliwość
porostów na zanieczyszczenie atmosfery została jednoznacznie udokumentowana
doświadczalnie (Le Blanc, Rao 1972; Marska 1982; Kiszka, Piórecki 1990; Pustelniak 1991; Grodzińska i in. 1993; Czarnota 1998; Niewiadomska i in. 1998;
Szczepaniak, Biziuk 2003; Tuncel, Yenisoy-Karakas 2003). Reakcje porostów na
zmieniające się zanieczyszczenie atmosfery można określić rejestrując zmiany
168
Anetta Wieczorek, Arleta Durka
koloru i wymiary plechy, liczbę wykształconych sorediów i izydiów, badając zawartość chlorofilu, aktywność fotosyntezy i oddychania lub liczbę uszkodzonych
i obumarłych komórek glonów w plechach (Marska 1982).
Celem niniejszej pracy była ocena stanu środowiska przyrodniczego lewobrzeżnej części Szczecina.
2. Materiał i metody badań
Aby określić stan środowiska przyrodniczego miasta Szczecina, posłużono
się metodą opartą na założeniu, że plechy porostu zebrane ze stanowisk naturalnych i przeniesione na tereny zanieczyszczone giną tym szybciej, im wyższe jest
stężenie toksykantów w powietrzu (Le Blanc, Rao 1972). W metodzie tej użyto
taksonu Xanthoria parietina. Gatunek ten jest bardzo pospolity w całej Polsce,
jest porostem nitrofilnym i pyłolubnym, który rośnie na korze drzew, szczególnie na topolach i osikach. Plechy Xanthoria parietina przeznaczone do badań
wraz z próbą kontrolną pozyskano z dużych nadmorskich kompleksów leśnych.
Do badań wybrano okazy o najbardziej regularnych kształtach, nieuszkodzone,
o średnicy powyżej 2 cm, zabarwione zgodnie z diagnozą gatunku. Fragmenty kory z plechami przymocowano do uprzednio przygotowanych plastikowych
płytek o wymiarach 15 cm x 7 cm, po trzy plechy na każdej płytce. Do umocowania użyto nici stilonowej, przy czym zwrócono uwagę, aby była ona zaczepiona
o kawałek kory, a nie przechodziła przez plechę. Płytki kolejno ponumerowano niezmywalnym pisakiem. Tak przygotowane plechy umieszczono na pniach
różnych gatunków drzew przydrożnych, w miejscach o takim samym stopniu
nasłonecznienia, na wysokości 2–3 m, zlokalizowanych na terenie lewobrzeżnej
części Szczecina. Łącznie założono 56 stanowisk (wykaz poniżej).
W okresie od września 2005 do marca 2006 roku wykonano 6-miesięczną
ekspozycję. Po upływie założonego czasu ekspozycji porosty zebrano i przeprowadzono morfologiczno-anatomiczne analizy stopnia degradacji plech w odniesieniu do próby kontrolnej.
Szczegółową analizę morfologiczną, uwzględniającą widoczne zmiany chorobowe przeprowadzono w laboratorium. Wszystkie badane rozetki podzielono
na trzy kategorie stopnia degradacji plech:
I stopień – plechy zdrowe, bez uchwytnych wizualnych uszkodzeń. Za zdrowe uznawano te rozetki, u których łatki na górnej stronie były jednolicie zabarwione, normalnego kształtu, zgodnie z diagnozą gatunku.
Ocena stanu środowiska przyrodniczego...
169
II stopień – plechy średnio uszkodzone. Tu zaliczono plechy, które miały
plamowate zaczernienia lub wyblaknięcia, nadmierne pokurczenia. Wymienione objawy degradacyjne nie mogły obejmować więcej niż 50% powierzchni rozetki.
III stopień – plechy silnie uszkodzone. W tej grupie znalazły się plechy,
które były w więcej niż 50% zdegradowane.
Oprócz podziału plech ze względu na stopień uszkodzenia, cały zebrany
materiał podzielono na trzy grupy w zależności od stopnia zabarwienia:
I grupa – plechy zdrowe o barwie intensywnie żółtej, zgodne z diagnozą
gatunku,
II grupa – plechy szarawe o brzegach żółtawych,
III grupa – plechy całkowicie szare.
Trzecia analiza morfologiczna podzieliła badany materiał na dwie grupy:
I – plechy bez widocznych uszkodzeń,
II – plechy z wyraźnymi uszkodzeniami.
Plechy porostów X. parietina zostały poddane również obserwacji mikroskopowej, uwzględniającej analizę komponentu glonowego. W tym celu wykonano preparaty barwione. Procentową zawartość martwych komórek glonowych
określono przy zastosowaniu 0,001% błękitu metylenowego (Le Blanc, Rao
1972; Marska 1982). Błękit metylenowy wybarwia splazmolizowane i martwe
komórki na opalizujący niebieski kolor. Laktofenol zabezpiecza preparat przed
wyschnięciem. Za podstawę pomiaru przyjęto pole widoczności w mikroskopie
pod powiększeniem 40x. Wykonano preparaty z różnych miejsc rozetek, zawsze
ze skrajnego i środkowego pola plechy. W polu widzenia mikroskopu liczono
wszystkie komórki glonów, dzieląc je na dwie grupy:
I grupa – tu zaliczono wszystkie zdrowe komórki glonów, o jednakowo
zabarwionych chloroplastach,
II grupa – w tej grupie znalazły się obumarłe komórki glonów wybarwione
na niebiesko oraz komórki pozbawione chloroplastów.
Uzyskane wyniki liczbowe z prac mikroskopowych zostały przeliczone
na średnie procentowe poszczególnych grup, kolejno dla każdej powierzchni badawczej.
170
Anetta Wieczorek, Arleta Durka
Wykaz stanowisk ekspozycyjnych
1 – ul. 26 Kwietnia N53°26’53”, E14°31’151’’; 2 – ul. Szymanowskiego
N53°26’212’’, E14°32’401’’; 3 – okolice ul. Gen. S. Maczka N53°25’332’’,
E14°29’119’’; 4 – ul. Ku Słońcu N53°26’430’’, E14°29’319’’; 5 – ul. Lubelska
N53°25’451’’, E14°28’591’’; 6 – ul. Bieszczadzka N53°25’442’’, E14°28’415’’;
7 – ul. Okulickiego N53°25’273’’, E14°28’386’’; 8 – ul. Ogrodowa N53°25’135’’,
E14°28’521’’; 9 – ul. Łódzka N53°25’591’’, E14°29’495’’; 10 – ul. Ku Słońcu
N53°25’504’’, E14°30’211’’; 11 – ul. Salińskiego N53°26’120’’, E14°30’130’’;
12 – Os. Kaliny N53°26’149’’, E14°30’840’’; 13 – ul. Bohaterów Warszawy
N53°26’560’’, E14°31’325’’; 14 – ul. Żołnierska N53°26’574’’, E14°29’490’’;
15 – ul. Mickiewicza N53°26’181’’, E14°31’272’’; 16 – ul. Kąpielisko Głębokie
N53°28’245’’, E14°29’790’’; 17 – ul. W. Szafera N53°27’253’’, E14°29’590’’;
18 – ul. A. Zawadzkiego N53°27’203’’, E14°29’513’’; 19 – ul. A. Zawadzkiego N53°27’507’’, E14°29’559’’; 20 – ul. Kadetów N53°27’256’’, E14°27’537’’;
21 – ul. W. Szafera N53°27’215’’, E14°90’140’’; 22 – ul.W. Szafera N53°27’203’’,
E14°29’172’’; 23 – ul. W. Szafera N53°27’232’’, E14°29’264’’; 24 – ul. Serbska
N53°26’585’’, E14°31’122’’; 25 – ul. Miodowa N53°29’230’’, E14°31’281’’;
26 – ul. Lisiej Góry N53°29’260’’, E14°31’287’’; 27 – ul. Lisiej Góry
N53°29’590’’, E14°31’295’’; 28 – ul. Wapienna N53°28’570’’, E14°32’309’’;
29 – ul. Duńska N53°27’477’’, E14°32’298’’; 30 – ul. Karpińskiego N53°26’577’’,
E14°32’451’’; 31 – ul. Łucznicza N53°27’102’’, E14°33’040’’; 32 – ul. Kredowa N53°28’362’’, E14°32’556’’; 33 – ul. Podbórz N53°29’141’’, E14°33’290’’;
34 – ul. Podbórz N53°29’105’’, E14°32’539’’; 35 – ul. Bukowska N53°29’492’’,
E14°33’200’’; 36 – ul. Ogrodnicza N53°29’118’’, E14°34’338’’; 37 – ul. W. Zagórskiego-Ostoi N53°29’358’’, E14°34’441’’; 38 – ul. Bajeczna N53°29’491’’,
E14°35’371’’; 39 – ul. Nad Odrą N53°30’220’’, E14°36’481’’; 40 – ul. Szosa Polska N53°29’249’’, E14°35’470’’; 41 – ul. Golęcińska N53°29’262’’,
E14°35’557’’; 42 – ul. Cukrowa N53°24’140’’, E14°29’468’’; 43 – ul. Cukrowa N53°23’422’’, E14°29’260’’; 44 – Autostrada Poznańska N53°23’321’’,
E14°29’496’’; 45 – Autostrada Poznańska N53°23’304’’, E14°30’134’’;
46 – ul. Rolna N53°28’131’’, E14°35’467’’; 47 – ul. Strzałowska N53°28’330’’,
E14°35’295’’; 48 – ul. Grobla N53°27’419’’, E14°35’475’’; 49 – ul. Bogumińska
N53°28’176’’, E14°34’555’’; 50 – ul. Hoża N53°28’390’’, E14°34’360’’; 51 –
ul. Bronowicka N53°24’166’’, E14°29’264’’; 52 – ul. Południowa N53°24’450’’,
E14°30’299’’; 53 – ogródki N53°24’241’’, E14°29’360’’; 54 – ul. Gospodarska
Ocena stanu środowiska przyrodniczego...
171
N53°23’510’’, E14°31’297’’; 55 – ul. Kapitańska N53°25’587’’, E14°34’330’’;
56 – ul. Kresowa N53°27’386’’, E14°33’159’’.
3. Wyniki badań
Zgodnie z przyjętymi kryteriami cały analizowany materiał został podzielony na trzy grupy określające stopień żywotności plech (zdrowe, średnio uszkodzone, silnie uszkodzone). Plechy zdrowe (I stopień) bez uchwytnych widocznych uszkodzeń chorobowych występowały jedynie na trzech stanowiskach.
Były to stanowiska numer 16, 25 i 26. Stanowiły one jedynie 5% wszystkich
przebadanych stanowisk i porastały korę forofitów występujących na obrzeżach
Szczecina (rys. 1). W drugiej grupie, o średnim stopniu uszkodzenia plech, znalazło się 18 powierzchni ekspozycyjnych, do których zaliczono stanowiska o numerach: 1, 2, 3, 5, 9, 13, 20, 23, 27, 33, 44, 45, 46, 48, 49, 51, 52 i 53. Porosty
tej grupy stanowią 30% (rys. 1). Największy udział w badanym materiale miały
plechy silnie uszkodzone 65% (rys. 1). Rozetki o III stopniu uszkodzenia zebrano
z 36 stanowisk o numerach: 4, 6, 7, 8, 10, 11, 12, 14, 15, 17, 18, 19, 21, 22, 24,
28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 47, 50, 54, 55, 56, 57.
W wyniku przeprowadzonej analizy stwierdzono na przebadanych powierzchniach występowanie w wiekszości plech z uszkodzeniami silnymi (65%) lub
średnim (30%) przy minimalnym udziale plech zdrowych (5%).
Plechy X. parietina zostały również poddane ocenie stopnia zabarwienia.
Według tego kryterium porosty przyporządkowano do trzech kategorii. W pierwszej grupie znalazły się plechy zdrowe o barwie intensywnie żółtej, które występowały na stanowiskach 16, 25 i 26. Grupa ta stanowiła jedynie 3% badanego
materiału (rys. 2) i obejmowała te same porosty, które znalazły się w I stopniu
degradacji plech. Najwięcej plech znalazło się w kategorii drugiej (74%), która
zgromadziła rozetki o barwie szarej z żółtym brzegiem (rys. 2). Tak zabarwione
plechy odnotowano na 39 stanowiskach o numerach: 1, 3, 4, 5, 6, 7, 8, 9, 10, 12,
14, 15, 17, 19, 20, 21, 22, 23, 24, 27, 28, 29, 30, 32, 33, 35, 36, 37, 39, 41, 44,
45, 46, 47, 48, 50, 51, 52, 57. Rozetki całkowicie szare stanowiły 23% całego badanego materiału (rys. 2). Występowały na stanowiskach o numerach: 2, 11, 13,
18, 31, 34, 38, 40, 42, 43, 49, 53, 54, 55, 56. Na badanym obszarze w większości stwierdzono obecność porostów o plechach szarawych z brzegami żółtymi,
mniejszą część stanowiły porosty całkowicie szare, a najmniejszą plechy zdrowe
o barwie żółtej.
172
Anetta Wieczorek, Arleta Durka
Całość przebadanego materiału podzielono na dwie grupy w zależności
od występowania na ich plechach plam, przebarwień oraz innych deformacji.
W pierwszej, mniejszej grupie znalazły się okazy bez widocznych uszkodzeń.
Plechy tych taksonów występowały na stanowiskach o numerach 14, 26 i 28, co
stanowi 4% przebadanego materiału. W drugiej grupie, większej, obejmującej
96% całości materiału (55 stanowisk), znalazły się plechy, na których zaobserwowano wyraźne uszkodzenia. Zebrane porosty posiadały widoczne przebarwienia
lub ciemne plamy, które świadczą wyraźnie o mniejszym lub większym stopniu
uszkodzenia plech.
Zebrane okazy po 6-miesięcznej ekspozycji poddane zostały również analizie anatomicznej, która miała na celu określenie żywotności komórek komponentu glonowego. Największą liczbę żywych komórek glonowych stwierdzono
w plechach pochodzących ze stanowisk o numerach: 5, 7, 10, 11, 12, 19, 21, 25,
32, 33, 37, 42, 45, 50. Tu średnia procentowa za wartość żywych komponentów
glonowych wahała się w granicach od 44 do 74% (rys. 3). W drugiej grupie znalazły się plechy, których średnia procentowa zawartość żywych komórek wahała
się od 2 do 32% (rys. 4).
Największy stopień uszkodzenia plech, gdzie zawartość żywych komórek
nie przekraczała 15% (29 stanowisk), odnotowano na stanowiskach o numerach
1, 2, 3, 4, 6, 9, 13, 15, 18, 22, 23, 24, 27, 28, 29, 31, 35, 36, 40, 41, 44, 46, 48, 49,
52, 53, 54, 55, 56. Na pozostałych powierzchniach ekspozycyjnych, o numerach:
14, 16, 17, 20, 26, 28, 30, 34, 38, 39, 43, 47, 51, 57, średnia zawartość żywych
komórek glonowych mieściła się w przedziale 16–32%.
Szczegółowa analiza zawartości martwych i żywych komórek glonowych
w centrum i na obrzeżach plech wyraźnie pokazała, że w większości przypadków
degradacja plech porostów postępowała od centrum rozetki ku brzegowi. Świadczą o tym wartości procentowe uzyskane w badaniach mikroskopowych. W tej
grupie w miarę posuwania się ku środkowi rozetki zmniejszał się udział żywych
komórek glonowych na prawie wszystkich przebadanych stanowiskach. Jedynie
na stanowisku 19 i 42 stopień uszkodzenia był większy na brzegu rozetki.
4. Wnioski i dyskusja
1. W lewobrzeżnej części Szczecina większość plech badanych porostów
testowych Xantoria parietina odznaczała się bardzo dużym stopniem degradacji
rozetki.
Ocena stanu środowiska przyrodniczego...
173
2. Widoczna degradacja plech została potwierdzona oceną stopnia zabarwienia plechy. W większości występowały plechy o barwie szarawej z brzegami
żółtymi oraz szare, co świadczy o wysokim stopniu uszkodzeniu materiału.
3. Plechy zebrane z 43 stanowisk charakteryzowały się wysoką zawartością
martwych komórek glonowych.
4. Na przeważającej liczbie stanowisk, gdzie stopień uszkodzenia plech był
stosunkowo niewielki, degradacja plech postępowała od centrum ku brzegowi
plechy.
5. Zastosowanie porostów X. parietina jako bioindykatora czystości powietrza dało dobre rezultaty i umożliwiło zobrazowanie stanu zanieczyszczenia powietrza w Szczecinie w roku 2005/2006.
W ostatnich latach w badaniach oceniających zanieczyszczenie powietrza
wykorzystywano jako biowskaźnik porost Hypogymnia physodes. Takie badania prowadzone były m.in. przez Marską (1982) na terenie Puszczy Wkrzańskiej
oraz w okolicach Zakładów Chemicznych „Police”. Stwierdziła ona stały wzrost
martwych komórek glonów w uszkodzonych plechach, uzyskała obraz zmian
w żywotności tego porostu zachodzących w przestrzeni i czasie. Podobne badania przeprowadziła Pustelniak (1991) na terenie Rzeszowa i doszła do wniosku,
że tempo obumierania plech zależy od pory roku.
Przeprowadzone badania stanu środowiska Szczecina z użyciem porostu
Xanthoria parietina wykazały przydatność tego taksonu do oceny stanu środowiska tak dużej aglomeracji miejskiej, jaką jest Szczecin. Pomimo że gatunek ten
charakteryzuje się dość szeroką skalą ekologiczną i dużą tolerancją w stosunku
do związków toksycznych zawartych w powietrzu, stopień uszkodzenia plech,
widoczne nekrozy oraz przebarwienia, a także duży stopień uszkodzenia komponentów glonowych świadczą o nie najlepszej jakości powietrza na obszarze lewobrzeżnej części Szczecina w roku 2006. Według danych Wojewódzkiego Inspektoratu Ochrony Środowiska stężenia substancji zanieczyszczających od kilku lat
nie przekraczają norm obecnie obowiązujących w Polsce, ale wyniki powyższej
pracy pokazują, że nawet niewielkie jednorazowe wysokie stężenia, w ogólnym
bilansie średniodobowych stężeń nieprzekraczające wartości dopuszczalnych,
mogą spowodować nieodwracalne uszkodzenia aparatu fotosyntetycznego, który
w przypadku porostów, ze względu na małą zawartość chlorofilu w przeliczeniu
na całą powierzchnię plechy, dają tak jednoznaczne efekty uszkodzenia plech.
174
Anetta Wieczorek, Arleta Durka
I – 5%
II – 30%
III – 65%
Rys. 1. Stopień degradacji plech
Fig. 1. Degree of thallus degeneration
plecha caáa
szara
whole grey
thallus
23%
plecha Īóáta
yellow thallus
3%
plecha szara
z Īóátymi
brzegami
yellow-edged
grey thallus
74%
Rys. 2. Procentowy udział plech o różnym zabarwieniu
Fig. 2. Percentage of thalluses with different colouration degree
100%
Īywe komórki glonowe
live algal cells
90%
80%
70%
60%
50%
40%
30%
20%
martwe komórki
glonowe
10%
0%
5
7
10 11 12 19 21 25 32 33 37 42 45 50
numery stanowisk ekspozycji
Rys. 3. Średnie wartości procentowe badanych grup żywotności komórek glonowych
w plechach Xanthoria parietina z terenu Szczecina
Fig. 3. Average percentage of the studied vitality groups of algae cells in Xanthoria
parietina from Szczecin
Ocena stanu środowiska przyrodniczego...
175
martwe komórki glonowe
dead algal cells
100%
90%
80%
70%
60%
50%
Īywe komórki glonowe
live algal cells
40%
30%
20%
10%
0%
1
3
6 9 14 16 18 22 24 27 29 31 35 38 40 43 46 48 51 53 55 57
numery stanowisk
Rys. 4. Średnie wartości procentowe badanych grup żywotności komórek glonowych
w plechach Xanthoria parietina z terenu Szczecina
Fig. 4. Average percentage of the studied vitality groups of algae cells in Xanthorria
parietina from Szczecin
BIBLIOGRAFIA
Czarnota P., 1998: Porosty jako indykatory zanieczyszczenia środowiska. Przegląd metod
lichenoindykacyjnych. Przegl. Przyrod., IX (1/2), s. 55–72.
Grodzińska K., Godzik B., Szarek G., 1993: Heavy metals and sulphur i lichens from
southern Spitsbergen. Fragm. Florist. Geobot. Supp., 2 (2), s. 699–708.
Kiszka J., Piórecki J., 1990: Badania nad lichenoindykacją województwa przemyskiego.
Roczn. Przemyski, 19, s. 281–290.
Le Blanc F., Rao D.N., 1972: Effects of sulphur dioxide on lichen and moss transplants.
Ekology, 54, s. 612–617.
Marska B., 1982: Wpływ emisji przemysłowych na porost Hypogymnia physodes (L.)
Nyl. eksponowany w tablicach wokół Zakładów Chemicznych „Police”. Zeszyty
Naukowe Akademii Rolniczej w Szczecinie, 95, s. 79–87.
Niewiadomska E., Jarowiecka D., Czarnota P., 1998: Effect of different levels of air
pollution on photosynthetic activity of some lichens. Act. Soc. Bot. Pol., 67 (3–4),
s. 259–262.
Pustelniak L., 1991: Application of the transplantation method in studiem on the influence
of the urban environment upon the vitality of Hypogymnia physodes (L.) Nyl. Thalli.
Zesz. Nauk. Uniw. Jagiell., Prac. Bot., 22, s. 193–201.
176
Anetta Wieczorek, Arleta Durka
Szczepaniak K., Biziuk M., 2003: Aspects of the biomonitoring studiem using mosses and
lichens as indicators of metal pollution. Environ. Res., 93, s. 221–230.
Tuncel S.G., Yenisoy-Karakas S., 2003: Elemental concentration In lichen in Western
Anatolia. Water Air Soil Pollut., 3, s. 97–107.
EVALUATION OF THE QUALITY OF NATURAL ENVIRONMENT
IN THE LEFT-BANK PART OF THE CITY OF SZCZECIN BASED
ON RESPONSE OF TEST LICHEN XANTHORIA PARIETINA (L.) TH. FR.
Summary
In examinations on the state of atmospheric cleanliness in the left-bank part of the
City of Szczecin, a method of transplanting lichens from non-polluted locations into areas
exposed to the effect of toxic substances was used. With this end in view, thallus of the
lichen Xanthoria parietina were used, coming from a low polluted area, which were
placed on plates and transferred into 56 locations randomly distributed within the examined area. The material was exposed for a period of six months. After that time of exposure, the material was subject to morphological and anatomical analysis which allowed
for thallus colour, presence or absence of necroses and discolouration and percentage
of dead and live algal cells.
As a result of carried out examinations, a considerable degree of thallus damage
was found, manifesting not only in morphological changes but also in substantial percentage of dead algal cells. It was also showed that process of thallus degradation moved
from the thallus centre to its edge.
Translated by Anetta Wieczorek
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
ANNA WIERZBICKA
Uniwersytet Szczeciński
JÓZEF KUR
Politechnika Gdańska
IDENTYFIKACJA I IZOLACJA GENU KODUJĄCEGO
ZAADAPTOWANĄ DO ZIMNA β-GALAKTOZYDAZĘ
PARACOCCUS SP.
Identification and izolation of the gene encoding cold-active
β-galactosidase from paracoccus sp.
Słowa kluczowe: β-galaktozydaza, hydrolazy, transglikolazy, klonowanie molekularne,
Paracoccus sp.
Key words: β-galactosidase, hydrolases, transglycosylases, molecular cloning, Paracoccus sp.
1. Wstęp
Celem prowadzonych badań była izolacja i identyfikacja genu kodującego β-galaktozydazę zaadaptowaną do zimna. Zimnolubne β-D-galaktozydazy są
grupą enzymów mogącą znaleźć szerokie zastosowanie w przemyśle, np. w hydrolizie laktozy zawartej w mleku lub serwatce.
Z kolekcji szczepów izolowanych z próbek gleby antarktycznej wyselekcjonowano szczep 32D, wykazujący aktywność β-galaktozydazy. Na podstawie
analizy sekwencji genu kodującego 16S rRNA sklasyfikowano badany szczep do
rodzaju Paracoccus sp. W celu identyfikacji fragmentu genomowego DNA Paracoccus sp. 32D, zawierającego gen kodujący β-galaktozydazę, przeprowadzono
izolację genomowego DNA i skonstruowano bibliotekę fragmentów DNA po-
178
Anna Wierzbicka, Józef Kur
przez trawienie enzymami restrykcyjnymi i klonowanie otrzymanych fragmentów do wektora plazmidowego pBAD/MycHisA. Komórki kompetentne E. coli
LMG194 transformowano mieszaniną ligacyjną i wysiano na podłoże agarowe
LB AIX (z dodatkiem ampicyliny, IPTG oraz X-gal). Po 18 godzinach inkubacji
w 30ºC uzyskano 2 klony rekombinantowe wykazujące aktywność β-galaktozydazy. Wyizolowane plazmidy poddano analizie restrykcyjnej, która wykazała,
że zawierają one te same fragmenty genomowego DNA szczepu Paracoccus sp.
DNA insertu plazmidu rekombinantowego poddano następnie sekwencjonowaniu. Analiza otrzymanej sekwencji wykazała obecność genu kodującego β-galaktozydazę o wielkości 1971 pz, zawierającą dwie zakonserwowane ewolucyjnie
domeny, tj. gluko-hydro-2N oraz gluko-hydro-2C, charakterystyczne dla białek
o tej aktywności.
Obecnie prowadzone są dalsze prace związane z produkcją β-galaktozydazy
Paracoccus sp. 32D w systemie ekspresyjnym E. coli oraz charakterystyka molekularna enzymu.
β-galaktozydazy (EC 3.2.1.23) są enzymami katalizującymi przede wszystkim reakcję hydrolizy wiązań O-glikozydowych w β-D-galaktozydach. Takim
galaktozydem jest laktoza występująca w mleku, której hydroliza prowadzi
do powstania D-glukozy i D-galaktozy (Coker in. 2003; Gasteiger i in. 2005;
Hoyoux i in. 2001; Nakagawa i in. 2003, 2006; Turkiewicz i in. 2003; Weisburg
i in. 1991). Stąd β-galaktozydazy są wykorzystywane do produkcji przetworów
mlecznych pozbawionych laktozy dla osób z naturalną nietolerancją mleka,
czy też zagospodarowania serwatki będącej uciążliwym produktem ubocznym
przemysłu mleczarskiego (Altschul i in. 1990; Coker i in. 2003; Gasteiger i in.
2005; Hoyoux i in. 2001; Marchler-Bauer i in. 2003; Nakagawa i in. 2003, 2006;
Weisburg i in. 1991).
Niektóre β-galaktozydazy wykazują również aktywność transglikozylacyjną, co umożliwia produkcję oligosacharydów glukozowo-galaktozowych, wykorzystywanych jako cenne dodatki żywieniowe. Zostały one zaliczone do składników żywności funkcjonalnej, które oprócz wartości odżywczych mają korzystny
wpływ na zdrowie człowieka (Gasteiger i in. 2005; Weisburg i in. 1991).
β-galaktozydazy są syntetyzowane przez komórki ssaków, roślin, drożdży,
grzybów strzępkowych i bakterii, jednak różnią się między sobą masą cząsteczkową, liczbą podjednostek tworzących natywną cząsteczkę, wartościami optymalnej temperatury i pH działania oraz zapotrzebowaniem na jony metali niezbędne dla aktywności enzymu i/lub stabilizacji jego struktury (Coker i in. 2003;
Identyfikacja i izolacja genu...
179
Gasteiger i in. 2005). Z przemysłowego punktu widzenia enzymy działające
z dużą wydajnością w niskich temperaturach są bardziej przydatne w niektórych
procesach technologicznych ze względu na obniżenie kosztów produkcji. Ponadto, przeprowadzanie tych procesów w niskich temperaturach zapobiega rozwojowi mezofilnej mikroflory chorobotwórczej (Altschul i in. 1990; Coker i in. 2005;
Hoyoux i in. 2001; Nakagawa i in. 2003, 2006).
Niniejsza praca prezentuje wyniki identyfikacji i izolacji genu kodującego
zaadaptowaną do zimna β-galaktozydazę z antarktycznego szczepu Paracoccus
sp. 32D.
2. Materiał i metody badań
Selekcja mikroorganizmu i warunki hodowlane
Szczep Paracoccus sp. 32D został wyselekcjonowany z kolekcji szczepów,
wyizolowanych z próbek gleby antarktycznej, hodowanych na zmodyfikowanym
podłożu agarowym LB (Nakagawa i in. 2007), zawierającym 1% laktozy, 1 mM
izopropylo-β-D-tiogalaktopiranozydu (IPTG), 0,01% 5-bromo-4-chloro-3-indolilo-β-galaktopiranozyd (X-Gal) oraz 0,5% soli morskiej (Altschul i in. 1990;
Coker i in. 2003; Hoyoux i in. 2001; Marchler-Bauer i in. 2003; Nakagawa i in.
2006; Weisburg i in. 1991). Hodowlę prowadzono w temperaturze 20 ºC przez
24 h.
Identyfikacja szczepu 32D
Filogenetyczna identyfikacja szczepu bibliotecznego 32D została przeprowadzona na podstawie analizy sekwencji genu kodującego 16S rRNA. Fragment
16S rDNA zamplifikowano techniką PCR z wykorzystaniem standardowych
starterów fD1 i rP2 (Miller 1972), a produkt reakcji PCR zsekwencjonowano.
Otrzymaną sekwencję nukleotydową porównano z sekwencjami 16S rDNA zdeponowanymi w bazach danych, takich jak Ribosomal Database Project (RDP)
i GenBank w National Center for Biotechnology Information (NCBI), z wykorzystaniem programu BLAST (Basic Alignment Search Tool) (Wanarska, Kur
2005).
180
Anna Wierzbicka, Józef Kur
Identyfikacja genu kodującego β-galaktozydazę
Aby zidentyfikować fragment genomowy DNA zawierający gen kodujący
β-galaktozydazę skonstruowano bibliotekę fragmentów DNA badanego szczepu.
W tym celu wyizolowano DNA genomowe badanego szczepu z wykorzystaniem
komercyjnie dostępnego zestawu Genomic DNA (A&A Biotechnology), które
następnie poddano trawieniu enzymami restrykcyjnymi BglII/SalI (Fermentas). Uzyskane fragmenty restrykcyjne wklonowano do wektora plazmidowego
pBAD/MycHisA (Invitrogen). Komórki kompetentne E. coli LMG194 (Invitrogen) transformowano mieszaniną ligacyną, po czym wysiano je na podłoże agarowe LB (1% peptonu K, 1% NaCl, 0,5% ekstraktu drożdżowego oraz 1,5% agaru technicznego) (Nakagawa i in. 2007) z dodatkiem 0,01% X-Gal, 1mM IPTG
oraz 0,01% ampicyliny (AIX). Płytki inkubowano w temperaturze 30 ºC przez
18h (Altschul i in. 1990; Coker i in. 2003; Gutshall i in. 1995; Hoyoux i in. 2001;
Nakagawa i in. 2003, 2006; Trimbar i in. 1994; Turkiewicz i in. 2003).
3. Wyniki badań
Charakterystyka szczepu 32D
Zsekwencjonowanie fragmentu 16S rDNA szczepu 32D i porównanie go
z sekwencjami zdeponowanymi w bazach danych RDB i GenBank pozwoliło ustalić przynależność badanego szczepu do rodzaju Paracoccus sp. Analiza
sekwencji genu 16S rDNA wykazała również, że badany szczep jest filogenetycznie najbardziej spokrewniony ze szczepami P. marcusii i P. haeundaensis
(Wanarska, Kur 2005).
Charakterystyka genu kodującego β-galaktozydazę
Gen kodujący β-galaktozydazę zidentyfikowano na podstawie utworzonej
biblioteki genomowej z wykorzystaniem wektora plazmidowego pBADMycHisA.
Spośród 800 wyrosłych na podłożu LA AIX kolonii wyselekcjonowano 2 kolonie rekombinantowe mające zdolność hydrolizy X-Gal. Wyizolowane z uzyskanych kolonii plazmidy poddano analizie restrykcyjnej, która wykazała, że oba
plazmidy zawierają ten sam fragment genomowego DNA. Otrzymany insert został zsekwencjonowany i potwierdzono obecność genu kodującego β-galaktozydazę o wielkości 1971 pz (Wanarska, Kur 2005), zawierającego zakonserwowane
ewolucyjnie domeny, tj. gluko-hydro-2N oraz gluko-hydro-2C, które są charak-
Identyfikacja i izolacja genu...
181
terystyczne dla białek o tej aktywności (Coombs, Brenechley 1999; Nakagawa
i in. 2006; Turkiewicz i in. 2003). Ustalono jednocześnie, że wyizolowany gen
koduje β-galaktozydazę zbudowaną z 656 reszt aminokwasowych o masie cząsteczkowej 74,1 kDa i teoretycznym punkcie izoelektrycznym pI 5,39 (Compute
pI/Mw tool) (Hu i in. 2007).
4. Podsumowanie
Zaprezentowane badania były prowadzone w celu wyizolowania ze środowiska organizmu psychrofilnego, zdolnego do hydrolizy laktozy w niskiej temperaturze, oraz zidentyfikowania genu kodującego β-galaktozydazę zaadaptowaną
do zimna.
Poszukiwany gen został wyizolowany z psychrofilnego szczepu antarktycznego Paracoccus sp. 32D. Na podstawie sekwencji nukleotydowej genu kodującego β-galaktozydazę ustalono skład aminokwasowy, masę cząsteczkową oraz
teoretyczny punkt izoelektryczny enzymu. Obecnie prowadzone są badania nad
wydajną produkcją β-galaktozydazy Paracoccus sp. 32D w arabinozowym systemie ekspresyjnym E. coli. Otrzymanie znaczących ilości enzymu umożliwi jego
pełną charakterystykę molekularną i zbadanie jego przydatności w procesach
technologicznych.
BIBLIOGRAFIA
Altschul S., Gish W., Miller W., Myers E., Lipman D., 1990: Basic local alignment search
tool. J. Mol. Biol., 3, s. 403–410.
Coker J.A., Sheridan P.P., Loveland-Curtze J., Gutshall K.R., Auman A.J., Brenchley
J.E., 2003: Biochemical characterization of a β-galactosidase with a low temperature
optimum obtained from an antarctic Arthrobacter isolate. J. Bacteriol., 18, s. 5473–
5482.
Coombs J.M., Brenchley J.E., 1999: Biochemical and phylogenetic analyses of a coldactive β-galactosidase from the lactic acid bacterium Carnobacterium piscicola BA.
Appl. Environ. Microbiol., 12, s. 5443–5450.
Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins M.R., Appel R.D., Bairoch A.,
2005: Protein identification and analysis tools on the ExPASy Server. W: J.M. Walker
(ed.): The Proteomics Protocols Handbook. Humana Press, Totowa, NJ, s. 571–607.
182
Anna Wierzbicka, Józef Kur
Gutshall K.R., Trimbur D.E., Kasmir J.J., Brenchley J.E., 1995: Analysis of a novel gene
and β-galactosidase isozyme from a psychrotrophic Arthrobacter isolate. J. Bacteriol.
1995, 8, s. 1981–1988.
Hoyoux A., Jennes I., Dubois P., Genicot S., Dubail F., Francois J.M., Baise E., Feller G.,
Gerday C., 2001: Cold-adapted β-galactosidasefrom the antarctic psychrophile
Pseudoalteromonas haloplanktis. Appl. Environ. Microbiol., 4, s. 1529–1535.
Hu J.M., Li H., Cao L.X., Wu P.C., Zhang C.T., Sang S.L., Zhang X.Y, Chen M.J.,
Lu J.Q., Liu Y.H., 2007: Molecular cloning and characterization of the gene encoding
cold-active β-galactosidase from a psychrotrophic and halotolerant Planococcus sp.
L4. J. Agric. Food Chem., 55, s. 2217–2224.
Marchler-Bauer A., Anderson J.B., DeWeese-Scott C., Fedorova N.D., Geer L.Y.,
He S., Hurwitz D.I., Jackson J.D., Jacobs A.R., Lanczycki C.J., Liebert C.A.,
Liu C., Madej T., Marchler G.H., Mazumder R., Nikolskaya A.N., Panchenko A.R.,
Rao B.S., Shoemaker B.A., Simonyan V., Song J.S., Thiessen P.A., Vasudevan S.,
Wang Y., Yamashita R.A., Yin J.J., Bryant S.H., 2003: CDD: a curated Entrez database of conserved domain alignments. Nucleic Acids Res, 1, s. 383–387.
Miller J.H., 1972: Experiment in molecular genetics. Cold Spring Harbor, NY, s. 433.
Nakagawa T., Fujimoto Y., Ikehata R., Miyaji T., Tomizuka N., 2006: Overexpression
and functional analysis of cold-active β-galactosidase from Arthrobacter
psychrolactophilus strain F2. ,Appl. Microbiol. Biotechnol., 72, s. 720–725.
Nakagawa T., Fujimoto Y., Uchino M., Miyaji T., Takano K., Tomizuka N., 2003: Isolation
and characterization of psychrophiles producing cold-active β-galactosidase. Soc.
Appl. Microbiol., 37, s. 154–157.
Nakagawa T., Ikehata R., Myoda T., Miyaji T., Tomizuka N., 2007: Overexpression
and functional analysis of cold-active beta-galactosidase from Arthrobacter
psychrolactophilus strain F2. Protein Expr. Purif., 54, s. 295–299.
Trimbur D.E., Gutshall K.R., Prema P., Brenchley J.E., 1994: Characterization
of a psychrotrophic Arthrobacter gene and its cold-active β-galactosidase. Appl.
Environ. Microbiol., 12, s. 4544–4552.
Turkiewicz M., Kur J., Białkowska A., Cieśliński H., Kalinowska H., Bielecki S., 2003:
Antarctic Marine bacterium Pseudoalteromonas sp. 22b as a source of cold-adapted
β-galactosidase. Genet. Anal., 20, s. 317–324.
Wanarska M., Kur J., 2005: β-D-galaktozydazy – źródła, właściwości i zastosowanie.
Biotechnologia, 4, s. 46–62.
Weisburg W.G., Barns S.M., Pelletier D.A., Lane D.J., 1991: 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol., 2, s. 697–703.
Identyfikacja i izolacja genu...
183
IDENTIFICATION AND IZOLATION
OF THE GENE ENCODING COLD-ACTIVE Β-GALACTOSIDASE
FROM PARACOCCUS SP.
Summary
Our experiments were aimed at isolation and identification of gene encoding coldactive β-galactosidase. Psychrophilic strain Paracoccus sp. 32D, isolated from samples
of Antarctic soil, was able to hydrolyse lactose at low temperature. The fragment of DNA
contain gene encoding β-galactosidase, was identify upon genomic library constructed
in pBADMyc-HisA. The insert was sequenced and it proved presence of the gene encoding β-galactosidase, contain two evolutionally conserved classical domains – glycolhydro-2N and glycol-hydro-2C super families, that are characteristic for proteins with
this activity.
Translated by Anna Wierzbicka, Józef Kur
ZESZYTY NAUKOWE UNIWERSYTETU SZCZECIŃSKIEGO
NR 581
ACTA BIOLOGICA NR 16
2009
MAGDALENA ZEMLIK
AGNIESZKA POPIELA
Uniwersytet Szczeciński
NOTATKI FLORYSTYCZNE Z MOSTKOWA I OKOLIC
(POJEZIERZE MYŚLIBORSKIE, NW POLSKA)
Floristic notes of the Mostkowo neighbourhood
(the Pojezierze Myśliborskie Lakeland, NW Poland)
Słowa kluczowe: Pomorze, stanowiska roślin naczyniowych, mapa, chorologia
Key words: Pomerania, sites of vascular plant species, map, chorology
1. Wstęp
Północno-zachodnia Polska należy do stosunkowo słabo zbadanych pod
względem florystycznym części kraju. Opublikowano wprawdzie szereg opracowań poświęconych florze i roślinności miejsc szczególnie interesujących
(i najczęściej objętych ochroną prawną), brakuje jednak kompleksowych prac
dotyczących ogółu gatunków roślin naczyniowych Pomorza Zachodniego powstałych na podstawie kompletnych danych, zarówno historycznych, jak i współczesnych. Do wyjątków należą flory roślin naczyniowych m.in. Wolina i Uznamu
(Piotrowska 1966), Wyspy Chrząszczewskiej (Ćwikliński 1988), Zaodrza (Zając
i in. 1993), Ińskiego Parku Krajobrazowego (Więcław 2002), Cedyńskiego Parku
Krajobrazowego (Stępień 2002). Jedyną pracą wypełniającą lukę w rozpoznaniu
zasobów florystycznych północno-zachodniej Polski jest Atlas rozmieszczenia
roślin naczyniowych w Polsce (ATPOL) (Zając, Zając 2001).
Mostkowo jest małą miejscowością leżącą w gminie Barlinek w województwie zachodniopomorskim. Miejscowość ta i jej okolice, z wioskami Sulimierz
186
Magdalenia Zemlik, Agnieszka Popiela
i Jedlice, nie były dotychczas badane pod względem florystycznym. Przed II wojną światową badania na tym terenie prowadził wprawdzie Libbert (1932), ale nie
publikował dat florystycznych z bezpośrednich okolic Mostkowa. Nie są znane również publikacje na temat tego obszaru poruszające zagadnienia związane
z szatą roślinną. Wyjątek stanowią pojedyncze informacje dotyczące parków
podworskich w gminie Barlinek (Bacieczko i in. 2000). Niniejsza praca jest zatem pierwszą, która podaje daty florystyczne z tego terenu.
Celem przeprowadzonych badań było uzupełnienie wiedzy o florze naczyniowej wschodniej części Pojezierza Myśliborskiego, a zarazem zebranie danych
do przygotowywanego opracowania flory naczyniowej Pojezierza Myśliborskiego.
2. Teren i metoda badań
Badany teren pod względem fizyczno-geograficznym należy do prowincji Niżu Środkowoeuropejskiego, prowincji Pojezierze Południowobałtyckie
i mezoregionu Pojezierze Myśliborskie (Borówka i in. 2002). Występuje tutaj
zespół form polodowcowych wykształconych w strefie postoju lądolodu okresu zlodowacenia bałtyckiego. Na badanym obszarze dominują gleby brunatne
i bielicowe, wykształcone głównie z materiałów morenowych. Dużą powierzchnię zajmują pola uprawne oraz zbiorowiska łąkowe. Łąki są użytkowane głównie
poprzez wypas i koszone raz w roku na przełomie czerwca i lipca. W okolicach
miejscowości Podgórze znajduje się kompleks lasów mieszanych sosnowo-dębowych, miejscami z licznymi śródleśnymi oczkami wodnymi. Największym
zbiornikiem wodnym jest jezioro Małe, ponadto występują tu śródpolne oczka
wodne, wysychające okresowo.
Badania terenowe prowadzone były wiosną i latem w 2006 i 2007 roku.
Teren badań podzielono na kwadraty zgodnie z systemem przyjętym dla Atlasu
rozmieszczenia roślin naczyniowych w Polsce (ATPOL). Każdy z tych kwadratów został dla celów niniejszej pracy podzielony na cztery mniejsze kwadraty,
oznaczone kolejno: 00, 01, 10, 11 (rys. 1). Podstawą kartowania była mapa topograficzna w skali 1 : 25 000.
Do opracowania nazewnictwa gatunków wykorzystano pracę Mirka i in.
(2002). Rodziny, a także gatunki roślin w rodzinach ułożono w porządku alfabetycznym. Gwiazdką [*] zaznaczono antropofity (według Zając, Zając 2001).
Notatki florystyczne z Mostkowa...
Rys. 1. Lokalizacja terenu badań na tle siatki ATPOL
Fig. 1. Localisation of investigated area
187
188
Magdalenia Zemlik, Agnieszka Popiela
3. Wykaz gatunków
Adoxaceae:
Adoxa moschatellina L. – AC2610: Miedzyń, park; AC3601: Podgórze, las
na południe od wioski; Mostkowo, las przy drodze do Dziedzic.
Alismataceae:
Alisma plantago-aquatica L. – AC2610: Miedzyń, oczko wodne w parku;
AC3600: brzeg Jeziora Sulimierskiego; AC3601: Mostkowo, oczko wodne na łące koło rowu; Mostkowo, staw hodowlany; śródleśne oczka wodne
w lesie za Podgórzem.
Amaranthaceae:
* Amarantus retroflexus L. – AC2610: Kolonia Jedlice, przy zabudowaniach
gospodarczych; Kolonia Jedlice, przydroże; AC3600: Sulimierz, przydroże koło placu sportowego; zarośla nad brzegami Jeziora Sulimierskiego;
Jedlice, przydroże przy drodze wiodącej przez wioskę; AC3601: Mostkowo,
przydroże; Mostkowo, koło zabudowań gospodarczych; Mostkowo, zarośla
nad rowem; Mostkowo, pole; Mostkowo, ogródki działkowe; Podgórze,
przydroże; Swadzim, koło zabudowań mieszkalnych.
Apiaceae:
Aegopodium podagraria L. – AC2610: Miedzyń, przydroże na drodze prowadzącej do Miedzynia; park w Miedzyniu; AC3600: Jedlice – Park; Jedlice, przydroże przy drodze prowadzącej przez wioskę; AC3601: Mostkowo
park; Mostkowo, przydroże przy dawnej stacji kolejowej; Mostkowo, przy
stawach hodowlanych; przydroże przy drodze do Swadzimia; Swadzim,
park; zadrzewienia w okolicy Swadzimia i Wiewiórek; las przed Mostkowem.
Angelica sylvestris L. – AC3600: Sulimierz, zarośla w pobliżu piaskowni; przydroże na drodze do Mostkowa; okolice jeziora Małego; AC3601: Podgórze,
przy drodze do lasu na południe od wioski; las na północ od wioski.
Anthriscus sylvestris (L.) Hoffm. – AC2610: przydroże na drodze z Lipian do Miedzynia; AC2611: Dziedzice; przydroże na drodze do Mostkowa; AC3600:
Sulimierz, nad Jeziorem Sulimierskim; AC3601: Mostkowo, przy lesie przy
drodze do Dziedzic.
Cicuta virosa L. – AC3600: Sulimierz, Jezioro Sulimierskie; AC3601: Mostkowo, przy śródpolnym oczku wodnym za strażą pożarną.
Notatki florystyczne z Mostkowa...
189
Daucus carota L. – AC2610: Kolonia Jedlice; przy zabudowaniach; AC2611:
Dziedzice, przy sadzie porzeczkowym; nieużytek porolny; AC3600: Sulimierz, teren byłego torowiska kolejowego; AC3601: Mostkowo, przy zabudowaniach byłego Państwowego Gospodarstwa Rolnego.
Heracleum sphondylium L. – AC2610: Żarnowo, przydroże; AC2611: łąka
w okolicach Dziedzic; AC3600: okolice Jedlic, przy śródpolnym oczku
wodnym; AC3601: przydroże na drodze do Swadzimia.
Hydrocotyle vulgaris L. – AC3601: Mostkowo, przy śródpolnym oczku wodnym.
Falcaria vulgaris Bernh – AC3600: Sulimierz, przydroże przy Koloni; Mostkowo, przy polu uprawnym na SW od wioski; AC3601: Mostkowo, przydroże
na drodze z Mostkowa do Sulimierza.
Oenanthe aquatica (L.) Poiret. – AC2610: Miedzyń, staw w parku; AC3600: Sulimierz, Jezioro Sulimierskie; AC3601: Mostkowo, oczko wodne na łące
za strażą pożarną.
Pimpinella saxifraga L. – AC2611: Dziedzice, nieużytek porolny; AC3600:
Sulimierz, przydroże na drodze z Sulimierza do Mostkowa; AC3601: Mostkowo, przydroże na drodze prowadzącej w kierunku stawów hodowlanych
na południowy zachód od wioski.
Sium latifolium L. – AC3600: Sulimierz, rów przy cmentarzu; rów przy osiedlu
blokowym; Jezioro Sulimierskie; AC3601: Mostkowo, jezioro Małe.
Araceae:
* Acorus calamus L. – AC3600: Sulimierz, nad Jeziorem Sulimierskim; AC3601:
staw hodowlany przy drodze z Mostkowa do Sulimierza.
Calla palustris L. – AC3600: brzeg Jeziora Sulimierskiego; Sulimierz, rów koło
placu sportowego; AC3601: las za Podgórzem, śródleśne oczka wodne.
Araliaceae:
Hedera helix L. – AC3600: Podgórze, las na południe od wioski.
Asteraceae:
Achillea millefolium L. – AC2610: Miedzyń, przydrożne zarośla; AC2611: okolice Dziedzic; AC3600: Mostkowo, przydroże na drodze z Mostkowa
do Sulimierza; AC3601: Mostkowo, nieużytki porolne koło cmentarza.
Anthemis tinctoria L. – AC3600: Mostkowo, miedza przy polu uprawnym na SW
od Mostkowa; AC3601: Mostkowo, przydroże koło stawów hodowlanych;
na terenie po byłym torowisku.
190
Magdalenia Zemlik, Agnieszka Popiela
Arctium lappa L. – AC2610: Miedzyń, zarośla w parku w okolicy stawu; AC2611:
przydroże na drodze z Mostkowa do Dziedzic; AC3601: Podgórze, zarośla
koło stawu; AC3600: Mostkowo, zarośla w okolicy stawów hodowlanych
przy drodze z Mostkowa do Sulimierza.
Arctium tomentosum Mill. – AC3600: Sulimierz, przydroże na drodze z Sulimierza do Mostkowa; AC3601: Swadzim, przydroże; podmokła łąka na drodze
z Wiewiórek do Swadzimia.
Artemisia campestris L. – AC2611: nieużytek porolny w okolicy Dziedzic;
AC2610: przydroże w okolicy Miedzynia; AC3600: Jedlice, łąka przy drodze z Jedlic do Lipian; AC3601: Mostkowo, miedza przy polu uprawnym
na południowym zachodzie.
Artemisia vulgaris L. – AC2611: przydroże przy drodze do Dziedzic; AC2610:
Kolonia Jedlice, przydroże; AC3600: Sulimierz, piaskownia; AC3601: Swadzim, przydroże na drodze z Wiewiórek do Swadzimia.
Bellis perennis L. – AC2610: Miedzyń, łąka przy drodze z Miedzynia do Jedlic;
AC2611: okolice Dziedzic; AC3600: Jedlice, przydrożne trawniki przy drodze z Jedlic do Lipian; AC3601: Mostkowo, na placu przykościelnym.
Centaurea cyanus L. – AC2610: Miedzyń, pola uprawne przy drodze do Miedzynia; AC2611: nieużytki porolne w okolicy Dziedzic; AC3600: Mostkowo,
na terenie po byłym torowisku; AC3601: Swadzim, przydroże.
Centaurea jacea L. – AC3600: przydroże na drodze z Mostkowa do Sulimierza;
Sulimierz, piaskownia; Mostkowo, nieużytki porolne za ogródkami działkowymi; AC3601: Swadzim, przydroże na drodze z Wiewiórek do Swadzimia; Mostkowo, nieużytki porolne za ogródkami działkowymi;
Centaurea stoebe L. – AC2610: Miedzyń, sucha murawa piaskowa w okolicach
lasu; AC2611: nieużytek porolny w okolicy Dziedzic; AC3600: Jedlice,
przydroże na drodze z Jedlic do Żarnowa; AC3601: Mostkowo, nieużytki
porolne w okolicy cmentarza.
* Chamomilla recutita (L.) Rauschert – AC2610: Miedzyń, przydroże na drodze
do Miedzynia; AC2611: Dziedzice, okoliczne pola uprawne; AC3600: Sulimierz, przy budynkach byłej stacji kolejowej; AC3601: Mostkowo, trawnik
koło byłego PGR.
* Chamomilla suaveolens L. – AC2610: Kolonia Jedlice, przydroże; AC3600:
Mostkowo, na terenie po torowisku kolejowym; AC3601: Mostkowo, trawnik koło byłego PGR.
Notatki florystyczne z Mostkowa...
191
* Cichorium intibus L. – AC2610: Kolonia Jedlice, przydroże; AC2600: Diedzice,
nieużytek porolny; AC3600: przydroże na drodze do Brzostowa; AC3601:
Mostkowo, trawnik koło byłego PGR.
Cirsium arvense L. Scop. – AC2610: Miedzyń, przydroże na drodze do Jedlic;
AC3600: Mostkowo, przydroże na drodze z Mostkowa do Sulimierza;
AC3601: Mostkowo, nieużytki porolne koło cmentarza.
* Conyza canadiensis (L.) Cronquist – AC2610: Miedzyń, przy zabudowaniach
gospodarczych; AC2611: Dziedzice, nieużytki porolne w okolicy; AC3600:
Sulimierz, na terenie po torowisku kolejowym; AC3601: Mostkowo, trawnik koło budynku dawnej poczty.
Eupatorium cannabinum L. – AC3600: Sulimierz, rów koło cmentarza.
* Galinsoga parviflora Cav. – AC2610: Miedzyń, przy zabudowaniach mieszkalnych; zarośla parkowe; AC2611: Dziedzice, sad z porzeczkami; AC3600:
Sulimierz, przydroże koło placu zabaw; AC3601: Mostkowo, zarośla nad
rowem koło centrali nasiennej.
Helichrysum arenarium L – AC2610: Miedzyń, przydroże koło lasu; AC3600:
Jedlice przydroże na polnej drodze z Jedlic do Miedzynia; Sulimierz,
piaskownia; na terenie po torowisku kolejowym.
Hypochoeris radicata L. – AC2610: Miedzyń, przydroże przy drodze do Miedzynia; AC2611: Dziedzice, nieużytki porole; AC3600: Mostkowo, przydroże
przy drodze z Mostkowa do Sulimierza; AC3601: Mostkowo, nieużytki porolne koło cmentarza.
Inula britannica L. – AC3600: Sulimierz, okolice piaskowni; AC3601: Mostkowo, miedza przy polach uprawnych na południowy zachód od wioski.
* Lactuca serriola L. – AC2610: Miedzyń, przydroże przy drodze wjazdowej
do Miedzynia; AC3600: Mostkowo, przydroże na drodze z Mostkowa do
Sulimierza; AC3601: Mostkowo, przy stawach hodowlanych w okolicach
byłej stacji kolejowej.
Lapsana communis L. s. s. – AC2610: Miedzyń, zarośla parkowe; AC3600: Jedlice, okolice parku; AC3601: Podgórze, las po południowej stronie wioski.
Leontodon autumnalis L. – AC2610: Brzostowo, przydroże na drodze z Żarnowa do Brzostowa; AC3600: Sulimierz, na terenie po torowisku kolejowym;
AC3601: Mostkowo, trawnik koło byłego PGR.
192
Magdalenia Zemlik, Agnieszka Popiela
* Matricaria maritima L. subsp. inodora (L.) Dostal – AC2610: Miedzyń, przy
zabudowaniach gospodarczych; AC2611: nieużytki porolne w okolicy Dziedzic; AC3600: Mostkowo, przydroże na drodze z Mostkowa do Sulimierza;
AC3601: Mostkowo, trawnik koło byłego PGR.
* Onopordum acanthium L. – AC3600: Jedlice, zarośla przy szuwarze trzcinowym; AC3601: Swadzim, zarośla przy drodze z Wiewiórek do Swadzimia.
Senecio jacobaea L. – AC26 10: Miedzyń, przydroże; AC3600: Mostkowo, przydroże na drodze z Mostkowa do Sulimierza; AC3601: Mostkowo, na terenie
byłej stacji kolejowej.
Senecio sylvaticus L. – AC3601: Podgórze, las za Podgórzem.
* Senecio vernalis Waldst. & Kit. – AC2611: nieużytki porolne w okolicy Dziedzic; AC2610: Żarnowo, pola uprawne w okolicy wioski; AC3600: Jedlice,
przydroże na drodze prowadzącej przez Jedlice; AC3601: Mostkowo, przydroże na drodze z Jedlic do Mostkowa.
Senecio vulgaris L. – AC2610: Miedzyń, przydroże na drodze do Miedzynia;
AC2611: sad porzeczkowy w okolicy Dziedzic; AC3600: przydroże na drodze z Sulimierza do Zofinówki; AC3601: Mostkowo, przydroże przy polach
uprawnych na SW od Mostkowa.
Sonchus arvensis L. – AC2610: przydroże na drodze z Miedzynia do Jedlic;
AC3600: Sulimierz, piaskownia; AC3601: Mostkowo, pola uprawne na SW
od Mostkowa.
* Sonchus oleraceus L. – AC3600: przydroże na drodze z Sulimierza do Mostkowa; AC3601: Mostkowo, łąka za budynkiem straży pożarnej.
Tanacetum vulgare L. – AC2610: Miedzyń, przy zabudowaniach; AC2611: Mostkowo, koło lasu na drodze do Dziedzic; AC3600: okolice Mostkowa na terenie po torowisku; AC3601: Mostkowo, trawnik przy zabudowaniach byłego
PGR.
Taraxacum officinale F. H. Wigg – AC2610: Miedzyń, okoliczne trawniki; przydroże na drodze do Miedzynia; AC2611: przydroże na drodze z Mostkowa do Jedlic; AC3600: Sulimierz, przydroże koło stadniny koni; AC3601:
Mostkowo, przydroże koło lasu na drodze w kierunku Dziedzic.
Tragopogon dubius Scop. – AC2610: Miedzyń, łąka przy drodze z Miedzynia
do Jedlic; AC3601: Mostkowo, przydroże na drodze przy budynku dawnej
poczty; AC3600: Sulimierz, przy placu sportowym.
Notatki florystyczne z Mostkowa...
193
Tragapogon pratensis L. s. s. – AC2610: Miedzyń, zarośla przy zabudowaniach
gospodarczych; AC2611: Dziedzice, nieużytek porolny w okolicy Dziedzic;
AC3600: Jedlice, przydroże przy drodze wiodącej przez wioskę; AC3601:
Mostkowo, trawnik koło byłego PGR.
Tussilago farfara L. – AC3600: Sulimierz, nad Jeziorem Sulimierskim.
Athyriaceae:
Athyrium filix-femina (L.) Roth. – AC3601: Podgórze, las po południowej stronie wioski; las po północnej stronie wioski; Mostkowo, las przy drodze
do Dziedzic.
Balsaminaceae:
* Impatiens glandulifera Royle – AC2610: Miedzyń, park; AC3601: Podgórze,
nad oczkiem wodnym.
* Impatiens parviflora Dc. – AC2610: Miedzyń, park; AC3600: Sulimierz, zarośla nad brzegiem Jeziora Sulimierskiego; AC3601: Mostkowo, las przy
drodze do Dziedzic.
Berberidaceae:
Berberis vulgaris L. – AC3600: Sulimierz, okolice byłego torowiska.
Betulaceae:
Betula pendula Roth. – AC3601: jezioro Małe; las na północ od wioski.
Boraginaceae:
[*] Anchusa arvensis (L.) M. Bieb. – AC3600: Sulimierz, pola uprawne w okolicy Zofinówki; AC3601: Mostkowo, pole uprawne na SW od wioski.
Anchusa officinalis L. – AC2610: Miedzyń, przydroże na drodze do Jedlic;
AC3600: Sulimierz, przydroże na drodze z Mostkowa do Sulimierza;
AC3601: Mostkowo, na terenie byłej stacji kolejowej.
Echium vulgare L. – AC2611: nieużytki porolne w okolicy Dziedzic; AC2610:
Miedzyń, zarośla przy polu uprawnym po W stronie wioski; AC3600: Sulimierz, teren byłego torowiska kolejowego; AC3601: Mostkowo, teren byłej
stacji kolejowej.
* Lithospermum arvense L. – AC2611: Dziedzice, nieużytek porolny; AC3600:
Sulimierz, trawnik koło budynków byłego PGR; AC3601: Mostkowo, łąka
za budynkiem straży pożarnej.
* Myosotis arvensis (L.) Hill – AC3600: Jedlice, przydroże przy drodze wiodącej
przez wioskę w kierunku Lipian; AC3601: Mostkowo, łąka koło stawów
hodowlanych na SW stronie wioski.
194
Magdalenia Zemlik, Agnieszka Popiela
Myosotis palustris (L.) L. Emend. Rchb. – AC3600: zarośla nad brzegiem jeziora
Małego; AC3601: Mostkowo, przy oczku wodnym na łące za budynkiem
straży pożarnej.
Myosotis stricta Link ex Roem. & Schulz. – AC3600: Sulimierz, piaskownia;
ogródki działkowe za piaskownią; AC3601: Podgórze, polana leśna w lesie
na południe od wioski.
Myosotis sylvatica Ehrh. ex Hoffm. – AC2610: Miedzyń, park; AC3600: Jedlice,
park; AC3601: Podgórze, las na N od wioski.
Symphytum officinale L. – AC2610: Miedzyń, zarośla przy parku; AC3600:
Sulimierz, zarośla nad brzegiem Jeziora Sulimierskiego; AC3601: Mostkowo, teren koło rowu przy centrali nasiennej.
Brassicaceae:
Alliaria petiolata (M.Bieb.) Cavara & Grande – AC2610: Miedzyń, park; Miedzyń przydroże; AC3600: przydroże na polnej drodze okolice Sulimierza;
AC3601: Mostkowo, przydroże koło przystanku na drodze do Barlinka.
* Armoracia rusticana P. Gaertn., B. Mey. & Scherb. –AC3600: Sulimierz, nad
Jeziorem Sulimierskim.
Barbarea vulgaris R. Br. – AC3600: Jedlice, przydroże; AC3601: Mostkowo,
przydroże na drodze do Barlinka.
[*] Berteroa incana (L.) Dc. – AC2611: Dziedzice, przydroże na drodze z Dziedzic
do Mostkowa; AC3610: Miedzyń, okoliczne trawniki; przy zabudowaniach
gospodarczych; AC3600: Brzostowo, przydroże na drodze z Brzostowa
do Żarnowa; AC3601: Mostkowo, trawnik koło budynku dawnej poczty.
* Capsella bursa-pastoris (L.) Medik. – AC2610: Miedzyń, trawniki koło zabudowań gospodarczych; AC2611: Dziedzice, nieużytek porolny koło Dziedzic; AC3600: Mostkowo, przydroże na drodze z Mostkowa do Sulimierza;
AC3601: Mostkowo, trawnik koło byłego PGR.
Rorippa amphibia (L.) Besser – AC3601: Mostkowo, oczko wodne na łące
za strażą pożarną; oczko wodne na polu przy drodze z Mostkowa do Wiewiórek.
Sisymbrium officinale (L.) Scop. – AC2610: Miedzyń, zarośla parkowe; AC2611:
Dziedzice, przydroże na drodze z Dziedzic do Mostkowa; AC3600: Sulimierz, nad rowem koło cmentarza; AC3601: Mostkowo, przy stawie hodowlanym w okolicy cmentarza.
Notatki florystyczne z Mostkowa...
195
* Thlaspi arvense L. – AC2610: Miedzyń, okoliczne ogródki; AC2611: Dziedzice, przy hodowli dzikich zwierząt; AC3600: przy polach uprawnych
w okolicy Zofinówki; AC3601: zarośla w pobliżu jeziora Małego.
Campanulaceae:
Campanula glomerata L. – AC2610: Miedzyń, sucha murawa w pobliżu
wioski; AC3600: Mostkowo, teren po torowisku kolejowym na SW od
wioski; AC3601: Mostkowo, teren po byłym torowisku; przy stacji kolejowej.
Campanula rapunculoides L. – AC3601: Podgórze, przy lesie na południe
od wioski.
Campanula trachelium L. – AC3600: okolice Sulimierza, przydroże przy drodze
do Zofinówki; AC3601: Podgórze, las na południe od wioski.
Cannabaceae:
Humulus lupulus L. – AC3600: Sulimierz, zarośla nad Jeziorem Sulimierskim;
AC3601: zarośla w okolicy jeziora Małego.
Caprifoliaceae:
* Lonicera tatarica L. – AC3601: Podgórze, las na S stronie wioski.
Sambucus nigra L. – AC2610: Kolonia Jedlice, przy zabudowaniach mieszkalnych; AC2611: przydroże na drodze z Dziedzic do Mostkowa; AC3600:
Jedlice, zarośla przy śródpolnym oczku wodnym.
Sambucus racemosa L. – AC3601: Mostkowo, las przy drodze do Dziedzic; Podgórze, las na południowej stronie wioski.
Viburnum opulus L. – AC3601: Podgórze, las na północnej stronie wioski; Mostkowo, las przy drodze do Dziedzic.
Caryophyllaceae:
* Agrostemma githago L. – AC2610: Kolonia Jedlice, pola uprawne w okolicy wioski; AC2611: Dziedzice, nieużytek porolny w okolicy Dziedzic;
AC3600: Sulimierz, pole uprawne przy piaskowni; AC3601: Mostkowo,
pole uprawne przy drodze z Mostkowa do Sulimierza.
Cerastium arvense L. s. s. – AC3600: Sulimierz, przydroże przy drodze do
Dzierzgowa; przy piaskowni; AC3601: Mostkowo, przydroże koło rowu.
Cerastium glomeratum Thuill. – AC3610: Miedzyń, łąka przy drodze do Lipian; AC3600: Sulimierz, przy polu uprawnym przy drodze do Zofinówki;
AC3601: Mostkowo, teren działek budowlanych; zarośla ogródkowe; przydomowa łąka.
196
Magdalenia Zemlik, Agnieszka Popiela
Cucubalus baccifer L. – AC3601: Podgórze, las na północ od wioski.
Herniaria glabra L. – AC3600: Jedlice, przy polu uprawnym na drodze prowadzącej z Jedlic do Żarnowa.
Holosteum umbellatum L. – AC2610: Miedzyń, w parku niedaleko stawu;
AC3600: Sulimierz, przy placu sportowym; AC3601: Mostkowo, łąka za
strażą pożarną.
[*] Melandrium album (Mill.) Garcke – AC2610: Kolonia Jedlice, przy zabudowaniach; przy polu uprawnym; AC3600: Sulimierz, teren po torowisku
kolejowym; AC3601: Mostkowo, nieużytek porolny koło cmentarza.
Melandrium rubrum (Weigel.) Garcke – AC3601: Podgórze, las na południe
od wioski.
Moehringia trinerva (L.) Clairv. – AC3601: Mostkowo, park; las na północ od
Podgórza
Silene vulgaris (Moench) Garcke – AC2611: Dziedzice, nieużytek porolny
w okolicy Dziedzic; AC2600: Miedzyń, pole uprawne; AC3600: Mostkowo, teren po torowisku kolejowym na południowy zachód od wioski.
Spergula arvensis L. – AC3600: Jedlice, przy polu uprawnym przy drodze
z Jedlic do Żarnowa.
Stellaria holostea L. – AC3601: Podgórze, przy lesie na południe od wioski.
Stellaria media (L.) Vill – AC2610: Miedzyń, przy polu uprawnym; AC2611:
Dziedzice, sad porzeczkowy; AC3600: Jedlice, przydroże na drodze do Żarnowa; AC3601: Mostkowo, przy ogródkach działkowych.
Stellaria nemorum L. – AC3600: Sulimierz, w okolicy parku; AC3601: Podgórze, zarośla w pobliżu lasu na północ od wioski.
Ceratophyllaceae:
Ceratophyllum demersum L. s. s. – AC3600: Sulimierz, Jezioro Sulimerskie;
AC3601: jezioro Małe.
Chenopodiaceae:
Chenopodium album L. – AC2610: Miedzyń, zarośla przy okolicznych ogrodach;
AC2611: Dziedzice, przy hodowli dzikich zwierząt; AC3600: Sulimierz,
zarośla na ogródkach działkowych w okolicy Jeziora Sulimierskiego; Jedlice, przydroże na drodze z Jedlic do Żarnowa; AC3601: Mostkowo, łąka za
budynkiem straży pożarnej.
Notatki florystyczne z Mostkowa...
197
Convolvulaceae:
Calystegia sepium (L.) R. Br. – AC2610: Miedzyń, zarośla nad stawem w parku;
AC3600: Sulimierz, zarośla nad brzegiem Jeziora Sulimierskiego; AC3601:
Mostkowo, zarośla na terenie byłej stacji kolejowej.
Convolvulus arvensis L. – AC2610: Miedzyń, okoliczne trawniki; AC2611: Dziedzice, przy hodowli dzikich zwierząt; okoliczne pola uprawne; AC3600:
Sulimierz, ogródki działkowe w okolicy Jeziora Sulimierskiego; AC3601:
Mostkowo, nieużytki porolne koło cmentarza.
Cornaceae:
Cornus sanguinea L. – AC3600: Sulimierz, zadrzewienia niedaleko Jeziora Sulimierskiego; AC3601: Podgórze, las na S od wioski.
Corylaceae:
Carpinus betulus L. – AC2610: Miedzyń, przy drodze do Miedzynia z kierunku
Lipian; AC3601: las na północ od wioski.
Corylus avellana L. – AC3601: Podgórze, las na południowej stronie wioski.
Crassulaceae:
Sedum acre L. – AC2610: Miedzyń; murawa piaskowa przy lesie w okolicach
Miedzynia; AC3600: Sulimierz, teren po torowisku kolejowym; AC3601:
Mostkowo, teren byłej stacji kolejowej.
Cucurbitaceae:
* Echinocystis lobata (F. Michx.) Torr & A. Gray – AC2610: Miedzyń, przy
stawie w parku; AC3600: Sulimierz, zarośla nad Jeziorem Sulimierskim;
AC3601: Mostkowo, na płocie przy kościele.
Cyperaceae:
Carex caryophyllea Latourr. – AC2611: przydroże na drodze z Dziedzic do Mostkowa; AC3600: Sulimierz, przy piaskowni; teren byłej stacji kolejowej;
AC3601: Mostkowo, zarośla przy stawie w parku; przy placu sportowym.
Carex gracilis Curtis – AC3600: Jedlice, szuwar trzcinowy przy drodze do Lipian; AC3600: Swadzim, zarośla szuwarowe przy drodze do Swadzimia.
Carex hirta L. – AC2611: Dziedzice, nieużytek porolny; AC2610: Miedzyń,
przydroże na drodze z Miedzynia do Jedlic; AC3600: Sulimierz, zarośla
nad jeziorem Sulimierskim; AC3601: Mostkowo, trawnik koło byłego PGR;
łąka za strażą pożarną.
Carex nigra Reichard. – AC2610: Miedzyń, łąka przy drodze z Miedzynia do
Jedlic; AC3600: Mostkowo, łąka przy stawie hodowlanym przy drodze
198
Magdalenia Zemlik, Agnieszka Popiela
z Mostkowa do Sulimierza; AC3601: Mostkowo, łąka za centralą nasienną;
przy stawie hodowlanym na SW stronie wioski.
Carex pairae F.W. Schultz. – AC3601: Podgórze, las na południe od wioski.
Carex pseudocyperus L. – AC2611: Dziedzice, rów przy drodze z Mostkowa
do Dziedzic; AC3600: Sulimierz, nad brzegiem jeziora Sulimierskiego;
AC3601: Mostkowo, przy oczku wodnym za budynkiem straży pożarnej.
Carex riparia Curtis – AC3600: Sulimierz nad Jeziorem Sulimierskim; AC3600:
Mostkowo, okolice jeziora Małego.
Carex sylvatica Huds. – AC3600: Sulimierz, przy parku; AC3601: Podgórze, las
na N od wioski.
Carex vesicaria L. – AC2611: zarośla przy drodze z Dziedzic do Mostkowa;
AC3600: Sulimierz, nad brzegami Jeziora Sulimierskiego; AC3601: Mostkowo, łąka przy przystanku autobusowym.
Carex vulpina L. – AC3600: Jedlice, w pobliżu szuwaru trzcinowego; AC3601:
Mostkowo, łąka koło przystanku na drodze z Mostkowa do Wiewiórek.
Eleocharis acicularis (L.) Roem. & Schult. – AC 36 01: Mostkowo, oczko wodne
na łące za strażą pożarną; jezioro Małe.
Eleocharis palustris (L.) Roem. & Schult. – AC3601: Wiewiórki, staw; AC3600:
Sulimierz, Jezioro Sulimierskie.
Scirpus sylvaticus L. – AC3601: Podgórze, przy śródleśnym oczku wodnym
w lesie na S stronie wioski.
Dipsacaceae:
Knautia arvensis L. J. M. Coult – AC2610: Miedzyń, przydroże przy drodze do
Miedzynia z kierunku Lipian; AC3600: Sulimierz, teren byłego torowiska
kolejowego; AC3601: Mostkowo, teren byłego torowiska kolejowego.
Dryopteridaceae:
Dryopteris carthusiana Vill H. P. Fuchs – AC3601: Podgórze, las na N od Podgórza; las na S od wioski.
Ericaceae:
Vaccinium myrtillus L. – AC36 01: Podgórze, las na północ od Podgórza.
Euphorbiaceae:
Euphorbia cyparisias L. – AC3600: Sulimierz, teren po torowisku kolejowym;
AC3601: Mostkowo, zarośla przy budynku byłej stacji kolejowej; teren
po torowisku kolejowym.
Notatki florystyczne z Mostkowa...
199
* Euphorbia peplus L. – AC2610: Miedzyń, zarośla parkowe; AC3600: Sulimierz, w okolicy Jeziora Sulimierskiego; AC3601: Mostkowo, zarośla nad
rowem koło centrali nasiennej.
Equisetaceae:
Equisetum arvense L. – AC2610: Kolonia Jedlice, przy zabudowaniach gospodarczych; AC2611: sad porzeczkowy w okolicy Dziedzic; AC3600: Sulimierz, na terenie po torowisku kolejowym; AC3601: Mostkowo, teren nad
rowem koło centrali nasiennej; teren byłej stacji kolejowej.
Equisetum palustre L. – AC3600: okolice jeziora Małego; AC3601: Mostkowo,
przy oczku wodny na łące za budynkiem straży pożarnej.
Equisetum sylvaticum L. – AC3600: Jedlice, zarośla parkowe; AC3601: Podgórze, las na S stronie wioski.
Fabaceae:
Coronilla varia L. – AC3600: Mostkowo, teren po torowisku kolejowym na SW
od wioski; AC3601: Mostkowo, przy stacji kolejowej.
Jasione montana L. – AC2610: Miedzyń, murawa piaskowa; AC3600: Sulimierz,
piaskownia; przydroże przy piaskowni.
Lathyrus palustris L. – AC3601: Mostkowo, łąka za centralą nasienną.
Lathyrus pratensis L. – AC3600: Mostkowo, łąka na SW od wioski; Jedlice, łąka
przy szuwarze trzcinowym; AC3601: Mostkowo, łąka za strażą pożarną;
łąka za szkołą.
* Lathyrus tuberosus L. – AC3600: pola uprawne w okolicy Sulimierza.
Lotus corniculatus L. – AC2610: Miedzyń, przydroże; AC2611: Dziedzice, łąka
w okolicy wioski; AC3600: Mostkowo, przydroże na drodze do Sulimierza;
AC3601: Mostkowo, na terenie działek budowlanych.
Lotus uliginosus Schkuhr – AC3600: łąka koło stawów rybackich między Jedlicami i Mostkowem; AC3601: Mostkowo, łąka koło rowu, łąka koło stawów
rybackich.
*Lupinus polyphyllus Lindl. – AC3601: Mostkowo, teren po torowisku kolejowym od Mostkowa w kierunku Barlinka.
Medicago falcata (L.) Arcangeli – AC3600: Sulimierz, przy piaskowni; piaszczyste przydroże za osiedlem blokowym.
Medicago lupulina L. – AC2610: Miedzyń, przy polu uprawnym w okolicy
wioski; AC3600: Mostkowo, teren byłego torowiska kolejowego; AC3601:
Mostkowo, przydroże przy dawnej stacji kolejowej.
200
Magdalenia Zemlik, Agnieszka Popiela
* Medicago sativa L. – AC3601: Mostkowo, łąka naprzeciwko dawnej poczty;
AC3600: Brzostowo, przydroże.
Melilotus alba Medik. – AC2610: Kolonia Jedlice, przydroże przy zabudowaniach gospodarczych; przy polu uprawnym na W od wioski; AC3600: Mostkowo, teren po torowisku kolejowym na SW od wioski; AC3601: Mostkowo, teren koło rowu przy centrali nasiennej.
Melilotus officinalis (L.) Pall. – AC2610: Miedzyń, przydroże na drodze do Jedlic; AC3600: Jedlice, przy przystanku autobusowym; AC3601: Mostkowo,
teren po torowisku kolejowym.
Ononis spinosa L. – AC3601: Mostkowo, zarośla w pobliżu dawnej poczty.
Trifolium arvense L. – AC2610: Miedzyń, murawa piaskowa przy drodze z Lipian do Miedzynia; AC3600: Sulimierz, teren po torowisku; przy łące za
osiedlem blokowym; piaskownia; AC3601: Mostkowo, teren po torowisku
kolejowym; dawna stacja kolejowa.
Trifolium hybridum L. – AC2610: Miedzyń, łąka przy drodze do Jedlic; AC3600:
Jedlice, łąka przy drodze prowadzącej do Lipian; AC3601: Mostkowo, łąka
przy centrali nasiennej.
Trifolium medium L. – AC2610: Miedzyń, przy murawie piaskowej koło lasu;
AC3600: Mostkowo, przydroże na drodze do Sulimierza; teren po torowisku kolejowym.
Trifolium pratense L. – AC2610: Miedzyń, przydroże na drodze do Jedlic;
AC2611: Dziedzice, przy nieużytku porolnym; przy hodowli dzikich zwierząt; AC3600: Brzostowo, przydroże przy drodze wiodącej przez wioskę;
AC3601: Mostkowo, łąka za strażą pożarną.
Trifolium repens L. – AC2610: Miedzyń, przydroże przy zabudowaniach; AC2611:
Dziedzice, przydroże na drodze do Mostkowa; AC3600: Sulimierz, łąka za
osiedlem blokowym; AC3601: Mostkowo, trawniki na południowej stronie
wioski.
Vicia cracca L. – AC2610: Miedzyń, przy polu uprawnym; AC2611: Dziedzice, przy hodowli dzikich zwierząt; AC3600: Sulimierz, teren nad rowem;
AC3601: Mostkowo, trawnik koło byłego PGR.
* Vicia grandiflora Scop. – AC3600: Sulimierz, na terenie byłego torowiska kolejowego.
* Vicia sativa L. – AC2611: Dziedzice, w okolicy sadu porzeczkowego; AC3600:
Sulimierz, pole uprawne; AC3601: Mostkowo, teren koło rowu przy centrali
nasiennej.
Notatki florystyczne z Mostkowa...
201
Vicia sepium L. – AC2610: Miedzyń, przy parku; AC3601: Mostkowo, łąka przy
centrali nasiennej.
Vicia tetrasperma (L.). Schreb – AC2610: Kolonia Jedlice, miedza przy polu
uprawnym; AC3600: Sulimierz, Jedlice, zarośla w pobliżu parku; AC3601:
Mostkowo, pole uprawne przy drodze do Wiewiórek.
* Vicia villosa Roth – AC2601: Miedzyń, przy ogródku uprawnym; AC2611:
Dziedzice, przy hodowli dzikich zwierząt; AC3600: Sulimierz, przy piaskowni; AC3601: Mostkowo, przy zabudowaniach dawnej poczty.
Fagacae:
Quercus robur L. – AC3601: las przy drodze do Dziedzic; zarośla koło jeziora
Małego.
Fagus sylvatica L. – AC3601: las przy drodze do Dziedzic; zarośla koło jeziora
Małego.
Fumariaceae:
* Fumaria officinalis L. – AC2610: Miedzyń, pole uprawne na drodze do Jedlic;
AC3600: przy polu uprawnym w okolicy Zofinówki; AC3601: Mostkowo,
przydroże nad stawem hodowlanym.
Geraniaceae:
Erodium cicutarium (L.) L’Her. – AC2610: Miedzyń, przy zabudowaniach
w pobliżu parku; AC2611: Dziedzice, nieużytek porolny w pobliżu Dziedzic; AC3600: Sulimierz, piaskownia; Mostkowo; AC3601: Mostkowo,
przydroże koło stawu hodowlanego.
* Geranium molle L. – AC2610: Miedzyń, przydroże przy parku; AC2611: Dziedzice, nieużytek porolny; AC3600: Sulimierz, przydroże na drodze do Zofinówki; AC3601: Mostkowo, przydroże na drodze prowadzącej do stawów
hodowlanych.
Geranium palustre L. – AC2600: Miedzyń, przy stawie w parku; AC3600: Sulimierz, zarośla nad Jeziorem Sulimierskim; AC3601: Mostkowo, łąka na
południowy zachód od wioski; zarośla w pobliżu Kaserni.
* Geranium pusillum Burm. F. Exl. – AC2611: Dziedzice, sad porzeczkowy
w okolicy wioski; AC3600: Sulimierz, przydroże na drodze prowadzącej
z Mostkowa do Sulimierza; AC3601: Mostkowo, przydroże przy stawie
hodowlanym.
Geranium robertianum L. – AC2610: Miedzyń, park; AC3600: Jedlice, zarośla
w okolicy jeziora Małego; AC3601: Mostkowo, przy lesie przy drodze do
Dziedzic.
202
Magdalenia Zemlik, Agnieszka Popiela
Geranium sylvaticum L. – AC3601: Podgórze, las na N od wioski.
Haloragidaceae:
Myriophyllum spicatum L. – AC3601: Podgórze, oczko wodne w lesie na S od
wioski.
Hydrocharitacae:
Hydrocharis morsus-ranae L. – AC3601: Mostkowo, brzeg jeziora Małego;
AC3600: Sulimierz, brzeg Jeziora Sulimierskiego.
Hypericacae:
Hypericum perforatum L. – AC2610: Miedzyń, przydroże przy drodze do Miedzynia od strony Lipian; AC2611: Dziedzice, nieużytek porolny; AC3600:
Sulimierz, przydroże na drodze z Sulimierza do Mostkowa; AC3601: Mostkowo, łąka przy stawach hodowlanych na SW od wioski.
Iridaceae:
Iris pseudacorus L. – AC3600: Sulimierz, nad brzegiem Jeziora Sulimierskiego;
AC3601: Podgórze, śródleśne oczka wodne w lesie na S od wioski.
Juncaceae:
Juncus articulatus L. em. K. Richt. – AC3600: Sulimierz, przy brzegu Jeziora
Sulimierskiego; AC3601: Mostkowo, jezioro Małe.
Juncus conglomeratus L. Em. Leers – AC3600: Sulimierz, przy rowie melioracyjnym w okolicy placu sportowego; AC3601: Podgórze, polana leśna
w lesie na S od wioski.
Juncus effusus L. – AC2610: Miedzyń, w pobliżu oczka wodnego w parku;
AC3600: Mostkowo, staw hodowlany na drodze z Mostkowa do Sulimierza; AC3601: Mostkowo, przy śródpolnym oczku wodnym przy stawach
hodowlanych.
Lamiaceae:
Ajuga reptans L. – AC3601: Podgórze, las na S od wioski.
Galeobdolon luteum Huds. – AC3601: Jedlice, park.
Galeopsis ladanum L. – AC3611: Dziedzice, nieużytek porolny; AC3600: przydroże na drodze z Sulimierza do Zofinówki; AC3601: Mostkowo, pole
uprawne za centralą nasienną.
Galeopsis pubescens Besser. – AC2610: Miedzyń, zarośla w okolicy parku;
AC3600: Sulimierz, przydroże na drodze z Sulimierza do Mostkowa;
AC3601: Mostkowo, przy polu uprawnym na SW od wioski.
Notatki florystyczne z Mostkowa...
203
Galeopsis speciosa Mill. – AC2610: przydroże przy drodze do Miedzynia;
AC3600: Kolonia Sulimierz, zarośla przy polu uprawnym; AC3601: Mostkowo, zarośla koło byłego torowiska na południowy zachód od wioski.
Galeopsis tetrahit L. – AC2611: Dziedzice, zarośla przy rowie melioracyjnym;
AC2610: Miedzyń, zarośla w okolicy parku; AC3600: Sulimierz, zarośla
w okolicy Jeziora Sulimierskiego; AC3601: Mostkowo, przydroże przy stawie hodowlanym.
Glechoma hederaceae L. – AC2610: Miedzyń, przy zabudowaniach; AC3600:
Sulimierz, przy budynku straży pożarnej; AC3601: Mostkowo, łąka za budynkiem straży pożarnej.
* Lamium album L. – AC2610: Miedzyń, łąka przy drodze z Miedzynia do Jedlic;
AC2611: Dziedzice, przydroże na drodze z Dziedzic do Mostkowa; AC3600:
Sulimierz, teren koło rowu melioracyjnego przy cmentarzu; AC3601: łąka
za budynkiem straży pożarnej.
* Lamium purpureum L. – AC2610: Miedzyń, przydroże; AC2611: Dziedzice, na
terenie sadu porzeczkowego w okolicy Dziedzic; AC3600: Sulimierz, teren
po torowisku kolejowym; AC3601: Mostkowo, łąka za budynkiem straży
pożarnej.
Lycopus europaeus L. – AC2610: Miedzyń, zarośla w parku; AC2611: Dziedzice,
zarośla przy rowie melioracyjnym przy drodze do Dziedzic; AC3600: Sulimierz, zarośla w pobliżu Jeziora Sulimierskiego.
Mentha aquatica L. – AC3600: Sulimierz, nad brzegiem Jeziora Sulimierskiego.
Mentha arvensis L. – AC2610: Miedzyń, łąka przy drodze z Miedzynia do Jedlic;
AC3600: Żarnowo, trawnik przy zabudowaniach mieszkalnych; AC3601:
Mostkowo, zarośla na ogródkach działkowych.
Prunella vulgaris L. – AC2611: Dziedzice, przydroże przy polu uprawnym;
AC3600: Jedlice, przydroże w pobliżu parku; AC3601: Podgórze, las na
północ od wioski.
Salvia pratensis L. – AC2601: Miedzyń, łąka przy przydrożu na drodze do Jedlic;
AC3600: Sulimierz, łąka koło piaskowni; AC3601: Mostkowo, łąka koło
centrali nasiennej.
Scutellaria galericulata L. – AC3600: Sulimierz, zarośla nad brzegiem Jeziora
Sulimierskiego; AC3601: Podgórze, przy stawie w centrum wioski; śródleśne oczko wodne w lesie na południe od wioski.
Stachys sylvatica L. – AC3600: Sulimierz, park; Jedlice, zarośla przy parku;
AC3601: Swadzim, przydroże na drodze z Wiewiórek do Swadzimia.
204
Magdalenia Zemlik, Agnieszka Popiela
Teucrium scordium L. – AC3600: przy polu uprawnym na drodze z Jedlic do
Żarnowa.
Thymus pulegioides L. – AC2610: Miedzyń, murawa piaskowa przy lesie
w okolicach Miedzynia; AC3600: Sulimierz, teren po torowisku kolejowym; AC3601: Mostkowo, zarośla w okolicy stacji; teren po torowisku kolejowym.
Lemnaceae:
Lemna minor L. – AC2610: Miedzyń, oczko wodne w parku; AC3600: Sulimierz,
nad Jeziorem Sulimierskim; AC3601: Mostkowo, oczko wodne na łące za
budynkiem straży pożarnej.
Spirodela polyrhiza (L.) Scheild. – AC3600: Jedlice, staw w parku; podawana
z Jedlic, park (Bacieczko i in. 2002).
Liliacae:
Alium oleraceum L. – AC3610: Miedzyń, murawa w pobliżu lasu; AC3600:
Sulimierz, przydroże przy piaskowni; AC3601: Mostkowo, teren po torowisku kolejowym.
Gagea lutea (L.) Ker Gawl. – AC2610: Kolonia Jedlice, trawnik przy zabudowaniach mieszkalnych; AC3600: Sulimierz, przydroże przy drodze z Sulimierza do Mostkowa; AC3601: las przy drodze z Mostkowa do Dziedzic.
Maianthemum bifolium (L.) F. W. Schmidt – AC3601: Podgórze, las na S od
wioski; Mostkowo, las przy drodze do Dziedzic.
Paris quadrifolia L. – AC3601: Podgórze, las na S od wioski; las na N od
wioski.
Polygonatum multiflorum (L.) All. – AC3601: Podgórze, las na południe od
wioski.
Lythraceae:
Lythrum salicaria L. – AC3600: Jedlice, łąka przy szuwarze trzcinowym;
AC3601: Mostkowo, nad stawem hodowlanym w pobliżu stacji.
Malvaceae:
* Malva neglecta Wallr. – AC2610: Miedzyń, przydroże przy drodze prowadzącej
przez wioskę; AC2611: Dziedzice, sad porzeczkowy; AC3600: Sulimierz,
przydroże na drodze z Sulimierza do Mostkowa; AC3601: Mostkowo, przy
zabudowaniach gospodarczych.
* Malva sylvestris L. – AC2610: Miedzyń, przydroże przy drodze do Jedlic;
AC3600: Sulimierz, przy polu uprawnym w okolicy Sulimierza.
Notatki florystyczne z Mostkowa...
205
Nymphacae:
Nymphaea alba L. – AC3600: Sulimierz, Jezioro Sulimierskie; jezioro Małe.
Nuphar lutea (L.) Sibth. & Sm. – AC3601: Podgórze, staw w centrum wioski.
Oleaceae:
Fraxinus excelsior L. – AC3600: zarośla w pobliżu jeziora Małego.
Onagracae:
Chamaenerion angustifolium (L.) Scop. – AC2610: Kolonia Jedlice, przy drodze
prowadzącej przez wioskę; AC3600: zadrzewienia brzozowe przy drodze
prowadzącej z Mostkowa do Jedlic; AC3601: Mostkowo, zarośla przy lesie
na północ od Podgórza.
Epilobium hirsutum L. – AC2610: Miedzyń, zarośla przy stawie w parku;
AC3600: Jedlice, łąka w pobliżu szuwaru trzcinowego; AC3601: Mostkowo, stawy hodowlane w pobliżu stacji.
Oenothera biennis L. s. s. – AC3600: Sulimierz, łąka przy polnej drodze z Sulimierza do Mostkowa.
Oxalidaceae:
Oxalis acetosella L. – AC2610: Miedzyń, park; AC3601: Podgórze, las na południe od wioski; las na północ od wioski.
Oxalis fontana Bunge – AC2610: Miedzyń, nieużytek przy zabudowaniach.
Papaveracae:
Chelidonium majus L. – AC2610: przydroże na drodze do Miedzynia; AC3600:
Sulimierz, zarośla nad brzegiem Jeziora Sulimierskiego; AC3601: Mostkowo, las przy drodze z Mostkowa do Dziedzic.
* Papaver rhoeas L. – AC2610: Miedzyń, przydroże na drodze do Miedzynia;
AC2611: Dziedzice, przydroże na drodze z Dziedzic do Mostkowa; AC3600:
okolice Brzostowa; przy śródpolnym oczku wodnym; AC3601: Mostkowo,
przydroże koło stawów hodowlanych przy byłej stacji kolejowej.
Pinacae:
Pinus sylvestris L. – AC3601: Podgórze, las na północ od wioski.
Plantaginaceae:
Plantago lanceolata L. – AC2610: Miedzyń, przydroże na polnej drodze do Jedlic; AC2611: przydroże na drodze do Dziedzic; AC3600: przydroże na drodze do Brzostowa; AC3601: Mostkowo, trawnik koło sklepu.
Plantago major L. – AC2610: przydroże na drodze do Miedzynia; AC2611: przydroże na drodze z Mostkowa do Dziedzic; AC3600: Zofinówka na terenie
206
Magdalenia Zemlik, Agnieszka Popiela
po byłym PGR; AC3601: Mostkowo, przydroże koło stawów hodowlanych.
Plumbaginacae:
Armeria maritima Mill. Willd. – AC2600: Miedzyń, sucha murawa przydrożna;
AC3600: Jedlice, piaszczyste przydroże przy drodze z Jedlic do Żarnowa;
AC3601: Mostkowo, zarośla przy budynku byłej stacji kolejowej.
Poaceae:
Agropyron repens (L.) P. Beauv – AC2610: przydroże na drodze do Miedzynia;
AC2611: nieużytek porolny w okolicy Dziedzic; AC3600: Jedlice, przy
oczku wodnym w pobliżu Jedlic; AC3601: Mostkowo, łąka w pobliżu torowiska kolejowego.
Alopecurus geniculatus L. – AC2601: Miedzyń, łąka na drodze z Miedzynia do
Jedlic; AC3601: Mostkowo, przy oczku wodnym na łące za budynkiem
straży pożarnej; AC3600: Mostkowo, przy stawie hodowlanym przy drodze
z Mostkowa do Sulimierza.
Alopecurus pratensis L. – AC2610: przydroże Miedzyń; łąka za Miedzyniem;
AC2611: Dziedzice, nieużytek porolny w okolicy Dziedzic; AC3600: przydroże na drodze z Mostkowa do Jedlic; AC3601: Mostkowo, łąka koło
rowu.
* Apera spica-venti (L.) P. Beauv – AC2611: nieużytek porolny w okolicy Dziedzic; AC3600: pole uprawne w okolicy Zofinówki; przydroże w okolicy
koloni; przy ośrodku zdrowia; AC3601: Mostkowo, nieużytek porolny
w okolicy cmentarza.
Arrhenatherum elatius (L.) P. Beauv. ex J. Presl & C. Presl – AC2610: Miedzyń,
łąka przy drodze do Jedlic; AC2611: Dziedzice, zarośla w pobliżu rowu
melioracyjnego; AC3600: Sulimierz, przy rowie melioracyjnym w okolicy
cmentarza; AC3601: Mostkowo, trawnik koło zabudowań dawnego PGR.
Bromus hordeaceus L. – AC2610: Miedzyń, łąka przy drodze z Miedzynia do
Jedlic; AC2611: Dziedzice, przydroże na drodze z Dziedzic do Mostkowa;
AC3600: Sulimierz, przydroże na drodze w kierunku parku; AC3601: Swadzim, przy drodze z Wiewiórek do Swadzimia.
[*] Bromus intermis Leyss. – AC2610: Kolonia Jedlice, przy polu uprawnym;
AC2611: Dziedzice, nieużytek porolny; AC3600: Jedlice, łąka przy drodze
do Lipian; AC3601: łąka w okolicy Swadzimia.
Notatki florystyczne z Mostkowa...
207
* Bromus sterilis L. – AC2610: Miedzyń, przy drodze prowadzącej do Miedzynia
od strony Lipian; AC2611: Dziedzice, nieużytek porolny w okolicy Dziedzic; AC3600: Sulimerz, przydroże przy drodze wyjazdowej z Sulimierza
do Mostkowa; AC3601: Podgórze, przy zabudowaniach gospodarczych.
* Bromus tectorum L. – AC3601: Mostkowo, trawnik koło byłego PGR; AC3600:
okolice Mostkowa, łąka za działkami ogrodowymi.
Calamagrostis epigejos (L.) Roth – AC2611: Dziedzice, nieużytek porolny
w okolicy Dziedzic; AC3600: Sulimierz, przydroże przy drodze prowadzącej do Zofinówki; AC3601: Mostkowo, teren nad rowem.
Dactylis glomerata L. – AC2610: Miedzyń, przy zabudowaniach gospodarczych;
AC2611: Dziedzice, nieużytek porolny w okolicy Dziedzic; AC3600: Sulimierz, na terenie po torowisku kolejowym; AC3601: Mostkowo, przydroże
koło stawu hodowlanego.
Deschampsia caespitosa (L.) P. Beauv. – AC3600: Sulimierz, łąka przy osiedlu
blokowym od strony Mostkowa.
* Echinochloa crus-gali (L.) P. Beauv. – AC2610: Kolonia Jedlice, łąka w pobliżu wioski; AC3600: Sulimierz, okolice byłego torowiska kolejowego;
AC3601: Mostkowo, na terenie działek budowlanych.
Festuca ovina s.s. L. – AC2601: Miedzyń, murawa piaskowa; AC3600: Sulimierz, przydroże w pobliżu dawnej stacji kolejowej; AC3601: Mostkowo,
przy drodze wyjazdowej z Mostkowa do Dziedzic.
Festuca pratensis Huds. – AC2601: Miedzyń łąka przy drodze z Miedzynia do
Jedlic; AC2611: Dziedzice, przydroże na drodze z Dziedzic do Mostkowa;
AC3600: Sulimierz, łąka przy piaskowni; AC3601: Mostkowo, łąka przy
rowie.
Festuca rubra L. s. s. – AC2611: Dziedzice, nieużytek porolny; AC3600: Sulimierz, łąka przy osiedlu blokowym; AC3601: Mostkowo, łąka przy rowie
w okolicy centrali nasiennej.
Glyceria maxima (Hartm.) Holmb. – AC3600: Sulimierz, Jezioro Sulimierskie;
AC3601: Podgórze, nad śródleśnym oczkiem wodnym.
Holcus lanatus L. – AC2610: Miedzyń, przydroże na drodze z Miedzynia do Jedlic; AC2611: Dziedzice, nieużytek porolny w okolicy Dziedzic; AC3600:
Sulimierz, przydroże; teren po torowisku kolejowym; AC3601: przydroże
na drodze z Mostkowa do Sulimierza; na terenie działek budowlanych.
208
Magdalenia Zemlik, Agnieszka Popiela
Lolium perenne L. – AC2610: Miedzyń, trawniki przydrożne; AC2611: Dziedzice, przydroże na drodze z Dziedzic do Mostkowa; AC3600: Sulimierz, teren po torowisku kolejowym; AC3601: Mostkowo, przy drodze wyjazdowej
z Mostkowa od strony wschodniej.
Phalaris arundinacea L. – AC2610: Miedzyń, przy stawie w parku; AC2611:
Dziedzice, przy rowie melioracyjnym; AC3600: Sulimierz, przy Jeziorze
Sulimierskim; AC3601: Mostkowo, przy oczku wodnym za budynkiem
straży pożarnej.
Phleum pratense L. – AC2610: Miedzyń, przydroże na drodze do Jedlic; AC3600:
okolice Mostkowa, nieużytki porolne za ogródkami działkowymi; AC3601:
Mostkowo, nieużytek porolny przy cmentarzu.
Phragmites australis (Cav.) Trin. ex Steud. – AC2610: Miedzyń, szuwar trzcinowy na łące przy drodze do Jedlic; AC2611: Dziedzice, rów melioracyjny
w okolicy Dziedzic; AC3600: Sulimierz, nad Jeziorem Sulimierskim;
AC3601: Mostkowo, oczko wodne na łące za budynkiem centrali nasiennej.
Poa annua L. – AC2610: Miedzyń, okoliczne trawniki; AC2611: Dziedzice,
przy sadzie porzeczkowym; AC3600: Jedlice, przydroże na drodze wiodącej przez wioskę; AC3601: Mostkowo, przydroże polnej drogi w kierunku
Kornatki.
Poa compressa L. – AC3610: Miedzyń, przy murawie piaskowej; AC3600: Sulimierz, piaskownia; przydroże na drodze do Zofinówki; AC3601: Mostkowo, przy torowisku kolejowym.
Poa pratensis L. – AC2610: Miedzyń, łąka przy drodze z Miedzynia do Jedlic;
AC2611: Dziedzice, nieużytek porolny w okolicy Dziedzic; AC3600: Sulimierz, łąka koło piaskowni; AC3601: łąka przy stawach hodowlanych na
południowy zachód od Mostkowa.
Poa trivialis L. – AC2610: Miedzyń, łąka przy drodze z Lipian do Miedzynia;
AC2611: Dziedzice, przydroże przy drodze z Mostkowa do Dziedzic;
AC3600: Sulimierz, przydroże na drodze z Sulimierza do Mostkowa;
AC3601: Mostkowo, łąka za strażą pożarną.
Polygonacae:
Polygonum aviculare L. – AC2610: Kolonia Jedlice, przydrożne trawniki;
AC2611: Dziedzice, przy sadzie porzeczkowym; AC3600: przydroże przy
drodze wyjazdowej z Sulimierza do Mostkowa; AC3601: przydroże przy
drodze z Mostkowa do Sulimierza.
Notatki florystyczne z Mostkowa...
209
Polygonum laphatifolium L. – AC2610: Miedzyń, przy stawie w parku; AC3600:
Sulimierz, zarośla nad Jeziorem Sulimierskim.
Polygonum mite Schrank – AC2610: Miedzyń, przy stawie w parku; AC3600:
Jedlice, łąka w pobliżu szuwaru trzcinowego; AC3601: Swadzim, w pobliżu
szuwaru trzcinowego przy drodze do Swadzimia.
Polygonum persicaria L. – AC3600: Sulimierz, przy rowie melioracyjnym przy
cmentarzu; zarośla przy brzegu Jeziora Sulimierskiego; zarośla przy brzegu jeziora Małego; przy śródpolnym oczku wodnym w okolicy Brzostowa;
AC3601: Mostkowo, łąka przy stawie hodowlanym na południowy zachód
od wioski.
Rumex acetosa L. – AC3600: Mostkowo, przydroże na drodze z Mostkowa do
Sulimierza; AC3601: Mostkowo, przydroże przy byłej stacji kolejowej.
Rumex acetosella L. – AC2610: Miedzyń, murawa piaskowa przy drodze do Miedzynia; AC3600: Sulimierz, piaskownia; AC3601: Podgórze, polana w lesie
na południe od wioski.
Rumex hydrolapathum Huds. – AC2610: Miedzyń, przy stawie w parku; AC3600:
Sulimierz, przy brzegu Jeziora Sulimierskiego; AC3601: Mostkowo, oczko
wodne na łące za budynkiem straży pożarnej.
Rumex maritimus L. – AC3601: Mostkowo, oczko wodne na łące za strażą
pożarną.
Rumex obtusifolius L. – AC3610: Miedzyń, łąka na drodze prowadzącej do
Jedlic;
AC2611: Dziedzice, sad porzeczkowy; AC3600: Sulimierz, zarośla przy Jeziorze
Sulimierskim; AC3601: Podgórze, łąka przy stawie.
[*] Rumex thrysiflorus Fingerh. – AC2610: Miedzyń, w pobliżu murawy piaskowej; AC3600: Sulimierz, piaskownia; przy łące w okolicy piaskowni.
Primulacae:
Anagallis arvensis L. – AC2611: Dziedzice, przy sadzie porzeczkowym; AC3600:
Sulimierz, przydroże przy drodze prowadzącej z Mostkowa do Sulimierza;
AC3601: Mostkowo, pole uprawne w okolicy stawów hodowlanych.
Hottonia palustris L. – AC3601: Podgórze, śródleśne oczka wodne w lesie
na południe od wioski.
Lysimachia nummularia L. – AC3600: Sulimierz, nad brzegiem Jeziora Sulimierskiego; AC3601: Podgórze, przy śródleśnym oczku wodnym w lesie na południe od wioski.
210
Magdalenia Zemlik, Agnieszka Popiela
Lysimachia vulgaris L. – AC3600: brzeg Jeziora Sulimierskiego; AC3601: brzeg
jeziora Małego.
Primula veris L. – AC3600: Sulimerz, zarośla w pobliżu Jeziora Sulimierskiego;
AC3601: Podgórze, las na południe od wioski; Mostkowo, las przy drodze
do Dziedzic.
Pteridaceae:
Pteridium aquilinum (L.) Kuhn. – AC3601: las za Podgórzem; las przed Podgórzem.
Ranunculaceae:
Anemone nemorosa L. – AC2610: Miedzyń, park; AC3600: Jedlice, park;
AC3601: las za Podgórzem.
Batriachum aquatile (L.) Dumort. – AC3601: bajorko w lesie za Podgórzem.
Caltha palustris L. – AC3600: nad brzegiem jeziora Sulimierskiego; AC3601:
Mostkowo, bajorko na podmokłej łące koło stawów hodowlanych.
* Consolida regalis Gray – AC2601: Miedzyń, przy polu uprawnym w okolicy
Miedzynia; AC3600: Sulimierz, przydroże na drodze do Zofiówki; AC3601:
Swadzim, przydroże.
Ficaria verna Huds. – AC2610: Kolonia Jedlice, przydroże; AC3600: Sulimierz,
przy ogrodzeniu przycmentarnym; AC3601: Mostkowo, zarośla przy budynku byłego PGR.
Ranunculus acris L. s. s. – AC2610: Miedzyń; łąka przy drodze do Jedlic;
AC2611: Dziedzice, łąka przy drodze do Mostkowa; AC3600: Sulimierz,
ogródki uprawne w pobliżu Jeziora Sulimierskiego; AC3601: Podgórze,
przy drodze prowadzącej do lasu na południe od wioski.
Ranunculus bulbosus L. – AC2610: Miedzyń, przy murawie piaskowej; AC3600:
Sulimierz, przydroże przy piaskowni.
Ranunculus repens L. – AC2610: Miedzyń, łąka przy drodze do Jedlic; AC3600:
Sulimierz, przydroże na drodze z Sulimierza do Mostkowa; AC3601: Mostkowo, trawnik koło byłego PGR.
Ranunculus sceleratus L. – AC3601: Podgórze, śródleśne oczko wodne na południe od wioski.
Resedaceae:
Reseda lutea L. – AC3600: przydroże przy drodze z Mostkowa do Sulimierza; AC3601: Mostkowo, przy polu uprawnym na południowy zachód od
wioski.
Notatki florystyczne z Mostkowa...
211
Rhamnaceae:
Frangula alnus Mill. – AC3601: Mostkowo, las przy drodze do Dziedzic.
Rhamnus catharticus L. – AC3601: Podgórze, na skraju lasu na południe od
wioski.
Rosaceae:
Agrimonia eupatoria L. – AC2610: Miedzyń, przydrożne zarośla; AC2611:
Dziedzice, przy rowie w okolicy Dziedzic; AC3600: Mostkowo, przydroże
na drodze do Sulimierza; AC3601: Mostkowo, teren nad rowem koło centrali nasiennej.
Cerasus avium (L.) Moench – AC2610: Miedzyń, park; AC3600: Sulimierz, zarośla na byłym torowisku kolejowym; AC3601: Podgórze, las na północ od
wioski.
Crataegus monogyna Jacq. – AC2610: Miedzyń, park; AC2611: Dziedzice,
na drodze prowadzącej z Mostkowa do Dziedzic; AC3600: Sulimierz, przy
drodze wjazdowej do Sulimierza od strony Dzierzgowa; AC3601: Mostkowo, nad rowem koło centrali nasiennej.
Geum urbanum L. – AC2610: Miedzyń, park; AC3600: Sulimierz, zarośla nad
brzegiem Jeziora Sulimierskiego; AC3601: Swadzim, przydroże na drodze
do Swadzimia z Wiewiórek.
* Padus serotina (Ehrh.) Borkh – AC2610: Miedzyń, zarośla parkowe; AC3600:
Sulimierz, przy parku; AC3601: Podgórze, las na N od wioski.
Potentilla anserina L. – AC3610: Miedzyń, przy stawie w parku; AC3600: Sulimierz, przy rowie melioracyjnym w okolicy cmentarza; AC3601: Mostkowo, przydroże koło stawu hodowlanego.
Potentilla collina Wibel. s. s. – AC2610: Miedzyń, murawa piaskowa w pobliżu
wioski; AC3600: Mostkowo, teren torowiska kolejowego na południowy
zachód od wioski; AC3601: Mostkowo, przydroże przy stawie hodowlanym
w pobliżu stacji kolejowej; teren byłej stacji kolejowej.
Potentilla reptans L. – AC2610: Jedlice, kolonia, przydrożne trawniki; AC 2611:
Dziedzice, nieużytek porolny w okolicy Dziedzic; AC3600: Sulimierz, przydroże na drodze z Sulimierza do Mostkowa; AC3601: Mostkowo, przydroże
przy polu uprawnym na SW od Mostkowa.
Rosa canina L. – AC2601: przydroże na drodze do Miedzynia; AC2611: Dziedzice, przydroże na drodze do Mostkowa; AC3600: Mostkowo, w pobliżu
zarośli nad jeziorem Małym; AC3601: Mostkowo, nad rowem przy centrali
nasiennej.
212
Magdalenia Zemlik, Agnieszka Popiela
Rubus caesius L. – AC2600: Miedzyń, przydroże na drodze do Miedzynia;
AC3601: Podgórze, przy drodze do lasu na południe od wioski.
Rubus idaeus L. – AC3601: Podgórze, las na południe od wioski; AC3600:
Jedlice, park.
Rubus plicatus Weihe & Ness – AC3601: Mostkowo, las przy drodze do Dziedzic.
Sorbus aucuparia L. Emend. Hedl. – AC2601: Miedzyń, park; AC3601: Mostkowo, przy drodze wyjazdowej z Mostkowa do Barlinka; AC3600: Sulimierz,
na terenie osiedla blokowego.
Rubiaceae:
Galium aparine L. – AC2610: Kolonia Jedlice, okoliczne pola uprawne; AC2611:
sad porzeczkowy w okolicy Dziedzic; AC3600: Sulimierz, piaskownia;
AC3601: Mostkowo, łąka za szkołą.
Galium mollugo L. – AC3600: Brzostowo, przydroże; AC3601: Mostkowo,
torowisko kolejowe.
Galium odoratum (L.) Scop. – AC3601: Podgórze, las na północ od wioski.
Galium verum L. – AC3600: Sulimierz, piaskownia; na terenie byłego torowiska
kolejowego; AC3601: Mostkowo, przydroże na drodze z Mostkowa do Sulimierza.
Salicaceae:
Salix aurita L. – AC3600: Sulimierz, brzeg Jeziora Sulimierskiego; AC3601:
Mostkowo, łąka za centralą nasienną.
Salix cinerea L. – AC2610: Kolonia Jedlice, na podmokłej łące; AC2611: Dziedzice, podmokła łąka w okolicy wioski; AC3600: Jedlice, szuwar na W
od wioski; AC3601: Mostkowo, łąka za centralą nasienną.
Salix pentandra L. – AC3611: Dziedzice, szuwar trzcinowy w okolicy wioski;
przy hodowli dzikich zwierząt; AC3601: Mostkowo, łąka przy centrali nasiennej; AC3600: Jedlice, szuwar trzcinowy przy drodze.
Scrophulariaceae:
* Digitalis purpurea L. – AC3601: Podgórze, las na S stronie wioski.
Linaria vulgaris Mill. – AC2610: Miedzyń, przydroże przy drodze z Lipian do
Miedzynia; AC3601: Mostkowo, przydroże przy stawie hodowlanym w pobliżu cmentarza; AC3600: Mostkowo, przydroże na drodze z Mostkowa do
Sulimierza.
Notatki florystyczne z Mostkowa...
213
Melampyrum pratense L. – AC2610: Miedzyń, murawa piaskowa w pobliżu lasu
sosnowego; AC3600: Sulimierz, murawa w pobliżu osiedla blokowego;
AC3601: Podgórze, las na południe od wioski.
Verbascum thapsus L. – AC3600: Sulimierz, przydroże na drodze z Mostkowa
do Sulimierza.
Veronica chamaedrys L. – AC2610: Miedzyń, park; przydrożne trawniki; AC2611:
Dziedzice, przydroże na drodze z Mostkowa do Dziedzic; AC3601: Mostkowo, łąka za budynkiem straży pożarnej; AC3600: Brzostowo, przydroże
na drodze z Żarnowa do Brzostowa.
* Veronica officinalis L. – AC3601: Podgórze, las na S od wioski.
* Veronica opaca Fr. – AC2611: Dziedzice, nieużytek porolny w okolicy wioski; AC3601: Mostkowo, nieużytek porolny przy cmentarzu; AC3600: Sulimierz, ogródki uprawne w okolicy Jeziora Sulimierskiego.
Veronica persica Poir. – AC3600: Sulimierz, zarośla nad jeziorem Sulimierskim;
AC3601: Mostkowo, nad rowem przy centrali nasiennej.
Solanaceae:
Solanum dulcamara L. – AC3601: Podgórze, śródleśne oczko wodne przy lesie
na S od wioski.
Sparganiacae:
Sparganium erectum L. Emend. Rchb. s. s. – AC3601: Mostkowo, oczko wodne na łące za strażą pożarną: Mostkowo, staw hodowlany przy cmentarzu;
AC3600: Jezioro Sulimierskie.
Thelypteridaceae:
Thelypteris palustris Schott – AC3601: Podgórze, las na S od wioski; las na N
od wioski; Mostkowo, las przy drodze do Dziedzic.
Typhaceaae:
Typha latifolia L. – AC3601: Mostkowo, oczko wodne na łące za strażą pożarną;
staw strażacki; AC3600: Sulimierz, Jezioro Sulimierskie.
Typha angustifolia L. – AC3600: Sulimierz, nad brzegim jeziora Sulimierskiego.
Urticaceae:
Urtica dioica L. – AC2610: Miedzyń, przydroże na drodze prowadzącej do Lipian; AC2611: Dziedzice, przy drodze prowadzącej z Mostkowa do Dziedzic; AC3600: Sulimierz, zarośla nad Jeziorem Sulimierskim; AC3601:
Mostkowo, przy rowie koło centrali nasiennej.
214
Magdalenia Zemlik, Agnieszka Popiela
Violaceae:
* Viola arvensis Murray – AC2600: Miedzyń, przy polu uprawnym; AC3611:
nieużytek porolny przy drodze w okolicy Dziedzic; AC3601: Mostkowo,
trawnik przy budynku byłego PGR; AC3600: Sulimierz, łąka za osiedlem
blokowym.
[*] Viola odorata L. – AC2610: Miedzyń, park; zarośla w pobliżu parku;
AC3600: Sulimierz, w pobliżu parku; AC3601: Mostkowo, przy zabudowaniach byłego PGR.
Viola reichenbachiana Jord. Ex Boreau. – AC3601: Podgórze, las na południe
od wioski.
Viola riviniana Rchb. – AC3600: Jedlice, park; AC3601: Mostkowo, park.
Viola tricolor L. s. s. – AC3600: Sulimierz, przy polu uprawnym na zachód
od wioski.
4. Podsumowanie wyników badań
Praca zawiera 792 daty florystyczne dla 297 gatunków notowanych w najbliższych okolicach wsi Mostkowo położonej we wschodniej części Pojezierza
Myśliborskiego. Biorąc pod uwagę geograficzne usytuowanie badanego terenu,
małe zróżnicowanie siedlisk, typowo rolniczy krajobraz, niewielką powierzchnię oraz zakres przeprowadzonych badań, można oszacować, że w niniejszym
opracowaniu odnotowano ok. 80% spodziewanych taksonów. Są to z reguły taksony pospolite w skali kraju i regionu; do wyjątków należą: Tragopogon dubius,
Eleocharis acicularis, Veronica opaca, Geranium sylvaticum, Teuctrium scordium, Batrachium aquatile, Carex caryophyllea.
BIBLIOGRAFIA
Borówka R., Friedrich S., Heese T., Jasnowska J., Kochanowska R., Opechowski M.,
Stanecka E., Zyska W., 2002: Przyroda Pomorza Zachodniego. Oficyna in plus,
Szczecin.
Bacieczko W., Jurzyk S., Przybylski G., 2002: Drzewa i krzewy parków i cmentarzy
w gminie Barlinek (województwo zachodniopomorskie). Rocznik Dendrologiczny,
48, s. 143–158.
Ćwikliński E., 1988: Rośliny naczyniowe Wyspy Chrząszczewskiej. Monografie 6, Wyższa
Szkoła Rolniczo-Pedagogiczna im. Georgi Dymitrowa w Siedlcach.
Notatki florystyczne z Mostkowa...
215
Mirek Z., Piękoś-Mirkowa H., Zając A., Zając M., 2002: Flowering plants and pteridophytes of Poland a checklist. W. Szafer Institute of Botany, Polish Academy
of Sciences, Kraków.
Myśliwy M., 2003: Flora roślin naczyniowych Barlinecko-Gorzowskiego Parku
Krajobrazowego w warunkach antropogenicznych przemian środowiska przyrodniczego, cz. 1–2. Praca doktorska wykonana w Katedrze Taksonomii Roślin
i Fitogeografii Uniwersytetu Szczecińskiego (manuskrypt).
Piotrowska H., 1966: Rośliny naczyniowe wysp Wolina i południowo-wschodniego
Uznamu. Poznańskie Towarzystwo Przyjaciół Nauk. Prace Komisji Biologicznej
30 (4). Poznań.
Stępień E., 2002: Flora roślin naczyniowych Cedyńskiego Parku Krajobrazowego,
cz. 1–2. Praca doktorska wykonana w Katedrze Taksonomii Roślin i Fitogeografii
Uniwersytetu Szczecińskiego (manuskrypt).
Więcław H., 2002: Flora roślin naczyniowych Ińskiego Parku Krajobrazowego i jej antropogeniczne przeobrażenia. Praca doktorska wykonana w Katedrze Taksonomii
Roślin i Fitogeografii Uniwersytetu Szczecińskiego (manuskrypt).
Zając A., Ciaciura M., Zając M., 1993: Rośliny naczyniowe Zaodrza (na zachód od
Szczecina). Szczecin.
Zając A., Zając M. (red.), 2001: Atlas rozmieszczenia roślin naczyniowych w Polsce.
Nakładem Pracowni Chronologii Komputerowej Instytutu Botaniki Uniwersytetu
Jagiellońskiego, Kraków.
FLORISTIC NOTES OF THE MOSTKOWO NEIGHBOURHOOD
(THE POJEZIERZE MYŚLIBORSKIE LAKELAND, NW POLAND)
Summary
New sites of 297 vascular plant species have been recorded in the neighbourhood
of Mostkowo – the small village surrended by arable field in the NW part of Western
Pomerania. The floristic data are given for the first time from this area.
Translated by Agnieszka Popiela

Podobne dokumenty