EPISTEME

Komentarze

Transkrypt

EPISTEME
ISSN 1895 - 4421
EPISTEME
CZASOPISMO NAUKOWO-KULTURALNE
KRAKÓW
Nr 22/2014, t. I
EPISTEME
CZASOPISMO NAUKOWO-KULTURALNE
Redakcja:
Zdzisław Szczepanik (red. naczelny)
Katarzyna Daraż-Duda (sekretarz redakcji)
Piotr Walecki
Grzegorz Chajko
Krzysztof Duda
Roman Turowski (red. techniczny)
Rada Naukowa:
Prof. dr hab. Dariusz Rott
Prof. dr hab. Włodzimierz Sady
Prof. dr hab. Michał Śliwa
Prof. dr hab. inż. Ryszard Tadeusiewicz
Prof. dr hab. Bogdan Zemanek
Ks. Prof. dr hab. Władysław Zuziak
Prof. nadzw. dr hab. Wiesław Alejziak
Prof. Ignatianum i UJ, dr hab. Józef Bremer SJ
Prof. dr przew. kwal. II Paweł Taranczewski
Prof. UP dr hab. Andrzej Kornaś
Prof. dr Olga E. Kosheleva
Prof. dr Marko Jacov
Prof. dr Aleksandr Lokshin
Prof. dr Hans Jørgen Jensen
Prof. dr Oleksandr Chyrkov
Prof. dr Iryna Diachuk
Prof. dr Luiza Arutinov
Prof. dr hab. Michaił Pawłowicz Odesskij
Prof. dr hab., dr. phil. Andrzej Wiercinski
Prof. dr eng. Elena Horska
Wydawca:
Stowarzyszenie Twórców Nauki i Kultury „Episteme”
ul. Okólna 28/87
30-669 Kraków
www.episteme-nauka.pl
© Stowarzyszenie Twórców Nauki i Kultury „Episteme” i Autorzy
Pierwotną wersją czasopisma jest wersja papierowa
SPIS TREŚCI
Agroekonomia, agroturystyka i zarządzanie
Karol Król, Dawid Bedla, Krzysztof Gawroński
ANALIZA WYBRANYCH ZAGROŻEŃ ZWIĄZANYCH
Z PROMOWANIEM, SPRZEDAŻĄ I REZERWACJĄ USŁUG
AGROTURYSTYCZNYCH W INTERNECIE – STUDIUM PRZYPADKU . . . . . . . . . . . 5
Barbara Biniaś
COMPARATIVE ANALYSIS OF THE SURFACE CHANGES
OF LONG-TERM GLACIER FORM IN POLAND, THE EXAMPLE
LODOWCZYK MIĘGUSZOWIECKI IN THE HIGH TATRA MOUNTAINS . . . . . . . 15
Marta Gas, Izabela Gołąb, Łukasz Kuta
SZANSE ROZWOJU GMINY MIĘDZYLESIE W OCENIE JEJ MIESZKAŃCÓW . . 23
Izabela Gołąb, Marta Gas, Łukasz Kuta
PERSPEKTYWY ROZWOJU TURYSTYKI WIEJSKIEJ
I AGROTURYSTYKI NA OBSZARZE GMINY MIĘDZYLESIE . . . . . . . . . . . . . . . . . . 31
Łukasz Kuta, Marta Gas, Izabela Gołąb, Karolina Kolasińska
DETERMINANTY STABILNEGO ROZWOJU INFRASTRUKTURY
AGROTURYSTYCZNEJ NA PRZYKŁADZIE
WYBRANYCH GOSPODARSTW W GMINIE MIĘDZYLESIE . . . . . . . . . . . . . . . . . . 39
Barbara Szczepańska
Wdrażanie postępu technicznego w opiniach
osób oferujących maszyny rolnicze na Dolnym Śląsku . . . . . . . . . 47
Maciej Sporysz, Maria Szczuka, Sylwester Tabor, Karolina Trzyniec,
Anna Karbowniczak, Andrzej Ochrem, Anna Klamerus Iwan
PROGNOZOWANIE CEN WYBRANYCH TOWARÓW POCHODZENIA
ROLNICZEGO Z WYKORZYSTANIEM SZTUCZNYCH SIECI NEURONOWYCH . 59
Spis treści
Leśnictwo i Łowictwo
Bartłomiej Rębkowski, Ewa Archanowicz,
Emil Archanowicz, Dominika Szadkowska
Ocena skuteczności działania wybranych kompozycji
preparatów ochronnych i dekoracyjno – ochronnych
zastosowanych na elewacji OSW ‘Marymont’ w Kirach . . . . . . . . . . 69
Paulina Anna Rutkowska, Michał Jamkowski
ROZWÓJ ROŚLINNOŚCI RUNA I POZIOMÓW
ORGANICZNYCH GLEB W 150-LETNIM CYKLU
UPRAWY SOSNY NA WYDMACH KOTLINY TORUŃSKIEJ . . . . . . . . . . . . . . . . . 369
Nauki o zwierzętach
Edyta Bańcyr, Paulina Jawor, Dawid Król, Joanna Bajzert,
Tadeusz Stefaniak, Anna Chełmońska-­Soyta
PORÓWNANIE KOMERCYJNIE DOSTĘPNYCH ZESTAWÓW DO
IZOLACJI RNA Z TKANKI MÓZGU CIELĘCIA MARTWO URODZONEGO . . . . . 81
Edyta Bauer, Justyna Żychlińska–Buczek, Michał Rozmus
CZYNNIKI WPŁYWAJĄCE NA PRZEBIEG PORODU U KRÓW RAS MLECZNYCH . . 91
Karolina Bierowiec, Krzysztof Rypuła, Katarzyna Płoneczka-Janeczko
EPIDEMIOLOGIA STAPHYLOCOCCUS AUREUS U KOTÓW WE WROCŁAWIU . . . 99
Michał Błasiaki, Agnieszka Banyśii
ROLA GRELINY W REGULACJI SEKRECJI
PROLAKTYNY U OWIEC – BADANIA IN VITRO . . . . . . . . . . . . . . . . . . . . . . . . . . . 107
Angelika Borowska, Jacek Maślanka, Anna Adamik
OCENA WYSTĘPOWANIA I ZAGĘSZCZENIA PUSZCZYKA
ZWYCZAJNEGO STRIX ALUCO I PUSZCZYKA URALSKIEGO
STRIX URALENSIS W PUSZCZY NIEPOŁOMICKIEJ . . . . . . . . . . . . . . . . . . . . . . . 115
Blanka Ćwieluch, Dorota Merta, Dobromiła Karpińska
DIETA KUNY LEŚNEJ (MARTES MARTES)
W PUSZCZY NIEPOŁOMICKIEJ W OKRESIE WIOSENNYM . . . . . . . . . . . . . . . . 123
Spis treści
Agata Fabiszewska, Krystyna Zielińska
WPŁYW OBECNOŚCI OCHRATOKSYNY A
NA WZROST SZCZEPÓW Z RODZAJU LACTOBACILLUS . . . . . . . . . . . . . . . . . . 131
Zita Gergely
USES OF LINEAR CONFORMATION EVALUATION SYSTEM
FOR TRADITIONAL HUNGARIAN HORSE BREED, FURIOSO-NORTH STAR . . . . 139
Marta Głogowska
STĘŻENIE RTĘCI W PRZEŁYKU
I JELICIE CIENKIM U LUDZI W RÓŻNYM WIEKU . . . . . . . . . . . . . . . . . . . . . . . . 147
Marta Głogowska
STĘŻENIE RTĘCI W TKANKACH NOWOTWOROWYCH
I NIEZMIENIONYCH PATOLOGICZNIE LUDZKIEGO ŻOŁĄDKA . . . . . . . . . . . . 155
Grygier Joanna, Schwarz Tomasz, Murawski Maciej,
Zięcik Adam, Dorota Zięba-Przybylska
WPŁYW KONTAKTU Z KNUREM NA WYDZIELANIE KORTYZOLU
I LH U DOJRZAŁYCH PŁCIOWO LOSZEK W OKRESIE OKOŁORUJOWYM . . . 163
Karolina Konieczna, Zbigniew W. Czerniakowski, Tomasz Olbrycht
MATERIAŁY DO POZNANIA ZGRUPOWAŃ CHRZĄSZCZY
OMARLICOWATYCH (COL., SILPHIDAE) W UPRAWACH ZIEMNIAKA
I BIOCENOZACH LEŚNYCH WYBRANYCH REGIONÓW
POLSKI POŁUDNIOWO-WSCHODNIEJ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173
Iwona Kozikowska, Katarzyna Suprewicz, Helena Sławska
KUMULACJA WYBRANYCH PIERWIASTKÓW BIOGENNYCH
W PĘPOWINIE I KRWI PĘPOWINOWEJ NOWORODKÓW
Z RÓŻNĄ MASĄ URODZENIOWĄ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta,
Magdalena Semla, Marta Batoryna, Martyna Błaszczyk
WPŁYW ALKOHOLU ETYLOWEGO NA POZIOM GLUTATIONU
ZREDUKOWANEGO W WĄTROBIE I NERKACH U MYSZY . . . . . . . . . . . . . . . . . 195
Dawid Król, Edyta Bańcyr, Paulina Jawor, Tadeusz Stefaniak
ROZPOZNANIE CIĘŻKIEGO PORODU NA PODSTAWIE
ZMIAN SEKCYJNYCH U MARTWO URODZONYCH CIELĄT . . . . . . . . . . . . . . . . 205
Spis treści
Katarzyna Kruczek, Barbara Danielak-Czech
FIZYCZNA LOKALIZACJA GENÓW MKBP I CRYAB W GENOMIE BYDŁA . . . . . 213
Martyna Małopolska, Ryszard Tuz
THE INFLUENCE OF PIGLET BIRTH WEIGHT
ON THE AMOUNT OF LOSSES IN CROSS-FOSTERED LITTERS . . . . . . . . . . . . 221
Koczanowski Józef, Monika Petrynka,
Katarzyna Olczak, Czesław Klocek, Mariusz Głownia
WPŁYW SPOSOBU ŻYWIENIA TUCZNIKÓW O ZRÓŻNICOWANYM
GENOTYPIE NA ICH WARTOŚĆ TUCZNĄ I RZEŹNĄ . . . . . . . . . . . . . . . . . . . . . . 229
Katarzyna Olczak, Monika Petrynka,
Martyna Małopolska, Czesław Klocek
REAKCJE STRESOWE U PSÓW I ICH BIOLOGICZNE UWARUNKOWANIA . . . . 237
Mateusz Malinowski, Bartłomiej Rospond, Jakub Sikorai
TERMOGRAFICZNA ANALIZA POWIERZCHNI
CIAŁA SZCZURA LABORATORYJNEGO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245
Katarzyna Słota, Piotr Micek
Wpływ temperatury i lignosulfonianów
na skład chemiczny, rozpuszczalność azotu
i strawność in vitro makuchu rzepakowego . . . . . . . . . . . . . . . . . . . . 255
M. Stefaniuk, Z. Podstawski, W. Młodawska
Chemotaksja plemników ogiera . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 263
Katarzyna Suprewicz, Iwona Kozikowska
STĘŻENIE RTĘCI W ŁOŻYSKU I BŁONIE PŁODOWEJ KOBIET ORAZ
WE KRWI PĘPOWINOWEJ A MASA URODZENIOWA NOWORODKÓW . . . . . 271
Hanna Szczukowska, Radomir Graczyk, Anna Seniczak
WPŁYW NAWOŻENIA OBORNIKIEM ŚWIŃSKIM I KOZIM
NA MECHOWCE (ACARI: ORIBATIDA) ŁĄKOWE . . . . . . . . . . . . . . . . . . . . . . . . . . 281
Agnieszka Szumiec, Anna Radko,
Anna Koseniuk, Tadeusz Rychlik
KONSERWATYZM GENETYCZNY
WYBRANYCH SEKWENCJI MIKROSATELITARNYCH U BOVIDAE . . . . . . . . . . 291
Spis treści
Technologia żywności
Magda Filipczak-Fiutak, Monika Wszołek
WPŁYW DODATKU β-GLUKANU NA MIKROFLORĘ
KEFIRÓW OTRZYMANYCH Z RÓŻNYCH KULTUR STATRTOWYCH . . . . . . . . 301
Grzegorz Fiutak, Macura Ryszard, Magda Filipczak-Fiutak, Joanna Brożyna
PORÓWNANIE WARTOŚCI ODŻYWCZEJ DZIKO ROSNĄCYCH
ROŚLIN JADALNYCH W ZALEŻNOŚCI OD OKRESU WEGETACJI . . . . . . . . . . . 311
Ewelina Gwóźdź, Piotr Gębczyński, Aleksandra Skrzypczak
KSZTAŁTOWANIE SIĘ CECH SENSORYCZNYCH PRZECIERÓW
POMIDOROWYCH W TRAKCIE PRZECHOWYWANIA . . . . . . . . . . . . . . . . . . . . . 321
Monika Kosowska, Joanna Rychlicka-Rybska, Teresa Fortuna
Zastosowanie skrobi jako zamiennika fosforanów
w produkcji polędwicy wędzonej, parzonej . . . . . . . . . . . . . . . . . . . . 333
Kinga Kraskai, Grzegorz Formickii, Edyta Kapustai,
Magdalena Semlai, Marta Batorynai, Martyna Błaszczyk
WPŁYW ALKOHOLU ETYLOWEGO NA POZIOM GLUTATIONU
ZREDUKOWANEGO W WĄTROBIE I NERKACH U MYSZY . . . . . . . . . . . . . . . . . 343
Katarzyna Liszka, Tadeusz Grega, Dorota Najgebauer-Lejko
CHARAKTERYSTYKA JOGURTÓW
Z DODATKIEM OWOCÓW ROKITNIKA I CZARNEGO BZU . . . . . . . . . . . . . . . . 353
Anna Ogrodowczyk, Joanna Fotschki, Barbara Wróblewska
The effect of L. delbruecki ssp. bulgaricus - 151 fermented
buttermilk beverage on the course of allergic reaction . . . . . 361
Inne
Paulina Anna Rutkowska, Michał Jankowski
Rozwój roślinności runa i poziomów
organicznych gleb w 150-letnim cyklu
uprawy sosny na wydmach Kotliny Toruńskiej . . . . . . . . . . . . . . . . . 369
Spis treści
Elżbieta Kornalska, Izabella Majewska, Witold Trela
Strukturalna deversyfikacja gospodarki rolnej
w Polsce po wstąpieniu do Unii Europejskiej . . . . . . . . . . . . . . . . . . . . 379
Izabella Majewska, Witold Trela, Elżbieta Kornalska
Współpraca z mediami a tworzenie wizerunku uczelni
na przykładzie Uniwersytetu Rolniczegow Krakowie . . . . . . . . . . 389
Witold Trela, Izabella Majewska, Elżbieta Kornalska
Działania innowacyjne w polskich
przedsiębiorstwach przemysłowych i usługowych . . . . . . . . . . . . . 397
Witold Trela, Elżbieta Kornalska, Izabella Majewska
Rozwój gospodarstw ekologicznych w Polsce . . . . . . . . . . . . . . . . . 409
Łukasz Borek, Krzysztof Ostrowski
Rola i znaczenie infrastruktury wodnomelioracyjnej w kształtowaniu walorów
krajobrazowych parku dworskiego w Brniu . . . . . . . . . . . . . . . . . . . 419
Agroekonomia, agroturystyka
i zarządzanie
Karol Król
Dawid Bedla
EPISTEME
22/2014, t. I
s. 5-13
ISSN 1895-2241
ANALIZA WYBRANYCH ZAGROŻEŃ ZWIĄZANYCH
Z PROMOWANIEM, SPRZEDAŻĄ I REZERWACJĄ
USŁUG AGROTURYSTYCZNYCH
W INTERNECIE – STUDIUM PRZYPADKU
RISKS ANALYSIS OF THE PROMOTION, SALE
AND RESERVATION OF THE AGROTOURISM
SERVICES IN THE INTERNET – A CASE STUDY
Abstrakt: Internet stanowi dynamicznie rozwijający się kanał dystrybucji
różnego rodzaju towarów i usług. Oprócz ich bezpośredniej sprzedaży służy
informowaniu i promocji. Zalety te zostały docenione przez gospodarstwa
agroturystyczne, których właściciele co raz częściej wymieniają Internet
jako najważniejsze źródło pozyskiwania klientów. Korzystanie z sieci Internet wiąże się jednak z coraz poważniejszymi zagrożeniami, na które są
narażeni nie tylko właściciele stron internetowych ale również ich użytkownicy, w tym klienci poszukujący „wczasów pod gruszą”. Celem artykułu
jest ocena zagrożeń na które narażeni są właściciele gospodarstw agroturystycznych wykorzystujący Internet do promocji, sprzedaży i rezerwacji
swoich usług. Przykładem takich zagrożeń są: próby wyłudzenia informacji,
ataki szkodliwego oprogramowania czy oszustwa o charakterze przestępstw
gospodarczych, które w realny sposób mogą przyczynić się do powstania
strat finansowych.
Słowa kluczowe: zagrożenia w Internecie, szkodliwe oprogramowanie, wyłudzanie informacji
Abstract: The Internet is now a rapidly growing sales channel for different
types of goods and services. In addition to direct sales or reservations, Internet is common used to inform and promotion. These advantages are also
recognized by the farmhouses, whose owners more often used the Internet
as a major source of customer acquisition. Using the Internet is associated
with increasing dangers on which exposed are not only the owners of websi5
Karol Król, Dawid Bedla, Krzysztof Gawroński
tes but all users. The purpose of this article is to evaluate the risks, which in
real way they can contribute to financial losses, attempts extorting, malware attacks and fraudulent nature of direct economic crimes, on which are
exposed website owners tourist farms.
Key words: threats on the Internet, malware, phishing
Wstęp
Szacuje się, że statystycznie więcej niż co trzeci mieszkaniec globu korzysta z Internetu. W przeliczeniu na populację to niemal 2,4
mld osób. Systematycznie rośnie liczba użytkowników Internetu
w Unii Europejskiej. W 2012 r. dostęp do sieci zadeklarowało 75% jej
mieszkańców [Report 2013]. W Polsce dostęp do Internetu w miejscu
zamieszkania deklaruje 70,5% gospodarstw domowych [IAB 2012].
Internet stosunkowo szybko stał się czwartym, masowym
źródłem społecznego przekazu. Coraz tańszy i ogólnodostępny,
stanowi wyposażenie większości gospodarstw domowych zarówno
w mieście, jak i na wsi. Barrow [2006, s. 11] nie pozostawia złudzeń,
cyt. „Internet stał się faktem”. Zastosowanie Internetu jako narzędzia
promocji i sprzedaży usług nie ominęło sektora turystyki wiejskiej.
Własną stronę internetową posiada już większość gospodarstw agroturystycznych. Liczne wykorzystują portale społecznościowe, blogi,
katalogi i komunikatory oraz honorują płatności i rezerwacje internetowe. Wszystkie te operacje usprawniają prowadzenie działalności
gospodarczej oraz wyszukanie i zakup usługi przez klientów, jednocześnie wystawiając użytkowników na zagrożenia. Największe firmy
zajmujące się bezpieczeństwem w Internecie prognozują wzrost liczby niebezpieczeństw w sieci. Dwornik [2013] przekonuje, że wraz
z upowszechnianiem dostępu do Internetu coraz częstsze będą próby
kradzieży i wyłudzeń poufnych informacji, a metody stosowane przez oszustów będą co raz bardziej wyszukane.
Materiał i metody
Celem pracy jest analiza opisowa oraz subiektywna ocena punktowa
wybranych zagrożeń występujących w Internecie, na które narażeni
są właściciele gospodarstw agroturystycznych wykorzystujący Sieć
do promocji, rezerwacji oraz sprzedaży swoich usług. Szczególną
6
Analiza wybranych zagrożeń związanych...
uwagę poświęcono zagrożeniom mogącym przyczynić się do powstania strat finansowych. W pracy przedstawiono mechanizm działania
oszustów. Ponadto wykonano studia przypadków (ang. case study) tj.
konkretnych zagrożeń występujących w Internecie oraz opisano sposoby ich uniknięcia. Studium przypadku to metoda rozpowszechniona w latach 90. XX wieku [Longley 1999] a jej głównym celem jest przedstawienie i analiza konkretnego zjawiska [Piekkari i Welch 2011].
Zagrożenia występujące w Internecie można podzielić na mniej
lub bardziej poważne w skutkach. Niektóre mogą doprowadzić do
utraty środków finansowych. Inne bywają jedynie uciążliwe, np.
„spam”. Z punktu widzenia techniczno-organizacyjnego zagrożenia
dzielimy na te, za które odpowiadają aplikacje (roboty sieciowe, programy komputerowe) i te, za którymi stoi bezpośrednio człowiek.
W przypadku tych ostatnich są to: próby wyłudzania poufnych informacji osobistych w tym kradzież tożsamości (ang. phishing, pharming,
spearphishing), ataki złośliwego oprogramowania (ang. malware,
spyware), ataki na strony internetowe typu wstrzyknięcie złośliwego
kodu (ang. HTML injection), próby oszustw internetowych bazujące
na ukrywaniu istotnych klauzur w obszernych regulaminach usług
lub oparte o informacje pozyskane w Internecie, wreszcie przemoc
bezpośrednia (ang. cyberbullying) i pornografia (tab. 1).
Phishing
W wolnym tłumaczeniu oznacza „łowienie w sieci” lub „łowienie siecią”. Wyłudzanie poufnych informacji osobistych poprzez podszywanie się pod zaufaną osobę lub instytucję np. bank, portal aukcyjny
lub społecznościowy. Próby oszustwa opierają się na wiadomości email, w której zawarta jest prośba o bezpośrednie udostępnienie haseł
dostępu lub podanie ich na spreparowanej stronie internetowej, do
której zwykle prowadzi odsyłacz zawarty w treści wiadomości. Próba
oszustwa ma charakter zautomatyzowany, masowy i globalny.
Pharming
Tab. 1. Charakterystyka wybranych zagrożeń występujących w Internecie
Forma phishingu. Próba oszustwa polegająca na wyłudzenia danych
autoryzacji dostępu poprzez fałszywą stronę internetową. Wymaga,
aby komputer użytkownika był zainfekowany programem typu koń
trojański lub zatrucia systemu nazw domenowych. Gdy komputer
użytkownika jest zainfekowany, pomimo wpisana prawidłowego adresu strony internetowej zostaje on przeniesiony na fałszywą. Atak ma
na celu przejęcie wpisywanych przez użytkownika haseł, numerów
kart kredytowych i innych poufnych informacji.
7
Spear phishing
W wolnym tłumaczeniu oznacza „łowienie harpunem”. Forma phishingu. Próba wyłudzenia poufnych informacji za pomocą ukierunkowanej
wiadomości e-mail. Oszust wykorzystuje informacje związane z potencjalną ofiarą pozyskane np. z portali społecznościowych. Wiadomość
jest przygotowana tak, aby sprawiała wrażenie wysłanej przez osobę, firmę lub instytucję znaną odbiorcy. Zwykle nadawca wiadomości
podszywa się pod wybranego użytkownika Internetu posługując się
personaliami oraz fotografią pozyskanymi w sieci.
Malware
Złośliwe oprogramowanie o szkodliwym działaniu. Wirusy, robaki,
programy szpiegujące, konie trojańskie i inne. Często infekuje strony
internetowe, które wykorzystuje do rozpowszechniania złośliwego
oprogramowania wśród odwiedzających ją użytkowników. Złośliwe
oprogramowanie może być instalowane przez zainfekowane strony
internetowe, programy pobierane z sieci albo instalowane z dysku CD,
DVD lub innych nośników danych.
Spyware
Programy, których celem jest zbieranie informacji o działaniach podejmowanych przez użytkowników komputera lub urządzeń mobilnych podejmowanych w sieci Internet. Często zbierane są również
dane personalne lub inne informacje poufne. Gromadzą informacje
o użytkowniku, często bez jego zgody, wiedzy i kontroli przekazują je
twórcy programu.
Inne
Karol Król, Dawid Bedla, Krzysztof Gawroński
HTML injection, przemoc w Internecie ang. cyberbullying (ataki
słowne, szykany, pomówienia, złośliwe komentarze i inne umieszczane na portalach społecznościowych), utrata danych z komputera,
złośliwe aplikacje w serwisach społecznościowych, cyber-terroryzm
(ataki botnet).
Źródło: opracowanie własne na podstawie raportu „Bezpieczeństwow Internecie” [Dwornik 2013]
Wyniki i wnioski
Studium przypadku – phishing, pharming, spear phishing
Władysław i Janina Nowak prowadzą gospodarstwo agroturystyczne w okolicach Olsztynka (woj. warmińsko-mazurskie). Działalności
turystycznej sprzyja lokalizacja gospodarstwa w okolicy jezior Mielno i Omen. Wypoczynek polecają pasjonatom wędkarstwa, sportów
wodnych, rowerzystów i miłośników jazdy konnej. Nastoletni syn
państwa Nowak prowadzi stronę internetową oraz profil gospodarstwa na portalu społecznościowym. Przed sezonem letnim,
8
Analiza wybranych zagrożeń związanych...
państwo Nowak podjęli decyzję o zakupie aparatu fotograficznego.
Syn namówił ich do zakupu i płatności przez Internet, po czym informację zamieścił na portalu społecznościowym. Następnego dnia
otrzymał wiadomość e-mail o treści: „Szanowni Państwo Władysław
i Janina Nowak! Gratulujemy zakupu aparatu fotograficznego.
Z przykrością informujemy, że nie odnotowaliśmy wpłaty. Aby
otrzymać zakupiony towar prosimy o zalogowanie się do konta i potwierdzenie wykonania przelewu (ryc. 1). Odnośnik zamieszczamy poniżej. Zakupiony towar zostanie wysłany natychmiast po zweryfikowaniu płatności. Dziękujemy za zakup aparatu
w naszym sklepie”. Syn państwa Nowak w przysłanym formularzu wpisał numer klienta oraz wprowadził hasło. Tego samego dnia
z konta bankowego rodziców wypłacono wszystkie pieniądze.
Ryc. 1. Przykład spreparowanego formularza logowania się do bankowości
internetowej (wszystkie pola hasła są wymagane)
Źródło: opracowanie własne na podstawie formularza Banku Pekao SA
W opisywanym przypadku mamy do czynienia z próbą oszustwa
typu ang. spear phishing, z wykorzystaniem spreparowanej strony
internetowej ang. pharming. Oszuści dysponowali wiedzą o personaliach ofiary oraz czynnościach związanych z zakupem aparatu fotograficznego i podszyli się pod pracownika sklepu internetowego.
Informacje czerpali z obserwacji konta na portalu społecznościowym
ofiary, do którego dostęp uzyskali dzięki utworzeniu fikcyjnego profilu, podszywając się po jednego z przyjaciół rodziny. Użytkownik
w formularzu logowania został poproszony o podanie numeru klienta oraz hasła w całości (ryc. 1). Próba wyłudzenia może być również
9
Karol Król, Dawid Bedla, Krzysztof Gawroński
ukryta pod pretekstem prośby o zresetowanie hasła lub ponowną
weryfikację numerów karty kredytowej.
Studium przypadku – malware, spyware
Wiesław i Dorota Kowalczyk prowadzą gospodarstwo agroturystyczne w okolicy Radziszowa (woj. małopolskie). Gospodarstwo wyróżnia
się ofertą skierowaną do osób starszych gwarantując indywidualną
dietę, okresowe wizyty lekarskie oraz sprzęt do rehabilitacji ruchowej i hydromasażu. Gospodarze udostępniają swój adres e-mail na
stronie internetowej gospodarstwa. Spośród licznych wiadomości
Wiesław Kowalczyk dostrzegł zapytanie ofertowe od klienta. Klient przekonywał, że jest zainteresowany dłuższym pobytem w gospodarstwie, a swoje zapytanie zawarł w pliku PDF dołączonym do
wiadomości. Pomimo licznych prób otwarcia załącznika operacja się
nie powiodła a system operacyjny zaczął pracować niestabilnie. Po
ponownym uruchomieniu komputera na ekranie monitora pojawił
się komunikat, że pliki umieszczone na dysku zostały zaszyfrowane
i zablokowane. W komunikacie zawarto informację o możliwości ich
odzyskania po uiszczeniu opłaty w wysokości 300 €.
Komputer państwa Kowalczyk został zainfekowany koniem
trojańskim z rodzaju Filecoder (ang.). Atak nastąpił poprzez spreparowaną wiadomość e-mail. Złośliwa aplikacja została uruchomiona
przy próbie otwarcia zainfekowanego dokumentu PDF. Filecoder
szyfruje pliki znajdujące się na dysku komputera. Ich odblokowanie
wiąże się z opłaceniem okupu w wyznaczonym czasie. Nie wniesienie
opłaty skutkuje usunięciem plików. W opisywanym przypadku mamy
do czynienia z atakiem typu ang. malware, z wykorzystaniem ukierunkowanej wiadomości e-mail. W przypadku nowych odmian koni
trojańskich posiadanie antywirusa może być niewystarczające. Atak
może nastąpić m.in. poprzez: zainfekowaną stronę internetową, instalację oprogramowania użytkowego niepewnego pochodzenia lub
przy pobieraniu nielegalnych plików z niesprawdzonych źródeł.
10
Analiza wybranych zagrożeń związanych...
Tab. 2. Ocena wybranych zagrożeń w Internecie. Skala punktowa 1-10.
Skala niebezpieczeństwa
Phishing
4
Spear phishing
8
4
4
8
4
7
7
Komentarz: niebezpieczeństwo strat finansowych spowodowane
atakiem jest relatywnie duże z uwagi na próby wyłudzeń loginów
i haseł do prywatnych kont lub numerów kart kredytowych. Atak
jest ukierunkowany i relatywnie trudny do przeprowadzenia gdyż
wymaga bezpośredniego zaangażowania oszustów. Z uwagi na trudność przygotowania ataku prawdopodobieństwo jego zaistnienia jest
nieduże, aczkolwiek rośnie proporcjonalnie do majątku potencjalnej
ofiary.
6
Malware
4
Ogólna
ocena
Komentarz: niebezpieczeństwo strat finansowych spowodowane
atakiem jest relatywnie nieduże z uwagi na ogólny i zwykle niedopracowany charakter wiadomości kierowanych do użytkowników Internetu. Atak jest relatywnie łatwy do przygotowania gdyż większość
wiadomości jest tworzona i rozsyłana przez roboty sieciowe i nie ma
charakteru ukierunkowanego na konkretną osobę lub grupę osób.
8
4
8
6
6
Komentarz: niebezpieczeństwo strat finansowych spowodowane
atakiem jest relatywnie duże z uwagi na próby wyłudzeń loginów
i haseł do prywatnych kont lub numerów kart kredytowych. Prawdopodobieństwo ataku i jego powodzenia jest duże ponieważ złośliwe
oprogramowanie występuje powszechnie, może być przenoszone na
dowolnym nośniku danych cyfrowych oraz rozpowszechniane w Internecie.
6
Spywre
Prawdopodobieństwo
Trudność prze-prowadze- zaistnienia powodzenia ataku
ataku
nia ataku
4
8
8
6
Komentarz: niebezpieczeństwo strat finansowych spowodowane
atakiem jest relatywnie duże z uwagi na próby wyłudzeń loginów
i haseł do prywatnych kont lub numerów kart kredytowych. Prawdopodobieństwo ataku i jego powodzenia jest duże. Większość komputerów jest zainfekowana mniej lub bardziej poważnymi aplikacjami
typu spyware.
Źródło: ocena własna
11
Karol Król, Dawid Bedla, Krzysztof Gawroński
Podsumowanie
W artykule przedstawiono wybrane zagrożenia występujące w Internecie na przykładzie gospodarstw agroturystycznych. Ataki
przeprowadzane za pośrednictwem Sieci często okazują się być
przemyślane i kompleksowe, a oszuści wykorzystują wiedzę
o zachowaniach społecznych człowieka, czerpiąc z dokonań psychologów i socjologów. Złośliwe oprogramowanie stanowi zagrożenie
dla wszystkich użytkowników komputerów i urządzeń mobilnych.
Bywa jednak, że jest tworzone z myślą o infekowaniu konkretnego
systemu operacyjnego lub jego komponentów. Próby wyłudzeń poufnych informacji generowane przez aplikacje sieciowe mają często
charakter globalny i masowy. Ataki bezpośrednie są zwykle bardziej
wyszukane i wymierzone w konkretnych odbiorców.
W praktyce instytucje, które wymagają uwierzytelniania w procesie logowania (potwierdzenie tożsamości) nigdy nie proszą o podanie pełnego hasła do serwisu internetowego. Przestrzegają przed
używaniem do logowania odnośników przesyłanych w wiadomościach e-mail lub SMS. Zalecają ostrożność w stosunku do wiadomości
pochodzących od nieznanych nadawców, które zawierają załączniki.
Większości zagrożeń występujących w Internecie można uniknąć
kierując się zasadą ograniczonego zaufania oraz zdrowego rozsądku.
Podstawową metodą obrony przed atakami jest profilaktyka oraz
świadome użytkowanie narzędzi i technik komputerowych. Zagrożeń występujących w Internecie można uniknąć również poprzez
ograniczone udostępnianie informacji osobistych. Liczne portale
społecznościowe zachęcają do rejestracji, przy której wymagają od
użytkownika podania danych osobowych, zainteresowań, preferencji konsumenckich, powiązań rodzinnych oraz zawodowych i wiele
innych. Użytkownicy często bez rozwagi udostępniają nieznajomym
prywatne dane a zjawisko to staje się coraz bardziej powszechne. W
obronie przed zagrożeniami występującymi w Internecie pomocne są
programy antywirusowe oraz zapory sieciowe tj. programy typu ang.
firewall, jednak żadne oprogramowanie komputerowe nie zastąpi zasady ograniczonego zaufania.
12
Analiza wybranych zagrożeń związanych...
LITERATURA
Barrow C. 2006. Biznes w sieci. Wydawnictwo Felberg SJA. Warszawa, s. 11.
Dwornik B. 2013. Hakerzy zmienili front. Bezpieczniej nie będzie [w] Raport
Bezpieczeństwo w Internecie. Wydawca: Interaktywnie.com Sp. z o.o.
Wrocław, s. 7-9.
IAB. 2012. Raport Strategiczny IAB Polska. Internet 2012 – Polska, Europa,
świat. Media & Marketing Polska. Dodatek specjalny. 10. Wydanie Jubileuszowe. Wydawca VFP Communications Sp. z o.o. Warszawa. s. 18.
Langley A. 1999. Strategies for theorizing from process data. Academy of Management Review. t. 24, nr 4: 691-710.
Piekkari R. Welch C. 2011. Rethinking the Case Study in International Business
and Management Research, Edward Elgar, Cheltenham, s. 5.
Report. 2013. Cyber security. Special Eurobarometer 404. Conducted by TNS
Opinion & Social at the request of the European Commission, Directorate-General Home Affairs, s. 4.
Adres do korespondencji:
dr inż. Karol Król
Katedra Gospodarki Przestrzennej i Architektury Krajobrazu
Wydział Inżynierii Środowiska i Geodezji
Uniwersytet Rolniczy w Krakowie
Al. Mickiewicza 24/28, p. 208, 30­059 Kraków
e-­mail: [email protected]
dr inż. Dawid Bedla
Katedra Ekologii, Klimatologii i Ochrony Powietrza
Wydział Inżynierii Środowiska i Geodezji
Uniwersytet Rolniczy w Krakowie
e­-mail: [email protected]
13
Barbara Biniaś
EPISTEME
22/2014, t. I
s. 15-21
ISSN 1895-2241
COMPARATIVE ANALYSIS OF THE SURFACE
CHANGES OF LONG-TERM GLACIER FORM
IN POLAND, THE EXAMPLE LODOWCZYK
MIĘGUSZOWIECKI IN THE HIGH TATRA MOUNTAINS
ANALIZA PORÓWNANWCZA ZMIAN POWIERZCHNI
WIELOLETNICH FORM LODOWCOWYCH
W POLSCE, NA PRZYKŁADZIE LODOWCZYKA
MIĘGUSZOWIECKIEGO W TATRACH WYSOKICH
Abstact. Lodowczyk Mięguszowiecki (multi-piece snow-ice), located in the
High Tatras, is according to some researchers, multi-piece Snow, appearing
in the Kocioł Mięguszowiecki only temporary and not imposing any significant impact on the surrounding area. Other research argues that this is
the evidence of existence of glacier forms in areas where their formation is
impossible [Dobiński 2011]. Lodowczyk Mięguszowiecki is object of stagnation of masses of snow and ice for many years. Despite unfavorable conditions (climatic, thermal and altitude) ‘lodowczyk’ can be defined as a form
of perennial ice, and to be more exact: glacieret (the only one in Poland).
Performed comparative analysis of information on the surface patches of
snow-ice in the High Tatras from the late nineteenth century (surface measurements glaciations in the Polish Tatra Mountains, based on a physiogeographical map from 1865, in the program Quantum GIS 2.0) and a reference
to the contemporary glacial surface (data from last 30 years).
Keywords: Lodowczyk Mięguszowiecki, glacieret, multi-piece snow-ice
Streszczenie. Lodowczyk Mięguszowiecki (wieloletni płat śnieżno-lodowy), znajdujący się w Tatrach Wysokich, to według niektórych badaczy
wieloletni płat śnieżny, pojawiający się w Kotle Mięguszowieckim jedynie
okresowo i nie wywierający znacznego wpływu na otaczający go obszar. Inni
badawcze twierdzą, że jest on dowodem na istnienie form lodowcowych
na obszarach, gdzie ich powstawanie jest niemożliwe [Dobiński 2011]. Lodowczyk Mięguszowiecki jest obiektem wieloletniego zastoju mas śnieżnych
i lodowych. Mimo niesprzyjających warunków (klimatycznych, termicznych
15
Barbara Biniaś
i wysokościowych) może być określany jako forma lodowa wieloletnia,
a dokładniej lodowczyk firnowy (jedyny w Polsce). Analizie porównawczej
poddano informacje dotyczące powierzchni płatów śnieżno-lodowych w Tatrach Wysokich z końca XIX w. (pomiary powierzchni zlodowaceń w polskich
Tatrach, w oparciu o mapę fizycznogeograficzną z 1865 roku, w programie
Quantum GIS 2.0) oraz odniesieniu do współczesnej powierzchni zlodowaceń (dane z ostatniego 30-lecia).
Słowa kluczowe: Lodowczyk Mięguszowiecki, lodowczyk, wieloletni płat
śnieżno-lodowy
WSTĘP
Lodowczyk Mięguszowiecki to śnieżno-lodowy płat firnowy w Tatrach Wysokich. W przeważającej części roku znajduje się pod
pokrywą śnieżną, wykazując cechy przyrostu warstw rocznych oraz
spełzywania. Posiada typowe cechy lodowczyka (glacieret). Według
Międzynarodowej Komisji Śniegu i Lodu UNESCO, lodowczykiem
jest forma śnieżna, istniejąca nieprzerwanie przez co najmniej dwa
sezony ablacyjne oraz wykonująca mało widoczne cechy ruchu. Lodowczyk Mięguszowiecki to przykład współczesnej formy najsilniej
zlodowaconej w Polsce. Odznacza go najwięcej cech typowych dla
w pełni wykształconych lodowców Są nimi m.in.: zróżnicowana
gęstość (biały lód lodowcowy, firn oraz śnieg), budowa warstwowa
(wyraźne warstwy roczne), morena usypiskowa, szczeliny, wiek (minimum kilkaset lat, tu: więcej niż 150 lat). Ponadto sieć cieków supraglacjalnych, inglacjalnych, subglacjalnych oraz groty i tunele (tunel
pod Lodowczykiem Mięguszowieckim jest zbliżony do długości całej
formy), wykazywanie ruchu prostego i złożonego oraz własna cyrkulacja powietrza, będąca odpowiednikiem wiatrów katabatycznych
[Kędzia 1994; Kędzia i in. 2004].
Obszar Kotła Mięguszowieckiego (inaczej Bańdziocha) znajduje się na granicy piętra leśnego. Siła, z jaką następują tam procesy
stokowe, uniemożliwia rozwój formacji drzewiastej. Kosodrzewina
występuje w szczątkowej formie w dolnych, nieaktywnych lub okresowo aktywnych częściach stoku. Skaliste i odsłonięte stoki górskie
są powierzchniami, które szybko się ochładzają jak i nagrzewają.
Ponadto w warunkach stałego zacienienia istnieją warunki dogodne
do tworzenia wieloletniej zmarzliny w podłożu oraz depozycji nietopniejącego przez wiele lat śniegu.
16
Analiza porównanwcza zmian powierzchni...
MATERIAŁ I METODY
Analizy porównawczej zmian powierzchni zlodowaceń w Tatrach
Wysokich, dokonano przy pomocy programu Quantum GIS 2.0.
Posłużono się najstarszym dostępnym źródłem kartograficznym,
z wyraźnie przedstawionym obszarem ówczesnych zlodowaceń,
fizycznogeograficznej austriackiej mapy Tatr z 1865 roku. Archiwalny materiał kartograficzny pochodzi ze zbiorów prywatnych,
wykorzystano jej wersję elektroniczna (skan). W celu porównania
do współczesnej powierzchni lodowcowych na obszarze Tatr, użyto dostępnej w formie rastrowej mapy Tatr Słowackich Wysokich,
z aktualizacją na 2011/2012 rok. Weryfikacji zmian obszarów tatrzańskich zlodowaceń dokonano kalibrując obie mapy. Po ujednoliceniu skali materiałów kartograficznych (mapa z 1865 roku wykonana w skali 1: 100 000, mapa z roku 2011/2012 w skali 1: 27 500)
oraz nałożeniu na siebie obrazów, dokonano wektoryzacji obszarów
objętych zlodowaceniem w 1865 i 2011/2012 roku. Następnie przy
użyciu odpowiednich narzędzi programu Quantum GIS 2.0, zmierzono ich powierzchnię pierwotną, porównując do stref zlodowaconych
współcześnie.
Około 150 lat temu, klimat Tatr był znacznie surowszy niż
współcześnie. Na ówczesnych materiałach kartograficznych widoczne są trwałe zlodowacenia. Poniższa mapa (ryc.1), przedstawia
XIX-wieczną topografię Tatr z istniejącymi formami lodowcowymi
[Budzyna 2012].
17
Barbara Biniaś
Ryc. 1. Fragment mapy fizycznogeograficznej Tatr z 1865r. Na rycinie zaznaczono ówczesne obszary objęte wieloletnim zlodowaceniem.
WYNIKI I DYSKUSJA
W wyniku komputerowych pomiarów kartograficznych uzyskano
przybliżoną powierzchnię zlodowaceń. Pod koniec XIX wieku obszar
19,84 ha Tatr Wysokich znajdował się pod wieloletnią pokrywą lodowo-śnieżną. Od przełomu XX i XXI wieku notowane jest ocieplenie klimatu. Wieloletnia pokrywa śnieżno-lodowa polskiej strony
Tatr Wysokich, występuje tylko w okolicy Mięguszowieckiego Kotła.
Powierzchnia tych form wynosi obecnie zaledwie 0,50 ha (dane pochodzą ze źródeł kartograficznych z lat 2011/2012). Śnieg, z którego tworzą się wieloletnie płaty śnieżno-lodowe Lodowczyka Mięguszowieckiego pochodzą głównie z lawin i zsypów śnieżnych (ok.
80%), co stanowi wyjaśnienie jego obecności poniżej tatrzańskiej
granicy wiecznego śniegu. Ablacja Lodowczyka ma miejsce w sezonie letnim. W tym okresie obserwowane jest znaczne zmniejszenie
masy Lodowczyka. Wytapianie się Lodowczyka Mięguszowieckiego
przejawia się wypływem wód z jego spodnich warstw, tworząc jaskinię lodową [Kotarba 2004; Filipowski 2012].
18
Analiza porównanwcza zmian powierzchni...
Tab. 1. Wymiary Lodowczyka Mięguszowieckiego
Okres badań
Zmniejszenie parametrów Lodowczyka Mięguszowieckiego od roku
1982 do 2012 [%]
Parametry Lodowczyka
Mięguszowieckiego
1989
1999
2012
Powierzchnia [ha]
0,64
0,47
0,50
22
Długość [m]
94,0
81,0
>75,0
20
Szerokość [m]
136,0
106,5
>100,0
26
Źródło: opracowanie własne.
Zestawienie tabelaryczne wskazuje, iż w ciągu ostatnich 30 lat
powierzchnia, długość oraz szerokość tej formy lodowej, zmniejszyła
się średnio o 20-26%. W latach o intensywnych opadach śniegu oraz
wzmożonym dostarczaniu go do Mięguszowieckiego Kotła, przy
niskich temperaturach w skali roku, hamujących zbyt silne wytapianie się śniegu i firnu z Lodowczyka, następuje połączenie wąskim pasem śnieżnym z mniejszym tworem lodowo-firnowym, umiejscowionym pod Mięguszowieckim Szczytem Pośrednim [Filipowski 2012].
Połączenie to bardzo rzadko utrzymuje się przez sezon dłuższy niż
2-3 lata. Jak podają inne źródła [Kotarba i in. 1987; Rączkowska
1993; Rączkowska 1997; Gądek i in. 2002; Rączkowska 2005;] przy
styku Lodowczyka Mięguszowieckiego ze ścianami skalnymi go
otaczającymi, tworzy się szczelina brzeżna. Jej głębokość w wielu
miejscach osiąga 32 metry. Tunel powstały z wytopienia wód z Lodowczyka osiąga długość od 64 metrów do 94 metrów.
Spełzywanie Lodowczyka badane było m.in. w latach 1998–
1999. Tempo ruchu grawitacyjnego wynosiło wtedy ok. 98 cm/ rok.
Gęstość firnu w lodowczyku to ok. 0,4 – 0,8, natomiast gęstość lodu
firnowego jest nieco większa, wynosi średnio 0,8 – 0,9 g/cm3 g/cm3
[Kotarba 2004]. Zwiększenie gęstości spowodowane jest zmniejszeniem się ilości powietrza zawartego w systematycznie „gęstniejącym”
firnie. Gęstość świeżego śniegu to mniej niż 0,1 g/cm3. Zdaniem wielu badaczy Tatr, maksymalny zasięg lodowców na półkuli północnej,
obejmuje okres 1600–1850 roku n.e. zwany często małą epoką lo19
Barbara Biniaś
dową (MEL), kiedy można datować początki tworzenia form śnieżno-lodowych. Przykładem ich jest m.in. Lodowczyk Mięguszowiecki
[Kotarba 2004].
WNIOSKI
1. Lodowczyk Mięguszowiecki to jedna z kilku form lodowcowych
w Tatrach oraz jedyna i największa w Polsce, która przetrwała
w szczątkowej formie do czasów współczesnych.
2. Zróżnicowana gęstość białego lodu lodowcowego w Lodowczyku
Mięguszowieckim, z warstwową, coroczną akumulacją firnu oraz śniegu, morena usypiskowa, szczeliny wewnętrzne,
wiek tej formy, sieć cieków supraglacjalnych, inglacjalnych,
subglacjalnych, tworzących groty i tunele, wykazywanie ruchu prostego i złożonego oraz własna cyrkulacja powietrza
(odpowiednik wiatrów katabatycznych) stanowi o ewenemencie
tej formy w skali kraju.
3. Zmiany powierzchni zlodowaceń, które nastąpiły w Tatrach na
przestrzeni ponad 150 lat są efektem zmian klimatycznych,
wzrostu średnich temperatur rocznych oraz zaburzeń termiki
poszczególnych pór roku.
BIBLIOGRAFIA
Budzyna P. 2012. Współczesne lodowce w Tatrach. [w]: Lodowce [online].
Aktualności tatrzańskie.kongresonkol.io.gliwice.pl.http://www.
nezdeluxe.pl/2012/03/wspoczesne-lodowce-tatrzanskie-to-nie.html
Dobiński W. 2011. Wieloletnia zmarzlina w wybranych obszarach Tatr,
Gór Skandynawskich i Spitsbergenu w świetle kompleksowych badań
geofizycznych i analiz klimatologicznych. Prace Naukowe Uniwersytetu
Śląskiego. Wydawnictwo Uniwersytetu Śląskiego. Katowice. Nr 2850.
Filipowski K. 2012. Portal fotograficzny Poczuj Magię Gór. Lodowczyk Mięguszowiecki. http://kamiltatry.wordpress.com./
Gądek B., red. Borowiec W., Kotarba A., Kownacki A., Krzan Z., Mirek Z.
2002. Obieg masy Lodowczyka Mięguszowieckiego w latach 1998-1999.
[w]: Przemiany środowiska przyrodniczego Tatr. Kraków-Zakopane: Instytut Botaniki PAN. Kraków, 125-130.
Kędzia S. 1994. Lodowczyk Mięguszowiecki w Tatrach. [w]: Przemiany środowiska przyrodniczego Karpat i kotlin podkarpackich. Sesja naukowa
20
Analiza porównanwcza zmian powierzchni...
w 40 – lecie Zakładu Geomorfologii i Hydrologii Gór i Wyżyn IGiPZ
PAN. Kraków 8 – 9 December 1993. Conference Papers. red. Starkiel
L. Prokop P. PAN IGiPZ. Warszawa, 117 – 118.
Kędzia S. Kotarba A. Mościcki J. 2004. Lodowiec gruzowy nad Wielkim
Stawem Hińczowym w Tatrach Słowackich. Wyniki wstępnych badań termicznych. [w:] A.
Styszyńska. A. A. Marsz (red.). Polish Polar Studies. XXX International Polar
Symposium. Gdynia 23-25.IX.2004. Gdynia, 167-179.
Kotarba A. (red.) 2004. Rola małej epoki lodowej w przekształcaniu środowiska przyrodniczego Tatr. PAN IGiPZ PAN. Prace Geograficzne. Nr 197.
Warszawa.
Kotarba A. Kaszowski L. Krzemień K. 1987. High Mountain denudational
system in the Polish Tatra Mountains. Geographical Studies IGiPZ PAN.
Special issue 3. Wrocław.
Rączkowska Z. 1993. Ilościowe wskaźniki niwacji w Tatrach Wysokich. [w]: Kotarba A. (red.) Dokumentacja Geograficzna IGiPZ PAN. Z badań fizycznogeograficznych w Tatrach. Zeszyt 4-5, 63-81.
Rączkowska Z. 1997. Geomorfologiczna rola płatów śnieżnych w Tatrach.
Maszynopis pracy doktorskiej. IGiPZ PAN.
Rączkowska Z. 2005. Morfodynamiczne cechy obszarów z wieloletnią zmarzliną w Tatrach. [w:] Współczesna ewolucja rzeźby Polski. (red.) Kotarba
A. Krzemień K. Święchowicz J. VII Zjazd Geomorfologów Polskich.
Kraków 19-22 września 2005. IGiGP UJ. Kraków, 385-388.
Adres do korespondencji:
mgr Barbara Biniaś
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Rolniczo-Ekonomiczny
Katedra Ochrony Środowiska Rolniczego
Al. Mickiewicza 21, 31-120 Kraków
e-mail: [email protected]
21
Marta Gas
Izabela Gołąb
Łukasz Kuta
Opiekun naukowy: prof. dr hab. inż. Andrzej Kotecki
EPISTEME
22/2014, t. I
s. 23-29
ISSN 1895-2241
SZANSE ROZWOJU GMINY MIĘDZYLESIE
W OCENIE JEJ MIESZKAŃCÓW
THE CHANCES OF THE DEVELOPMENT
OF THE COMMUNITY MIĘDZYLESIE
IN THE ASSESSMENT OF ITS RESIDENTS
Abstrakt. Do głównych zadań konsultacji społecznych należy rejestracja
opinii, uwagi propozycji mieszkańców gminy. Poprzez odpowiedni dobór
pytań, ankieta może dostarczyć osobom zainteresowanym istotnych informacji na temat społeczności lokalnej. Celem opracowania było wskazanie,
z czego mieszkańcy gminy Międzylesie są zadowoleni, co ich zdaniem dobrze funkcjonuje, jakie są zalety i atrakcje ich gminy i czy dostrzegają szanse
dalszego jej rozwoju. Badania zostały przeprowadzone w 2013 roku. W celu
uzyskania opinii na temat szans dalszego rozwoju gminy przeprowadzone
zostały ankiety ze stu dwudziestoma respondentami. Wyniki ankiet stały
się bazą wiedzy o tym, co mieszkańcy faktycznie sądzą na temat gminy,
jakie problemy napotykają w życiu codziennym oraz jakie obszary życia
wymagają ulepszenia i poprawy.
Słowa kluczowe: konsultacje społeczne, społeczność lokalna, zalety, atrakcje,
szanse
Summary. The main purpose is the registration consultation of the public
opinion, comments and proposals in the municipality. By an appropriate
choice questions, survey may provide important information on the persons concerned local communities. The objective of the study was to identify, from what people in municipalities Międzylesie are happy, what they
are of the opinion that a well-functioning, what are the advantages and attractions of municipalities and do you see opportunities further its development. Tests have been carried out in 2013. In order to gain feedback on the
opportunities of further development have been carried out with one hundred twenty survey respondents. Survey results have become knowledge
base about what people actually believe about municipalities, what are some
of the problems they face in their daily lives and what areas require improvement and improvement of life.
Key words: public consultation, the local community, virtues, attractions, chances.
23
Marta Gas, Izabela Gołąb, Łukasz Kuta
Wstęp
Cele rozwoju gminy maja przede wszystkim charakter społeczny,
związany z poprawą jakości życia jej mieszkańców. Osiągnięcie takiego celu jest możliwe dzięki zabezpieczeniu dopływu niezbędnych
środków finansowych. Gmina może zyskiwać lub tracić na swojej
atrakcyjności i przez to przechodzić przez specyficzny cykl swojego
życia. Można go rozpatrywać na tle cyklu całego regionu. Kluczowe
czynniki sukcesu wiążą się w znacznej mierze z położeniem geograficznym. Często nastawienie marketingowe może z powodzeniem
służyć wyeksponowaniu walorów geograficznych ale również korzyści
wynikających z roli tego miejsca w realizacji działalności gospodarczej [Czornik 2004].
Rozwój jednostek samorządu terytorialnego to długookresowy
proces zmian mających charakter celowy i prowadzący do poprawy
stanu już istniejącego. Niejednokrotnie spotykana w literaturze
ekonomicznej kwestia rozwoju jest niezwykle rozległa i złożona.
Pojęcie rozwoju powinno być jednak kojarzone z oczekiwanymi,
pozytywnymi przeobrażeniami ilościowych, jakościowych i strukturalnych właściwości mających wpływ na życie jej mieszkańców
[Bejm 2009].
Uważa się, że rozwój lokalny powinien wynikać z konkretnej
wizji kształtowania się w przyszłości obrazu gminy. Planowanie
przyszłości wiąże się z określeniem celów, jakie powinny być osiągane. Celem rozwoju lokalnego jest zatem między innymi zapewnienie
ludziom możliwie wysokiego poziomu życia [Trojanek 1994].
Konsultacje społeczne to proces, w którym władze samorządowe
mają możliwość przedstawić obywatelom swoje zamierzenia
bezpośrednio lub pośrednio ich dotyczące. Dzięki konsultacjom
możliwe jest poznanie preferowanych przez mieszkańców rozwiązań,
co pozwala na poprawę efektywności i skuteczności komunikacji.
Konsultacje społeczne przeprowadza się w następujących formach:
• zebrań mieszkańców gminy,
• spotkań konsultacyjnych z przedstawicielami organizacji
społecznych, zawodowych, kulturalnych, politycznych i sportowych
działających na terenie danej gminy,
• badania opinii mieszkańców z wykorzystaniem formularza
ankietowego [Ferenc i in. 2010].
24
Szanse rozwoju gminy międzylesie w ocenie jej mieszkańców...
Międzylesie to gmina o charakterze miejsko - wiejskim, granicząca z Republiką Czeską. Jest najdalej wysuniętym terenem
na południe w powiecie kłodzkim i w województwie dolnośląskim,
z miastem Międzylesie oraz 21 sołectwami. Położenie gminy, uwarunkowania przyrodnicze, gospodarcze i kulturowe czynią z niej
gminę o charakterze turystyczno-rolniczym, z mocno wyakcentowanym potencjałem i przyjętą funkcją turystyki, jako głównym
kierunkiem rozwoju. Na obszarze gminy według stanu na dzień 31
grudnia 2012 roku zameldowanych było 7.523 osób, z czego w mieście Międzylesie 2.771 osób. Średnia gęstość zaludnienia to 39,8 osób/
km2. Gmina Międzylesie w roku 2004 jako pierwsza w województwie
dolnośląskim wdrożyła na swoim terenie lokalny program ,,Program
Aktywizacji Obszarów Wiejskich” - PAOW , którego celem było
wspieranie ze środków budżetu gminy w formie grantów lokalnych
inicjatyw oraz kreowanie aktywności lokalnych społeczności - organizacja imprez integracyjnych, doradztwo, promowanie wzorców
[PSORW 2014].
Cel pracy, materiał i metody
Celem opracowania było poznanie opinii na temat szans rozwoju gminy Międzylesie w ocenie jej mieszkańców. Badania przeprowadzono w 2013 roku podczas trwania obozu naukowego
Studenckiego Koła Naukowego „Koniczynka”. W celu uzyskania
materiałów źródłowych przeprowadzona została ankieta ze stu
dwudziestoma jej mieszkańcami. Ankieta składała się z 23 pytań
i metryczki. W celu poznania opinii mieszkańców badanej gminy na
temat szans jej dalszego rozwoju z puli wszystkich 23 pytań wybrane zostały tylko te na podstawie których można było poznać opinię
mieszkańców. Zaletą wykorzystania ankiety w tym badaniu było poznanie różnorodności poglądów respondentów oraz wysunięcie na tej
podstawie odpowiednich wniosków. Respondenci zostali zapytani
przede wszystkim o stan infrastruktury społeczno – gospodarczej
swojego miejsca zamieszkania i okolic oraz czy dostrzegają szanse
dla dalszego rozwoju gminy Międzylesie. Do przeprowadzenia badań
mieszkańcy gminy zostali wybrani w sposób celowy. Podstawowym
kryterium wyboru było miejsce zamieszkania respondentów na te25
Marta Gas, Izabela Gołąb, Łukasz Kuta
renie badanej gminy Międzylesie. Wśród respondentów znalazły się
głównie kobiety – 61% populacji, mężczyźni – 39% populacji.
Biorąc pod uwagę wiek respondentów, najwięcej osób znajdowało się w kategorii wiekowej od 50 do 59 lat – 26% populacji,
osób w wieku od 40 do 49 lat było 23% populacji, 21% populacji stanowiła grupa osób w wieku od 30 do 39 lat, 17% populacji stanowiły
osoby w wieku od 20 do 29 lat, natomiast 11% i 2% populacji stanowili mieszkańcy w wieku 60 lat i więcej i od 16 do 19 lat.
Badani mieszkańcy legitymowali się podstawowym (6%), zawodowym (26%) i średnim wykształceniem ( 41%). Studia wyższe
skończyło 27% badanych mieszkańców.
Wyniki badań
Sytuację gminy Międzylesie pod względem stanu infrastruktury
drogowej ponad połowa jej mieszkańców (59%) oceniła jako bardzo
słaby, 23% ankietowanych oceniła stan dróg jako słaby, 15% osób
odpowiedziała, że stan dróg w gminie ocenia jako dobry a tylko 3%
respondentów oceniła stan infrastruktury jako bardzo dobry. Na pytanie dotyczące oceny gospodarki komunalnej, opinie były podzielone,
ponieważ 38% respondentów oceniła ten obszar na ocenę bardzo dobrą, 32% ankietowanych na ocenę dobrą, 18% osób jako słabą, natomiast 13% ankietowanych oceniła gospodarkę komunalną na poziomie bardzo słabym. Kolejnym obszarem jaki został poddany ocenie
było rolnictwo, które ostatecznie przez ponad połowę mieszkańców
(57%) zostało ocenione dobrze, natomiast pozostali ankietowani
ocenili je jako słabe (29%) i bardzo słabe (14%). Zapytani o przyczynę
negatywnej oceny, odpowiadali w większości, że jest to spowodowane w głównej mierze dużą liczbą małych gospodarstw, często nierentownych. Następną rzeczą o jaka zostali zapytani mieszkańcy była
ocena oświaty, ochrony zdrowia i innych podmiotów gospodarczych
poza rolnictwem, które działają na obszarze gminy. Zarówno ochrona zdrowia jak i podmioty gospodarcze poza rolnictwem zostały ocenione prze ponad połowę mieszkańców (odpowiednio 63% i 70%)
na ocenę słabą, co spowodowane było brakiem szpitala i specjalistów w ośrodkach zdrowia, a także brakiem większych zakładów produkcyjnych. Oświata w gminie Międzylesie została oceniona przez po26
Szanse rozwoju gminy międzylesie w ocenie jej mieszkańców...
nad trzy czwarte ankietowanych (81%) na ocenę dobrą. Mieszkańcy
gminy mieli również za zadanie ocenić rynek pracy. Jak się okazało, aż 86% ocenia stan tego obszaru jako bardzo słaby, co wiąże
się ze wspomnianym już wcześniej brakiem większych zakładów
przemysłowych, które zapewniły by miejsce pracy dla sporej części
jej mieszkańców. W ankiecie znalazło się również pytanie dotyczące
oceny promocji gminy i form promocji jakie według. jej mieszkańców
powinna podjąć gmina, w celu zainteresowania przyszłych potencjalnych inwestorów. I tak w przypadku pierwszej części pytania,
respondenci ocenili promocje gminy jako przeciętna (38%), dobrą
(31%), bardzo dobrą (23%) i złą (8%). W przypadku wyboru form
promocji, ponad połowa ankietowanych (70%) uważała, że najlepszym sposobem zachęcenia przyszłych inwestorów i turystów w
celu odwiedzenia gminy będzie: udział w targach i wystawach , stosowanie ulg podatkowych dla inwestorów oraz organizowanie imprez promujących gminę. Dla 30% respondentów nakręcenie filmu
promującego gminę było by dobrą forma promocji gminy Międzylesie. Mieszkańcy badanej gminy na pytanie: Kogo uważasz za lidera
w swoim otoczeniu, najczęściej wybierali: przedstawiciela władzy
samorządowej (28%), duchownego (18%), sołtysa (13%), dyrektora
szkoły (6%). Pozostali wskazywali na doradców Ośrodka Doradztwa
Rolniczego, przedsiębiorców, osoby z rożnych organizacji pozarządowych. Mieszkańcy gminy Międzylesie zapytani o działalność
w organizacjach, stowarzyszeniach, ruchach, klubach lub różnego
typu fundacjach najczęściej wymieniali: Koło Gospodyń Wiejskich
(24%), Ochotniczą Straż Pożarną i organizacje charytatywne (14%).
Wśród ankietowanych 15% osób nie poświęcało swojego wolnego
czasu na działalność w rożnego rodzaju typu organizacjach aktywizujących mieszkańców do działania na rzecz mieszkańców i samej
gminy. Ankietowani mieszkańcy gminy Międzylesie zapytani o to
jakie ich zdaniem powinny być główne cele rozwoju gminy najczęściej wybierali: rozwój działalności gospodarczej – małych i średnich
przedsiębiorstw (39%), rozwój gospodarki turystycznej z zachowaniem zasad ekorozwoju (23%), osiągnięcie pełnego rozwoju układów
infrastruktury technicznej (21%), unowocześnienie rolnictwa – rozpowszechnienie technologii produkcji ekologicznej (13%) oraz poprawę kondycji społecznej ludności (4%). Respondenci zapytani
27
Marta Gas, Izabela Gołąb, Łukasz Kuta
wprost o szanse rozwoju ich gminy odpowiadali w większości
(63%), że widzą taką szansę, 23% osób odpowiadało, że nie widzi
takiej szansy, a pozostali (14%) nie miała zdania na ten temat.
W drugiej części pytania respondenci mieli wskazać czynniki, które
w przyszłości przyczynią się do rozwoju ich gminy. Najczęściej wymienianymi czynnikami były: rozwój turystyki wiejskiej i agroturystyki
(39%), budowa chodników, ścieżek rowerowych i zwiększenie bazy
noclegowej i gastronomicznej (29%). Ankietowani wymieniali, również większe zainteresowania władz samorządowych, zwiększenie
funduszy na promocje oraz poprawę wizerunku gminy w oczach osób
spoza gminy Międzylesie.
Wnioski
Mówiąc o szansach rozwoju gminy należy na samym początku
określić ideę i ogólny kierunek jej rozwoju. Istotne jest również wskazanie tych dziedzin wiodących w gospodarce gminy, które stanowią
jej bazę ekonomiczną i podstawę egzystencji. Zdaniem mieszkańców
gmina Międzylesie ma szanse dalszego rozwoju, ponieważ jej położenie geograficzne sprzyjać będzie dalszemu rozwojowi turystyki
i tym samy będzie bardziej konkurencyjna w stosunku do innych
regionów dolnego śląska i nie tylko. Opinia mieszkańców może stanowić ważne źródło informacji dla przedstawicieli gminy odpowiedzialnych za realizowane projekty mające na celu uatrakcyjnić obszar
gminy w celu przyciągnięcia nie tylko turystów, ale również potencjalnych inwestorów. Rozwój gminy pozwoli nie tylko zwiększyć jej
atrakcyjność ale pozwoli również w znacznym stopniu ograniczyć
odpływ młodych mieszkańców do większych miast.
Bibliografia
Bejm M. (red.), P. Bogdanowicz, P. Piotrowski, (2009), Ustawa o partnerstwie publiczno-prywatnym. Komentarz, C. H. Beck, Warszawa.
Czornik M. 2002. Miasto: ekonomiczne aspekty funkcjonowania. Katowice, 36
Praca zbiorowa pod redakcją merytoryczną ekspertów Polskiego Instytutu
Demokracji. Ferenc A. i in. 2010. Jak prowadzić konsultacje społeczne
w samorządach? Warszawa 2010
28
Szanse rozwoju gminy międzylesie w ocenie jej mieszkańców...
Trojanek M., Oddziaływanie władzy lokalnej na efektywność przedsięwzięć
inwestycyjnych, Poznań, AE 1994, Zeszyty Naukowe nr 137, seria II,
Prace, Habilitacyjne, s. 16
Źródła internetowe: www.psorw.odnowawsi.pl
Adres do korespondencji:
mgr inż. Marta Gas, mgr inż. Izabela Gołąb
Katedra Szczegółowej Uprawy Roślin
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected], [email protected]
mgr Łukasz Kuta
Instytut Inżynierii Rolniczej
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
29
Izabela Gołąb
Marta Gas
Łukasz Kuta
Opiekun naukowy: prof. dr hab. inż. Andrzej Kotecki
EPISTEME
22/2014, t. I
s. 31-37
ISSN 1895-2241
PERSPEKTYWY ROZWOJU TURYSTYKI
WIEJSKIEJ I AGROTURYSTYKI
NA OBSZARZE GMINY MIĘDZYLESIE
THE DEVELOPMENT POTENTIALS
OF THE RURAL TOURISM AND FARM TOURISMS
ON THE AREA OF THE COMMUNE MIĘDZYLESIE
Abstrakt. Gmina Międzylesie posiada korzystne warunki do rozwoju
turystyki wiejskiej i agroturystyki ze względu na walory przyrodniczokrajobrazowe, kulturowe i niski poziom uprzemysłowienia. Celem opracowania było wskazanie najważniejszych czynników mających wpływ na
rozwój turystyki wiejskiej i agroturystyki w tej gminie. Badania zostały
przeprowadzone w 2013 roku. W celu uzyskania opinii na temat perspektyw przyszłego rozwoju turystyki wiejskiej i agroturystyki w gminie
przeprowadzono ankiety ze stu dwudziestoma jej mieszkańcami. Respondenci dostrzegli możliwość rozwoju turystyki wiejskiej. Decydujący wpływ
na zainteresowanie mieszkańców rozwojem przedsięwzięć związanych
z turystyką wiejską była potrzeba szukania dodatkowego źródła dochodów.
Słowa kluczowe: turystyka wiejska, agroturystyka, perspektywy rozwoju,
korzyści, zagrożenia
Summary. The Municipality Międzylesie has favorable conditions for rural
tourism and farm tourism development due to natural features, cultural
and low level of industrialization. The objective of the study was to identify the main factors affecting the future development of tourism and rural
tourism and farm tourism in the municipality of Międzylesie. Tests have
been carried out in 2013. In order to gain feedback on the future prospects
of rural tourism in the municipality was conducted surveys of the one hundred twenty its residents. Respondents saw able to develop rural tourism.
A decisive influence on interest in population development projects related
to rural tourism was the need to seek additional sources of income.
Key words: rural tourism, farm tourism, development potentials, benefits,
threats, highlands.
31
Izabela Gołąb, Marta Gas, Łukasz Kuta
Wstęp
Już na początku XIX w. turystyka wiejska znana była w formie
wczasów letniskowych lub wczasów pod gruszą [Gotkiewicz i in.
2000]. Trudności ze zdefiniowaniem pojęcia turystyki wiejskiej
wynikają głównie z braku jednoznacznego, powszechnie przyjętego
pojęcia przestrzeni wiejskiej oraz zróżnicowania form wypoczynku
i rekreacji jakie oferowane są na obszarach wiejskich [Kłodziński
2006]. Turystyka wiejska według Drzewieckiego [1995] stanowi
formę rekreacji na obszarach prawdziwej wsi i obejmuje różne rodzaje aktywności rekreacyjnej [Drzewiecki 1995].
Agroturystyka, która związana jest z gospodarstwami rolnymi
jest tą formą turystyki wiejskiej, która w ostatnich latach rozwinęła
się najprężniej szczególnie na obszarach górskich. Agroturystyka, jak
żadna inna gałąź turystyki, wykorzystuje piękno krajobrazu wiejskiego oraz może dostarczyć gościom atrakcji w formie codziennych, tradycyjnych zajęć w gospodarstwie i obrzędów ludowych [Kudryś – Kujawska 2010].
Turystyka wiejska jest rodzajem transgresji i sprzyja kształtowaniu się postaw transgresyjnych. W wyniku bezpośredniego poznania
specyficznego sposobu życia i pracy na wsi niejednokrotnie następuje rewizja poglądów oraz przewartościowanie posiadanej przez
turystów – szczególnie mieszkańców dużych miast wiedzy na temat
rolnictwa oraz życia na wsi. Taki rodzaj turystyki kształtuje postawy
wobec rzeczywistości przyrodniczej, społecznej i kulturowej wsi,
uczy tolerancji wobec odmiennych postaw i zachowań oraz szacunku
dla mieszkańców wsi i ich stylu życia i kultury [Przecławski 2001].
Rozwój turystyki wiejskiej i agroturystyki, w sferze społecznej,
sprzyja rozwojowi miejscowej infrastruktury ogólnej i turystycznej służącej mieszkańcom, wymianie kulturowej i kontaktom oraz
przenikaniu nowych idei. Dla wielu zainteresowanie turystów
wypoczynkiem na wsi potęguje poczucie dumy i zadowolenia
z miejsca zamieszkania wśród mieszkańców, a także stwarza warunki
dla ochrony lokalnej kultury i wzrostu świadomości jej znaczenia
[Kmita 1994].
Gmina Międzylesie jest gminą miejsko –wiejską położona
w województwie dolnośląskim, w powiecie kłodzkim. Obszar
gminy położony jest na wysokości od 440 do 1326,1 m n.p.m. w
32
Perspektywy rozwoju turystyki wiejskiej i agroturystyki na obszarze...
obrębie dwóch makroregionów: Sudetów Wschodnich oraz Sudetów
Środkowych, pomiędzy Górami Bystrzyckimi od zachodu i Masywem
Śnieżnika od wschodu. Przez gminę przebiegają dwa główne szlaki
komunikacyjne: droga krajowa nr 33 - Kłodzko-Boboszów i linia kolejowa o znaczeniu międzynarodowym Wrocław-Praga i przejścia
graniczne: drogowe Boboszów-Dolna Lipka, kolejowe w Międzylesiu i trzy turystyczne - Kamieńczyk, Jodłów i Niemojów [Międzylesie 2014]. Na obszarze gminy znajduje się część rezerwatu przyrody
Śnieżnik Kłodzki, który chroni najwyższe wzniesienie w Sudetach
Wschodnich z roślinnością zielną, reprezentującą resztki elementu
krajobrazu karpackiego w Sudetach [ RDOS 2014].
Cel pracy, materiał i metody
Celem opracowania było wskazanie najważniejszych czynników
mających wpływ na rozwój turystyki wiejskiej i agroturystyki w gminie. Badania przeprowadzono w 2013 roku podczas trwania obozu
naukowego Studenckiego Koła Naukowego „Koniczynka”. W celu
uzyskania materiałów źródłowych przeprowadzona została ankieta ze stu dwudziestoma jej mieszkańcami. Ankieta składała się z 23
pytań i metryczki. W celu określenia czynników oraz dalszych perspektyw rozwoju turystyki wiejskiej i agroturystyki z puli 23 pytań
wybrane zostały te na podstawie których można było wywnioskować
co ma lub będzie miało wpływ na rozwój tych form turystyki na obszarze gminy Międzylesie. Zaletą wykorzystania ankiety w tym badaniu było poznanie różnorodności poglądów respondentów oraz
stworzenie na tej podstawie odpowiednich wniosków. Respondenci
zostali zapytani przede wszystkim o aktualny stan infrastruktury
społeczno – gospodarczej swojego regionu, potencjale możliwości
rozwoju turystyki wiejskiej i agroturystyki w kolejnych latach oraz
działania, które będą sprzyjały ich rozwojowi. Bezpośrednia forma
wywiadu miała stanowić główne źródło informacji na temat perspektyw rozwoju turystki wiejskiej i agroturystyki w regionie. Do
przeprowadzenia badań mieszkańcy gminy zostali wybrani w sposób
celowy. Podstawowym kryterium wyboru było miejsce zamieszkania
respondentów w gminie Międzylesie.
33
Izabela Gołąb, Marta Gas, Łukasz Kuta
Wyniki
Wśród respondentów znalazły się głównie kobiety – 61% populacji,
mężczyźni stanowili 39% ankietowanych. Biorąc pod uwagę wiek respondentów, najwięcej osób znajdowało się w kategorii wiekowej od 50
do 59 lat – 26% populacji, osób w wieku od 40 do 49 lat było 23% populacji, 21% populacji stanowiła grupa ankietowanych w wieku od 30
do 39 lat, 17% populacji stanowiły osoby w wieku od 20 do 29 lat, natomiast 11% i 2% populacji stanowili mieszkańcy w wieku 60 lat i więcej
i od 16 do 19 lat. Badani mieszkańcy legitymowali się podstawowym
(6%), zawodowym (26%) i średnim wykształceniem (41%), studia
wyższe skończyło 27% badanych mieszkańców. Działalność rolnicza
była źródłem utrzymania dla 12% respondentów, 37% mieszkańców
była zatrudniona, 19% ankietowanych mieszkańców prowadziła
własną działalność gospodarczą, 11% było bez pracy, 6% uczyło się
lub studiowało, a pozostałe 15% respondentów to emeryci lub renciści. Prawie połowa mieszkańców (47%) na pytanie: Czy położenie
gminy jest szansą czy zagrożeniem dla rozwoju turystyki wiejskiej
i agroturystyki odpowiedziała że jest szansą, 31% ankietowanych
osób odpowiedziało, że ich zdaniem jest zagrożeniem, 16% badanej
populacji udzieliła odpowiedzi, że w ich opinii jest zarówno szansą
i zagrożeniem, a pozostała część respondentów (7%) nie miała
zdania. Na pytanie dotyczące tego czy mieszkańcy są pozytywnie
nastawieni do gospodarki rynkowej ponad połowa ankietowanych
(53%) odpowiedziała, że tak, 38% udzieliła odpowiedzi na nie, natomiast 9% respondentów nie miała zdania na ten temat. Na pytanie: Czy wg. Pana/Pani mieszkańców gminy Międzylesie cechuje przedsiębiorczość w podejmowaniu własnej działalności gospodarczej
41% ankietowanych mieszkańców odpowiedziała, że nie, 34% populacji udzieliła pozytywnej odpowiedzi, a 25% respondentów nie miała
zdania. W pytaniu dotyczącym rodzaju działań na rzecz przygotowania ich jako mieszkańców gminy Międzylesie do prowadzenia
własnej działalności gospodarczej – w tym różnych form turystyki
wiejskiej, aż 56% respondentów wybrało działania w formie kursów
i szkoleń (głównie mających dotyczyć pozyskiwania funduszy europejskich), 34% ankietowanych wybrało działania dające możliwość
podnoszenia ogólnego poziomu wykształcenia, 26% osób wybrało
działania mające na celu upowszechnienie pozytywnych wzorców,
34
Perspektywy rozwoju turystyki wiejskiej i agroturystyki na obszarze...
a 4% ankietowanych mieszkańców wybrało inne działania np. wymianę doświadczeń, staże itp. Respondenci na pytanie: Dla zapewnienia rozwoju gminy Międzylesie wg. Pana/ Pani niezbędny jest szybki
postęp w: przyroście małych i średnich przedsiębiorstw – 22% ankietowanych wybrało taką odpowiedz , rolnictwie – 21% respondentów, 19% mieszkańców wybrało likwidację bezrobocia, budowę
i modernizację dróg wybrało 16% mieszkańców, zdaniem pozostałych ankietowanych szybki postęp jest niezbędny w rolnictwie
i ochronie zdrowia ( po 6%), oświacie (5%), gospodarce komunalnej
(4%) i stanie środowiska naturalnego – 1% ankietowanych.
Ponad połowa (56%) mieszkańców gminy Międzylesie na pytanie dotyczące atrakcyjności ich regionu odpowiedziała, że jest to region atrakcyjny, dla 18% respondentów region ten nie jest obszarem
atrakcyjnym turystycznie. Dla 10% ankietowanych badana gmina
jest bardzo atrakcyjna turystycznie, 16% pytanych osób miało podzielone zdanie. W przypadku pytania: Jaka jest Pana/Pani opinia na
temat atrakcyjności badanej gminy dla odwiedzających? – 67% populacji odpowiedziała że ich zdaniem gmina Międzylesie jest atrakcyjna
dla odwiedzających, pozostali ankietowani odpowiadali, że ich zdaniem jest bardzo atrakcyjna ( 9%), nieatrakcyjna - 14% osób, 10%
respondentów nie miała zdania. W pytaniu dotyczącym głównych
powodów jakimi turyści kierują się wybierając obszar gminy
Międzylesie w celu wypoczynku - 31% ankietowanych wybierało
odpowiedz, że ze względu na krajobraz, 28% osób odpowiedziało, że
ze względu na walory przyrodnicze, 23% respondentów odpowiedziało, że decydującym czynnikiem jest cisza i brak przemysłu,
pozostali ankietowani wybierali odpowiedź: imprezy kulturalne
(4%), atrakcyjna oferta turystyczna (14%). W pytaniu dotyczącym
wpływu turystyki wiejskiej i agroturystyki na dalszy rozwój gminy,
aż 70% mieszkańców odpowiedziało, że taka forma turystyki może
mieć pozytywny wpływ na rozwój ich miejsca zamieszkania i jednocześnie może podreperować ich budżet domowy, 8% respondentów
odpowiedział, że turystyka wiejska nie będzie miała pozytywnego wpływu na rozwój badanej gminy, pozostali ankietowani (22%)
nie mieli zdania. Na pytanie dotyczące zrealizowanych lub zaplanowanych inwestycji mających na celu zwiększeni atrakcyjności
gminy Międzylesie respondenci wymieniali najczęściej (53%) bu35
Izabela Gołąb, Marta Gas, Łukasz Kuta
dowę chodników, ścieżek rowerowych, basenów, zwiększenie bazy
noclegowej. Część mieszkańców (34%) uważała, że najważniejszymi
inwestycjami jakie należy wykonać na terenie ich gminy jest budowa
zakładu produkcyjnego, który zmniejszył by emigrację, zwłaszcza
młodych ludzi do dużych miast. Pozostali ankietowani (13%) wymieniali budowę: kina, hotelu, restauracji, szpitala itp. Na pytanie
dotyczące mocnych stron gminy Międzylesie 28% ankietowanych
wybrało turystykę i agroturystykę, 24% respondentów wybrało czyste powietrze, 21% korzystne położenie, pozostali ankietowani wybierali: atrakcyjne tereny (9%), rolnictwo (8%), aktywność mieszkańców
(7%), surowce naturalne (3%), sprzyjający klimat do działalności
gospodarczej (1%). Mieszkańcy pytani o główne problemu z jakimi
boryka się ich gmina wymieniali: odpływ ludzi – zwłaszcza młodych
i wykształconych (24%), bezrobocie ( 24%), zły stan dróg (14%), niski
poziom cywilizacyjny wsi (9%), brak zainteresowania inwestorów
(6%), niski stopień aktywności gospodarczej mieszkańców (6%), nieproduktywne rolnictwo (11%), zła kondycja finansowa gminy (6%).
Wnioski
Walory krajobrazowe oraz czyste środowisko gminy Międzylesie
stwarzają warunki do rozwoju turystyki wiejskiej i agroturystyki na
jej obszarze. Zrealizowane i zaplanowane inwestycje polegające m.in.
na budowie chodników, ścieżek rowerowych, organizacji imprez kulturalnych, powiększeniu bazy noclegowej co pozwoli w przyszłości
pozyskać nowych turystów, chcących powracać w ten rejon
w następnych latach w celu odpoczynku i poznania życia na wsi.
Według respondentów rozwój turystyki wiejskiej i agroturystyki
na obszarze gminy Międzylesie stanowić będzie w przyszłości
ogromną szansę na poprawę jakości ich życia jako jej mieszkańców.
Pod względem ekonomicznym dokona się to przede wszystkim poprzez wzrost dochodów osób obsługujących turystów, rozwój infrastruktury i zmniejszenie bezrobocia. Pozytywne zmiany w sferze
ogólnospołecznej zarysują się w dziedzinie podwyższenia kwalifikacji
i wykształcenia mieszkańców, poprawy estetyki wsi oraz większej
dbałości o kultywowanie tradycji.
36
Perspektywy rozwoju turystyki wiejskiej i agroturystyki na obszarze...
Bibliografia
Gotkiewicz W. Brodziński Z. Szalkiewicz W. 2000. Dodatkowe i alternatywne
źródła dochodu na obszarach wiejskich. Olsztyn, Centrum Rozwoju Obszarów Wiejskich, 146.
Drzewicki M. 1995. Agroturystyka. Bydgoszcz, Instytut Wydawniczy Świadectwo, 4.
Kudryś – Kujawska A. 2010. Turystyka wiejska jako szansa rozwoju gmin
i powiatów na przykładzie powiatu Gryfickiego. Folia Pomer. Univ. Technol. Stein., Oeconomica 284(61), 54.
Kmita E. 1994. Agroturystyka jako szansa aktywizacji społeczno – gospodarczej
środowisk wiejskich. Zagadnienia Doradztwa Rolniczego, nr2, 17 - 21.
Przecławski K. 2001. Człowiek a turystyka. Zarys socjologii turystyki. Wyd.
ALBIS, Kraków, 30.
Źródła internetowe:
http://www.wroclaw.rdos.gov.pl,
http://www.miedzylesie.pl
Adres do korespondencji:
mgr inż. Izabela Gołąb, mgr inż. Marta Gas
Katedra Szczegółowej Uprawy Roślin,
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected], [email protected]
mgr Łukasz Kuta
Instytut Inżynierii Rolniczej,
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
37
Łukasz Kuta, Marta Gas
Izabela Gołąb, Karolina Kolasińska
Opiekun naukowy: dr hab. inż. Józef Cież
EPISTEME
22/2014, t. I
s. 39-45
ISSN 1895-2241
DETERMINANTY STABILNEGO ROZWOJU
INFRASTRUKTURY AGROTURYSTYCZNEJ
NA PRZYKŁADZIE WYBRANYCH GOSPODARSTW
W GMINIE MIĘDZYLESIE
FACTORS DETERMINING A FARM TOURISM
CONDITION IN SELECTED FARMS
IN MIĘDZYLESIE COMMUNITY
Abstrakt. Gmina Międzylesie położona jest w południowej części województwa Dolnośląskiego u podnóża Sudetów. Na obszarze tym występują
korzystne warunki dla rozwoju agroturystyki, choć widoczne są również liczne czynniki ograniczające. Celem artykułu jest określenie tych
czynników, które determinują rozwój turystyki wiejskiej na obszarach
górskich w najwyższym stopniu. Badania zostały przeprowadzone na próbie
10 gospodarstw agroturystycznych w gminie Międzylesie. Z analizy danych
wynika, że opisywana gmina posiada znaczne szanse na systematyczny
rozwój, zarówno agroturystyki jak również innych dziedzin gospodarki.
Głównymi środkami do poprawy konkurencyjności gminy są między innymi: sprawna praca lokalnych władz oraz aktywizacja społeczeństwa
w kontekście podejmowania własnych inicjatyw. Ważna jest przy tym troska
o sprawną magistralę transportową oraz dotowanie działalności ze źródeł
samorządowych oraz z funduszy unijnych.
Słowa kluczowe: agroturystyka, rozwój lokalny, gmina wiejska, sytuacja
społeczno-ekonomiczna.
Summary. Międzylesie is situated in the south-western part of Poland. After accession to UE main tasks undertaken by the organizations were to
promote economic and social progress through closer economic cooperation and removing barriers to trade between Member States. In the county
Międzylesie there is very high level of unemployment, which reduces the
developmental progress of the entire countys. What’s more people living in
this area were sure that thanks to EU an economic policy has been improved. Even though were some disadvantage it turned out that thanks to good
39
Łukasz Kuta, Marta Gas, Izabela Gołąb, Karolina Kolasińska
motivated people the development can be achieved. In addition an excellent
location will lead to a visible success in the future. An important aspect of
the business community is to start and finish of brand new investment already underway such as building roads, sewerage network or creating additional jobs. One of the most important factor of development is promotion.
The figures show that almost a third Międzylesie residents estimate its level
as average so this factor should be higher to make sure a rapid growth.
Key words: agrotourism, local development, community, social and economic
situation.
Wstęp
Sytuacja społeczno-ekonomiczna w gminach, jako najmniejszych jednostkach samorządu terytorialnego determinowana jest przez szereg
czynników. Do kluczowych należy zaliczyć: dostęp do surowców naturalnych, stopień zaawansowania gospodarczego, stopę bezrobocia
czy walory środowiskowe [Wołowiec 2012]. Szczególne znaczenie ten
ostatni aspekt posiada w gminach górskich. Niepowtarzalny klimat,
warunki naturalne, specyficzny ład przestrzenny sprzyjają rozwojowi
usług turystycznych. Typowym przejawem takiej działalności są gospodarstwa agroturystyczne, które wpływają na wzrost atrakcyjności
i rozwój regionu [Niedziółka 2008]. Jednak aby mogły sprawnie
funkcjonować i rozwijać się powinny być dotowane z innych źródeł
[Małecki 2009].
Głównym celem osiąganym w sferze lokalnego rozwoju gospodarczego jest generowanie dochodów dla przedsiębiorstw, gospodarstw domowych oraz jednostek samorządu terytorialnego [Broll
2008]. Efektem rozwoju w zakresie lokalnego sektora gospodarki
powinien być stały wzrost sprzedaży oraz wzrost wartości przedsiębiorstw, a w konsekwencji wzrost liczby miejsc pracy. Dalszym naturalnym skutkiem tego procesu jest wzrost zamożności i standardu
życia mieszkańców gminy [Potoczek 2008].
Celem niniejszego artykułu jest analiza potencjalnych szans na
poprawę sytuacji społeczno-ekonomicznej oraz konkurencyjności
gospodarstw agroturystycznych na przykładzie górskiej gminy
Międzylesie.
Materiał i metody
W celu przeanalizowania szans i perspektyw rozwoju, przeprowadzono wywiad z wykorzystaniem kwestionariusza ankiety wśród właści40
Determinanty stabilnego rozwoju infrastruktury agroturystycznej na przykładzie...
cieli gospodarstw agroturystycznych. Na potrzeby artykułu, wywiad
taki stanowił główne źródło informacji na temat sytuacji ekonomicznej i funkcjonowania gospodarstw agroturystycznych a pośrednio
był źródłem do porównań z danymi z lat ubiegłych. Badania przeprowadzono w 2013 r. podczas obozu naukowego Studenckiego Koła
Naukowego „Koniczynka” na obszarze gminy Międzylesie, na losowo
wybranej grupie właścicieli 10 gospodarstw agroturystycznych.
Respondenci zostali zapytani przede wszystkim o aktualny stan infrastruktury społeczno - gospodarczej regionu oraz o potencjalne
możliwości rozwoju agroturystyki w gminie w kolejnych latach. Ankieta składała się z 7 pytań otwartych oraz 8 zamkniętych.
Wyniki badań
Z przeprowadzonych badań wynika, że region posiada szanse na
rozwój i poprawę stopy życia jego mieszkańców. Szans na wzrost
konkurencyjności należy upatrywać według mieszkańców w rozwoju turystyki wiejskiej. W gminie Międzylesie znajduje się
kilkanaście ośrodków świadczących usługi turystyczne, 10 z nich
poddano badaniom. Jak przedstawiono na ryc. 1 zdecydowana
większość respondentów (7 osób) jest przekonana o pozostaniu
w dotychczasowym miejscu zamieszkania i kontynuowaniu działalności agroturystycznej.
Ryc. 1. Rozkład odpowiedzi na pytanie: Czy wiąże Pan/Pani swoją
przyszłość z prowadzeniem działalności agroturystycznej?
Źródło: badanie własne.
41
Łukasz Kuta, Marta Gas, Izabela Gołąb, Karolina Kolasińska
Wśród ankietowanych 2 osoby zadeklarowały, że w związku
z niską stopą opłacalności, zrezygnują z prowadzenia agroturystyki.
Niezdecydowany co do swojej przyszłości był jeden właściciel.
Kluczowa wydaje się tutaj rola władz gminy dla których priorytetem
powinna być troska o prawidłowe zaspokojenie potrzeb ludności
tam zamieszkującej, by w znacznym stopniu ograniczyć emigrację
zarobkową.
Gospodarstwa agroturystyczne są szansą dla rozwoju regionu
(tak stwierdziło 61% badanych), dlatego władze powinny stwarzać
dogodne warunki do ich rozwoju. Jak wynika z badań blisko 90%
właścicieli takich podmiotów nie uzyskało żadnej pomocy z gminnych funduszy. To stanowi główną barierę w zakładaniu takich gospodarstw. Jedynym źródłem, dzięki któremu udało się zmodernizować lub rozbudować gospodarstwa były środki z Unii Europejskiej
- program PROW 2007 - 2013 r. Brak wsparcia dla rolników sprawia,
że jedynie 5% respondentów wskazało na ten dział gospodarki jako
perspektywiczny dla poprawy konkurencyjności. W ostatnich 5 latach właściciele jedynie 3 badanych gospodarstw poczynili inwestycje
rozwojowe, które dotyczyły głównie rozbudowy obiektu, poprawy
komfortu pokoi oraz udostępniania atrakcji dla turystów w ogrodach
przydomowych. Właściciele gospodarstw turystycznych podkreślili, że
dochody generowane z działalności jedynie w 70% są w stanie zrekompensować poczynione nakłady związane z ich funkcjonowaniem.
W 80% podmiotów świadczących usługi turystyczne przynajmniej
jedna z osób pracuje w branży nie związanej z rolnictwem. Czerpane
w taki sposób dochody pozwalają zrównoważyć w pełni poniesione
koszty usług turystycznych. Według opinii właścicieli gospodarstw
agroturystycznych blisko 40% wszystkich kosztów ponoszonych jest
w związku z wykorzystywaną energią elektryczną oraz wodą.
W porze zimowej wysoce kosztochłonne jest ogrzewanie pomieszczeń. Dlatego też, zdaniem blisko 70% ankietowanych, tak istotne dla opłacalności są odpowiednie warunki pogodowe szczególnie zimą, kiedy zorganizowane grupy turystów przybywają na obszary górskie w celach rekreacyjnych.
Z wygospodarowanych z działalności rolniczej oraz agroturystycznej dochodów respondenci są w stanie w 65% sfinansować
zakup potrzebnych dóbr.
42
Determinanty stabilnego rozwoju infrastruktury agroturystycznej na przykładzie...
Lokalna społeczność w 65% bardzo źle ocenia funkcjonujący rynek pracy zaś tylko 31% jest zadowolonych z sytuacji w sektorze zatrudnienia. Środowisko naturalne jest oceniane bardzo dobrze przez
13% respondentów, a praca urzędu gminy jest dobrze postrzegana
przez 64% mieszkańców.
Szczególny wpływ, według ankietowanych na wzrost atrakcyjności ruchu turystycznego w gminie mają projekty związane
z udoskonaleniem infrastruktury drogowej i kolejowej. W tym celu
przygotowywane są projekty unijne dostępne dla jednostek samorządu terytorialnego. Kluczową kwestią według właścicieli gospodarstw agroturystycznych jest rozwój współpracy transgranicznej
oraz podejmowanie wspólnych inicjatyw międzygminnych. Z uwagi
na lokalizację, gminy górskie dążą do rozwoju funkcji uzdrowiskowej,
ponieważ może to stanowić atrakcyjny aspekt dla poprawy wizerunku
gminy. W ocenie rolników i osób pracujących w gospodarstwach
rolnych ważne jest by podtrzymywać specyficzną dla regionu kulturę oraz tradycję. To właśnie troska o utrzymanie i pielęgnowanie
tego co przechodziło z pokolenia na pokolenie jest elementem tożsamości z daną społecznością. Niepowtarzalność określonych wzorców
oraz sposobów postępowania w znaczny sposób przyczynia się do
wyjątkowości i zainteresowania przyjeżdżających turystów.
Ważnym zadaniem gminy z kolei, jest wyznaczenie wizji i kierunku jej rozwoju poprzez zagospodarowanie i rozwój przestrzeni społeczno-gospodarczej. W odpowiedzi na pytanie o kluczowe
cele jakie powinny być podejmowane przez władze gminne należy uwzględnić przede wszystkim pobudzenie konkurencyjności
i motywowanie mieszkańców do zakładania własnej działalności gospodarczej. Wsparcie mieszkańców w inicjowaniu własnej działalności
gospodarczej może przyjąć formę dotacji bądź redukcji obciążeń
podatkowych. Ważnym aspektem w ocenie właścicieli gospodarstw
agroturystycznych jest kształtowanie i utrzymanie ładu przestrzennego oraz dbanie o nienaruszalność środowiska naturalnego.
Jednym z często wskazywanych elementów wspierających rozwój
gminy jest jej właściwa promocja.
Uzyskane dane opisujące zadowolenie z promocji gminy wskazują, że prawie jedna trzecia mieszkańców Międzylesia szacuje
jej poziom jako przeciętny. Tylko 2% określa ją bardzo wysoko. Co
43
Łukasz Kuta, Marta Gas, Izabela Gołąb, Karolina Kolasińska
czwarty badany uważa, że najlepszym sposobem promocji gminy
jest organizowanie imprez gminnych, udzielanie ulg podatkowych
dla inwestorów oraz publikowanie broszurek informacyjnych
zachęcających turystów do zwiedzania regionu. Ponad 50% respondentów zaznaczyło, że wzrost gospodarczy regionu jest możliwy
dzięki wpływom z turystyki i agroturystyki, co przekłada się na poprawę stopy życia mieszkańców gminy. Mieszkańcy gminy Międzylesie wyrazili chęć podejmowania działalności gospodarczej, jednak aby
to miało miejsce władze gminne powinny organizować odpowiednie
kursy oraz szkolenia dla osób zainteresowanych własną inicjatywą.
Wnioski
Analizując możliwości rozwoju gminy Międzylesie zauważyć należy, że
gospodarstwa agroturystyczne są popularną formą aktywności gospodarczej. W ocenie właścicieli tych podmiotów rozwojowi sprzyjają
korzystne warunki przyrodnicze oraz lokalizacja. Należy wskazać, że
wśród barier w rozwoju turystyki wiejskiej najczęściej wymienia się
brak wsparcia finansowego ze strony władz gminy, brak dotacji na rozpoczęcie działalności oraz utrudnienia proceduralne z tym związane. Ważnym elementem sprzyjającym rozwojowi turystyki wiejskiej
jest wysoki standard komunikacji drogowej oraz kolejowej.
Nieodzownie sprzyjającym aspektem dla rozwoju turystyki
wiejskiej jest niepowtarzalność kultury regionalnej, jej historia oraz
tradycje i obyczaje. Kwestią szczególnie warunkującą dalszy rozwój
jest opłacalność ekonomiczna działalności, która determinowana
jest osiąganymi dochodami, ponoszonymi kosztami oraz warunkami
pogodowymi. W ogólnej ocenie należy podkreślić, że prowadzenia
działalności na obszarach górskich może być bardzo konkurencyjne
w stosunku do jednostek zlokalizowanych w innych gminach.
Bibliografia
Broll R. 2008. Lokalny kapitał społeczny. Wydawnictwo Akademii Ekonomicznej. Wrocław.
Małecki P. 2009. Dotacje unijne, subwencje i inne dopłaty w podatku od towarów
i usług. Ośrodek Doradztwa i Doskonalenia Kadr, Gdańsk: 6.
44
Determinanty stabilnego rozwoju infrastruktury agroturystycznej na przykładzie...
Niedziółka A. Kotala A. 2008. Rola i znaczenie władz lokalnych w rozwoju agroturystyki w województwie małopolskim. Wyd. UR Kraków.
Parysek J. 2001. Podstawy gospodarki lokalnej. Wyd. Uniwersyt. im. A. Mickiewicza. Poznań.
Sierak J. 2010. Fundusze Unii Europejskiej jako źródło finansowania rozwoju
infrastruktury komunalnej w Polsce, Wyd. SGH w Warszawie: 84-95.
Szlaska A. 2007. Strategie rozwoju gminy jako wyznacznik podejścia lokalnej
elity politycznej do rozwoju lokalnego, SriL. Warszawa.
Wołowiec T. 2012. Strategia rozwoju gminy jako narzędzie zarządzania zmianą
gospodarczą. Zeszyty Naukowe WSEI seria: EKONOMIA, 5(2/2012):
61-89.
Adres do korespondencji:
mgr Łukasz Kuta
Instytut Inżynierii Rolniczej
Uniwersytet Przyrodniczy we Wrocławiu
ul. Chełmońskiego 37/41, 51­630 Wrocław
e-mail: [email protected]
mgr inż. Izabela Gołąb, mgr inż. Marta Gas
Katedra Szczegółowej Uprawy Roślin
Uniwersytet Przyrodniczy we Wrocławiu
ul. Chełmońskiego 37/41, 51­630 Wrocław
e-mail: [email protected], [email protected]
mgr inż. Karolina Kolasińska
Instytut Inżynierii Środowiska
e-mail: [email protected]
45
Barbara Szczepańska
Opiekun naukowy: prof. dr hab. Stanisław Witold Kłopot
EPISTEME
22/2014, t. I
s. 47-59
ISSN 1895-2241
Wdrażanie postępu technicznego
w opiniach osób oferujących maszyny
rolnicze na Dolnym Śląsku
Implementation of technical deveopment
in the opinions of people offering
agricultural machinery in Lower Silesia
Abstrakt. Celem artykułu jest prezentacja wyników badań zrealizowanych
w maju i czerwcu 2013 r. na terenie Dolnego Śląska w Zakładzie Socjologii Miasta i Wsi Uniwersytetu Wrocławskiego. Projekt dotyczył społeczno-ekonomicznych uwarunkowań wdrażania procesu postępu technicznego (rozumianego jako mechanizacja rolnictwa). Przeprowadzono 15
wywiadów kwestionariuszowych z osobami reprezentującymi punkty
oferujące sprzedaż maszyn i urządzeń rolniczych w całym województwie
dolnośląskim. Z przeprowadzonych badań wynika, że znaczna część gospodarstw indywidualnych jest wyłączona z możliwości korzystania z oferty
punktów zajmujących się handlem nowymi maszynami. Czy (mniej lub
bardziej celowy) mechanizm wykluczania małych i średnich gospodarstw
z możliwości dostępu do nowych maszyn jest zgody z ideą rolnictwa społecznie zrównoważonego oraz strategią wielofunkcyjnego rozwoju obszarów
wiejskich? Strategie marketingowe pośredników faworyzują określoną
grupę - dużych gospodarstw. Pozostałe gospodarstwa są wykluczane lub
skazane na poszukiwania maszyn na własną rękę na rynku wtórnym (większe ryzyko nietrafionego zakupu, niepewność otrzymywanych informacji).
W pracy przedstawiono procentowy udział różnych gospodarstw w korzystaniu z oferty wspomnianych punktów, sposoby pozyskiwania nowych klientów, kanały docierania z informacjami o nowych maszynach, sposoby
przekonywania do zakupu w zależności od powierzchni użytkowanego gospodarstwa oraz sytuacje konfliktowe i sposoby ich rozwiązywania.
Słowa klucze: gospodarstwa rolne, wdrażanie postępu rolniczego, maszyny rolnicze, Dolny Śląsk
Summary. The purpose of the article is to present the results of the research carried out by the students of sociology in the Department of Urban
47
Barbara Szczepańska
and Rural Sociology at Wroclaw University in May and June 2013 in the
area of Lower Silesia. The project dealt with the socio-economic conditions
of introducing technological development (understood as mechanisation of
agriculture). Fifteen questionnaire interviews were conducted with people
representing points of sale of machines and agricultural equipment in the
whole Lower Silesian Voivodeship. The research shows that the majority of
individual farms are devoid of the possibility of using points of sale offering new machines. Is the mechanism (more or less deliberate) of excluding
small and medium-sized farms from the access to new machines consistent
with the idea of socially sustaiable agriculture and the strategy of multifunctional development of rural areas? Marketing strategies of sales representatives favour one specific group – large farms. Other farms are excluded
or forced to search for machines on the after-market (greater risk of unsuccessful purchases, unreliable information). The study presents the percentage share of various farms in the use of offers made by the above mentioned
points of sale, ways of gaining customers, channels of information about
new products, ways of convincing people to purchase depending on the size
of a farm, conflict situations and ways of solving them.
Key words: agricultural holdings, technological development, agricultural machines, Lower Silesia
Wstęp
Postęp rolniczy najczęściej jest rozumiany jako progresywna zmiana, której efektem jest przekształcenie tradycyjnego chłopskiego rolnictwa w kolejne etapy jego rozwoju: rolnictwo tradycyjne – rolnictwo
przemysłowe – rolnictwo nowoczesne/społecznie zrównoważone –
rolnictwo biotechnologiczne [Woś i Zegar 2002].
Postęp w rolnictwie najczęściej dzieli się na postęp: biologiczny,
chemiczny i technologiczny [Runowski 1997]. Na ten ostatni
składa się: postęp organizacyjny, agronomiczny i techniczny. Postęp
techniczny – najczęściej rozumiany był jako mechanizacja rolnictwa,
w efekcie której wydajność pracy wzrasta przez zastąpienie pracy
ludzkiej pracą maszyn. Obecnie zwraca się uwagę na elementy
dodatkowe postępu technicznego takie jak postęp budowlany,
energetyczny [Wójcicki 2007].
Wdrażanie postępu rolniczego jest złożonym procesem o bogatej
tradycji badawczej. Na początku XX w. w USA to właśnie w gospodarstwach rolnych badano mechanizmy przyjmowania innowacji jako
przykłady absorpcji innowacji w gospodarce [Bertrand, Wierzbicki
48
Wdrażanie postępu technicznego w opiniach osób oferujących maszyny...
1970]. W Polsce założeniem polityki rolnej w okresie od 1956 r. był
wzrost produktywności rolnictwa przy braku działań zmieniających
strukturę agrarną. Zwiększenie produktywności miało następować
przez wdrażanie postępu rolniczego (wprowadzenie do praktyki rolnej nowych odmian rośli, ras zwierząt, urządzeń rolniczych). Powstało
wiele znaczących prac poświęconych rozpowszechnianiu innowacji
w społecznościach wiejskich w tym okresie [Gałęski B. 1971]. Obecnie powszechnie wiadomo, że poszczególne rodzaje postępu muszą
się uzupełniać, aby w wyniku ich zastosowania dawały pozytywne
rezultaty, lepszą efektywność pracy (np. aplikowanie nawozów dolistnych przy stosowaniu odpowiednich opryskiwaczy).
Proces wdrażania postępu realizuje się przy aktywnym udziale otoczenia zewnętrznego gospodarstw rolnych. W warunkach
gospodarki rynkowej można wyróżnić następujące typy podmiotów odpowiedzialnych za wdrażanie postępu: 1) system instytucjonalny państwa – realizujący długookresowe cele polityki rolnej
i społecznej w stosunku do obszarów wiejskich. Polityka ta w okresie
poakcesyjnym mieścić się musi w WPR UE – to z funduszy unijnych
napływają środki adresowane do wsi i rolnictwa, 2) otoczenie
rynkowe – podmioty gospodarcze polskie i zagraniczne, działające
w obszarze rozpowszechniania przemysłowych czynników produkcji
dla rolnictwa (materiał siewny, środki ochrony roślin, maszyny), 3)
instytucje „trójkąta wiedzy” – zajmujące się edukacją, badaniami
oraz tworzeniem innowacji [Chyłek 2011].
W otoczeniu zewnętrznym rolnictwa indywidualnego działają
polskie oraz zagraniczne podmioty gospodarcze, oferujące środki niezbędne do produkcji rolnej. Na danym terenie są reprezentowane
przez przedstawicieli regionalnych. W przypadku dużych firm, lub
firm długo funkcjonujących na rynku polskim, jeden przedstawiciel
reprezentuje firmę na powierzchni równej lub mniejszej obszarowi
województwa. Przedstawiciele ci współpracują z hurtowniami oraz
rolnikami indywidualnymi. W przypadku firm zajmujących się oferowaniem maszyn i urządzeń dla rolnictwa występuje inna logika docierania z ofertą. Możemy wyróżnić podmioty gospodarcze: zajmujące
się handlem maszynami nowymi, zajmujące się handlem maszynami
używanymi oraz łączące ofertę maszyn nowych i używanych.
49
Barbara Szczepańska
Materiał i metody
W maju i czerwcu 2013 r. w Instytucie Socjologii Uniwersytetu Wrocławskiego zostały zrealizowane badania „Rola otoczenia
zewnętrznego w procesie wdrażania innowacji w indywidualnych gospodarstwach rolnych”. Projekt dotyczył czynników warunkujących
proces wdrażania postępu biologicznego, chemicznego oraz technicznego w gospodarstwach rolnych. Projekt badawczy obejmował kilka
grup respondentów: 1) Właścicieli indywidualnych gospodarstw domowych związanych z rolnictwem. Próba została dobrana w sposób
losowo-kwotowy. W każdym powiecie zrealizowana została zgodna
z obliczoną kwotą liczba wywiadów kwestionariuszowych z respondentami, łącznie 232 wywiady kwestionariuszowe. 2) Wyczerpującą
próbę doradców rolnych z 26 Powiatowych Zespołów Doradców,
uzyskano 187 wywiadów ankiety. 3) Przedstawicieli regionalnych
firm zajmujących się sprzedażą przemysłowych czynników produkcji
roślinnej – materiał siewny, środki ochrony roślin - przeprowadzono
22 wywiady kwestionariuszowe oraz osoby zajmujące się handlem
maszynami – 15 wywiadów kwestionariuszowych.
Na wstępie można postawić tezę, że obserwujemy proces
wykluczania poprzez rynek (np. poprzez mechanizmy docierania z informacją) pewnej kategorii gospodarstw rolnych (do 30
ha) z udziału w postępie technicznym. Strategia marketingowa
firm oferujących maszyny rolnicze faworyzuje duże gospodarstwa.
W dłuższej perspektywie czasowej racjonalnym ekonomicznie zabiegiem dla firm byłoby dążenie do rozszerzenia rynku i zwrócenie
uwagi na gospodarstwa średnie (do 30 ha) jako możliwą grupę docelową. W krótszej perspektywie wiąże się to z bardziej kosztowną strategią, która stawiałaby na bezpośrednie docieranie do większej liczby
rolników. Całościowa próba wyjaśnienia tego mechanizmu przekracza ramy tego artykułu, dlatego celem publikacji jest przedstawienie
części wyników prezentujących opinie osób zajmujących się obrotem
maszynami rolniczymi.
Na terenie Dolnego Śląska działa ograniczona liczba podmiotów
zajmujących się handlem maszynami rolniczymi. Do wzięcia udziału
w projekcie zostały zaproszone wszystkie zidentyfikowane podmioty. Przeprowadzono 15 wywiadów kwestionariuszowych. W badaniu wzięło udział 13 mężczyzn oraz 2 kobiety. Średnia wieku wyni50
Wdrażanie postępu technicznego w opiniach osób oferujących maszyny...
osła 32,4 lata. Wyższe wykształcenie magisterskie posiadało 9 osób
(kierunki rolnicze oraz ekonomiczne), 4 osoby wyższe licencjackie,
2 osoby średnie. Osoby reprezentujące cztery punkty zadeklarowały,
że zaopatrują rolników tylko z części województwa dolnośląskiego
(stosunkowo niewielki obszar działalności). Ponad połowa respondentów twierdziła, że obszar działania firmy jest większy niż Dolny
Śląsk. Dwie osoby reprezentowały firmy działające na pograniczu
województw. Wszyscy badani zadeklarowali, że w swojej ofercie posiadają produkty więcej niż jednej firmy: 13 podmiotów oferowało
maszyny nowe, 2 maszyny nowe i używane.
Wyniki
O możliwościach wdrażania postępu przez użytkowników gospodarstw można wnioskować na postawie różnych czynników takich
jak np. wielkości gospodarstwa (im większe tym bardziej związanie
z rynkiem, a więc biorące udział we wdrażaniu postępu), struktury
dochodów gospodarstwa domowego (dywersyfikacja dochodów
np. z prowadzenia działalności pozarolniczej dla pewnej kategorii
gospodarstw może ale nie musi sprzyjać wdrażaniu postępu), zasobów społecznych i kulturowych rodziny (im większe tym lepiej),
intensywności kontaktów z instytucjami otoczenia zewnętrznego,
wyposażenia w maszyny w gospodarstwie.
Na Dolnym Śląsku w 2010 r. było 107 tys. indywidualnych
gospodarstw rolnych (tab. 1). Struktura agrarna województwa jest
typowa dla całej Polski. Gospodarstw indywidualnych użytkujących
do 5 ha było 72 %, są to gospodarstwa małe, nazywane w literaturze
gospodarstwami hobbystycznymi lub samozaopatrzeniowymi [Zegar
2009]. Dla większość tych gospodarstw główne źródło dochodów stanowi praca poza rolnictwem lub źródła socjalne.
Gospodarstwa powyżej 50 ha stanowią tylko 2,8% ogółu gospodarstw użytkują łącznie ponad 55% ogólnej powierzchni użytków
rolnych. Z analiz ekonomicznych wynika, że to one i tak zwane
gospodarstwa wielkoobszarowe, powstałe w wyniku przekształceń
sektora państwowego, dostarczają na rynek większość produkcji.
Gospodarstwa te są nastawione na maksymalizację zysku, co wymusza inwestowanie w szeroko pojęte innowacje.
51
Barbara Szczepańska
W perspektywie całego kraju można zauważyć petryfikację
struktury agrarnej, ponieważ w ciągu ostatnich 20 lat „w gospodarstwach powyżej hektara użytków rolnych tylko nieznacznie zmieniły
się proporcje udziału poszczególnych grup obszarowych w strukturze
agrarnej rolnictwa indywidualnego” [Kłopot 2012]
1-2 ha
14
13,1
72%
95397
8,5
23897
2,1
2-5 ha
19
17,8
67077
6,0
5-10 ha
13
12,1
113814
10,1
10-15 ha
6
5,6
79172
7,0
15-20 ha
3
2,8
54242
4,8
20-30 ha
3
2,8
72817
6,5
30-50 ha
2
1,9
85165
7,6
50 + ha
3
2,8
534522
47,5
Łącznie
107
100,0
1126103
100,0
23,3%
4,7
100,0
Struktura w grupach
obszarowych dla 2010
(w %)
44,1
Struktura w grupach
obszarowych dla 2010
(w %)
Struktura w grupach
obszarowych dla 2010
(w %)
44
Powierzchnia ogólnaa
Liczba gospodarstw
indywidualnych wg
powierzchni ogólnej (w
do 1 ha
Struktura w grupach
obszarowych dla 2010
dla grup obszarowych
Grupa obszarowa gospodarstw indywidualnych
Tab. 1. Liczba indywidualnych gospodarstw rolnych
oraz powierzchnia ogólna w województwie dolnośląskim
16,6
28,4%
55,0
100,0
Źródło: PSR 2010
Niejednokrotnie w publicznych debatach zadawano pytanie
o przyszłość funkcjonowania gospodarstw średnich (w rozumieniu
do 30 ha). Pomimo głoszenia haseł zaniku tych gospodarstw (w koncepcji rolnictwa industrialnego miały zasilić powierzchnię gospodarstw dużych) ich ilość od lat nie ulega gwałtownym zmianom.
W paradygmacie rolnictwa społecznie zrównoważonego odgrywają
one kluczową rolę, nie będąc gospodarstwami wysoko utowarowionymi, oprócz funkcji produkcyjnych zapewniają zachowanie war52
Wdrażanie postępu technicznego w opiniach osób oferujących maszyny...
tości społecznych, kulturowych polskiej wsi oraz działania konserwujące środowisko naturalne. Obecnie tylko część dochodu gospodarstwa domowego uzyskiwana jest w nich z gospodarstwa rolnego
(sprzedają ponad 50 % swojej produkcji na rynek lub bezpośrednim
konsumentom). Skala produkcji wiąże te gospodarstwa z rynkiem.
Ich rozwój nie może się dokonywać przez zwiększenie areału powierzchni, ale np. poprzez wchłanianie postępu technicznego. Dzięki
temu, nastąpi zastąpienie pracy ludzkiej pracą maszyn, zmniejszą się
koszty pracy, a w efekcie nastąpi zwiększenie produktywności gospodarstwa. W niniejszym artykule ze względu na pełnione różnorodne
funkcje ta grupa gospodarstw stanowi główną kategorię zainteresowania.
Dane z PSR informują o zasobach maszyn i urządzeń rolnych
w gospodarstwach. W opracowaniu odwoływano się do danych
dotyczących wyposażenia gospodarstw w ciągniki. Na Dolnym Śląsku
ciągnik posiada łącznie 37,7 tys. gospodarstw (35% ogółu). W grupie gospodarstw o powierzchni od 1 do 2 ha. ciągnik posiada 21,2%.
W grupie od 2 do 5 ha 41,7%, od 5 do 10 ha 71,8%, a w grupie od
10 do 30 ha 86,7%. Odwołując się literatury należy pamiętać, że
przeciętny wiek ciągnika używanego w polskim rolnictwie w 2004 r.
wyniósł 22 lata. Ponad 15-to letnie ciągniki stanowiły około 93%,
a ponad 25-letnie 33% ogółu [Kruczkowski 2005 za Pawlak 2013].
Dane z PSR nie pozwalają na przedstawienie danych dotyczących
zakupu ciągników uwzględniających grupę obszarową i konkretne województwo. Dla uchwycenia zjawiska przytoczę dane dla całej
Polski. W gospodarstwach indywidualnych w okresie od 2004 do
2010 zakupiono ponad 180 tys. ciągników. Ciągników fabrycznie
nowych zakupiono 50,3 tys. (27,9% ogółu). Rolnicy z gospodarstw
o powierzchni od 30 do 50 ha kupili najwięcej pojazdów nowych - 9,9
tyś. (19,6%). Liczba oraz moc nowych ciągników zwiększała się wraz
z areałem gospodarstwa [Pawlak 2013].
Przytoczone powyżej dane na temat wielkości rynku ciągników ilustrują niewielki rynek pierwotny maszyn i urządzeń. Nie
wszystkie gospodarstwa z grupy średnio obszarowej posiadają ciągniki. Co więcej, zapotrzebowanie na nowoczesne maszyny jest coraz
większe. Model rolnictwa społecznie zrównoważonego wymaga technicznej i ekologicznej modernizacji gospodarstw. Zastępowanie w gos53
Barbara Szczepańska
podarstwach rolnych ciągników starszej generacji bardziej nowoczesnymi
umożliwia zastosowanie techniki produkcji zapewniających poprawę
efektywności nakładów produkcji, z zachowaniem wymogów poszanowania środowiska naturalnego [Pawlak 2013].
Zasadne stają się pytania o to, czy podejmowane przez przedstawicieli handlowych zajmujących się handlem maszyn działania
włączają, czy wyłączają gospodarstwa do 30 ha z udziału w postępie
technicznym. W jakim stopniu gospodarstwa do 30 ha korzystają
z oferty punktu handlu maszynami rolniczymi? Od tego, jakie gospodarstwa zaopatrują się w nowy sprzęt, zależą efekty wdrażania
postępu technicznego. Jakimi metodami zachęca się rolników do
korzystania z oferty firmy? Jaka jest stosowana argumentacja, że
rozwiązanie proponowane przez daną firmę jest najlepsze dla tego
konkretnego gospodarstwa?
Respondenci zostali poproszeni o określenie procentowego
udziału gospodarstw z poszczególnych grup obszarowych, które
najczęściej korzystają z oferty zakupu maszyn rolniczych.
Blisko jedna trzecia respondentów określiła, że około 45% kupujących to gospodarstwa od 31 do 50 ha. Taka sama liczba osób
twierdziła, że gospodarstwa powyżej 50 ha stanowią ponad 2/3 klientów (tab. 2). Dane te mają odzwierciedlenie w informacjach na temat zakupu maszyn i urządzeń z PSR 2010.
Gospodarstwa o powierzchni od 6 do 30 ha stanowią niewielki
procent klientów (tab. 2). Korzystanie z oferty podmiotów gospodarczych handlujących na rynku pierwotnym maszynami rolniczymi
może być jednym z warunków koniecznych w prowadzeniu gospodarstwa nastawionego na rozwój. Użytkownicy gospodarstw do 30
ha w ograniczonym stopniu korzystają z oferty tych podmiotów. Biorąc pod uwagę przyjętą strategię firm oferujących nowe maszyny
oraz sytuację dochodową rolników z gospodarstw do 30 ha można
stwierdzić, że są oni skazani na mniej pewny rynek wtórny. Większa awaryjność maszyn, większe nakłady pracy przy wykonywaniu
prac polowych jak i przy obsłudze technicznej, mniejsza efektywność
w porównaniu do nowych maszyn, wydajność jest w dużym stopniu
uzależniona od stanu zaplecza naprawczego oraz kwalifikacji mechaników [Pawlak 2013].
54
Wdrażanie postępu technicznego w opiniach osób oferujących maszyny...
Tab. 2. Procentowy udział rolników z różnych grup obszarowych
w korzystaniu z oferty punktu.
Ogółem
15
100,0
15
100,0
3
5
3
2
1
20,0
33,3
20,0
13,3
6,7
1
6,7
15
100,0
1
7
1
1
4
1
6,7
53,1
6,7
6,7
26,3
6,7
15
100,0
%
26,3
40,2
33,5
51 do 300 ha
4
6
5
%
%
40,0
53,3
6,7
31 do 50 ha
6 do 15 ha
6
8
1
%
%
0
1-9
10-19
20-29
30-39
40-49
50-59
60-69
70-79
80-100
16 do 30 ha
2 do 5 ha
Udział % klientów
korzystających
z oferty
Grupa obszarowa gospodarstw indywidualnych (liczba wskazań oraz udział %)
1
6,7
4
2
1
2
1
3
1
26,3
13,3
6,7
13,3
6,7
20,0
6,7
15
100,0
Źródło: badania własne.
Badani deklarowali, że najlepszą metodą pozyskiwania nowych
klientów są bezpośrednie kontakty z rolnikami - 13 wskazań (należy pamiętać że byli to użytkownicy gospodarujący najczęściej na
50 i więcej hektarach). Na drugim miejscu - 12 wskazań - sytuuje się
odpowiedź, że informacja o firmie i jej ofercie jest przekazywana przez stałych klientów nowym (tzw. polecenie). Zdecydowanie lepszą
metodą pozyskiwania nowych klientów było uczestnictwo w ogólnopolskich imprezach organizowanych dla rolników – odpowiedź ta
uzyskała 8 wskazań – w imprezach regionalnych tylko 2 wskazania.
Poproszono badanych o wskazanie dwóch metod pozyskiwania
klientów dla różnych grup obszarowych. Łącznie dla gospodarstw
do 30 ha najczęstsze wskazanie uzyskała odpowiedź, że nowi klienci
zgłaszają się sami, dla gospodarstw powyżej 30 ha najlepszą metodą
były bezpośrednie kontakty z rolnikami. Mniejsze gospodarstwa
były i nadal są skazane na samodzielne poszukiwanie informacji
o ofercie pośredników handlowych. Fakt ten można interpretować
55
Barbara Szczepańska
jako kolejny element procesu wykluczania ich z bezpośredniego docierania z informacją o nowych maszynach do gospodarstw. Można
założyć, że rolnicy z gospodarstw o powierzchni powyżej 50 ha mieli
łatwiejszy dostęp do upustów cenowych, pełnego przekazu informacji o oferowanym sprzęcie, serwisie itp.
Bardzo ważną metodą jest również polecenie maszyny przez
stałych klientów nowym klientom, sąsiadom, znajomym. Przekazanie dobrej opinii o punkcie obsługi jest istotnym elementem budujący zaufanie. Ani razu nie odnotowano udziału roli sołtysa oraz
doradców rolnych przy pozyskiwaniu nowych klientów.
Ważne są różnice w sposobach argumentacji w sytuacji rozmowy
na temat zakupu maszyn. Dla rolników z gospodarstw o powierzchni
do 30 ha najczęściej przedstawianymi argumentami były: 9 wskazań
– korzystne różnice w cenie, to że pojazd jest tańszy w stosunku do
innych. Po 8 wskazań uzyskały odpowiedzi – łatwość w obsłudze oraz
dobry i szybki serwis. Czwartym co do ilości wskazań argumentem
było mniejsze skomplikowanie w porównaniu z innymi maszynami
tego samego typu. Dla gospodarstw powyżej 30 ha najczęściej pojawiającym się argumentem był dobry i szybki serwis (2/3 osób wskazało na ten czynnik). Drugim ważnym argumentem była długość
gwarancji (6 wskazań). Trzecim – oszczędności związane z zabiegami agrotechnicznymi (5 wskazań). W odpowiedziach widać różnicę
w przyjmowanej strategii funkcjonowania gospodarstw. Dla rolników
z gospodarstw średnich obszarowo to łatwość w obsłudze oraz cenowa dostępność dobra, dla gospodarstw dużych sprawnie funkcjonujący serwis oraz długość gwarancji.
Wnioski
Gospodarstwa od 5 do 30 ha w województwie dolnośląskim stanowią
ponad 23 % gospodarstw indywidualnych oraz użytkują ponad
28% powierzchni użytków rolnych. W koncepcji rolnictwa społecznie zrównoważonego grupa ta ma znacznie kluczowe dla zapewnia
ciągłości funkcji społecznych i kulturowych rolnictwa na wsi polskiej.
Na podstawie informacji uzyskanych w toku badań została
potwierdzona wstępna teza o wykluczaniu z rynku nowych maszyn
rolniczych grupy gospodarstw do 30 ha. Niezależnie od sytuacji ekonomicznej gospodarstw jednym z czynników wykluczającym z doci56
Wdrażanie postępu technicznego w opiniach osób oferujących maszyny...
eraniem z informacjami o ofercie są strategie marketingowe podmiotów gospodarczych oferujących maszyny. Gospodarstwa te skazane
są na funkcjonowanie na rynku wtórnym (większe ryzyko nietrafionego zakupu, niepewność informacji). Pełne potwierdzenie tezy
o wykluczeniu gospodarstw o powierzchni do 30 ha wymagałoby
bardziej wyczerpujących badań.
Proces wykluczania z udziału w postępie technicznym jest
jednym z aspektów wyłączania grupy gospodarstw o powierzchni do
30 ha z rynku. Można mówić o wykluczaniu z rynków innych środków
produkcji (np. materiału siewnego, środków ochrony roślin) oraz
o wykluczaniu z rynku zbytu. Punkty skupu i zakłady przetwórcze
są w zdecydowanej większości zainteresowane współpracą z dużymi
obszarowo gospodarstwami.
W stosunku do grup obszarowej gospodarstw do 30 ha potrzebne jest budowanie bardziej kosztownych kanałów docierania z informacjami o postępie technicznym. Włączenie tej grupy obszarowej
jako grupy celu dla firm oferujących maszyny rolnicze w krótkiej perspektywie zwiększa koszty ich funkcjonowania ale w efekcie można
doprowadzić do rozszerzenia rynku, przełamuje barierę dotychczasowego popytu. Dla gospodarstw ma to następujące walory: uzyskują
produkty, maszyny najnowszej generacji oraz w większym stopniu
oszczędzają pracę ludzka – wpływają na produktywność gospodarstwa. Nawet jeśli maszyny nie pracują na dużych powierzchniach,
to dzięki dostępności oraz wiedzy pośredników handlowych właściciele gospodarstw mogą dostosowywać swój park maszynowy do
tych działów produkcji, które są bardziej efektywne ekonomicznie
w małych i średnich gospodarstwach.
Bibliografia
Bertrand A. L. Wierzbicki Z. 1970 Socjologia wsi w Stanach Zjednoczonych;
stan i tendencje rozwojowe. Zakład Narodowy im. Ossolińskich, Wrocław.
Chyłek E.K. 2011. Proces modernizacji rolnictwa i obszarów wiejskich w Polsce,
[w:] Wieś i Rolnictwo, Nr 3 (128), 2005, s. 13
Gałęski B. 1971. Innowacje a społeczność wiejska. Książka i Wiedza, Warszawa.
GUS 2011a. Środki produkcji w rolnictwie. Powszechny spis rolny 2010.
Warszawa s. 76, 89, 90.
57
Barbara Szczepańska
GUS 2011b. Użytkowanie gruntów. Powszechny spis rolny 2010. Warszawa
s. 56, 60.
Kłopot S. W. Gospodarstwa „hobbystyczne” w strukturach funkcjonalnych wsi
i rolnictwa, [w:] Przestrzeń krajobrazu kulturowego wsi, Oficyna Wydawnicza ATUT-Wrocławskie Wydawnictwo Oświatowe, Wrocław 2012,
s. 112
Pawlak J. 2013. Modernizacja parku ciągnikowego w Polsce w świetle wyników
powszechnego spisu rolnego z 2010r. Problemy inżynierii rolniczej z. 3,
s. 20
Pawlak J. 2013. Rynek ciągników używanych w Polsce w latach 2005-2010. Problemy inżynierii rolniczej z. 3, s. 52
Runowski H. 1997. Postęp biologiczny w rolnictwie. Wydawnictwo SGGW,
Warszawa.
Wierzbicki Z. Bertrand A. L. 1970. Socjologia wsi w Stanach Zjednoczonych;
stan i tendencje rozwojowe. Zakład Narodowy im. Ossolińskich, Wrocław.
Woś A. Zegar J. S. 2002. Rolnictwo społecznie zrównoważone. Instytut Ekonomiki Rolnictwa i Gospodarki Przestrzennej, s. 37-45
Wójcicki Z. 2007. Technologiczne i ekologiczna modernizacja rolnictwa i obszarów wiejskich. Infrastruktura i Ekologia Terenów Wiejskich, s. 7
Zegar J. S. 2009. Struktura polskiego rolnictwa rodzinnego pod koniec
pierwszej dekady XXI wieku, Warszawa IERIGŻ, s. 151-152
Adres do korespondencji:
mgr inż. Barbara Szczepańska
Zakład Socjologii Miasta i Wsi
Instytut Socjologii
Uniwersytet Wrocławski
e-mail: [email protected]
58
Maciej Sporysz, Maria Szczuka
Sylwester Tabor, Karolina Trzyniec
Anna Karbowniczak, Andrzej Ochrem
Anna Klamerus Iwan
EPISTEME
22/2014
s. 59-68
ISSN 1895-2241
Opiekun naukowy: dr hab. inż. Sylwester Tabor, prof. UR
PROGNOZOWANIE CEN WYBRANYCH TOWARÓW
POCHODZENIA ROLNICZEGO Z WYKORZYSTANIEM
SZTUCZNYCH SIECI NEURONOWYCH
FORECASTING THE PRICES OF CHOSEN GOODS
OF AGRICULTURAL ORIGIN WITH THE USE
OF ARTIFICIAL NEURAL NETWORKS
Abstrakt. Celem pracy było opracowanie metodyki prognozowania cen
wybranych towarów spożywczych za pomocą sztucznych sieci neuronowych.
Przedstawiono ogólny algorytm opracowywania prognostycznego modelu
neuronowego. Przedstawiono przykład zastosowania tego algorytmu do
opracowania 30 modeli neuronowych dla zmiennych prognostycznych charakteryzujących wybrane produkty spożywcze. W opracowaniu przedstawiony został jeden model uważany za najlepszy dla próby walidacyjnej. Do
prognozowania zostały wybrane kontrakty terminowe na: cukier, pszenicę
(notowania na giełdzie londyńskiej LSE w systemie ciągłym), wołowinę (londyńska GFT Global Markets, system ciągły) oraz sok pomarańczowy (Chicago CME, system ciągły). Okres notowań obejmował 3 lata (2011- 2013).
Najlepsze efekty na próbie walidacyjnej udało się uzyskać dla perceptronu
z ośmioma warstwami ukrytymi z algorytmem uczenia BFGS 101, wykładniczą funkcją aktywacji w warstwie ukrytej oraz liniową funkcją aktywacji
wyjścia.
Słowa kluczowe: prognozowanie, sieci neuronowe, towary pochodzenia rolniczego, szeregi czasowe.
Summary. The aim of the thesis was to work out the methodology of forecasting the prices of chosen goods of agricultural origin with the use of artificial neural networks. The general algorithm of drawing up the prognostic
neural model has been introduced. The example of applying the algorithm
to work out 30 neural models for prognostic variables describing grocery
59
Maciej Sporysz, Maria Szczuka, Sylwester Tabor, Karolina Trzyniec...
products has been presented. This work introduces one model, which is
considered to be the best for the validity trial. An arbitrary choice of fixedterm contracts has been made for the prognosis: for sugar, wheat (London
Stock Exchange LSE quotations in constant system), beef (London GFT Global Markets, constant system) and orange juice (Chicago CME, constant
system). The information was gathered over the period of 3 years (20112013). The best effects in validity trials were produced for the perceptron
with eight layers hidden with the learning algorithms BFGS 101, the interpreting function of the activation in the hidden layer, as well as the linear
function of the activation exit.
Key words: forecasting , neural networks, agricultural products
Wprowadzenie
Sztuczne sieci neuronowe (SSN) są modelami nieliniowymi, które
pozwalają na opisanie skomplikowanych relacji zachodzących między
danymi. Można je zatem wykorzystać do analizowania zjawisk ekonomicznych i finansowych. W zależności od rodzaju problemu,
jaki ma zostać rozwiązany, wykorzystuje się różne rodzaje SSN
[Witkowska 2002]. Naukowcy stworzyli technikę obliczeniową wzorowaną na strukturze i sposobie działania układów nerwowych organizmów żywych zwaną sztuczną siecią neuronową. Jest ona zespołem połączonych ze sobą elementów przetwarzających informacje – neuronów. Neurony są powiązane w sieć za pomocą połączeń
o parametrach nazywanych wagami, modyfikowanych w trakcie tak
zwanego procesu uczenia. Topologia połączeń oraz ich parametry
stanowią programy działania sieci [Tadeusiewicz 1993]. Jednym
z narzędzi, które wspomaga podejmowanie różnego rodzaju decyzji
są prognozy [Cieślikowski i in. 2005]. Najistotniejszym kryterium
poprawności wyznaczanych prognoz jest ich dokładność, dlatego
prowadzone są ciągłe prace nad nowymi metodami prognostycznymi
umożliwiającymi zmniejszenie błędu prognozy [Niedbała i in. 2007].
Jednym z najnowszych narzędzi wykorzystywanych do prognozowania są sztuczne sieci neuronowe [Koszela i in. 2005].
60
Prognozowanie cen wybranych towarów pochodzenia rolniczego z wykorzystaniem...
Materiał i metody
Do prognozowania arbitralnie wybrano kontrakty terminowe na:
cukier, pszenicę (notowania na giełdzie londyńskiej LSE w systemie
ciągłym), wołowinę (londyńska GFT Global Markets, system ciągły)
oraz sok pomarańczowy (Chicago CME, system ciągły). Informacje
pochodziły z okresu obejmującego 3 lata (od 17 lutego 2011 do 17
lutego 2013). Przykładowy zestaw danych podano w.
Tab. 1. Kontrakty terminowe na cukier - przykładowy zestaw danych
Data
Cena
[GBP t-1]
Zmiana
[%]
Zmiana
[GBP t-1]
Kurs
odniesienia
[GBP t-1]
Kurs
otwarcia
Kurs
min
Kurs
max
17.02.2011
725,9
-2,99
-22,4
748,3
739,7
725,7
751
18.02.2011
720,3
-0,77
-5,6
725,9
731
715,4 732,4
21.02.2011
724,7
0,61
4,4
720,3
717,5
712,9 725,3
22.02.2011
718,5
-0,86
-6,2
724,7
731,6
717,9 735,7
23.02.2011
701,8
-2,32
-16,7
718,5
720
690,6 721,7
Źródło: Opracowanie własne
W tabeli zostały przedstawione ceny za tonę cukru w GBP (funt
brytyjski), zmiany kursu w stosunku do poprzedniej ceny w postaci
procentowej jak i nominalnej, kursy odniesienia zanotowane poprzedniego dnia, kursy otwarcia oraz ceny minimalne i maksymalne. Najwyższe notowanie na cukier było w dniu 17.02.2011 i wynosiło725,9 GBP natomiast najniższa cena za tonę cukru była zanotowana sześć dni później i wynosiła 701,8 GBP.
Wybór zmiennych
Jako zmienne niezależne (predyktory ilościowe) przyjęto Kurs odniesienia, Kurs otwarcia oraz zmianę procentową w poprzednim notowaniu waloru.
Architektura sieci
Do budowy sieci wykorzystano automatycznego projektanta sieci
neuronowych (dostępnego w Statistica 10). Zbudowano około 30
61
Maciej Sporysz, Maria Szczuka, Sylwester Tabor, Karolina Trzyniec...
różnych sieci, w tym sieci o architekturze MLP (wielowarstwowy perceptron- sieć ze wsteczną propagacją, i RBF ( Radial Basis Function
network – sztuczna sieć neuronowa z radialną (promieniową) funkcją
bazową. Sieci miały różną liczbę neuronów w warstwie ukrytej i różne
funkcje aktywacji. Każdą z sieci oceniono pod względem poziomu
błędu (jakości sieci).
Podziału na zbiory uczący, testowy i walidacyjny dokonano
w proporcjach odpowiednio 40%/30%/30% (Rysunek).
Próba
Ucząca 40%
Testowa 30% Walidacyjna 30%
Źródło: Opracowanie własne
Rys. 1. Podział próby na zbiór uczący, testowy i walidacyjny
Wyniki
Ceny kontraktów na cukier notowanych na londyńskiej giełdzie LSE
w systemie ciągłym kształtowały się zgodnie z rozkładem normalnym
ze średnią 622 funty za tonę (z odchyleniem standardowym 77,13).
Współczynnik zmienności wyniósł 12,39%. Pozostałe statystyki zaprezentowano na rysunku 2.
62
Prognozowanie cen wybranych towarów pochodzenia rolniczego z wykorzystaniem...
Źródło: Opracowanie własne
Rys. 2. Statystyki cen kontraktów na cukier
Najlepsze efekty na próbie walidacyjnej udało się uzyskać dla perceptronu z ośmioma warstwami ukrytymi z algorytmem uczenia BFGS
101, wykładniczą funkcją aktywacji w warstwie ukrytej oraz liniową
funkcją aktywacji wyjścia. Porównanie rzeczywistych cen zamknięcia
z cenami prognozowanymi dla próby walidacyjnej zaprezentowano na.
Źródło: Opracowanie własne
Rys. 3. Porównanie rzeczywistych i prognozowanych cen zamknięcia
63
Maciej Sporysz, Maria Szczuka, Sylwester Tabor, Karolina Trzyniec...
Ponadto na ukazano rozkład prognozowanych cen zamknięcia w
zależności od kursu odniesienia (poprzednia sesja) i kursu otwarcia.
Źródło: Opracowanie własne
Ryc. 4. Relacja kursu odniesienia i kursu otwarcia na predykcję ceny zamknięcia
Tę samą analizę powtórzono dla kontraktów na wieprzowinę.
Można zauważyć, iż ceny wieprzowiny charakteryzowały się mniejszą
zmiennością (współczynnik zmienności 5%).
64
Prognozowanie cen wybranych towarów pochodzenia rolniczego z wykorzystaniem...
Źródło: Opracowanie własne
Rys. 5. Statystyki cen kontraktów na wieprzowinę
Tym razem okazało się, że najlepsze efekty uzyskane zostały
dla perceptronu z trzema warstwami ukrytymi algorytmem uczenia
BFGS 210. Logistyczną funkcją aktywacji w warstwie ukrytej oraz
tangensem hiperbolicznym w warstwie wyjścia.
Źródło: Opracowanie własne
Rys. 6. Porównanie rzeczywistych i prognozowanych cen zamknięcia
65
Maciej Sporysz, Maria Szczuka, Sylwester Tabor, Karolina Trzyniec...
Porównanie rzeczywistych cen zamknięcia z cenami prognozowanymi dla próby walidacyjnej zaprezentowano na rysunku
6 natomiast na rysunku 7 ukazano rozkład prognozowanych cen
zamknięcia dla wołowiny w zależności od kursu odniesienia (poprzednia sesja) i kursu otwarcia.
Źródło: Opracowanie własne
Ryc. 7. Relacja kursu odniesienia i kursu otwarcia na predykcję ceny
zamknięcia
Podsumowanie
Sieci neuronowe doskonale sobie radzą z danymi niekompletnymi,
podczas gdy tradycyjne metody statystyczne są w tym przypadku
całkowicie bezsilne. Wyznaczanie prognoz za pomocą sieci neuronowych wymaga znacznie mniej czasu niż w przypadku modeli
ekonometrycznych. Do analizy nie potrzebujemy żadnych założeń
które dotyczą natury rozkładu danych. Zamiast przyjmować założenia odnośnie nieznanej populacji, sieci neuronowe z przynajmniej
jedną warstwą ukrytą wykorzystają dane do określenia charakteru
zależności między zmiennym. Sieci neuronowe, podobnie jak inne
modele konstruowane do celów prognostycznych, opisują aktualną
66
Prognozowanie cen wybranych towarów pochodzenia rolniczego z wykorzystaniem...
rzeczywistość, a modelowane zjawisko spełnia założenie o zachowaniu relacji, opisywanych przez model dla całego horyzontu prognozy.
Dlatego też należy starannie dobrać okres estymacji parametrów modelu, aby zachować tendencje rozwoju prognozowanych relacji.
Uzyskane rezultaty wskazują, że sztuczne sieci neuronowe mogą
być przydatnym narzędziem prognostycznym finansowych szeregów
czasowych. Jednakże nie można ich traktować jak czarne skrzynki
i należy starannie specyfikować model, dbając zarówno o odpowiedni
dobór zmiennych wejściowych, jak i o stosowną architekturę sieci.
Bibliografia
Cieślikowski B. 2005. Prognozowanie stanu technicznego zespołu przekładniowego kombajnu zbożowego za pomocą modelu regresyjnego. Inżynieria
Rolnicza. Nr 10(70). s. 49-55.
Koszela K., Boniecki P., Weres J. 2005. Ocena efektywności neuronowego prognozowania w oparciu o wybrane metody na przykładzie dystrybucji produktów rolniczych. Inżynieria Rolnicza. Nr 2(62). s. 69-76.
Niedbała G., Przybył J., Sęk T. 2007. Prognozowanie zawartości cukru w korzeniach buraka cukrowego z wykorzystaniem technik regresyjnych i neuronowych. Inżynieria Rolnicza. Nr 2(90). s. 225-234.
Tadeusiewicz R. 1993. Sieci neuronowe, Państwowa Oficyna Wydawnicza
RM. Warszawa.
Witkowska D. 2002. Sztuczne sieci neuronowe i metody statystyczne. Wybrane
zagadnienia finansowe, Wydawnictwo C.H. Beck, Warszawa.
Adres do korespondencji:
dr Maciej Sporysz
Instytut Inżynierii Rolniczej i Informatyki
e-mail: [email protected]
mgr inż. Maria Szczuka
Instytut Inżynierii Rolniczej i Informatyki
e-mail: [email protected]
dr hab. inż. Sylwester Tabor, prof. UR
Instytut Inżynierii Rolniczej i Informatyki
e-mail: [email protected]
67
Maciej Sporysz, Maria Szczuka, Sylwester Tabor, Karolina Trzyniec...
mgr inż. Karolina Trzyniec
Instytut Eksploatacji Maszyn
Ergonomii i Procesów Produkcyjnych
e-mail: [email protected]
mgr inż. Anna Karbowniczak
Instytut Inżynierii Rolniczej i Informatyki
e-mail: [email protected]
mgr inż. Andrzej Ochrem
Katedra Hodowli Bydła
e-mail: [email protected]
dr inż. Anna Klamerus Iwan
Katedra Inżynierii Leśnej
e-mail: [email protected]
Maria Szczuka
Wydział Inżynierii Produkcji i Energetyki
Instytut Inżynierii Rolniczej i Informatyki
ul. Balicka 116B, 30-149 Kraków
68
Bartłomiej Rębkowski, Ewa Archanowicz
Emil Archanowicz, Dominika Szadkowska
Opiekun naukowy: Prof. dr hab. Krzysztof J. Krajewski
EPISTEME
22/2014, t. I
s. 69-77
ISSN 1895-2241
Ocena skuteczności działania wybranych
kompozycji preparatów ochronnych i
dekoracyjno – ochronnych zastosowanych
na elewacji OSW ‘Marymont’ w Kirach
Effectiveness evaluation of selected protective and decorative products sets used
on elevations of SGGW resort ‘Marymont’, Kiry
Abstrakt. Drewniane elementy elewacji, wykonane z drewna świerkowego,
ośrodka szkoleniowo – wypoczynkowego SGGW ‘Marymont’, w trakcie eksploatacji uległy charakterystycznym przebarwieniom o wyraźnym układzie
strefowym. Wybrane elementy zostały poddane zabiegom renowacyjnym,
polegającym na usunięciu startych powłok zabezpieczających i przebarwionego drewna, oraz zabezpieczeniu oczyszczonych miejsc różnymi zestawami preparatów złożonych ze środków ochrony drewna i nawierzchniowych preparatów dekoracyjno-ochronnych. Skuteczność działania tych
kompozycji oceniano po 12 oraz 24 miesiącach. Największą skutecznością
wykazał się żelowy preparat ogniochronny i impregnujący na bazie wody
I-2. W niniejszym artykule omówiono wstępne wyniki testów skuteczności
wybranych kompozycji preparatów ochronnych i dekoracyjno ochronnych.
Słowa kluczowe: przebarwienia drewna, drewno świerkowe, środki ochrony
drewna.
Summary. Severe, zonal discolorations of wooden elements, made of spruce, of building façade of SGGW resort ‘Marymont’ developed during usage.
Old paints and discolored layers of wood were removed from chosen façade
elements during renovation. Renovated elements were treated with different product sets composed of chosen protective primers and surface decorative and protective paints. The effectiveness of those sets were evaluated
after 12 and 24 months of exposure. The highest effectiveness was observed
with product I-2 – gel, water based fire redundant and protective primer.
Preliminary effectiveness evaluation of chosen sets of protective and decorative products used on façade of resort ‘Marymont’ will be discussed in
this paper.
Key words: discoloration of wood, spruce wood, wood protective measures.
69
Bartłomiej Rębkowski, Ewa Archanowicz, Emil Archanowicz...
Wstęp
Drewno świerkowe jest jednym z najpopularniejszych materiałów
wykorzystywanych w Polsce jako budulec, jako materiał wykończeniowy na elewacje, materiał do produkcji gontu, do kształtowania
małej architektury lub innych produktów wystawionych na działanie
warunków zewnętrznych.
Stabilność koloru drewna na elewacjach budynków jest jedną
z istotnych cech decydujących o estetyce obiektów. Zachowanie naturalnego wyglądu i barwy drewna w czasie jego użytkowania w warunkach zewnętrznych jest bardzo trudne. W przypadku budowli
wykonanych z drewna świerkowego, dodatkowa trudność polega na
braku różnic w wyglądzie makroskopowym drewna bielu i twardzieli
tego gatunku.
Drewno użytkowane w warunkach zewnętrznych ulega erozji,
powodowanej przez oddziaływanie czynników atmosferycznych na
jego powierzchnię. Jest to proces powolny. Tempo erozji drewna zostało określone przez Williamsa i in. [2001] i wynosi ok. 4,5 mm na 100
lat. Jak podają Feist i Hon [1984], Feist [1988], Williams i in. [2001],
Tolvaj i Mitsui [2005] oraz Jankowska [2013], najważniejszym
czynnikiem przyczyniającym się do degradacji drewna użytkowanego w warunkach zewnętrznych jest promieniowanie słoneczne, szczególnie w zakresie promieniowania ultrafioletowego. Docierające
do powierzchni drewna promieniowanie UV jest w dużej części pochłaniane przez ligninę, co prowadzi do jej degradacji. Celuloza i hemiceluloza nie absorbują zbyt dobrze światła z tego zakresu [Feist
i Hon 1984, Hon i in. 1986, Feist 1988]. Degradacja ligniny prowadzi
do żółknięcia lub brązowienia drewna. Finalnie proces ten prowadzi
do szarzenia drewna, określanego jako fotodegradacja drewna. Jest
to wyłącznie proces powierzchniowy, bowiem promieniowanie UV
wnika w drewno jedynie na niewielką głębokość. Badania Browne
i Simonsona [1957] wskazują, że odbarwienie sięga na głębokość do
2,5 mm, jednak późniejsze badania [Hon i Ifju 1978, Hon 1991] pokazały, że penetracja promieni UV w drewnie wynosi zaledwie ok. 75
µm. Jak zauważają Arnold i in. [1991], samo oddziaływanie promieniowania ultrafioletowego, nawet przy podwyższonej wilgotności
powietrza prowadzi jedynie do brązowienia drewna. Wspomniani
autorzy prawidłowość tę tłumaczą faktem kumulacji produktów
degradacji ligniny na powierzchni drewna, uniemożliwiającym wni70
Ocena skuteczności działania wybranych kompozycji preparatów ochronnych...
kanie promieniowania w jego głębsze warstwy i tym samym ograniczającym dalszą degradację. W celu usunięcia z powierzchni poddawanej naświetlaniu produktów degradacji drewna zastosowali oni
deszczowanie próbek. Woda, oprócz efektu wymywania produktów
rozkładu, przyczynia się do skurczu i pęcznienia drewna, co może
prowadzić do powstawania spękań. W spękaniach tych może osadzać
się brud i kurz, przyczyniając się do obniżenia wartości estetycznej
drewna, w tym do szarzenia jego powierzchni [Hon i in. 1986].
Oprócz zmian powierzchni drewna, użytkowanego w warunkach zewnętrznych, wywołanych oddziaływaniem czynników
abiotycznych, zachodzą w nim zmiany wywołane czynnikami biologicznymi, z których do najważniejszych zalicza się są barwice, pleśnie
oraz glony i porosty. Do czynników biotycznych o największym
wpływie na zmiany wyglądu powierzchni drewna wtórnie zawilgoconego należą barwice, w szczególności sinizna wtórna. Siniznę wtórną
wywołują grzyby z gromad Ascomycota (workowe), Deuteromycota
(mitosporowe) oraz Zygomycota (sprzężniowe). Zmiany wywołane
przez grzyby powodujące siniznę wtórną zachodzą tylko w strefie
powierzchniowej drewna, głównie w drewnie bielu. Infekcja występuje tylko w drewnie wyrobionym, przy jego wtórnym, wielokrotnym
zawilgoceniu. Pleśnie oraz glony rozwijają się na powierzchni drewna, która uległa długotrwałemu, silnemu zawilgoceniu. Zarówno
pleśnie, glony i sinizny nie powodują rozkładu ściany komórkowej,
a ich rozwój przyczynia się jedynie do obniżenia wartości estetycznej
drewna [Ważny i in. 2001, Krajewski i Witomski 2005].
Przedstawione poniżej badania miały na celu znalezienie kompozycji środków ochronnych i dekoracyjno-ochronnych dostępnych
na rynku polskim, które ograniczałyby negatywny wpływ czynników
biotycznych i abiotycznych na walory estetyczne drewna stosowanego w warunkach zewnętrznych bez kontaktu z gruntem.
Materiały i metody
Prace badawcze wykonywano in situ, w OSW ‘Marymont’ w Kirach
koło Zakopanego w lipcu 2011, 2012 oraz 2013 roku. Do testów
wybrano różne elementy elewacji wykonanej z drewna świerkowego,
takie jak przypory, przęsła balustrady oraz okładziny elewacji wykonane z półokrąglaków. Założono, iż wytypowane do badań elementy
71
Bartłomiej Rębkowski, Ewa Archanowicz, Emil Archanowicz...
nie mogły mieć bezpośredniego kontaktu z gruntem. Wybrano elementy o poziomym i pionowym układzie włókien zamontowane
pionowo lub poziomo. Wszystkie elementy poddano czyszczeniu
mechanicznemu przy użyciu szlifierek mechanicznych, papierów
ściernych, dłut i pilników. W ten sposób usunięto całą przebarwioną warstwę drewna, aż do uzyskania jednolitego koloru. Grubość
zebranej warstwy drewna nie przekraczała 1,0 mm, Następnie, na
oczyszczone elementy zostały naniesione wybrane kompozycje
środków ochronnych i dekoracyjno-ochronnych. Naniesienie preparatu było zgodne z zaleceniami ich producentów. Kolejność aplikacji
poszczególnych preparatów została przedstawiona w tabeli (tab. 2).
Ocena skuteczności zabezpieczenia drewna przed niepożądanymi
zmianami wyglądu powierzchni została przeprowadzana po 12 i 24
miesiącach. Daną kompozycję preparatów uznawano za skuteczną,
jeżeli w ciągu 12 i 24 miesięcy nie stwierdzono powstania przebarwień drewna oraz wysolenia preparatów ochronnych na powierzchnię drewna. W artykule przedstawiono wyniki dotyczące prac wykonanych w latach 2011 i 2012.
Do wyboru środków ochronnych i dekoracyjno-ochronnych
użyto dwóch kryteriów. Pierwszym kryterium było dopuszczenie
danych preparatów do obrotu na rynku polskim, drugim kryterium
była możliwie jak najmniejsza zmiana barwy drewna przez sam preparat. Wybrano 6 preparatów ochronnych i dekoracyjno-ochronnych
dopuszczonych do obrotu w 2011 roku. Poniżej przedstawiono zestawienie zastosowanych preparatów.
Tab. 1. Preparaty ochronne i dekoracyjno-ochronne wraz z podstawowymi
informacjami o składzie chemicznym zastosowane w badaniach
Symbol
72
Funkcja
Substancje aktywne
I-1
impregnat na bazie wody
czwartorzędowe związki
amoniowe, kwas borny, propanol
I-2
żelowy preparat ogniochronny
i impregnujący na bazie wody
chlorki benzyloamoniowe,
butylokarbaminiany, flufenoksuron, propanol
I-3
impregnat na bazie rozcieńczalników organicznych
permetryna, propiconazol,
butylokarbaminiany
Ocena skuteczności działania wybranych kompozycji preparatów ochronnych...
I-4
impregnat na bazie wody
cypermetryna, propiconazol
I-6
środek dekoracyjno-ochronny do drewna na bazie rozpuszczalników organicznych
oksym ketonu etylowo
metylowego
I-7
impregnat dekoracyjnoochronny na bazie żywic ftalowych
ksylen, tebukonazol, tolilofluanid, permetryna
Ogółem renowacji poddano 26 elementów elewacji budynku OSW
‘Marymont’, w tym 20 ażurowych przęseł balustrady, 3 okładziny
elewacji wykonane z półokrąglaków, 3 przypory. Na oczyszczonych
elementach zastosowano wyselekcjonowane preparaty w wybranych
kombinacjach. 1 przęsło balustrady pozostawiono niezabezpieczone
żadnymi preparatami ochronnymi lub dekoracyjno-ochronnymi.
Wyniki i dyskusja
Wyniki oceny skuteczności zastosowanych kompozycji preparatów ochronnych i dekoracyjno-ochronnych przedstawiono w tabeli (tab. 2).
Wykazano iż, kompozycje preparatów zawierające preparat I-2
charakteryzowały się zadowalającą skutecznością. Kompozycje,
w których zastosowano preparat I-6 nie dały pozytywnego efektu.
Dodanie do kompozycji zawierającej preparat I-6 preparatu I-2 lub
preparatu I-4 wpływa pozytywnie na skuteczność takiej kompozycji.
Dodanie do kompozycji zawierającej preparat I-6 preparatu I-1 nie
daje pozytywnego wpływu na skuteczność takiej kompozycji. Preparat
I-2 wykazał się szczególnymi właściwościami. Powierzchnie elementów
zabezpieczonych tym preparatem wykazywały zwiększoną higroskopijność, objawiającą się podwyższoną wilgotnością powierzchni.
Różnice w skuteczności działania danych kompozycji mogą wynikać z ich składu chemicznego lub z lokalizacji elementów elewacji
poddanych zabezpieczeniu. Działanie i skuteczność poszczególnych
substancji aktywnych wybranych preparatów powinno zostać ocenione w osobnym badaniu. Od lokalizacji wybranego elementu zależą
warunki w jakich funkcjonuje drewno, szczególnie nasłonecznienie,
narażenie na bezpośrednie oddziaływanie wody opadowej, wilgoci,
wiatru oraz tempo wysychania powierzchni.
73
Bartłomiej Rębkowski, Ewa Archanowicz, Emil Archanowicz...
Tab. 2. Wyniki oceny skuteczności działania wybranych zestawów
preparatów. B – balustrada, P – przypora, O – okładzina
elewacji wykonana z półokrąglaka
Symbol
obiektu
Zastosowane
preparaty i kolejność aplikacji
Data
renowacji
Ocena po 12
miesiącach
Ocena po 24
miesiącach
B1
I-3, I-2,
2012-07
brak
przebarwień
-
B2
I-6, I-2,
2012-07
brak
przebarwień
-
B32
I-1, I-6,
2011-07
wysolenia,
wysolenia,
przebarwienia przebarwienia
B33
I-1,
2011-07
przebarwienia przebarwienia
B34
I-1, I-2,
2011-07
brak
przebarwień
brak
przebarwień
B35
I-4, I-1, I-6,
2011-07
brak
przebarwień
brak
przebarwień
B41
I-4, I-6,
2011-07
brak
przebarwień
brak
przebarwień
B42
I-4, I-2,
2011-07
brak
przebarwień
brak
przebarwień
B43
I-1, I-2,
2011-07
brak
przebarwień
brak
przebarwień
Symbol
obiektu
Zastosowane
preparaty i kolejność aplikacji
Data
renowacji
Ocena po 12
miesiącach
Ocena po 24
miesiącach
B44
I-1, I-6
2011-07
brak
przebarwień
Przebarwienia
B45
I-1, I-6
2011-07
brak
przebarwień
Przebarwienia
B46
I-4, I-1, I-6
2011-07
przebarwienia Przebarwienia
B47
I-4, I-1, I-6
2011-07
wysolenia,
wysolenia,
przebarwienia przebarwienia
B57
Brak
2011-07
zacieki,
zacieki,
przebarwienia przebarwienia
74
Ocena skuteczności działania wybranych kompozycji preparatów ochronnych...
B58
I-6
2011-07
wysolenia,
wysolenia,
przebarwienia przebarwienia
B59
I-2
2011-07
brak
przebarwień
B60
I-6
2011-07
wysolenia,
wysolenia,
przebarwienia przebarwienia
B73
I-6, I-2,
2012-07
brak
przebarwień
-
B74
I-7, I-2,
2012-07
brak
przebarwień
-
B75
I-3, I-2,
2012-07
brak
przebarwień
-
P2
I-1,
2011-07
brak
przebarwień
brak
przebarwień
P3
I-1,
2012-07
brak
przebarwień
-
P4
I-3, I-2,
2012-07
brak
przebarwień
-
O1
I-1,
2011-07
brak
przebarwień
brak
przebarwień
O2
I-1, I-2,
2012-07
brak
przebarwień
-
O3
I-1, I-2,
2012-07
brak
przebarwień
-
brak
przebarwień
Wnioski
Na podstawie uzyskanych wyników sformułowano następujące wnioski końcowe:
1. Zastosowane kompozycje preparatów ochronnych i dekoracyjno-ochronnych wykazały się różną skutecznością. Na szczególną
uwagę zasługuje preparat I-2. Wszystkie kompozycje wykorzystujące ten preparat wykazały się dużą skutecznością ochrony przed
niepożądanymi zmianami wyglądu powierzchni drewna zarówno
w okresie 12, jak i 24 miesięcy.
2. Elementy elewacji na które naniesiono kompozycje
charakteryzujące się skutecznością powinny być poddawane
75
Bartłomiej Rębkowski, Ewa Archanowicz, Emil Archanowicz...
okresowej ocenie w kolejnych latach w celu określenia trwałości
danego rozwiązania.
3. Skuteczność kompozycji, preparatów jak i poszczególnych
substancji aktywnych powinny być potwierdzone laboratoryjnie.
Bibliografia
Arnold M. Sell J. Feist W. C. 1991. Wood weathering in fluorescent ultraviolet
and xenon arc chambers. Forest Products Journal, 41(2): 40 – 44.
Browne F. L. Simonson H. C. 1957. The penetration of light into wood. Forest
Product Journal, 7: 308 – 314.
Feist W. C. 1988. Outdoor wood weathering and protection. W: Rowell R. M.
Barbour R. J. 1988. Archeological wood: properties, chemistry, and preservation. Advances in chemistry, 225: 263 – 298.
Feist W. C. Hon D. N. –S. 1984. Chemistry of weathering and protection. W:
Rowell R. M. 1984. The chemistry of solid wood. Advances in chemistry,
207: 401 – 451.
Hon D. N. –S. 1991. Photochemistry of wood. W: Hon D. N. –S. Shiraishi N.
1991. Wood and cellulosic chemistry. Marcel Dekker, New York, 525 – 555.
Hon D. N. –S. Clemenson S. C. Feist W. C. 1986. Weathering characteristics of
hardwood surfaces. Wood Science and Technology, 20: 169 – 183.
Hon D. N. –S. Ifju G. 1978. Measurement penetration of light into wood by
detection of photo – induced free radicals. Wood Science and Technology,
11 (2): 118 – 127.
Jankowska A. 2013. Wpływ sztucznego starzenia na wybrane właściwości
drewna egzotycznego. Praca Doktorska SGGW, Warszawa.
Krajewski A. Witomski P. 2005. Ochrona drewna – surowca i materiału.
Wydawnictwo SGGW, Warszawa.
Tolvaj L., Mitsui K., 2005. Light source dependance of the photodegradation of
wood. The Japan Wood Research Society, 51, 468 – 473.
Ważny J. (red.) Karyś J. (red.). 2001. Ochrona budynków przed korozją biologiczną. Praca zbiorowa. Wydawnictwo ARKADY, Warszawa.
Williams R. S. Knaebe M. T. Feist C. W. 2001. Erosion rates of wood during
natural weathering. Part II: Earlywood and latewood erosion rates. Wood
and Fiber Science, 33 (1): 43 – 49.
76
Ocena skuteczności działania wybranych kompozycji preparatów ochronnych...
Adres do korespondencji:
mgr. inż. Bartłomiej Rębkowski
mgr. inż. Ewa Archanowicz
mgr. inż. Dominika Szadkowska
Katedra Nauki o Drewnie i Ochrony Drewna
Wydział Technologii Drewna
Szkoła Główna Gospodarstwa Wiejskiego w Warszawie
e-mail: [email protected], [email protected]
[email protected]
mgr. inż. Emil Archanowicz
Katedra Technologii i Przedsiębiorczości w Przemyśle Drzewnym
Wydział Technologii Drewna
Szkoła Główna Gospodarstwa Wiejskiego w Warszawie
e-mail: [email protected]
77
Nauki o zwierzętach
Edyta Bańcyr, Paulina Jawor, Dawid Król
Joanna Bajzert, Tadeusz Stefaniak
Anna Chełmońska-­Soyta
Promotor: prof. dr hab. Anna Chełmońska-Soyta
Opiekun naukowy: dr Paulina Jawor
EPISTEME
22/2014, t. I
s. 81-89
ISSN 1895-2241
PORÓWNANIE KOMERCYJNIE DOSTĘPNYCH
ZESTAWÓW DO IZOLACJI RNA Z TKANKI
MÓZGU CIELĘCIA MARTWO URODZONEGO
COMPARISON OF COMMERCIALLY AVAILABLE
KITS FOR THE ISOLATION OF RNA FROM
THE BRAIN OF A STILBORN CALF
Abstrakt. W ostatnim czasie badania wielu zespołów skierowane są na poznanie mechanizmów molekularnych, głównie ekspresji genów zachodzących
w różnych strukturach mózgu. Analiza ekspresji genów stała się kluczowym
narzędziem w rękach naukowców. Puntem krytycznym analiz ekspresji
genów, jest izolacja z tkanek RNA o wysokiej czystości i jakości. Specyficzna budowa mózgu powoduje, że w czasie izolacji pojawia się wiele punktów
krytycznych, które mogą zadecydować o niepowodzeniu eksperymentu,
a tym samym uzyskaniu RNA zdegradowanego bądź w zbyt niskiej koncentracji. Na rynku nie ma komercyjnie dostępnych zestawów dedykowanych do
izolowania RNA z tkanki mózgowej. Celem badań było porównanie czterech
dostępnych komercyjnie zestawów do izolacji RNA pod kątem ilości i jakości
uzyskanego kwasu nukleinowego z mózgu pobranego od martwo urodzonego cielęcia. Uzyskane wyniki wskazują, że na uzysk RNA wpływa zarówno fragment mózgu, z jakiego izolowano RNA jak i użyty zestaw. Różnice
w ilości RNA mogły wynikać z zastosowanych kolumn i odczynników. Ilość
wyizolowanego RNA z istoty białej wydaje się być niższa niż w korze.
Słowa kluczowe: mózg, izolacja RNA, cielę
Summary. In recent times, many research teams are directed to explore
molecular mechanisms of gene expression mainly occurring in different
brain structures. Analysis of gene expression has become a key tool in the
hands of scientists. The critical point during gene expression analysis is isolation of RNA, which has got high purity and quality. In recent years, the
interest of many research groups directed toward the analysis of the expres81
Edyta Bańcyr, Paulina Jawor, Dawid Król, Joanna Bajzert, Tadeusz Stefaniak...
sion of genes encoded in the brain tissue. Due to the specific construction of
the brain tissue at the time of isolation there are many critical points, which
can decide a failure of the experiment , thereby obtaining a degraded RNA
or at too low a concentration. On the market there is no dedicated commercially available kits for RNA isolation strictly from brain tissue. The aim of
the study was to compare four commercially available kits for RNA isolation, the quantity and quality of the resulting nucleic acid,obtained from
a brains isolated from stillborn calf. The results indicate that the yield of
RNA affects both brain fragment from which RNA was isolated and used
as a set. Differences in the amount of RNA may have resulted from the columns and reagents used. The amount of RNA isolated white matter appears
to be lower than in the cortex.
Key words: brain, RNA isolation, still born calf
Wstęp
Mózg uważany jest za jeden z najmniej poznanych do tej pory narządów. Kluczowa rola, jaką pełni dla każdego organizmu jest nieoceniona ­jest to nie przede wszystkim „centrum dowodzenia”, które koduje liczne białka, przekaźniki, receptory, odpowiadając tym samym za
funkcjonowanie organizmu. Dokładna analiza ścieżek sygnałowych
w mózgu uzależniona jest od wyizolowania genów kodujących
odpowiednie białka, które pełnią rolę przekaźników. Ze względu na
wysoką zawartość tłuszczu w tkance mózgowej, dochodzącej nawet
do 60% [Chang i in. 2009; Clandinin i in. 1980] izolacja RNA jest stosunkowo trudna. Micele tłuszczu znacznie utrudniają homogenizację
tkanki, przez co ilość jak i jakość uzyskanego RNA bywa niezadowalająca. Wyróżnia się trzy główne typy RNA : rybosomalne (rRNA),
informacyjne (mRNA) i transportujące (tRNA). Informacyjne RNA
stanowi około 5% wszystkich kwasów rybonukleinowych w komórce
[Cirera 2013, Żak 2001].
Izolacja niezdegradowanego RNA stanowi punkt wyjścia w przeprowadzeniu kolejnych analiz, jak Real­Time PCR, tworzenie bibliotek cDNA czy mapowanie RNA. Punktem krytycznym dla izolacji
RNA jest zazwyczaj pierwszy etap ekstrakcji, polegający na homogenizacji materiału. Niemniej, kolejne etapy są równie ważne, przez co
na każdym etapie możliwe są degradacja jak i straty RNA.
82
Porównanie komercyjnei dostępnych zestawów do izolacji...
Celem badań było porównanie czterech dostępnych komercyjnie
zestawów do izolacji RNA, pod względem ilości i jakości uzyskanego RNA z dwóch części mózgu­kory przedczołowej oraz istoty białej
podkorowej, pobranych od martwo urodzonego cielęcia.
Materiały i metody
W trakcie analiz wykorzystano komercyjnie dostępne zestawy
do izolacji RNA: Qiagen Rneasy Fibrous Tissue (nr kat. 74704), Life
Technologies Pure Link RNA Mini Kit (nr kat. 121830 20), EurX
Gene Matrix Universal RNA Purification Kit (nr kat. E3598) oraz
zestawu firmy A and A Biotechnology Total RNA Mini Plus (nr kat.
036­50). Wycinki mózgu pobrano od cielęcia martwo urodzonego
z ciąży o prawidłowej długości. Analizom poddano próby pobrane
z dwóch obszarów mózgu: kory przedczołowej i istoty białej podkorowej pobranej w połowie długości komory bocznej. Masa każdego
wycinka mieściła się w przedziale 17­20 mg.
Każdą z analiz wykonano w trzech powtórzeniach. Każda procedura izolacji była przeprowadzana zgodnie ze wskazówkami producenta, dołączonymi do każdego z zestawów do izolacji, przy czym
w żadnej z izolacji nie zastosowano dodatkowego trawienia Dnazą.
Po wycięciu odpowiedniego fragmentu mózgu próbę poddano homogenizacji z zastosowaniem TissueRuptor (Qiagen). W zależności od
zestawu, próby zawieszano w odpowiednich buforach, zawartych
w każdym z zestawów (tabela 1) a następnie, po wyizolowaniu RNA
zawieszano je w wodzie wolnej RNA.
Tab. 1. Zestawienie buforów do zawieszania prób oraz ilość wody
do wymywania RNA w używanych zestawach.
Lp
Nazwa zestawu
Bufor do
zawieszenia
próby
Objętoś wody
wolnej od RNA
[uL]
1
Qiagen
RTL
100
2
EurX
RL
120
3
Life Technologies
Trizol Reagent
100
4
A and A
Biotechnologys
Fenozol
100
83
Edyta Bańcyr, Paulina Jawor, Dawid Król, Joanna Bajzert, Tadeusz Stefaniak...
Stężenie RNA zmierzono za pomocą urządzenia NanoDrop
(Thermo Scientific). Jakość i ewentualny stopień degradacji RNA
sprawdzono za pomocą elektroforezy w 2% żelu agarazowym
zawieszonym w buforze TBE, poprowadzonej w warunkach denaturujących w obecności bromku etydyny, przy napięciu 70V, 1,5h.
Wyniki i dyskusja
W tabeli nr 2 zestawiono wyniki izolacji, przedstawiające stężenie
RNA w każdej z prób w ng/μL oraz oznaczenia przy różnych długościach fali, wykonane w celu oznaczenia zanieczyszczenia preparatów
białkiem, rozpuszczalnikami organicznymi i solami chaotropowymi
użytymi do izolacji. Ilość uzyskanego RNA różniła się w zależności
od użytego zestawu, w skład których wchodziły różne bufory jak
i kolumienki, wypełnione innymi złożami. Najwyższe stężenie RNA
otrzymano podczas izolacji z kory przedczołowej i uzyskano je stosując zestaw z firmy Qiagen. W przypadku istoty białej, ilość uzyskanego RNA zwykle była niższa niż w przypadku kory. Najwyższe stężenie RNA uzyskano po zastosowaniu zestawu firmy EurX.
W przypadku obu tych zestawów, pomimo najwyższych wartości
średnich, występowała duża różnica w wynikach w kolejnych izolacjach. Średni całkowity uzysk RNA z kory czołowej był najwyższy
w przypadku zestawu firmy Qiagen (20730 ng), zaś najniższy odnotowano w przypadku zestawu firmy EurX (7152 ng). W przypadku
istoty białej najwyższy całkowity uzysk RNA odnotowano po użyciu
zestawu firmy EurX (14196 ng), zaś najniższy w przypadku zestawu
firmy Life Technologies (1020 ng). Jak podają Dunlop i in. (1984),
ilość i jakość uzyskanego RNA zależy zarówno od miejsca mózgu,
z którego pobrano próbę, jak i od sposobu homogenizacji [Larska
i in. 2010]. Istota biała, ze względu na włókna nerwowe pokryte
osłonkami mielinowymi, znacznie trudniej ulega homogenizacji niż
kora, stąd też prawdopodobnie niższe stężenia RNA uzyskiwanego
w przypadku wykorzystania istoty białej. Na ilość uzyskanego RNA
miały wpływ również inne czynniki zewnętrzne, jak chociażby skład
buforów używanych w trakcie izolacji, jak i złoże, umieszczone w kolumience.
84
Porównanie komercyjnei dostępnych zestawów do izolacji...
Wartość stosunku OD 260/280 znajdująca się w przedziale 1,8­
2,0 oznacza, że preparat jest pozbawiony zanieczyszczeń białkowych.
Wartość oscylująca wokół 1,5 świadczy o tym, że w danym preparacie
jest ok 50% białka [Słomski i in. 2011]. W przypadku izolacji RNA
z kory mózgowej, prawie wszystkie preparaty (z wyjątkiem jednej
izolacji przy użyciu zestawu firmy Qiagen i EurX­stosunek wyniósł
1,6) wykazywały stosunkowo wysoką czystość. W przypadku izolacji RNA z istoty białej, największą ilość zanieczyszczeń odnotowano po użyciu zestawu firmy Qiagen. W związku z tym bardzo ważną
czynnością w czasie izolacji, wydaje się być ilość płukań przy użyciu
buforu płuczącego, przed uwolnieniem RNA z kolumienki. Skład
buforu objęty jest tajemnicą handlową, stąd trudno jednoznacznie
stwierdzić, jaki składnik mieszaniny może przyczyniać się do pozostawania zanieczyszczeń. Również tutaj istotny wpływ może mieć
złoże krzemionkowe, którymi wypełnione są poszczególne kolumienki.
Kolejnym parametrem świadczącym o odpowiedniej czystości
preparatu jest stosunek 260/230 [Pfaffl 2003]. W przypadku izolacji RNA powinien wynosić on >1,8. W przypadku izolacji RNA
z kory, w przypadku zestawów z firmy A&A Biotechnology stosunek
260/230 był wyższy niż 1,8. W przypadku zestawów z innych firm,
stosunek 260/230 był niższy niż 1,8 sięgając nawet 0,5 w przypadku
Life Technologies, czy 0,3 w przypadku firmy Qiagen. W przypadku
izolacji RNA z istoty białej podkorowej, najlepszy stosunek 260/230
odnotowano w przypadku zestawu firmy EurX. Najniższy wskaźnik,
sięgający 0,1 odnotowano w przypadku zestawu z firmy Life Technologies. Niższy niż 1,8 stosunek świadczy o zabrudzeniu preparatów
odczynnikami używanymi w izolacji (głównie sole chaotropowe).
Na podstawie przeprowadzonej elektroforezy w żelu agarozowym
stwierdzono, że RNA z tkanki mózgowej nie uległo degradacji.
W przypadku prób wyizolowanych z istoty białej nie odnotowano
prążków odpowiadających RNA.
85
Edyta Bańcyr, Paulina Jawor, Dawid Król, Joanna Bajzert, Tadeusz Stefaniak...
213,2
I
73,9
II
67,1
Life
Technologies
EurX
1,9 0,9 2,0
1,8
5,3 2,6 2,0
1,6
1,8 0,8 2,1
1,4
1,7 0,8 2,0
1,0
37,8
0,9 0,6 1,6
0,3
167
59,6
16700
7152
69,3
19,2
A280
1,9
A260
4,2 2,0 2,0
SD
260/230
III
Średni całkowity
uzysk RNA ng
Stężenie w ng/μL
76,9
Średnie stężenie w
ng/μL
Numer powtó-rzenia
Nazwa zestawu
II
III
A&A
Biotechnology
BIAŁA PODKOROWA
167
EurX
Qiagen
86
I
A&A
Biotechnology
260/280
KORA
Badany materiał
Tab. 2. Wyniki pomiaru na NanoDrop uzyskanego RNA
I
121,3
3,0 1,4 2,0
1,9
II
83,9
2,1 1,0 2,0
2,0
III
52,2
1,3 0,6 2,0
0,5
I
330
8,2 4,1 2,0
1,7
II
249
147,9 6,2 3,1 1,9
1,1
III
43,1
1,0 0,6 1,6
0,3
I
76
1,9 0,9 1,9
1,9
II
47,4
1,2 0,6 1,8
1,4
III
66,8
1,7 0,8 1,9
1,7
I
149,7
3,8 1,8 2,0
2,4
85,8
207,3
63,4
20730
6340
14,6
II
21,8
3,2 1,6 2,0
2,4
183,3
4,9 2,2 2,0
1,7
I
15,7
0,4 0,2 1,9
0,1
0,1 0,1 2,1
0,1
0,2 0,1 2,2
0,1
0,7 0,6 1,3
0,3
0,8 0,4 1,9
0,8
0,4 0,3 1,6
0,1
II
5,2
III
9,7
I
24,9
Qiagen
II
34,2
III
17,9
10,2
25,7
14196
34,5
III
Life
Technologies
118,3
8580
1020
2570
85,2
5,3
8,2
Porównanie komercyjnei dostępnych zestawów do izolacji...
Wnioski
Na podstawie uzyskanych wyników, trudno jednoznacznie wybrać jeden, “idealny” zestaw. Większą ilość RNA udaje się uzyskać w przypadku kory mózgowej w porównaniu do istotny białej. W większości
przypadków odnotowano zanieczyszczenie solami, choć w przypadku
pojedynczych izolacji z zastosowaniem zestawów firmy A&A Biotechnology i Life Technologies (kora) nie zaobserwowano wysokiego zanieczyszczenia solami. Wysoką średnią koncentrację RNA odnotowano w przypadku firm: Qiagen, A&A Biotechnology oraz EurX. Żadna
z prób poddanych analizie, nie była dodatkowo traktowana DNazą,
która podawana jest opcjonalnie, w przypadku każdego zestawu.
Najprawdopodobniej, dłuższe przemywanie kolumienek przy użyciu
buforu do płukania oraz zastosowanie DNazy umożliwi otrzymanie czystszych preparatów. Niemniej, aby wybrać zestaw idealny dla
danej tkanki, powinno się zawsze przetestować kilka, komercyjnie
dostępnych zestawów.
87
Edyta Bańcyr, Paulina Jawor, Dawid Król, Joanna Bajzert, Tadeusz Stefaniak...
Literatura
Chang E. L. Wefel J. S. Hess K. R. Allen P. K. Lang F. F. Kornguth D. G. Arbuckle R. B. Swint J. M. Shiu A. S. Maor M. H. Meyers C. A. 2009. Neurocognition in patients with brain metastases treated with radiosurgery or
radiosurgery plus whole­brain irradiation: a randomised controlled trial.The
Lancet Oncology, 10(11):1037­44
Cirera S. 2013. Highly efficient method for isolation of total RNA from adipose
tissue. BMC Research Notes, 6 (472): 1­5
Clandinin M. T. Chappell J. E. Leong S. Heim T. Swyer P. R. Chance G. W.
1980. Intrauterine fatty acid accretion rates in human brain: implications
for fatty acid requirements. The Early Human Development, 4(2): 121­9
Dunlop D. S. Bodony R. Lathaja A. 1984. RNA concentration and protein
synthesis in rat brain during development. Brain Research, 294(1):148­51
Larska M. Polak M. P. Zmudziński J. F. Torres J. M. 2010. Comparison of
mRNA expression levels of selected genes in the brain stem of cattle naturally infected with classical and atypical BSE. Brain Research 1351:13­22
Pfaffl M. W. 2003. Livestock Transcriptomics: Quantitive mRNA analytics in
molecular endocrinology and physiology Praca habilitacyjna,Wydana na
Chair of Physioology, Department of Animal Science, Center of Life and
Food Sciences, Germany 2003: 4­8
Słomski R. 2011. Analiza DNA. Teoria i praktyka, Podręcznik pod red.
R.Słomskiego, rozdział 7 s.61­64, rozdział 8 s. 65­81
Żak I. 2001. Kwasy nukleinowe. Chemia Medyczna, 325­345. Wydawnictwo
Śląska Akademia Medyczna
Protokoły zawarte w poszczególnych zestawach
Adres do korespondencji:
mgr inż. Edyta Bańcyr
Katedra Immunologii
Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
dr Paulina Jawor
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
88
Porównanie komercyjnei dostępnych zestawów do izolacji...
lek wet. Dawid Król
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
dr inż. Joanna Bajzert
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
prof. Dr hab. Tadeusz Stefaniak
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
prof. Dr hab. Anna Chełmońska-Soyta
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
Instytut Immunologii i Terapii Doświadczalnej PAN
im. L. Hirszfelda we Wrocławiu
*Praca finansowana z Grantu NCBiR nr PBS2/A8/20/2013.
„Diagnozowanie infekcji śródmacicznej u cieląt słabej żywotności i martwo
urodzonych. Ocena przydatności wybranych parametrów jako potencjalnych markerów”
**This work was supported by NCBiRnr PBS2/A8/20/2013. Diagnosis of
intrauterine infection in weak and stillborn calves. Evaluation of selected
parameters as a potential markers.
89
Edyta Bauer
Justyna Żychlińska–Buczek
Michał Rozmus
Opiekun naukowy: dr hab. Ewa Ptak, prof. UR
EPISTEME
22/2014, t. I
s. 91-98
ISSN 1895-2241
CZYNNIKI WPŁYWAJĄCE NA PRZEBIEG PORODU
U KRÓW RAS MLECZNYCH
FACTORS AFFECTING THE PARTURITION
IN DAIRY COWS
Abstrakt. Stopień trudności porodu decyduje często o powodzeniu
zaczynającej się laktacji, wpływa on także na późniejsze próby skutecznego
zacielenia. Porody trudne i skomplikowane są niejednokrotnie przyczyną
wcześniejszego brakowania krów ze stada. Doświadczenie opierało się na
obserwacji 107 porodów. Porody łatwe stanowiły 64%, natomiast porody
trudne zaobserwowano u 12,2% krów a pozostałe porody z pomocą jednej lub dwóch osób. Główne przyczyny trudnych porodów to: pośladkowe
położenie, proste ustawienie zadu oraz ciąże bliźniacze. Największy wpływ
na łatwość wycielenia u obserwowanych krów wywarło ułożenie płodu
oraz masa i płeć urodzonego cielęcia. Stwierdzono również wysoce istotną
zależność między łatwością wycielenia a ustawieniem zadu oraz liczbą
urodzonych cieląt. Zaobserwowano zależność między łatwością wycielenia
a kolejną laktacją.
Słowa kluczowe: bydło mleczne, przebieg porodu
Summary. The degree of calving difficulty is often a decisive factor for the
successful lactation. Also, it affects the future attempts of cow insemination. A difficult and complicated calving is often a reason of an involuntary
culling of a cow The observation included 107 calvings. Easy deliveries were
observed in 64% while difficult deliveries in 12.2% of cows. The difficult
calvings resulted mainly from: breech presentation, straight rump position
and calf sex. Calving ease was affected in the highest degree by fetus position an body weight and sex of a calf. A highly significant relationship between calving ease and rump position as well as the number of calves delivered
was found. The relationship between calving ease and a successive lactation
was also observed.
Key word: dairy cattle, calving ease.
91
Edyta Bauer, Justyna Żychlińska–Buczek, Michał Rozmus
WSTĘP
Niejednokrotnie hodowcy dysponują krowami o potencjale produkcyjnym przekraczającym 12–13 tysięcy kg za laktację. Poród jest
przełomowym momentem w życiu krowy Wraz z podnoszeniem
wydajności mlecznej zauważono nasilające się problemy zdrowotne oraz częstsze komplikacje przy porodach [Wójcik i Kruk 2008].
Poród należy do skomplikowanych procesów fizjologicznych podczas
którego następuje wydalenie płodu i łożyska z organizmu samicy.
U bydła najczęściej występują porody naturalne, które są jednocześnie najzdrowsze dla samicy [Adamowicz 2005]. Wszystkie porody
muszą odbywać się pod nadzorem, ponieważ zdarzają się komplikacje przy wypieraniu płodu. Konieczna jest wtedy ingerencja hodowcy lub w trudniejszych przypadkach lekarza weterynarii. Łatwość
porodu jest cechą funkcjonalną a stopień trudności porodu zależy od
wielu czynników środowiskowych. Celem pracy była ocena jakości porodu przy uwzględnieniu wpływu takich czynników jak: klasyfikacja
łatwości wycielenia, kondycja, budowa zadu, masa ciała urodzonych
cieląt, płeć cieląt, ułożenie płodu, liczbę płodów oraz sezon wycielenia.
MATERIAŁ I METODY
Badania przeprowadzono w roku 2008 w dwóch gospodarstwach
zlokalizowanych w Pszczynie w województwie dolnośląskim. Badaniami objęto krowy (łącznie 214 zwierząt) rasy polskiej holsztyńsko­
fryzyjskiej odmiany czarno­białej (HO) z różnym udziałem genów
bydła holsztyńsko­fryzyjskiego (hf). Kolejność laktacji u krów obserwowanych określona była na podstawie karty krowa – jałówka.
Długość ciąży u badanych krów trwała od 278 do 290 dni. Wszystkie
oceniane krowy były urodzone w Polsce. Na podstawie bezpośrednich obserwacji oceniono ustawienie zadu, sezonu wycieleń, położenie
płodu, liczby cieląt, płci cieląt podczas 107 porodów. Kondycję krów
oceniono na podstawie skali BCS( body condition scoring): 2 – krowa
bardzo chuda: 2,5 krowa chuda; 3 – krowa kondycji średniej: ­3,5 –
krowa w kondycji powyżej średniej; 4 – krowa kondycji opasowej:
4,5 ­kondycja mocno opasowa. Przyjęto 4 sezony wycielenia: wiosna
(marzec, kwiecień maj), lato (czerwiec, lipiec, sierpień), jesień (wrzesień, październik, listopad), zima (grudzień, styczeń, luty).
92
Czynniki wpływające na przebieg porodu u krów ras mlecznych
Obliczenia statystyczne
Zbadano zależności między następującymi parami cech.
a) LAKTACJA a ŁATWOŚĆ WYCIELENIA
b) POŁOŻENIE PŁODU a ŁATWOŚĆ WYCIELENIA
c) USTAWIENIE ZADU a ŁATWOŚĆ WYCIELENIA
d) SEZON WYCIELENIA a ŁATWOŚĆ WYCIELENIA
e) LICZBA CIELĄT a ŁATWOŚĆ WYCIELENIA
f) PŁEĆ CIELĘCIA a ŁATWOŚĆ WYCIELENIA
W tym celu obliczono wartości współczynnika korelacji rangowej
Spearmana, i wykorzystano test X2, korzystając w tym celu z programu Statistica.
WYNIKI I DYSKUSJA
Z analizy danych wynika, że masa rodzących się cieląt wahała się
w granicach od 36 kg do 39 kg. Wysoka masa urodzeniowa cieląt jest
często przyczyną skomplikowanych porodów [Brzozowski i in. 1998].
Badania przeprowadzone przez Philipssona [1976] wykazały wyraźnie
rosnący stopień trudnych wycieleń wraz ze wzrostem masy ciała cieląt.
Tab. 1. Współczynniki korelacji między badanymi cechami
u obserwowanych krów
2
Łatwość wycielenia 1
Laktacja
2
Długość
ciąży(dni)
3
Położenie płodu
4
3
4
5
6
7
­0,15
0,23*
0,22*
0,09 0,13
­0,06
­0,011 0,018
­0,00
0,19 0,04
­0,25
­0.06
0,05
0,08
0,02
­0.04
0,13
0,11
­0,04 0,05
0,02
­0,26 0,05
0,61**
­0,10 0,09
0,08 0,09 0,25*
0,02
0,33
8
9
Liczba cieląt(szt.)
5
Masa płodu
6
Płeć cielęcia
7
­0,07 0,11
Kondycja krów
8
0,18
Ustawienie zadu
9
** współczynnik korelacji wysoce istotny (p ≤ 0,01)
* współczynnik korelacji istotny (p ≤ 0,05)
93
Edyta Bauer, Justyna Żychlińska–Buczek, Michał Rozmus
Tabela 1 zawiera wartości współczynników korelacji między badanymi cechami. Stwierdzono statystycznie wysoce istotną korelację
między masą płodu a płcią cielęcia (p≤0,01). Łatwość wycielenia była
istotnie (p ≤ 0,05) skorelowana z takimi cechami jak: położenie płodu
(r= 0,25), masa płodu (r = 0,23) oraz płeć cielęcia (r = 0,22).
Stwierdzono wysoce istotną zależność (p≤0,01) między
łatwością wycielenia a położeniem płodu, łatwością wycielenia a ustawieniem zadu oraz łatwością wycielenia a liczbą cieląt. Wystąpiła
również statystycznie istotna zależność między łatwością wycielenia a kolejną laktacji (p<0,05). Na łączną liczbą 107 obserwowanych
porodów odnotowano 96,2% porodów z położeniem główkowym, a
jedynie 3,7% z położeniem pośladkowym. Należy tutaj dodać, że przodowanie główkowe (95%) jest korzystniejsze dla cieląt niż uznawane za fizjologiczne położenie pośladkowe, które stanowi około 5%
porodów [Dejneka i Twardoń 2008]. Ważną cechą budowy, która ma
znaczący wpływ na łatwość wycielenia jest ustawienie zadu. Podobne
zdanie mieli Tyczka i in., [1999]), którzy potwierdzili wysoce istotny
wpływ nachylenia miednicy na przebieg porodu.
Tab. 2. Liczba porodów bez pomocy (BP), z pomocą jednej osoby(ZP),
trudnych z pomocą dwóch osób(T) i z pomocą weterynaryjną (W)
w zależności od analizowanych czynników wraz z wartością X2
Czynnik
Łatwość wycielenia
BP
ZP
T
Łącznie
%
W
1.Położenie
płodu
15,5**
główkowy
22
68
10
3
103
96,2
pośladkowy
-
1
3
-
4
3,7
2.Ustawienie
zadu
94
35,5**
spadzisty
19
58
11
-
88
82,2
prosty
2
7
1
3
13
12,1
uniesiony
1
4
1
-
6
5,6
3.Sezon
wycielenia
X2
7,2
Czynniki wpływające na przebieg porodu u krów ras mlecznych
wiosna
19
15
18
17
69
64,5
lato
4
2
6
1
13
12,1
jesień
-
-
2
1
3
2,8
zima
6
3
6
7
22
20,6
4.Liczba cieląt
20,5**
1
2
67
13
3
85
79,4
2
2
2
-
-
4
3,7
5.Płeć cielęcia
9,9
cieliczki
13
37
4
-
54
50,5
buhajki
7
30
9
3
49
45,8
bliźnięta
2
2
-
-
4
3,7
6.Kondycja
krowy
16,1
2.0
1
-
-
-
1
0,9
2.5
2
5
1
-
8
7,5
3.0
5
21
3
-
29
27,1
3.5
6
18
5
-
29
27,1
4.0
8
17
3
3
31
29,0
4.5
-
8
1
-
9
8,4
1
5
28
2
1
36
33,6
2
3
12
6
-
21
19,6
3
5
13
2
1
21
19,6
4
5
6
2
-
13
12,1
5
2
6
-
-
8
7,5
7.Laktacja
42,9*
6
1
2
-
-
3
2,8
7
-
1
-
1
2
1,9
8
-
1
-
-
1
0,9
9
-
-
1
-
1
0,9
10
1
-
-
-
1
0,9
95
Edyta Bauer, Justyna Żychlińska–Buczek, Michał Rozmus
Zaobserwowano, że płeć urodzonych cieląt nie wpłynęła na trudność porodu. Cielęta płci żeńskiej jak i płci męskiej w takim samym
stopniu wymagały pomocy podczas porodu. Nogalski [2004] podaje, że trudne porody występują na ogół przy wyższej niż przeciętna
masa ciała rodzących się buhajków. Podobnie twierdzili Brzozowski
i in. [1998] oraz Dejneka i Twardoń [2008].
Sezon wycielenia nie miał istotnego wpływu na przebieg porodu
(tab. 2), chociaż jak podają
Jankowska i in [2005] że sezon zimowy nie sprzyja łatwym wycieleniom. Potwierdzają to również badania przeprowadzone przez
Steinbock i in. [2003].
Wiele badań wskazuje na istotną zależność między cechami budowy bydła a przebiegiem porodu. Według Krysiaka [1987] u krów,
występuje skomplikowany przebieg osi miednicy, wyznaczający drogę płodu podczas porodu. W swoich badaniach Nogalski i in. [2001]
oraz Nogalski [2007] stwierdzili, że u jałówek, u których powierzchnia kanału miednicy przy wycieleniu nie przekraczała 280 cm2
porody klasyfikowane jako ciężkie i bardzo ciężkie stanowiły ponad
50%. Wyniki wielu badań wskazują, że u krów o zadzie spadzistym
i szerokim przebieg porodu jest znacznie łatwiejszy[Brzozowski
2002]. Zbyt spadzista budowa jest niepożądana z tego względu, iż
sprzyja częstszemu wypadaniu pochwy i macicy [Brzozowski 2002].
STWIERDZENIA I WNIOSKI
W analizowanej populacji (100%), porody łatwe stanowiły 64%,
a porody trudne – 12,2%. Trudne porody spowodowane były głównie przez pośladkowe położenie, proste ustawienie zadu i płeć cielęcia. Największy wpływ na łatwość wycielenia wywarło położenie
płodu, masa i płeć cielęcia. Stwierdzono również wysoce istotną zależność między łatwością wycielenia a ustawieniem zadu oraz liczbą
urodzonych cieląt. Przeprowadzone obserwacje potwierdzają, że
w przypadku mlecznego użytkowania krów przebieg porodu ma istotne dla dobrostanu i wyników produkcyjnych znaczenie w hodowli.
96
Czynniki wpływające na przebieg porodu u krów ras mlecznych
LITERATURA
Brzozowski P., Reklewska B., Zdziarski K. 1998. Zależność między przebiegiem
porodów a wymiarami ciała cieląt pochodzących z krzyżowania rotacyjnego.
Prace i materiały zootechniczne, 52; 61 – 70.
Brzozowski P. 2002. Ewolucja oceny typu i budowy bydła mlecznego w Polsce.
Zeszyty Naukowe Przeglądu Hodowlanego, 66; 15 – 32.
Dejneka G.J., Twardoń J. 2008. Wpływ przebiegu porodu na śmiertelność
cieląt. Materiały konferencyjne. Noworodek a Środowisko. cz. 4, Problemy cieląt i krów. UP, Wrocław.
Jankowska M., Sawa A., Neulitz J. 2005. Wpływ wybranych czynników na
przebieg porodu i zachorowalność krów. Roczniki naukowe PTZ, 1; 205
– 211.
Krysiak K. 1987. Anatomia zwierząt. PWN, Warszawa.
Nogalski Z., Klupczyński J., Miciński J. 2001. Próba określenia zależności
między przebiegiem pierwszego porodu a wymiarami miednic u krów. Roczniki naukowe PTZ, 59; 173 – 180.
Nogalski Z. 2004. Zootechniczne uwarunkowania jakości porodu jałówek i krów
czarno ­białych. Rozprawy i monografie, UWM, Olsztyn.
Nogalski Z. 2007. Ciężkie porody. Hoduj z głową – Bydło, 6 (30); 18 – 24.
Philipsson J. 1976. Studies on calving difficulty, stillbirth and associated factors
in Swedish cattle breeds. Acta agriculture scandinavica, 26; 165 – 173.
Steinbock L., Nasholm A., Berglund B., Philipsson J. 2003. Genetic effects on
stillbirth and calving difficulty in swedishholstein at first and second calving. American Dairy Science Association, 2228 – 2235.
Tyczka J., Hibner A., Sakowski T., Nowakowski P. 1998. Konsekwencje doskonalenia krów w typie mlecznym na cechę „zawieszenie tylne wymienia”.
Zeszyty Naukowe Przeglądu Hodowlanego, 5; 14 – 17.
Wójcik P., Zając-Mazur M. 2006. Wpływ systemu utrzymania na wybrane parametry płodności, oceny budowy i przyczyny brakowania krów rasy phf odmiany czarno­białej. Roczniki Naukowe PTZ, 4; 35 – 41.
Wójcik P., Kruk M. 2008. Analiza zmian kąta ustawienia zadu na podstawie pomiarów zoometrycznych i ich wpływ na przebieg porodu u krów rasy polskiej
holsztyńsko fryzyjskiej odmiany czarno­białej. Roczniki naukowe PTZ, 3;
221 – 231.
97
Edyta Bauer, Justyna Żychlińska–Buczek, Michał Rozmus
Adres do korespondencji:
Edyta Bauer
Katedra Genetyki i Metod Doskonalenia Zwierząt
Uniwersytet Rolniczy w Krakowie
Al. A. Mickiewicza 24, 31­120 Kraków
98
Karolina Bierowiec
Krzysztof Rypuła
Katarzyna Płoneczka-Janeczko
EPISTEME
22/2014, t. I
s. 99-105
ISSN 1895-2241
EPIDEMIOLOGIA STAPHYLOCOCCUS AUREUS
U KOTÓW WE WROCŁAWIU
EPIDEMIOLOGY OF STAPHYLOCOCCUS AUREUS
IN CATS FROM WROCŁAW
Abstrakt. Zwierzęta mogą być zakażone lub mogą być nosicielami szczepów metycylinoopornych (MRSA). Może mieć to wpływ na ich zdrowie
oraz stanowią one potencjalne źródło patogenu dla człowieka. Badanie
miało na celu określenie częstotliwości występowania Staphylococcus aureus u kotów utrzymywanych w domu oraz analizę wybranych czynników
ryzyka. Wymazy pobierano z nosa, worków spojówkowych, skóry i odbytu. Dodatkowo właściciele byli proszeni o wypełnienie ankiety dotyczącej
danych demograficznych i epidemiologicznych odnoszących się do transmisji gronkowca. Od 200 kotów pobrano łącznie 800 wymazów, a wyizolowano 51 izolaty Staphylococcus aureus. W sześciu szczepach potwierdzono
obecność genu mecA. Wykazanie obecności szczepów MRSA wśród kotów
wskazuje na ich znaczenie jako potencjalne źródło lub wektor szczepów
MRSA dla ludzi.
Słowa klucze: Staphylococcus aureus, MRSA, kot
Summary. Animals may be contaminated, colonized or infected with
MRSA, with implications for their health and as potential reservoir of
the pathogen for humans. The study was designed to investigate the prevalence of the Staphylococcus aureus in cats kept only in households and
determination of colonization risk factors. Swabs were taken from nares,
conjunctival sacs, skin and anus from each animal. Additionally the owners
were asked to fill out survey of demographic and epidemiological data, relevant to staphylococcus transmission and examined cat. A total of 51 Staphylococcus aureus isolates were identified from 800 swabs samples, which
were obtained from 200 cats. In the six of the Staphylococcus aureus strains
presence of mecA gene were confirmed. The recognition of MRSA carriers
among pets has shown their role as potential reservoir or vectors for human
MRSA infection in the community.
Key words: Staphylococcus aureus, MRSA, cat
99
Karolina Bierowiec, Krzysztof Rypuła, Katarzyna Płoneczka-Janeczko
Wstęp:
Gronkowiec złocisty to powszechnie znany patogen zarówno ludzi jak
i zwierząt. Bakteria ta jest przyczyną wielu rożnych chorób, począwszy
od łagodnych zakażeń skóry po ciężkie bakteriemie [Leonard i Markey 2008]. Od drugiej połowy XX wieku metycylinooporne szczepy
Staphylococcus aureus (MRSA) stanowią jedną z głównych przyczyn
zakażeń szpitalnych, tzw. szczepy HA-MRSA (hospital-asocciated
MRSA). Również u zdrowych osób, niezwiązanych ze środowiskiem
szpitalnym, obserwuje się nosicielstwo szczepów MRSA, są to szczepy
CA-MRSA (community-associated MRSA) [Wan i in. 2011]. U zwierząt metycylinooporne szczepy gronkowca złocistego wyizolowano po
raz pierwszy w latach 70-tych [Devriese i in. 1972]. Od tego czasu,
zarówno u zwierząt gospodarskich jak i towarzyszących potwierdzono wiele przypadków bezobjawowego nosicielstwa tego patogenu.
Niemniej jednak możliwość transmisji gronkowca pomiędzy ludźmi
a zwierzętami jest zagadnieniem wciąż stosunkowo słabo poznanym
[Heller i in. 2010]. Powszechnie utrzymuje się opinia, że bardziej narażone na występowanie nosicielstwa lub zakażeń wywoływanych
przez gronkowca złocistego są zwierzęta, których właściciele na co
dzień mają kontakt ze środowiskiem szpitalnym lub zakładami leczniczymi dla zwierząt [Soares Magalhães i in. 2010]. U ludzi wykazano zależność między miejscem pracy, a zwiększonym ryzykiem
kolonizacji przez Staphylococcus aureus [Kottler i in. 2010]. Mogłoby
to wskazywać, że analogicznie ryzyko może wystąpić u ich zwierząt.
Nie wykazano jednak jak dotąd związku pomiędzy częstotliwością
izolacji szczepów gronkowca złocistego od zwierząt towarzyszących
a miejscem pracy ich właściciela [Soares Magalhães i in. 2010].
Celem pracy było określenie częstotliwości występowania
gronkowca złocistego u zdrowych kotów z terenu Wrocławia oraz
analiza wybranych czynników ryzyka związanych z nosicielstwem
gronkowca u badanych zwierząt.
Materiał i metody:
Badaniem objęto 200 kotów pochodzących z terenu Wrocławia.
Wszystkie badane zwierzęta były klinicznie zdrowe w dniu pobierania materiału oraz były utrzymywane tylko w jednym środowisku
100
Epidemiologia staphylococcus aureus u kotów we wrocławiu
tzw. koty nie wychodzące z domu. Od każdego kota sterylnymi
wymazówkami pobierano cztery wymazy: z worka spojówkowego, nozdrzy, skóry (okolica pachwiny) i z odbytu. Dodatkowo, odnośnie każdego kota, właściciel wypełniał ankietę dotyczącą cech
osobniczych zwierzęcia (rasa, płeć, wiek) oraz wybranych czynników
ryzyka nosicielstwa gronkowca złocistego u badanego kota. Pytania
ankietowe przedstawia tab.
1. Pobrany materiał poddawano 24-godzinnej inkubacji w bulionie
z dodatkiem wyciągu mózgowo-sercowego (BHI), a następnie przesiewano na podłoże wybiórczo-różnicujące dla gronkowców (pożywka
Chapmana). Na podstawie badania bakteriologicznego klasyfikowano wstępnie izolowane szczepy jako rodzaj Staphylococcus spp. i z nich
izolowano DNA do dalszych analiz.
Przeprowadzając reakcję łańcuchową polimerazy (PCR)
potwierdzano przynależność uzyskanych izolatów do gatunku Staphylococcus aureus. W reakcji wykorzystano startery dla genu nuc
opisane przez Martin i wsp. 2006. Dodatkowo zidentyfikowane szczepy Staphylococcus aureus poddawano reakcji PCR w celu wykazania
obecności genu mecA świadczącego o metycilinooporności takiego
szczepu [Xu i in.2012].
Uzyskane wyniki oraz dane pochodzące z badania ankietowego
analizowano testem Chi-kwadrat, przy użyciu oprogramowania StatSoft Inc. 2011. Za istotne statystycznie uznano wyniki, gdy P<0,05.
Wyniki:
Wyizolowano i potwierdzono przynależność gatunkową 51 szczepów
Staphylococcus aureus. Od 11 kotów izolowano więcej niż jeden szczep gronkowca złocistego. Metodą PCR potwierdzono obecność genu
mecA w sześciu szczepach. Prewalencja gronkowca złocistego w przebadanej grupie kotów, biorąc pod uwagę wszystkie miejsca izolacji
szczepów, wyniosła 20%, a dla szczepów MRSA 3%. Szczegółowe
dane dotyczące liczby izolowanych szczepów w zależności od miejsca
pobrania materiału zawarto w tab. 2.
Znaleziono zależność pomiędzy izolacją gronkowca złocistego z
różnych miejsc pobrania. Gronkowiec częściej był izolowany równoc101
Karolina Bierowiec, Krzysztof Rypuła, Katarzyna Płoneczka-Janeczko
ześnie z worka spojówkowego i ze skóry (p=0,0155) oraz z worka spojówkowego i z nozdrzy (p=0,002). Nie potwierdzono natomiast statystycznej zależności między występowaniem nosicielstwa
gronkowca złocistego u kotów, a pracą właściciela w tzw. grupie
ryzyka (służba zdrowia, zakład leczniczy dla zwierząt). Szczegółowe
dane dotyczące analizy pytań ankietowych znajdują się w tab. 1.
Tab. 1. Analiza badania ankietowego
PYTANIE:
p/n
P
1. Czy którykolwiek z domowników pracuje w służbie
zdrowia?
8/32
0,44
2. Czy którykolwiek z domowników pracuje w zakład12/46
zie leczniczym dla zwierząt?
0,96
3. Czy którykolwiek z domowników w przeciągu ostatniego roku był hospitalizowany?
5/39
0,211
4. Czy u badanego kota w przeciągu ostatniego roku
w badaniu laboratoryjnym potwierdzono obecność
gronkowca złocistego?
4/6
5. Czy kot w przeciągu ostatniego roku był leczony?
0,017
2
0,078
17/62
7
p – wyniki pozytywne wśród kotów (potwierdzona obecność Staphylococcus
aureus)
n- liczba osób odpowiadająca pozytywnie w badaniu ankietowym
P – statystyczna istotność wyniku
Tab. 2. Liczba i rodzaj izolowanych szczepów w zależności od miejsca
pobrania materiału.
Miejsce pobrania
n
MSSA
MRSA
Worek
spojówkowy
12
11
1
Nozdrza
23
21
2
Skóra
12
10
2
Odbyt
4
3
1
102
Epidemiologia staphylococcus aureus u kotów we wrocławiu
Dyskusja i wnioski:
Rozpowszechnienie Staphylococcus aureus w przebadanej grupie
kotów wyniosło 20%. Uzyskany wynik był wyższy w porównaniu z podobnymi badaniami przeprowadzonymi na świecie. W Stanach Zjednoczonych w grupie klinicznie zdrowych kotów prewalencja wyniosła
7,59%, a u kotów chorych 24,58%. Porównując materiał pobrany
z różnych okolic ciała (skóra - pachwina oraz czoło, jama nosowa, jama
ustna, odbyt), u zdrowych kotów izolowano szczepy MRSA najczęściej ze skóry, a u kotów z zapaleniem skóry z jamy nosowej [Abraham
i in. 2007]. W Irlandii wykazano nosicielstwo gronkowca złocistego
u 0,7% zdrowych kotów [Abbot i in. 2010]. Badania europejskie wskazują na obecność metycylinoopornych szczepów gronkowca złocistego u 2,1% kotów [Loeffler i in. 2010].
W omawianym badaniu własnym, biorąc pod uwagę tylko jedno
miejsce pobraniamateriału (nozdrza), ustalono prawie dwukrotnie
niższą częstość występowania patogenu, niż w przypadku analizy
wykonanej na podstawie danych z czterech miejsc pobrania. Jest
to ważne spostrzeżenie, które wskazuje na ryzyko braku uzyskania
obiektywnych wyników w przypadku planowania podobnych badań.
Podobne wyniki uzyskał Kottler i in. 2010. przy pobieraniu materiału z dwóch miejsc (nos i odbyt).
U psów i kotów wykazano, że czynnikami sprzyjającymi kolonizacji gronkowcem złocistym są: większa liczba kuracji antybiotykowych, dłuższy czas przebywania w lecznicy oraz zabiegi chirurgiczne [Soares Magalhães i in. 2010]. W omawianym badaniu analizowano wpływ m.in. zawodu właściciela na prawdopodobieństwo
występowania gronkowca złocistego również u jego zwierzęcia. Nie
potwierdzono jednak tego zjawiska. Również w podobnych badaniach nie wykazano związku pomiędzy częstotliwością izolacji szczepów
gronkowca złocistego od zwierząt towarzyszących, a miejscem pracy
ich właściciela [Kotltler i in. 2010, Soares Magalhães i in. 2010].
Obecnie w Polsce, poza niektórymi środowiskami szpitalnymi,
nie prowadzi się rutynowych badań nad rozpowszechnieniem szczepów MRSA u zdrowych ludzi, a tym bardziej u zwierząt towarzyszących. Ponieważ wielolekooporne szczepy Staphylococcus aureus
stanowią zagrożenie dla zdrowia publicznego oraz sprawiają duże
problemy terapeutyczne, zarówno u ludzi, jak i u zwierząt, bardzo
103
Karolina Bierowiec, Krzysztof Rypuła, Katarzyna Płoneczka-Janeczko
ważna jest identyfikacja oraz charakterystyka epidemiologiczna
wszystkich potencjalnych źródeł tego patogenu.
literatura:
Abbot Y., Leggett B., Rossney A. S., Leonard F. C., Markey B. K. 2010. Isolation rates of methicillin-resistant Staphylococcus aureus in dogs, cats and
horses in Irland. Veterinary Record 166:451-455.
Abraham J. L., Morris D. O., Griffeth G. C., Shofer F. S., Ranin S. C. 2007.
Surveillance of healthy cats and cats with inflammatory skin disease for
colonization of the skin by methicillin-resistant coagulase-positive staphylococci and Staphylococcus schleiferi spp. Schlerferi. Veterinary Dermatology 18:252-259.
Devriese L. A., Vandamme L. R., Fameree L. 1972: Methicillin 9cloxacillin)resistant Staphylococcus aurues strains isolated from bovine mastitis cases.
Zentralblatt fur Veterinarmedizin Riehe 19: 598-605.
Heller J., Kelly L., Reid S. W. J., Mellor D.J. 2010: Qualitative risk assessment
of the acquisition of methicillin-resistant Staphylococcus aureus in pet dogs.
Risk Analysis 30: 458-468.
Kottler S., Middleton J. R., Perry J., Weese J.S., Cohn L. A. 2010: Prevalence
of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus
carriage in three populations. Journal of Veteterinary Internal Mededicine 24: 132-139.
Leonard F. C., Markey B. K. 2008: Meticillin-resistant Staphylococcus aureus in
Animals: a review. The Veterinary Journal 175: 27-36.
Loeffler A., Pfeiffer D. U., Lindsay J. A., Magalhães R. J., Lloyd D.H. 2010:
Prevalence of and risk factors for MRSA carriage in companion animals:
a survey of dogs, cats and horses. Epidemiology and Infection 14: 1-10.
Martin B., Garriga M., Hugas M., Bover-Cid S., Veciana-Nogués M.T., Aymerich T. 2006. Molecular, Technological and safety characterization of Grampositive cocci from slightly fermented sausages. International Journal of
Food Microbiology 107:148-158.
Soares Magalhães R. J., Loeffer A., Lindsay J., Rich M., Roberts L., Smith H.,
Lloyd D.H., Pfeiffer D. U. 2010: Risk factors for methicillin-resistant Staphylococcus aureus (MRSA) infection in dogs and cats: a case-control study.
Veterinary Record 4: 55.
Wan M. T., Fu S. Y., Lo Y.P., Huang T. M., Cheng M. M., Chou C. C. 2011: Heterogenity and phylogenetic relationships of community-associated methicillin-sensitive/resistant Staphylococcus aureus isolates in healthy dogs,
cats and owners. Journal of Applied Microbiology 112: 205-213.
104
Epidemiologia staphylococcus aureus u kotów we wrocławiu
Xu B., Liu L., Li X., Li X., Wang X. 2012. A muliplex PCR assai for the rapid
and sesitive detection of methicillin-reusistant Staphylococcus aureus and
simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. Journal of Food Science 77:638-642.
Adres do korespondencji:
lek. wet. Karolina Bierowiec
Zakład Chorób Zakaźnych Zwierząt i Administracji Weterynaryjnej
Katedra Epizootiologii z Klinika Ptaków i Zwierząt Egzotycznych
Wydział Medycyny Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
Zadanie współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego
105
Michał Błasiaki
Agnieszka Banyśii
Opiekun naukowy: dr hab. inż. Edyta Molik
EPISTEME
22/2014, t. I
s. 107-113
ISSN 1895-2241
ROLA GRELINY W REGULACJI SEKRECJI
PROLAKTYNY U OWIEC – BADANIA IN VITRO
THE ROLE OF GHRELIN IN THE REGULATION
OF PROLACTIN SECRETION IN SHEEP
– IN VITRO STUDIES
Abstrakt. Proces zapoczątkowania i utrzymania laktacji u owiec wymaga
obecności wielu hormonów. Celem przeprowadzonych badań było określenie roli greliny w regulacji sekrecji prolaktyny u owiec laktujących, w oparciu
o hodowlę iv vitro przysadek. Badania przeprowadzono w maju - w okresie dnia długiego (L14:D10). Przysadki pobrano od 10 polskich owiec długowełnistych w 30 dniu laktacji i podzielono wzdłuż bruzdy podłużnej tak,
aby każda połowa zawierała część gruczołową i nerwową. Inkubacje in vitro
przysadek prowadzono na 12 dołkowych płytkach przez 3 godziny w temperaturze 37°C. Przysadki z grupy kontrolnej były inkubowane w czystym
podłożu Parkera, natomiast te z grupy doświadczalnej w podłożu wzbogaconym egzogenną greliną. Stężenie prolaktyny w podłożu oznaczono
metodą radioimmunologiczną. Przeprowadzone badania wskazują na modulujące działanie greliny na sekrecję prolaktyny z przysadek mózgowych
owiec w okresie laktacji
Słowa kluczowe: grelina, prolaktyna, laktacja, in vitro badania
Summary. The process of initiation and maintenance of lactation in sheep
requires the presence of a number of hormones. The aim of this study was
to determine the role of ghrelin in the regulation of prolactin secretion in
lactating sheep, based on in vitro incubation of pituitaries. The study was
conducted in May - long-day period (L14:D10). Pituitary were collected
from 10 Polish Longwool Sheep on day 30 of lactation, and divided along
the longitudinal grooves so that each half contained half of the adenohypophysis as well as neurohypophysia. Incubations were carried out in 12 well
plates for 3 hours at 37 ° C. The control group was incubated in a clean Parker medium, and experimental in medium supplemented with exogenous
ghrelin. The concentration of prolactin in the medium were determined by
RIA method. The study showed modulated effect of ghrelin on the secretion
of prolactin from the sheep pituitaries gland.
Key words: ghrelin, prolactin, lactation, in vitro study
107
Michał Błasiaki, Agnieszka Banyśii
Wstęp
Rozwój gruczołu mlekowego stymulowany jest głownie przez prolaktynę (PRL), hormon wzrostu (GH), hormony steroidowe, hormony kory nadnerczy ora glikokortykoidy. U wszystkich ssaków
rozwój gruczołu mlekowego rozpoczyna się już w stadium embrionalnym i płodowym. Następuje wtedy formowanie zawiązków
gruczołu, rozwój brodawek sutkowych i przewodów mlekonośnych
oraz wzrost tkanki łącznej i tłuszczowej. U dojrzałych samic cykl
laktacji można podzielić na następujące etapy: mammogenezę, laktogenezę, galaktopoezę oraz inwolucję. Każdy z wymienionych etapów podlega ścisłej kontroli hormonalnej [Neville i in. 2002]. Hormony te można podzielić na trzy grupy. 1) hormony reprodukcyjne:
estrogen, gestageny, laktogen łożyskowy, prolaktyna i oksytocyna:
2) hormony metaboliczne: hormon wzrostu (ang. growth hormone,
GH) (możliwe działanie bezpośrednie lub za pośrednictwem IGF-1),
kortykosteroidy, hormony tarczycy, insulina oraz hormony tkankowe przewodu pokarmowego przewodu pokarmowego: 3) hormony
produkowane miejscowo, takie jak GH, PRL, peptyd PTH-podobny (ang. parathyroid hormone-related protein, PTHrP) oraz leptyna.
Przez cały okres ciąży proliferacja nabłonka gruczołu mlecznego jest
zależna od estrogenów i progesteronu. Proces inwolucji obejmuje regresję gruczołu mlekowego po zakończeniu laktacji. Wówczas utrata
komórek nabłonkowych wymienia na drodze apoptozy jest związana
ze zmniejszeniem poziomu PRL, GH oraz IGF-I. Prolaktyna wykazuje działanie ogólnoustrojowe oddziałując na przebieg laktacji, gospodarkę wodno-elektrolitową, rozwój i wzrost, metabolizm, wydzielanie wewnętrzne, odporność oraz układ nerwowy i rozród. Szerokie
spektrum działania prolaktyny jest prawdopodobnie spowodowane
istnieniem kilku izoform jej receptora (PRLR) oraz zdolnością PRL
do aktywacji licznych szlaków sygnałowych [Dusza i in. 2007]. Grelina jest hormonem neuropeptydowym, którego najlepiej poznaną
funkcją jest regulacja apetytu. Obwodowa grelina ma wpływ na metabolizm tkanki tłuszczowej i sprzyja występowaniu otyłości poprzez SSS (ang. melanocortin-sympathetic nervous system pathway).
W prowadzonych dotychczas badaniach wykazano, że grelina wpływa
stymulująco na wydzielanie prolaktyny [Kędzia i Przybyszewska
2007]. Inne badania wykazały jednak hamujący wpływ greliny na
108
Rola greliny w regulacji sekrecji prolaktyny u owiec...
sekrecję PRL [Dusza i in. 2007]. Celem przeprowadzonych badań
było określenie roli greliny w regulacji sekrecji prolaktyny z przysadek mózgowych laktujacych owiec, w systemie inkubacji iv vitro.
Materiał i metody
Badania przeprowadzono w Pracowni Biotechnologii i Genomiki, Katedry Hodowli Trzody Chlewnej i Małych Przeżuwaczy, Uniwersytetu Rolniczego w Krakowie (Bielany) na 10 sztukach maciorek polskich owiec
długowełnistych. Owce przeznaczone do doświadczenia były wyrównane pod względem masy ciała (65±5 kg) i były w 3 i 4 laktacji, Doświadczenie przeprowadzono w maju w okresie długiego dnia (L14:D10).
Ze względu na sezonowość rozrodu owiec długowełnistych, w celu
pozyskania przysadek w 30 dniu laktacji, u matek przeprowadzono
synchronizację cyklu rujowego przy użyciu gestagenów metodą Chronogest. Gąbki poliuretanowe nasycone 40 mg preparatu cronolone
(Intervet, Holandia) wprowadzano owcom dopochwowo na 14 dni.
W dniu wyjęcia gąbek maciorkom podawano 500 j.m. PMSG (Serogonadotropin, Biowet, Drwalew). Ruja występowała 48-72 godzin
po podaniu preparatu, a czas jej trwania kontrolowano dodatkowo
trykiem próbnikiem. Stanówkę przeprowadzono w listopadzie. Do
krycia naturalnego użyto tryków rasy polska owca długowełnista
o masie ciała (80 ± 5kg). Maciorki wykociły się pomiędzy 1-5 kwietnia. W okresie karmienia jagniąt owce żywiono system tradycyjnym
zgodnym z Normami opracowanymi przez IZ. Po odchowaniu jagniąt
do wieku 30 dni przeprowadzono uboje matek. Na 12 godzin przed
ubojem owce były głodzone. Pobrane przysadki dzielono wzdłuż
bruzdy podłużnej na dwie połowy tak, aby każda zawierała część
gruczołową i nerwową. Inkubację in vitro prowadzono na płytkach
12 dołkowych (cells culture firmy Sigma) przez 3 godziny w podłożu
Parkera w temp. 37˚C. Jedna połowa przysadki była inkubowana
w czystym podłożu Parkera (kontrola), natomiast druga, doświadczalna, w roztworze podłoża Parkera wzbogaconym egzogenną greliną (100 ng/ml). Owcza grelina została zakupiona w laboratorium
Poly Peptide Laboratories (Strasbourg, France). Inkubacja przez
pierwsze 15 minut została określona jako próba zerowa, w tym czasie
obydwie części przysadki, doświadczalna, jak i kontrolna, przebywały
109
Michał Błasiaki, Agnieszka Banyśii
w czystej pożywce, w celu ustabilizowania funkcji wydzielniczych
komórek. Po upływie kolejnych 15 minutowych okresów inkubacji
pobierano i podawano 1 ml podłoża z każdej inkubowanej połowy
przysadki. Oznaczanie stężenia prolaktyny w podłożu wykonano
w Zakładzie Endokrynologii IFiŻZ PAN w Jabłonnie metodą radioimmunologiczną (RIA) opisaną przez Kokota i Stupnickiego (1985).
Uzyskane wyniki poddano analizie statystycznej przy użyciu programu SAS wykorzystując jednoczynnikową analizę wariancji oraz Test
Scheffe’go.
Wyniki i dyskusja
Przeprowadzone badania wykazały, że dodatek greliny do medium
inkubacyjnego spowodowało istotny (przy P≤0,05) wzrost sekrecji
prolaktyny w 30 minucie inkubacji w grupie doświadczalnej (89,6
± 18,1 mg/ml) w porównaniu z grupą kontrolną (73,6 ± 17,4 mg/
ml). Po 45 minutach inkubacji, stężenie prolaktyny w grupie doświadczalnej było istotnie (przy P≤0,05) niższe niż w grupie kontrolnej
i wynosiło odpowiednio (69 ± 15,2 mg/ml oraz 77,2 ± 17,6 mg/ml).
Po 60 minutach zanotowano istotnie niższe (przy P≤0,05) stężenie
prolaktyny (46,3 ± 8,4 mg/ml) w grupie doświadczalnej niż w grupie
kontrolnej (51,8 ± 9,6 mg/ml) (Ryc.1).
Ryc. 1. Wpływ greliny na stężenie prolaktyny w pierwszej godzinie
inkubacji, * - średnie różnią się w pobraniach przy P≤0,05
Podczas drugiej godziny inkubacji istotny (P≤0,05) wzrost
sekrecji prolaktyny nastąpił tylko w 45 minucie i wynosił w grupie
doświadczalnej (31,5 ± 8,4 mg/ml), a w grupie kontrolnej (25,8 ± 7,6
mg/ml) (Ryc.2).
110
Rola greliny w regulacji sekrecji prolaktyny u owiec...
Ryc. 2. Wpływ greliny na stężenie prolaktyny w drugiej godzinie inkubacji
* - średnie różnią się w pobraniach przy P≤0,05
Podczas trzeciej godziny inkubacji zmiany w poziomie prolaktyny były statystycznie nieistotne (Ryc. 3).
Ryc. 3. Wpływ greliny na stężenie prolaktyny w trzeciej godzinie inkubacji
Uzyskane wyniki badań wskazują na modulujące działanie greliny
na sekrecję prolaktyny. W pierwszej i drugiej godzinie inkubacji obserwowano zarówno wzrost sekrecji prolaktyny jak i obniżenie jej poziomu w grupie doświadczalnej. Tak więc podanie egzogennej greliny
w okresie fizjologiczne wysokiego stężenia prolaktyny u laktujących
owiec nie przyniosło jednoznacznej odpowiedzi czy grelina stymuluje sekrecję prolaktyny, czy też wykazuje działanie hamujące. Badania
przeprowadzone na ludziach wykazały, że grelina stymuluje wydzielanie prolaktyny. Podanie egzogennej greliny kobietom spowodowało natychmiastowy wzrost stężenia PRL w osoczu krwi [Messini
i in. 2010]. Potwierdzono również stymulujące działanie greliny na
sekrecje prolaktyny u samic szczurów karłowatych. [Carmignac i in.
111
Michał Błasiaki, Agnieszka Banyśii
1998]. U samców wykazano hamujące działanie greliny na sekrecje
prolaktyny [Kaya i in. 2004]. Riley i wsp. w 2002 wykazali, że podanie szczurzej greliny rybom z gatunku Tilapia, stymuluje sekrecję
prolaktyny in vitro. Nie wykazano natomiast jakiegokolwiek wpływu
greliny na ekspresję mRNA genu prolaktyny.
Uzyskane dotychczas wyniki badań wykazały, że oddziaływanie
greliny na uwalnianie prolaktyny może być zależne od gatunku zwierząt. W przypadku owiec - zwierząt sezonalnych, podanie egzogennej
greliny w okresie laktacji modulowało sekrecję prolaktyny.
Wnioski
Przeprowadzone badania wskazują na modulujące działanie greliny
na in vitro sekrecję prolaktyny z przysadek mózgowych owiec w okresie laktacji.
Efekt oddziaływania greliny na sekrecje prolaktyny jest zależny
od czasu inkubacji komórek.
Bibliografia
Carmignac D. F. Bennett P. A. Robinson I. C. A. F. 1998. Effects of growth
hormone secretagogues on prolactin release in anesthetized dwarf (dw/dw)
rats. Endocrinology, 139: 3590 – 3596.
Dusza L. Ciereszko R. Krzymowski T. 2007. Biologia rozrodu zwierząt. Fizjologiczne regulacje procesów rozrodczych samicy. Wydawnictwo UWM,
Olsztyn,ss. 95 – 131.
Kaiya H. Kojima M. Hosoda H. Koda A. Yamamoto K. Kitajima Y. Matsumoto M. Minamitake Y. Kikuyama S. Kangawa K. 2001. Bullfrog ghrelin is
modified by n-octanoid acid at its third threonine residue. The Journal of
Biological Chemistry, 276: 40441 – 40448.
Kędzia A. Przybyszewska W. 2007. Grelina – nowy hormon zaangażowany
w regulację wzrastania i homeostazę metaboliczną ustroju. Endokrynologia Pediatryczna, 6: 53 – 60.
Kokot F., Stupnicki R. 1985. Metody radioimmunologiczne i radiokompetycyjne
stosowane w klinice. PZWL, Warszawa 1985.
Messini C. I. Dafopoulos K. Chalvatzas N. Georgoulias P. Anifandis G. Messinis I. E. 2010. Effect of ghrelin and thyrotropin-releasing hormone on
prolactin secretion in normal women. Hormone and Metabolic Research,
42: 204 – 208.
112
Rola greliny w regulacji sekrecji prolaktyny u owiec...
Neville M. C. McFadden T. B. Forsyth I. 2002. Hormonal regulation of
mammary differentiation and milk secretion. Journal of Mammary Gland
Biology and Neoplasia, 7: 17 – 38.
Riley L. G. Hirano T. Grau E. G. 2002. Rat ghrelin stimulates growth hormone
and prolactine release in the tilapia, Oreochromis mossambicus. Zoological Science, 19: 797 – 800.
Adres do korespondencji:
mgr inż. Michał Błasiak
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
mgr inż. Agnieszka Banyś
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
dr hab. inż. Edyta Molik
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
dr hab. inż. Edyta Molik
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
113
Angelika Borowska
Jacek Maślanka
Anna Adamik
Opiekun naukowy: prof. dr hab. Bogusław Bobek
EPISTEME
22/2014, t. I
s. 115-121
ISSN 1895-2241
OCENA WYSTĘPOWANIA I ZAGĘSZCZENIA
PUSZCZYKA ZWYCZAJNEGO STRIX ALUCO
I PUSZCZYKA URALSKIEGO STRIX URALENSIS
W PUSZCZY NIEPOŁOMICKIEJ
THE EVALUATION OF OCCURRENCE AND DENSITY
OF THE TAWNY OWL STRIX ALUCO
AND THE URAL OWL STRIX URALENSIS
IN THE NIEPOŁOMICE FOREST
Abstrakt. Na terenie Puszczy Niepołomickiej metodą stymulacji głosowej
przeprowadzono badania dotyczące występowania i liczebności puszczyka
zwyczajnego (Strix aluco) oraz puszczyka uralskiego (Strix uralensis). W 2009
roku (kwiecień, maj, listopad) i w 2010 roku (marzec, kwiecień) przejazdów
i wabienia sów dokonywano na liniowych transektach, których długość
wynosiła 16 km w kompleksie Głównym Puszczy i 7,2 km w Kompleksie
Grobla. W 2012 roku (marzec) i w 2013 roku (marzec, maj) obserwacje
badanych gatunków sów wykonywano podczas przejazdów na trasie
29,2 km w Kompleksie Południowym Puszczy i 12,5 km na terenie kompleksów leśnych Koło, Grobla i Grobelczyk. W wyniku badań stwierdzono
zróżnicowane zagęszczenie obydwu gatunków sów w zależności od typów
siedliskowych lasu. W kompleksach Koło, Grobla i Grobelczyk, gdzie dominował las wilgotny średnie zagęszczenie puszczyków zwyczajnych wynosiło
1,02 osobników/ km transektu a puszczyków uralskich 0,51 osobników/
km transektu. W południowym kompleksie Puszczy, gdzie dominował bór
mieszany wilgotny, średnie zagęszczenie puszczyka zwyczajnego wynosiło
0,40 osobników/ km transektu a puszczyka uralskiego 0,29 osobników/ km
transektu.
Słowa kluczowe: zagęszczenie populacji, stymulacja głosowa, typy siedliskowe lasu.
Summary. Using method of the vocal stimulation, occurence of the Tawny
Owl (Strix aluco) and the Ural Owl (Strix uralensis) were studied in Niepołomicka Forest during 4 years (2009-2013) presence of birds were recorded
115
Angelika Borowska, Jacek Maślanka, Anna Adamik
along line transects in April-May, November (2009), March-April (2010),
in March (2012) and in March-May (2013). During night sessions 38 the
Tawny Owls and 23 the Ural Owls was registered. Relative population density showed higher density of Tawny Owl in deciduous forest Tilio-Carpinetum than in mixed coniferous forest Pino-Quercetum (1,02 vs. 0,40 individuals per 1 km of line transects). For the Ural Owl similar trend was found.
Higher population density was found in deciduous forest than in coniferous
forest (0,51 vs. 0,29 individuals per 1 km of line transect).
Key words: population density, vocal stimulation, forest types.
Wstęp
Wyniki badań przeprowadzonych na terenie Puszczy Niepołomickiej
w latach 1970-1980 wskazywały na liczne występowanie puszczyka
zwyczajnego (Strix aluco). Stwierdzono wówczas 5–10 par/ 10 km2
powierzchni [Głowaciński 1975, Grodziński i Wasilewski 1984].
Największe zagęszczenie lęgowych par puszczyka zwyczajnego zaobserwowano w najstarszych drzewostanach lasów liściastych kompleksu Grobla, stanowiącego północną część Puszczy Niepołomickiej
[Wasilewski 1990]. Puszczyk uralski (Strix uralensis) jest gatunkiem
borealno-górskim pochodzenia tajgowego, który w górach związany
jest przede wszystkim z buczynami. Pierwsze udokumentowane
stwierdzenia tego gatunku na terenie Puszczy pochodzą z lat 70-tych
ubiegłego wieku [Głowaciński 1975, Grodziński i Wasilewski 1984,
Ruprecht i Szwagrzak 1988]. Według Wasilewskiego (1990) i Czuchnowskiego (1993) puszczyk uralski regularnie gnieździł się na terenie kompleksu iglastego położonego w południowej części Puszczy.
Od lat 90-tych jego liczebność powoli ale systematycznie wzrasta.
Obecnie jak podaje Standardowy Formularz Danych Natura 2000 dla
„Puszczy Niepołomickiej” liczebność puszczyka uralskiego wynosi 25
– 30 par.
Celem pracy jest ocena występowania oraz względnego zagęszczenia puszczyka zwyczajnego i puszczyka uralskiego na terenie
Puszczy Niepołomickiej.
Teren badań, materiał i metody
Puszcza Niepołomicka położona jest w widłach rzek Wisły i Raby,
nieopodal granicy administracyjnej miasta Krakowa. Składa się
116
Ocena występowania i zagęszczenia puszczyka zwyczajnego strix aluco...
z czterech kompleksów leśnych o łącznej powierzchni 10,8 tys. ha.
Zasadniczy kompleks leśny, zwany potocznie „Borem” usytuowany
jest na południu Puszczy i zajmuje obszar około 8,8 tys. ha. Główne
typy siedliskowe tego kompleksu to bory mieszane wilgotne i lasy
mieszane wilgotne a w składzie gatunkowym drzew dominuje sosna
(Pinus silvestris) z domieszką brzozy brodawkowatej (Betula pendula),
dębu szypułkowego (Quercus robur) i olchy czarnej (Alnus glutinosa)
[Madwecka-Kornaś 1971, Zinkow 2009]. Trzy mniejsze kompleksy
o łącznej powierzchni 2,0 tys. ha znajdują się w północnej części
Puszczy i są to: Las Grobla o powierzchni 1,5 tys. ha oraz uroczyska
Grobelczyk i Koło o powierzchni leśnej wynoszącej odpowiednio 300
i 200 ha [Bonczar i in. 2005]. Puszcza Niepołomicka charakteryzuje
się długim okresem wegetacyjnym trwającym 220-230 dni. Średnioroczna temperatura dochodzi do 8, 2 °C, a roczna suma opadów osiąga
wartość średnio 646 mm [Niedźwiedź, Obrębska-Starklowa 1991].
Badania terenowe nad występowaniem obydwu gatunków
puszczyków prowadzone były z wykorzystaniem metody stymulacji
głosowej. Emitując głos za pomocą sprzętu do wabienia prowokowano sowy do odzywania się, a tym samym ujawnienia swojej obecności
na danym terenie [Domasiewicz i in. 1984, Mikusek 2005, Tomiałojć
1990]. Sowy wabiono przez 3-4 godziny po zapadnięciu zmroku również w okresach ich małej aktywności głosowej. Obserwacje badanych
gatunków sów wykonano w roku 2009 (kwiecień, maj, listopad),
w roku 2010 (marzec, kwiecień), w roku 2012 (marzec) oraz w roku
2013 (marzec, maj). W latach 2009 i 2010 wabienia sów dokonywano
podczas przejazdów na trasie 16 km w kompleksie Głównym Puszczy
i 7,2 km w Kompleksie Grobla. W latach 2012 i 2013 stymulację głosową tej grupy ptaków wykonano podczas przejazdów na trasie 29,2
km w Kompleksie Południowym Puszczy i 12,5 km na terenie kompleksów leśnych Koło, Grobla i Grobelczyk (Ryc. 1).
Wyniki i dyskusja
W wyniku przeprowadzonych badań nad występowaniem i liczebnością puszczyka zwyczajnego i puszczyka uralskiego w Puszczy Niepołomickiej stwierdzono łącznie 61 osobników obydwu gatunków
sów, wśród których znajdowało się 38 puszczyków zwyczajnych i 23
117
Angelika Borowska, Jacek Maślanka, Anna Adamik
puszczyków uralskich. Obliczenia dotyczące względnego zagęszczenia populacji obydwu gatunków sów wykazują znaczne zróżnicowanie
w poszczególnych latach i kompleksach leśnych. W latach 2009/10
zagęszczenia puszczyków w Kompleksie Głównym były wyższe niż
w latach 2012/13. W kompleksach Koło, Grobla i Grobelczyk również zaobserwowano wyższe zagęszczenia badanych gatunków sów
leśnych w latach 2009/2010 w porównaniu z latami 2012/2013.
Stwierdzono drastyczne różnice w zagęszczeniu puszczyka uralskiego na tym terenie pomiędzy badanymi latami. (Tab. 1.)
Ekstrapolując zebrane dane z wszystkich lat badań, przy założeniu, że są one reprezentatywne dla badanego obszaru obliczono, iż średnie zagęszczenie puszczyka zwyczajnego w Kompleksie Głównym wynosi 0,40 osobników/ km transektu a puszczyka
uralskiego 0,29 osobników/ km transektu. W kompleksach Koło,
Grobla i Grobelczyk średnie zagęszczenie puszczyka zwyczajnego
wynosi 1,02 osobników/ km transektu natomiast puszczyka uralskiego 0,51 osobników/ km transektu. Obserwacje wykazały, że obydwa
objęte monitoringiem gatunki sów częściej występują w północnej –
grądowej części Puszczy Niepołomickiej. Prawdopodobnie preferencje te mają związek z wyższymi niż w borach zagęszczeniami gryzoni
[Banaszczyk 2010, Karkula 2010] stanowiącymi podstawę diety tych
ptaków. Ponadto efekt ten można tłumaczyć występowaniem w kompleksach liściastych dużej liczby drzew dziuplastych [Bigaj i in. 2012]
oraz starych gniazd ptaków drapieżnych, które są wykorzystywane
przez puszczyki. Grądy jako siedliska suboptymalne dla sów stwarzają dogodną możliwość przystąpienia do lęgów.
Wnioski
Uzyskane wyniki są obarczone błędem powstałym z małej liczby pobranych prób. Dla ustalenia liczebności obydwu gatunków
puszczyków potrzebne są liczenia wieloletnie prowadzone na stałych
powierzchniach próbnych, dlatego zaleca się aby profesjonalny monitoring dynamiki i liczebności populacji puszczyka zwyczajnego
i puszczyka uralskiego odbywał się każdego roku w okresie szczytowej
aktywności głosowej sów, czyli w miesiącach: luty, marzec, kwiecień
oraz wrzesień październik listopad.
118
Ocena występowania i zagęszczenia puszczyka zwyczajnego strix aluco...
Tab. 1. Liczba wykrytych osobników puszczyka zwyczajnego i puszczyka
uralskiego na terenie Puszczy Niepołomickiej oraz względne zagęszczenie
tych gatunków mierzone liczbą wykrytych ptaków przypadających na 1 km
transektu (w nawiasach).
2009/2010
Teren pomiarów
2012/2013
Puszczyk
zwyczajny
(Strix aluco)
Puszczyk uralski
(Strix uralensis)
Puszczyk
zwyczajny
(Strix aluco)
Puszczyk uralski
(Strix uralensis)
Kompleks
Główny
11 (0,14)
8 (0,10)
7 (0,08)
5 (0,06)
Grobla,
Grobelczyk,
Koło
12 (0,33)
9 (0,11)
8 (0,21)
1 (0,03)
Ryc. 1. Teren badań i rozmieszczenie punktów wabienia puszczyka
zwyczajnego oraz puszczyka uralskiego w Puszczy Niepołomickiej.
119
Angelika Borowska, Jacek Maślanka, Anna Adamik
Bibliografia
Banaszczyk M. 2010. Ocena liczebności gryzoni w grądach Puszczy Niepołomickiej. Praca magisterska. Uniwersytet Pedagogiczny w Krakowie.
Kraków 2010.
Bigaj B. Maślanka J. Wojciuch-Płoskonka M. 2012. Dostępność dziupli w drzewostanie Puszczy Niepołomickiej. Sympozjum. Wpływ gospodarki leśnej
na odnawialne zasoby przyrodnicze Puszczy Niepołomickiej i sąsiednich
kompleksów leśnych na Nizinie Nadwiślańskiej. Niepołomice 10-12 września 2012.
Bonczar Z. Jamka W. Szpetkowski K. 2005. Niepołomice w historii i tradycji
polskiego łowiectwa. FHU ANPOL Kraków.
Czuchnowski R. 1993. Ekologia rozrodu Puszczyka uralskiego Strix uralensis
w Puszczy Niepołomickiej, Remiz 2 (1), s. 8.
Domasiewicz A, Katarnas E. Lewartowski E. Szwagrzak A. 1984. Zarys metodyki liczenia sów. Koło Naukowe Biologów UW. Warszawa.
Głowaciński Z. 1975. Ptaki Puszczy Niepołomickiej (Studium faunistyczno ekologiczne). Acta zool. Cracov. 20 (1): 1 – 87.
Grodziński W. Wasilewski J. 1984. Energy and Matter Flow Through Carnivores – In: Grodziński W. Weiner L. Maycock P. F. Forest Ecosystems in
Industrial Regions, Springer – Verlag, p. 132 – 138.
Karkula B. 2010. Ocena liczebności populacji drobnych gryzoni w borze
mieszanym wilgotnym Puszczy Niepołomickiej. Praca magisterska.
Uniwersytet Pedagogiczny w Krakowie. Kraków 2010.
Madwecka – Kornaś A. 1971. Tematyka i cel zespołowych badań w Puszczy
Niepołomickiej. Studia Naturae A, 6: 7 – 12.
Mikusek R. (ed.). 2005. Metody badań i ochrony sów. Fundacja Wspierania
Inicjatyw Ekologicznych. Kraków.
Niedźwiedź T. Obrębska – Starklowa B. 1991. Klimat. W: Dynowska I. Maciejewski M. (red.). Dorzecze górnej Wisły – część I. PWN Warszawa –
Kraków.
Ruprecht A. L. Szwagrzak A. 1988. Atlas rozmieszczenia sów Strigiformes
w Polsce. Studia Naturae A, 32: 95 – 99.
Tomiałojć L. 1990. Ptaki Polski – rozmieszczenie i liczebność. PWN. Warszawa.
Wasilewski J. 1990. Dynamika liczebności i konsumpcja ptaków drapieżnych
Puszczy Niepołomickiej. Acta zool. Cracov. 33, 10: 173 – 213.
Zinkow J. 1997. Wokół Niepołomic i Puszczy Niepołomickiej. Niepołomice.
120
Ocena występowania i zagęszczenia puszczyka zwyczajnego strix aluco...
Adres do korespondencji:
mgr Angelika Borowska
Zakład Ekologii, Badań Łowieckich i Ekoturystyki
Instytut Biologii
Uniwersytet Pedagogiczny im. KEN w Krakowie
ul. Podbrzezie 3, 31-054 Kraków
e-mail: [email protected]
mgr Jacek Maślanka
Zakład Ekologii, Badań Łowieckich i Ekoturystyki
Instytut Biologii, Uniwersytet Pedagogiczny im. KEN w Krakowie
ul. Podbrzezie 3, 31-054 Kraków
e-mail: [email protected]
mgr Anna Adamik
Zakład Ekologii, Badań Łowieckich i Ekoturystyki
Instytut Biologii, Uniwersytet Pedagogiczny im. KEN w Krakowie
ul. Podbrzezie 3, 31-054 Kraków
121
Blanka Ćwieluch
Dorota Merta
Dobromiła Karpińska
Promotor: prof. dr hab. Bogusław Bobek
EPISTEME
22/2014, t. I
s. 123-130
ISSN 1895-2241
DIETA KUNY LEŚNEJ (MARTES MARTES)
W PUSZCZY NIEPOŁOMICKIEJ
W OKRESIE WIOSENNYM
SPRING DIET OF THE PINE MARTEN (MARTES
MARTES) IN THE NIEPOŁOMICE FOREST
Abstrakt. Metodą analizy odchodów wykonano ocenę wiosennej diety
kuny leśnej (Martes martes) w północnym kompleksie Puszczy Niepołomickiej. Zebrane w terenie w kwietniu i maju 2013 roku próby (n=46) poddano działaniu alkoholu oraz detergentu nieenzymatycznego, a następnie
płukano pod bieżącą wodą na sitach o średnicy 0,7 mm. Następnie materiał
suszono przez 24 godziny w temperaturze 60oC i ważono. Wyróżniono 7 kategorii pokarmu, tj. jeleniowate, dziki, gryzonie, ptaki, gady, owady, materiał
roślinny. Skład wiosennej diety kuny leśnej przedstawiono jako frekwencję
(częstość występowania) danej kategorii (%F) oraz procent skonsumowanej biomasy (%B). W obliczeniach skonsumowanej biomasy zastosowano
współczynniki strawności. Najwyższą frekwencję wykazano dla owadów
(31,7%), a następnie dla roślin (27,8%) i dla gryzoni (24,1%). Najwyższy udział w wiosennej diecie kuny leśnej (%B) miały gryzonie (53,1%), a następnie
ptaki (34,1%) i materiał rośliny (6,5%).
Słowa kluczowe: odchody, % biomasy, frekwencja, kategorie pokarmu,
wszystkożerny.
Summary. The spring diet of the pine marten (Martes martes) in the
northern complex of the Niepołomice Forest was evaluated using a faeces
analysis. The samples collected in the field in April and May of 2013 (n=46)
were treated with alcohol and non-enzymatic detergent and then washed in
running water on 0.7mm meshes. . The material was then dried for 24 hrs at
a temperature of 60oC and weighed on a laboratory scale. Seven categories
of food were distinguished, namely rodents, insects, reptiles, plants, birds,
cervids, and wild boars. The composition of the spring diet of pine martens
was presented as the frequency of occurrence of a given category (%F), and
as a percentage of the biomass consumed (%B). The highest frequency was
found for insects (31.7%), followed by that of plants (27.8%), and rodents
123
Blanka Ćwieluch, Dorota Merta, Dobromiła Karpińska
(24.1%). The highest biomass percentages (%B) in the spring diet of pine
martens were those of rodents (53.1%), birds (34.1%), and plant material
(6.5%).
Key words: feces, % biomass, frequency, food categories, omnivorous.
WSTĘP
Kuna leśna (zwana też tumakiem) jest drapieżnikiem z rodziny łasicowatych (Mustelidae) występującym na terenie całej Polski. Chociaż preferowanymi biotopami kuny są stare lasy liściaste i mieszane
zapewniające obfitość pokarmu i schronień w postaci dziupli, można
ją też spotkać w zadrzewieniach śródpolnych, na terenach zdominowanych przez agrocenozy, a nawet w podmiejskich lasach z rozległą
zabudową letniskową (Goszczyński i in. 1994). Kuna leśna należy do
drapieżników oportunistycznych, a jej skład pokarmu jest zmienny
i zależny od środowiska, w którym bytuje, pory roku oraz dostępności konkretnych rodzajów pożywienia takich jak min. gryzonie,
owady, padlina jeleniowatych i dzików czy owoce. Dzienne zapotrzebowanie kuny na pokarm wynosi ok 160 g, co odpowiada około 10%
masy ciała (Pulliainen 1981).
Liczebność kuny leśnej w Polsce szacowana jest na ok. 60 tys.
osobników (Goszczyński 2011). Roczny, wynoszący około 7 tys.
odstrzał kun zwiększył się od początku lat 90-tych XX wieku ponad siedmiokrotnie (Budny i in. 2010). W kontekście niewielkiego
zainteresowania pozyskaniem skór tego gatunku świadczy to o istotnym wzroście liczebności, co skutkuje zwiększoną presją tego
drapieżnika na populacje potencjalnych ofiar. Puszcza Niepołomicka
w całości stanowi obszar Specjalnej Ochrony Ptaków Natura 2000
(PLB 1200020). Występuje tam około 175 gatunków, a obecność
4 gatunków z Polskiej Czerwonej Księgi Zwierząt, jak również 12 gatunków z Załącznika I Dyrektywy Ptasiej czyni ją ostoją ptasią o randze europejskiej. Liczne badania potwierdzają, że wiosną i wczesnym latem ptaki mogą stanowić istotny element diety kuny (Jędrzejewska i Jędrzejewski 2001). Kuna leśna występuje w Puszczy Niepołomickiej pospolicie, a jej zwyczaje pokarmowe na tym terenie nie
są znane. Niniejsza praca stanowi pierwszy etap badań diety tego
drapieżnika, a jej celem jest określenie składu pokarmu kuny leśnej
w sezonie wiosennym w oparciu o analizę odchodów.
124
Dieta kuny leśnej (martes martes) w puszczy niepołomickiej...
TEREN BADAŃ, MATERIAŁY I METODY
Puszcza Niepołomicka położona jest w zachodniej części Kotliny
Sandomierskiej, w widłach Wisły i Raby. Pod względem siedliskowym
składa się z dwóch kompleksów leśnych. W kompleksie południowym
o powierzchni 87 km2 dominują bory i bory mieszane typu Pino-Quercetum. Północną część Puszczy (21 km2) tworzą otoczone wilgotnymi
i podmokłymi łąkami 3 małe kompleksy leśne: Grobla, Grobelczyk
i Koło. Występują tam głównie lasy liściaste z dominującym udziałem
grądów typu Tilio-Carpinetum (Denisiuk i Medwecka-Kornaś 1976).
Ocenę wiosennej diety kuny leśnej na terenie północnego kompleksu Puszczy Niepołomickiej wykonano metodą analizy kału.
W kwietniu i w maju 2013 dokonywano przemarszów drogami
leśnymi i liniami oddziałowymi. Podczas 8 przemarszów odbywających
w tygodniowych odstępach czasu, zebrano 46 odchodów tego gatunku,
które analizowano w laboratorium z wykorzystaniem standartowych
metod opisanych przez, Goszczyńskiego (1976) oraz Jędrzejewskiego
i Jędrzejewską (2001). Próby moczono w alkoholu - celem odkażenia,
detergencie nieenzymatycznym – celem odtłuszczenia, a następnie
płukano na sicie o średnicy oczek 0,7mm. Każdą próbę dzielono na
frakcje (włosy, skóra, kości, szczątki owadów, pióra, fragmenty skorupy jaj, owoce, nasiona, materiał roślinny oraz frakcja nieoznaczona),
a następnie przez 24 godziny suszono w temperaturze 60oC i ważono. Ssaki identyfikowano na podstawie preparatów mikroskopowych
włosów (Dziurdzik 1973, Teerink 1991), zębów i fragmentów kości
(Pucek 1984). Obecność gadów stwierdzono na podstawie fragmentów
skóry i kończyn. Wyróżniono następujące kategorie pokarmu: jeleniowate, dziki, gryzonie, ptaki, gady, owady, materiał roślinny. Skład diety kuny podany został jako frekwencja występowania poszczególnych
kategorii pokarmu (%F), oraz jako % spożytej biomasy (%B). W obliczeniach % skonsumowanej biomasy zastosowano tzw. współczynnik
strawialności obliczony doświadczalnie dla podstawowych typów ofiar
(Jędrzejewska i Jędrzejewski 2001).
WYNIKI
Łącznie przeanalizowanych zostało 46 prób odchodów kuny leśnej
pochodzących z sezonu wiosennego. Częstość występowania danej
125
Blanka Ćwieluch, Dorota Merta, Dobromiła Karpińska
kategorii pokarmu (Ryc. 1A) w odchodach kuny była najwyższa dla
owadów (31,7%), materiału roślinnego (27,8%) oraz gryzoni (24,1%).
Szczątki ptaków oznaczono w 10,1% analizowanych prób, jednak ze
względu na znaczną fragmentację piór oraz brak charakterystycznych
kości, nie udało się przeprowadzić identyfikacji do poziomu gatunku.
Najniższą, wynoszącą po 1,3% frekwencję zanotowano w przypadku jeleniowatych i dzików. W grupie owadów zidentyfikowano
chrząszcze (Coleoptera) w tym biegacze (Carabus sp.) i chrabąszcze
(Melolontha sp.) a także mrówkowate (Formicidae sp.) oraz gąsienice.
W materiale roślinnym najczęściej pojawiały się trawy (Graminae),
igły drzew szpilkowych (Pinopsida) oraz liście i pędy borówek (Vaccinium sp.). Spośród zidentyfikowanych gryzoni najwyższą frekwencją odznaczały się norniki (Microtus sp.) oraz myszy (Apodemus sp.).
W rodzaju Apodemus wyodrębniono gatunki: mysz zaroślowa (Apodemus sylvaticus) oraz mysz leśna (Apodemus flavicollis). Ponadto
wykazano obecność 2 orzesznic (Muscardinus avellarius) i badylarek
(Micromys minutus), oraz nornicy rudej (Myodes glareolus). Procentowy udział poszczególnych kategorii w biomasie pokarmu skonsumowanego przez kuny przedstawia Ryc. 1B. Dominują gryzonie
(53,1%) i ptaki (34,1%). Mniejszy udział w diecie kuny wykazano dla
materiału roślinnego (6,5%) i owadów (5,0%). Marginalne znaczenie
miały gady (1,3%) oraz jeleniowate i dziki (łącznie mniej niż 1%).
DYSKUSJA
Kuna leśna należy do drapieżników oportunistycznych, tj. odżywia
się każdym rodzajem pokarmu, który może zdobyć, a jej dieta determinowana jest środowiskiem bytowania oraz sezonem (Goszczyński
1976). Na pokarm kuny leśnej składają się głównie drobne ssaki,
a zwłaszcza gryzonie. Tumaki chwytają także ptaki i rabują ich gniazda. Latem i jesienią znaczną część pożywienia kun stanowią owoce znajdowane w lasach lub przyległych do nich sadach. W sezonie
wegetacyjnym stałym składnikiem diety są owady, zwłaszcza żuki
gnojarze, biegacze, chrabąszcze a także larwy os i trzmieli. W okresie
zimowym, przy niskich stanach gryzoni, kuny odżywiają się również
padliną (Goszczyński 1976, De Marinis i Musetti 1995, Jędrzejewska
i Jędrzejewski 2001, Dyman i in. 2005).
126
Dieta kuny leśnej (martes martes) w puszczy niepołomickiej...
Podstawowym pokarmem kuny leśnej w Puszczy Niepołomickiej
są gryzonie. Stanowią one ponad połowę (53,1%) skonsumowanej
biomasy, a ich obecność wykazano w ¼ badanych odchodów.
W Puszczy Białowieskiej gryzonie stanowiły 74% biomasy pokarmu
w sezonie wiosenno-letnim i do 83% w okresie jesienno-zimowym
(Jędrzejewski i in. 1993). W borealnych lasach Finlandii podstawę
zimowej diety kuny leśnej stanowiły gryzonie, zwłaszcza nornica
ruda, chociaż w latach depresji liczebnej gryzoni znaczna część pokarmu kuny stanowiły tam wiewiórki, ptaki oraz padlina reniferów
(Pulliainen i Ollinmaki 1996).
Drugą pod względem biomasy (%B=34,1) kategorię pokarmu
kuny leśnej w Puszczy Niepołomickiej stanowiły ptaki, chociaż ich
obecność stwierdzono tylko w 10% prób. Podobne wyniki uzyskano na terenie Puszczy Białowieskiej gdzie w czerwcu ptaki stanowiły
37% biomasy zjadanego przez kunę pokarmu. Aż 50% stwierdzonych
gatunków stanowiły dziuplaki, a zwłaszcza drozdy, dzięcioły, kowaliki i muchołówki, co może świadczyć o ich znacznej podatności na
drapieżnictwo kuny. (Jędrzejewska i Jędrzejewski 2001).
Najczęściej (%F=31,7) pojawiająca się w wiosennej diecie kuny
leśnej kategorią pokarmu były owady (głównie chrząszcze, a także
gąsienice, mrówki), jednakże ich udział w skonsumowanej biomasie
był niewielki (B%=5,0). Podobną tendencję wykazał Jędrzejewski
i in. (1993) na terenie Puszczy Białowieskiej. Chociaż szczątki
owadów występowały w 51% zebranych tam odchodów, to ich udział w biomasie wyniósł maksymalnie 3%. Prawie połowę owadów
zjadanych przez kuny stanowiły błonkoskrzydłe (Hymenoptera), tj.
osy, pszczoły, trzmiele i szerszenie. W lasach Polski środkowej badano skład gatunkowy owadów w diecie kun, które oznaczono niemalże w 30% zebranych odchodów. Najczęściej odnajdywaną grupą
były chrząszcze, osowate, a w pojedynczych przypadkach motyle,
pluskwiaki i trzmiele (Skłodowski i Posłuszny 2005).
Materiał roślinny w odchodach kun leśnych z terenu Puszczy
Niepołomickiej wykazywał dużą frekwencję (27,8%) przy jednoczesnym niewielkim (6,5%) udziale w skonsumowanej biomasie pokarmu. Wynika to najprawdopodobniej z faktu, iż w okresie zbioru
materiału brak było owoców, które są znaczącym składnikiem diety
kuny (Goszczyński i in. 1994, Caryl 2008). Obecne w odchodach
127
Blanka Ćwieluch, Dorota Merta, Dobromiła Karpińska
trawy mogły zostać zjedzone przypadkowo przy okazji polowania na
gryzonie lub owady.
Śladowe ilości jeleniowatych i dzików (mniej niż 1,0% biomasy)
w wiosennej diecie kuny wykazane w niniejszej pracy pochodzą
prawdopodobnie z padłych zwierząt. Udział padliny w diecie kuny
jest największy pod koniec zimy, przy czym kuny preferują raczej resztki ofiar zabitych przez inne drapieżniki, niż padłych z głodu lub
w wyniku chorób (Jędrzejewski i in. 1993). Niniejsza praca stanowi
pierwszy etap oceny diety kuny leśnej na terenie Puszczy Niepołomickiej. W dalszych badaniach oprócz kolejnych sezonów uwzględnić należny wpływ dostępności potencjalnej bazy pokarmowej, która
w poszczególnych latach może ulegać znaczącym wahaniom. Dotyczy
to zwłaszcza populacji gryzoni, dla których charakterystycznym
zjawiskiem są cykle liczebności, jak również zróżnicowanej w kolejnych latach produkcji nasion i owoców.
Ryc. 1. Frekwencja poszczególnych kategorii pokarmu (A) oraz procentowy
udział biomasy tych kategorii w sumie biomasy skonsumowanej
(B) w próbkach odchodów kuny leśnej (Martes martes L.) (n=46)
zebranych wiosną 2013 roku na terenie północnego kompleksu
Puszczy Niepołomickiej.
BIBLIOGRAFIA
Budny M., Panek M., Bresiński W., Kamieniarz R., Kolanoś R. i Mąka H.
2010. Sytuacja zwierząt łownych w Polsce sezon łowiecki 2009/2010 –
wyniki monitoringu. Biuletyn Stacji Badawczej w Czempiniu 7: 24-26.
Caryl F. M. 2008. Pine marten diet and habitat use within a managed coniferous forest. School of Biological & Environmental Sciences University of
Stirling.
128
Dieta kuny leśnej (martes martes) w puszczy niepołomickiej...
Denisiuk Z., Medwecka-Kornaś A. 1976 Rozmieszczenie zespołów i potencjalna roślinność naturalna w północnej części Puszczy Niepołomickiej. Studia
Naturae A. 13: 171-195.
De Marinis A.M., Musetti M. 1995. Feeding habitats of the pine marten Martes martes L., 1758 in Europe: a Review. Hystrix, 7: 143-150.
Dyman A., Krasko D., Sidorovich V. 2005. Ladscape-related differences in diet,
food supply and distribution pattern of the pine marten, Martes martes in
the transitional mixed forest of northern Belarus. Folia Zoologica 54(1-2)
s. 39-52.
Dziurdzik B. 1973. Klucz do oznaczania włosów ssaków Polski. Acta Zoologica
Cracoviensia 18(4): 73-92.
Goszczyński, J. 1976. Composition of the food of marten. Acta Theriologica
21: 527-534.
Goszczyński J., Romanowski J., Zalewski A. 1994, Kuny, Oficyna Edytorska
“Wydawnictwo Świat”, Warszawa.
Goszczyński, J. 2011. Kuna leśna (tumak) Martes martes. Strony 192-194
w: J. Kiryjow, W. Matysek i A. Wierzbieniec (red.). Łowiectwo. Łowiec
Polski. Warszawa 2011.
Jędrzejewska, B. i W. Jędrzejewski. 2001. Ekologia zwierząt drapieżnych
Puszczy Białowieskiej. Wydawnictwo Naukowe PWN, Warszawa.
Jędrzejewski W., Zalewski A., Jędrzejewska B. 1993. Foraging by pine marten
Martes martes in relation to food resources in Białowieża National Park,
Poland. Acta theriologica 38: 405-426.
Lockie, J. D. 1959. The estimation of the food of fox. Journal Wildlife Management 23: 224-227.
Marchesi P., Mermod C. 1989. Regime alimentaire de la martre Martes martes
dens le Jura Suisse (Mammalia: Mustelidae). Revue Suisse de Zoologie 96
(1): 127-146.
Pucek Z. (red.). 1984. Klucz do oznaczania ssaków Polski. PWN, Warszawa.
Pulliainen E. 1981. Winter habitat selection, home range, and movements of the
pine marten (Martes martes) in a Finnish lappland forest. In: Chapman
J. A. and Pursley D. (eds.) Worldwide Furbearer Conference Proceedings. Frostburg, Maryland, USA: 580-598.
Pulliainen E., Ollinmaki P., 1996. A long-term study of the winter food niche of
the pine maten Martes martes in northern boreal Finland. Acta Theriologica 41(4): 337-352
Skłodowski J., Posłuszny M. 2005. Chrząszcze w pokarmie kuny kamionki
Martes foina i kuny leśnej Martes martes. Sylwan 10: 61−66.
Teerink B. J. 1991. Hair of West-European mammals: atlas and identification
key. Cambridge University Press 1991.
129
Blanka Ćwieluch, Dorota Merta, Dobromiła Karpińska
Adres do korespondencji:
mgr Blanka Ćwieluch, dr Dorota Merta
Zakład Ekologii
Badań Łowieckich i Ekoturystyki
Instytut Biologii
Uniwersytet Pedagogiczny im. KEN w Krakowie
ul. Podbrzezie 3, 31-054 Kraków,
e-mail: [email protected]
130
Agata Fabiszewska
Krystyna Zielińska
EPISTEME
22/2014, t. I
s. 131-137
ISSN 1895-2241
WPŁYW OBECNOŚCI OCHRATOKSYNY A
NA WZROST SZCZEPÓW Z RODZAJU LACTOBACILLUS
IMPACT OF OCHRATOXIN A PRESENCE
IN MEDIA ON LACTOBACILLUS SPECIES GROWTH
Abstrakt. Celem pracy była ocena wpływu ochratoksyny A, toksyny produkowanej przez grzyby strzępkowe, na wzrost pięciu szczepów bakterii
fermentacji mlekowej (Lactobacillus buchnerii KKP 907 p, L. fermentum N
KKP 2020 p, L. plantarum C KKP 788 p, L. plantarum K KKP 593 p and L.
plantarum S KKP 880. Długość fazy adaptacyjnej wzrostu została określona w podłożu LYM za pomocą automatycznego systemu detekcji mikroorganizmów BacT/ALERT® (Biomerieux). Podłoża zawierały ochratoksynę
A (OTA) w stężeniu: 50, 75, 100 ppb, poza podłożem kontrolnym, które nie
zawierało dodatku OTA. Aby ocenić wpływ OTA na przebieg fazy wzrostu logarytmicznego, oznaczono liczbę bakterii po 48 h hodowli. Stwierdzono, że
obecność ochratoksyny A w podłożu w ilości 100 ppb, nie miała wpływu na
obie badane fazy wzrostu. Potwierdzono, że żaden z pięciu szczepów bakterii fermentacji mlekowej nie był wrażliwy na obecność OTA w badanym
zakresie stężeń.
Słowa kluczowe: Lactobacillus, BacT/ALERT®, ochratoksyna A
Summary. The objective of the study was to evaluate an impact of ochratoxin A (a naturally occurring toxin produced by moulds) on growth of five
lactic acid bacteria strains (Lactobacillus buchnerii KKP 907 p, L. fermentum
N KKP 2020, L. plantarum C KKP 788 p, L. plantarum K KKP 593 p and L.
plantarum S KKP 880). The length of lag phase was determined using an
automated microbial detection system BacT/ALERT® and a LYM medium
(Biomerieux). Media contained ochratoxin A (OTA) in concentration: 50,
75, 100 ppb, except for the control medium, which did not contain OTA.
To determine an impact of OTA on log phase the number of bacteria counts
was estimated after 48 h. As for the presence of 100 ppb of ochratoxin A no
impact on both growth phases was found. There was proved that five lactic
acid bacteria strains were not sensitive to examined concentration of OTA.
Key words: Lactobacillus, BacT/ALERT®, ochratoxin A
131
Agata Fabiszewska, Krystyna Zielińska
Wstęp
Ochrona środowiska naturalnego wiąże się z produkcją pasz
bezpiecznych dla zdrowia zwierząt, a zatem stosowania odpowiednich metod ich zabezpieczania przed rozwojem grzybów strzępkowych
wytwarzających toksyczne metabolity drugorzędowe - mikotoksyny,
w tym kancerogenną ochratoksynę A (OTA). OTA została uznana
za powszechnie występującą mikotoksynę w surowcach roślinnych
w Polsce, a zatem poszukiwanie metod dekontaminacji skażonych surowców jest istotnym problemem badawczym [Kluczek i Kojder 2000].
Istnieją nieliczne doniesienia naukowe traktujące zagadnienia
mikrobiologicznej degradacji ochratoksyny A. Wśród drobnoustrojów zdolnych do eliminacji OTA są bakterie fermentacji mlekowej,
interesujące z punktu widzenia bezpieczeństwa ich stosowania,
a szczególnie szczepy z rodzaju Lactobacillus (m. in. L. salivarius,
L. delbrueckii, L. acidophilus, L. helvetius, L. casei, L. lactis subsp. lactis,
L. plantarum, L. sanfranciscensis, L. brevis i L. rhamnosus). Większość
z nich obniża zawartość ochratoksyny A tylko o około kilkanaście
procent. Wrażliwość szczepów bakterii na obecność tej mikotoksyny
w środowisku nie jest zależna od zdolności do jej degradacji [Piotrowska i Żakowska 2000, 2005, Fuchs i in. 2008]. Ważnym zatem
problemem badawczym jest ocena wrażliwości na obecność ochratoksyny A szczepów bakterii, wchodzących w skład kultur starterowych, o zdolności do obniżania poziomu ochratoksyny A. Szczepy charakteryzujące się niską wrażliwością na obecność OTA oraz
jednoczesną zdolnością do obniżania jej poziomu w środowisku
mogą znaleźć zastosowanie w biologicznej dekontaminacji fermentowanych produktów pochodzenia roślinnego.
Celem niniejszej pracy była ocena wpływu ochratoksyny A na
wzrost pięciu szczepów bakterii fermentacji mlekowej z rodzaju Lactobacillus. Wszystkie badane szczepy cechowały się zdolnością do obniżania zawartości OTA średnio o co najmniej 20 % w warunkach in
vitro [Kapturowska i in., 2010].
Materiały i metody
Badania prowadzono z udziałem następujących szczepów bakterii fermentacji mlekowej, należących do Kolekcji Kultur Drobnous132
Wpływ obecności ochratoksyny a na wzrost szczepów z rodzaju lactobacillus
trojów Przemysłowych Instytutu Biotechnologii Przemysłu RolnoSpożywczego: Lactobacillus buchneri KKP 907 p, L. fermentum N KKP
2020 p, L. plantarum K KKP 593 p, L. plantarum C KKP 788 p, L. plantarum S KKP 880. Inokulum bakteryjne przygotowywano w płynnym
podłożu MRS [de Man i in., 1960]. Bakterie hodowano przez 48 h
w temperaturze 30oC. Długość trwania fazy adaptacyjnej szczepów
bakterii w czasie hodowli w podłożu LYM badano za pomocą zautomatyzowanego analizatora mikrobiologicznego BACT/ALERT® firmy
Biomerieux według instrukcji producenta oraz wyników prac Kunickiej [2006] i Sokołowskiej [2008]. Zasada pomiaru w analizatorze
polega na kolorymetrycznym pomiarze ilości metabolitów wydzielanych zewnątrzkomórkowo do podłoża, co pozwala na określenie
czasu detekcji
w aparacie, a tym samym pośrednio ocenę długości lag fazy (fazy
adaptacyjnej wzrostu komórek). Liczbę j.t.k. bakterii po 48 h hodowli oznaczono metodą posiewów na podłożu stałym MRS. Płytki
inkubowano przez 72 h w temperaturze 30 oC.
Wyniki i dyskusja
Ocenę czasu trwania fazy adaptacyjnej wykonano z użyciem analizatora BACT/ALERT®, a liczba bakterii fermentacji mlekowej oznaczona po 48 h hodowli pozwoliła na określenie wpływu ochratoksyny
A na przebieg faz wzrostu logarytmicznego pięciu szczepów z rodzaju
Lactobacillus. W zależności od stężenie OTA w podłożu czas detekcji
dla szczepu Lactobacillus plantarum S KKP 880 wynosił od 20 do 25 h
(tab. 1), a liczba komórek bakterii po 48 h hodowli wahała się od 8,05
(dla próby kontrolnej, kiedy w podłożu nie znajdowała się OTA) do
7,51 j.t.k./cm3 (dla podłoża z 100 ppb OTA). Dłuższe czasy detekcji
odnotowano dla szczepu L. plantarum K KKP/593/p od 23 do 30 h
w zależności od inokulum, którym szczepiono podłoża, ale liczba
komórek bakterii po 48 h hodowli wynosiła od 8,04 do 7,05 j.t.k./
cm3. Szczep L. plantarum K KKP/593/p okazał się nieco bardziej
wrażliwy na obecność OTA przy stężeniu 100 ppb (tab. 1).
Dużą zmiennością w obrębie rejestrowanego czasu detekcji
odznaczały się pozostałe trzy szczepy: L. fermentum N KKP 2020 p,
L. plantarum C KKP 788 p L. buchnerii KKP 907 p, który w zależności
133
Agata Fabiszewska, Krystyna Zielińska
od kondycji komórek bakterii w inokulum wynosił od 10 – 11 h do
nawet 32 – 37 h (tab. 1). Liczba komórek bakterii po 48 h hodowli wahała się od 8,57 do 7,63 oraz od 7,36 do 6,16 j.t.k./cm3 dla szczepu L.
fermentum N KKP 2020 p, od 7,79 do 7,38 oraz od 6,85 do 6,05 j.t.k./
cm3 dla szczepu L. plantarum C KKP 788 p i od 7,08 do 6,35 j.t.k./
cm3 dla szczepu L. buchnerii KKP 907 p.
Tab. 1. Wpływ stężenia ochratoksyny A na liczbę j.t.k bakterii z rodzaju
Lactobacillus po 48 h hodowli oraz czas detekcji w analizatorze BACT/
ALERT® w dwóch niezależnych hodowlach.
Hodowla nr 1
Hodowla nr 2
stężenie
OTA [ppb]
log jtk/cm3
0
7,76
21
8,05
25
50
7,75
20
7,51
23
75
7,82
20
7,89
24
100
7,65
20
7,88
24
czas detekcji
[h]
log jtk/cm3
czas detekcji
[h]
Lactobacillus plantarum S KKP 880
Lactobacillus plantarum K KKP 593 p
0
8,04
23
7,86
29
50
7,69
23
7,95
29
75
7,37
22
7,88
30
100
7,58
22
7,05
30
Lactobacillus fermentum N KKP 2020 p
0
8,57
32
7,36
10
50
8,20
34
7,10
10
75
7,63
35
6,16
11
8,30
37
7,15
11
100
Lactobacillus plantarum C KKP 788 p
134
0
7,79
30
6,85
10
50
7,38
25
6,45
10
75
7,57
26
6,75
10
100
7,68
27
6,05
11
Wpływ obecności ochratoksyny a na wzrost szczepów z rodzaju lactobacillus
Lactobacillus buchnerii KKP 907 p
0
7,00
10
6,95
25
50
7,08
10
6,65
27
75
7,01
10
6,75
26
100
6,77
11
6,35
29
Przeprowadzono analizę statystyczną uzyskanych danych, która
wskazała, że na czas detekcji danego szczepu w analizatorze BACT/
ALERT® nie ma wpływu ani zawartość OTA w podłożu w zakresie do
100 ppb (p-value=0,996587) ani także rodzaj szczepu (spośród pięciu
badanych w ramach pracy, p-value=0,634664). Z kolei intensywność
rozwoju bakterii wyrażona liczbą komórek bakterii po 48 h hodowli
w podłożu LYM zależała od rodzaju szczepu (p-value=0,009542).
Najsłabszą dynamiką wzrostu odznaczył się szczep Lactobacillus buchneri KKP 907 p, który cechował się istotnie niższą liczbą j.t.k/cm3
po 48 h hodowli w podłożu LYM w stosunku do szczepu L. plantarum
S KKP 880.
Istnieje niewielka ilość doniesień naukowych traktujących zagadnienie wrażliwości bakterii na obecność ochratoksyny A. Według
Fuchs i in. [2008] większość szczepów bakterii fermentacji mlekowej,
zdolnych do eliminacji ochratoksyny A, jest także niewrażliwa na
obecność OTA w przedziale stężeń od 5 ppb do 500 ppb. Autorzy
wskazują także na fakt, że szczepy, które cechują się podobną
wrażliwością w stosunku do mikotoksyny, mogą znacznie różnić się
stopniem jej degradacji [Fuchs i in. 2008]. Z kolei Heller i in. [1975]
donoszą, że obecność OTA w stężeniu 1 mg/cm3 nie wywołała efektu
letalnego u badanych gatunków bakterii: Bacillus subtilis, Staphylococcus pyogenes var. aureus i Streptococcus faecalis, jednak jej obecność
wpłynęła na wydłużenie logarytmicznej fazy wzrostu oraz obniżenie
dynamiki wzrostu bakterii.
Wnioski
Obecność ochratoksyny A w ilości do 100 ppb nie wpływała istotnie
na długość fazy adaptacyjnej oraz liczbę komórek badanych szczepów
z rodzaju Lactobacillus po 48 h hodowli w warunkach laboratoryjnych.
135
Agata Fabiszewska, Krystyna Zielińska
Liczba j.t.k badanych szczepów bakterii w podłożu kontrolnym oraz
w podłożu zawierającym OTA nie różniła się istotnie statystycznie.
Wszystkie badane szczepy bakterii spełniają kryteria małej
wrażliwości na obecność OTA oraz mogą być potencjalnie zastosowane w kulturach starterowych mających na celu dekontaminację
skażonego surowca roślinnego.
Bibliografia
De Man J. C., Rogosa M., Sharpe M. E. 1960. A medium for the cultivation
of lactobacilli. J. Appl. Bact., 23 (1): 130-135.
Fuchs S., Sontag G., Stidl R., Ehrlich V., Kundi M., Knasmüller S. 2008. Detoxification of patulin and ochratoxin A, two abundant mycotoxins, by
lactic acid bacteria. Food Chem. Toxicol., 46: 1398-1407.
Heller K., Schultz C., Löser R., Röschenthaler R. 1975. The inhibition of
bacterial growth by ochratoxin A. Can. J. Microbiol., 21(7): 972-979.
Kapturowska A., Stecka K., Zielińska K., Kupryś M. 2010. Ocena zdolności
szczepów
z rodzaju Lactobacillus do obniżania zawartości ochratoksyny A w warunkach modelowych. Monografia „Wielokierunkowość Badań w Rolnictwie i Leśnictwie”, red. Barbara Wiśniowska-Kielian, Wyd. UR
w Krakowie, t. 1: 107-112.
Kluczek J. P., Kojder A. 2000. Mikotoksyny w zarysie. Wydawnictwo Uczelniane Akademii Techniczno–Rolniczej w Bydgoszczy, Bydgoszcz, 1939, 90-103.
Kunicka A. 2006. Wykorzystanie aparatu BacT/ALERT do badania produktów spożywczych, Aktualności Biomerieux, PASSA Zakład Poligraficzny, Konstancin-Jeziorna, 1: 10-13.
Piotrowska M., Żakowska Z. 2000: The biodegradation of ochratoxin A in
food products by lactic acid bacteria and baker’s yeast. Progr. Biotechnol., Food Biotechnol. 17: 307-310.
Piotrowska M., Żakowska Z. (2005): Elimination of ochratoxin A by lactic
acid bacteria. Pol. J. Microbiol. 54: 279-286.
Sokołowska B. 2008. System BacT/ALERT w monitorowaniu jakości i bezpieczeństwa żywności, Aktualności Biomerieux, PASSA Zakład Poligraficzny, Konstancin-Jeziorna, 6: 8-13.
136
Wpływ obecności ochratoksyny a na wzrost szczepów z rodzaju lactobacillus
Adres do korespondencji:
mgr inż. Agata Fabiszewska, dr inż. Krystyna Zielińska
Instytut Biotechnologii Przemysłu Rolno-Spożywczego
im. prof. Wacława Dąbrowskiego
Zakład Technologii Fermentacji,
ul. Rakowiecka 36, 02-532 Warszawa,
e-mail: [email protected]
137
Zita Gergely
Thesis supervisor: Dr. Ferenc Szabó
Dr. László Pongrácz
EPISTEME
22/2014, t. I
s. 139-146
ISSN 1895-2241
USES OF LINEAR CONFORMATION EVALUATION
SYSTEM FOR TRADITIONAL HUNGARIAN HORSE
BREED, FURIOSO-NORTH STAR
Abstract. Furioso-North Star is a traditional Hungarian horse breed, which was bred in the second half of the 19th century. Until World War II the
breed played an important role as carriage horse in farming and in the army.
Nowadays, sports have become the primary purpose of using. Because of
the new type of uses it would be worth reforming the evaluation system and
the selection methods. Therefore, we could get inspirations from countries
that are leading in equestrian sports (e.g.: Germany and the Netherlands).
Hence, beside the currently applied 100-point-scale system we studied the
possibilities of introducing the linear conformation evaluation system used
for the Dutch and German sport horses. This method could help breeders
to improve conformation traits of horses however preserving traditional
bloodlines and families.
Key words: Furioso-North Star, horse breeding, conformation, evaluation
Introduction
Furioso-North Star breed was named after the two founding Thoroughbred stallions: Furioso and North Star. In the meantime two other
Thoroughbreds had a great influence on the breed: Predzwit and Catalin. Besides Hungary, Romania and Slovakia have a small number
of pure-bred stocks, so since the 1980’s Romanian and Slovakian
stallions have been used in breeding [Bodó and Hecker 2013; Mihók
et al. 2001; Mihók and Bodó 2012]. In 1989 the National Association
of the Furioso-North Star Horse Breeders was established.
139
Zita Gergely, Ferenc Szabó, László Pongrácz
This breed was successfully used for military purposes and they
worked perfectly as carriage horses. But nowadays, sports have become the primary purpose of uses. They are good for sports, because
they have lively temperaments; their movements are impulsive, loose and flexible. They have a balanced nervous system therefore they
are reliable companions for men at work and in sports. They are successful in dressage, three days’ event, and carriage-driving. Because
of their calmness they are also welcomed in show-jumping [Mihók et
al. 2001; Pongrácz 2006; Breeding Program 2008].
The current population of the breed is composed of about 595
mares and 85 stallions. In terms of these numbers, Furioso-North
Star is an endangered species and also an important gene reserve.
Its future purpose is to control and increase the population, while
improving its quality [Breeding Program 2008].
An important part of the horse breeding is the conformation
and movement evaluation. A 100-point-scale system is used by the
conformation evaluation and a 130-point-scale system by the movement evaluation for Furioso-North Star breed [Breeding Program
2008]. But if we look at the evaluation systems used in the leading
sport horse breeding countries we can see, that they mostly use the
linear evaluation system. The linear evaluation system uses a scale
of 1 to 9 values, so we can judge the horses between two biological edges [Posta 2012 a, b]. It is important to mention, that 9 is not
always the best value [Novotni 2009]. The advantage of this method
is that the conformation can be described more accurately and we
can see, how much and in which direction an individual differs from
the ideal [Posta 2012 a, b]. Furthermore this method can help us to
estimate the breeding value and to prepare the pairing plan [URL1].
Owing to the low number of individuals of Furioso-North Star
and the bad financial conditions it is hard to compete with the significant European sport horse breeding countries (e.g. Germany, the
Netherlands and Belgium). But apart from this we should take them
as an example in our horse breeding [Mihók et al. 2009].
Material and methods
First we examined the conformation evaluation methods that are
used for Hungarian and foreign (mostly European) horse breeds.
140
Uses of linear conformation evaluation system for traditional hungarian horse breed...
Then we compared the evaluation aspects of the different evaluation
methods: we examined the similarities and the differences. Taking
into account the characteristics of the breed (e.g. number of individuals, uses) and the breed standards we prepared the new evaluation
system. This was, of course, not the final version, because we had
to test it in practice. We evaluated a couple of horses with the help
of the breeding-leader, the chairman of the breeders association and
other members of the association and one of my supervisors. We corrected the errors that occurred, so the final version could have been
completed and we also made a version in which we marked the values
that a “perfect” Furioso-North Star would receive. In the future it will
be a reference point for us.
Finally, with the help of the Furioso-North Star Studbook we
measured how many stallions have enough progeny in order to estimate the breeding value.
Results and discussion
According to the prior surveys we found, that the linear conformation evaluation is known in Hungary, but not used for Hungarian horse breeds. However it is widely used abroad (e.g. South Tirol, Switzerland, Bavaria, Germany, and the Netherlands). Finally we chose the
Dutch method.
As for the aspects of evaluation many differences could have
been found. Most of the aspects proved to be the same, but there
were some, that were not included in the Dutch method (e.g. development, breed-character, gender-character), while others were evaluated separate (e.g. length of neck, position of neck, muscling of neck).
Evaluating the movement they often regard other worth and traits as
more important. An important difference was that the Dutch made
three different evaluating sheets for dressage horses, jumping horses
and harness horses. We thought that it would be useless to make this
kind of partition, because this Hungarian breed has very low numbers of individuals. Finally we prepared one type of evaluation sheet
you can see below (Figure 1, Figure 2).
141
Zita Gergely, Ferenc Szabó, László Pongrácz
Fig. 1. First page of the Furioso-North Star conformation and movement
evaluation
142
Uses of linear conformation evaluation system for traditional hungarian horse breed...
Fig. 2. Second page of the Furioso-North Star conformation and movement
evaluation
143
Zita Gergely, Ferenc Szabó, László Pongrácz
The method of conformation evaluation can also help us to estimate the breeding value. Therefore we collected and averaged the
evaluation results of a sire’s progeny, and finally we could make a diagram based on the obtained values. This shows us the conformation
performance of a sire’s progeny compared to the average of the population. Furthermore we can determine the extent and the direction
of the difference, too. With the help of this method we can select the
most suitable stallion to our mare during the breeding process.
In Table 1. we can see the list of the stallions that are selected for
estimating the breeding value. These 25 stallions have enough mare
progeny to perform the researches, but we would like to involve the
stallion progeny into the researches in order to increase the number
of progeny and make the results more reliable. So in this year our
purpose will be to evaluate as many progeny as possible.
Tab. 1. Stallions that will be involved into researches and the number
of mare progenyaccording to the Furioso-North Star Studbook, 2012
Name of the stallion
Number of mare progeny
1.
3188 North Star X-5 Nádor
24
2.
3399 Furioso XV-29 Fukar
23
3.
3260 Charon
18
4.
3820 Hódmezővhely The Bart-15 Igor 15
5.
3402 Karcag North Star-72 Buli
14
6.
4331 Gyanu I
13
7.
3398 Furioso XX-108 Havas
13
8.
3401 Karcag North Star-191 Öcsi
12
9.
2413 North Star VIII-13 Nomád
11
10.
2880 North Star XLI-32 Nimród
11
11.
1948 Bob herceg-2
11
12.
3719 Furioso LIX-34 Gulliver
11
13.
4005
The
Trónörökös
14.
3193 Hódmezővhely Furioso-19 Rege 10
144
Bart
Furioso-145 10
Uses of linear conformation evaluation system for traditional hungarian horse breed...
15.
2853 Délegyháza North Star-137 Dani 10
16.
2911 Kunszentmiklós North Star-3
10
17.
2806 Furioso VI-11 Csacska
10
18.
4882 Furioso XXX-162 Koktél
10
19.
2525 Abádszalók-5 Merán
9
20.
2150 Furioso IX-50 Fullajtár
9
21.
2388 Furioso IX-3 Rinaldó
9
22.
1607 Aldato Furioso-182 Aladár
8
23.
1545 Orosháza Hadfi-365
8
24.
3526 Hódmezővásárhely Furioso-16 8
Akira II
25.
3729 Magdan Tano
8
Conclusions
Based on our previous experiences the new evaluation method can
be used for Furioso-North Star breed. There is a minor problem with
this new method. It is still unusual for the judges of the breed, because they have been used to the 100- and 130-point-scale systems
from the beginning. This problem may ease after it has been applied
in practice.
Another problem that has to be solved is to develop a special
rating system to this method, since horses will not receive points in
this evaluation system and the highest value is not always the best
among the obtained values. So we have to find out how we could
compare the results of the horses.
The larger part of the work begins this spring. We can evaluate
the horses with this new method in this season. As soon as we have
the data, we will start the calculations related to the breeding values
of the stallions, as well as develop the special rating system.
The number of the progeny is not very numerous so it may cause
problems during the researches. But in terms of the current number
of mares we did not expect more, even so we hope that our work will
be efficient.
145
Zita Gergely, Ferenc Szabó, László Pongrácz
Bibliography
Bodó I. Hecker W. 2013. Lótenyésztés, lótartás, lóhasználat. Mezőgazda
Kiadó, Budapest
Mihók S. Bodó I. 2012. Horse breeding in Hungary, Hungarian horse breeds. Hungarian Agricultural Research, 21. (2) 4-18.
Mihók S. Pataki B. Ernst, K. Ernst J. 2001. Gazdasági Állataink – Fajtatan:
Ló és szamár. Mezőgazda Kiadó, Budapest
Mihók S. Posta J. Jónás S. Galló J. Komlósi I. 2009. Áttekintés a (sport)
lótenyésztésben végzett fontosabb kutatásokról. Animal Welfare,
Etológia és Tartástechnológia 5. (4) 27-36.
Novotni P. 2009. A ló küllemi bírálata. Pro – Book Könyvkiadó, Budapest
Pongrácz L. 2006. A mesterlovász könyve. Szaktudás Kiadó Ház, Budapest
Posta J. 2012a. Új irányzatok a sportlovak értékelésében. Lovas Élet, 13. (7)
40-41.
Posta J. 2012b. Lineáris leíró bírálat a lótenyésztésben. Magyar Állattenyésztők Lapja, 40. (8) 16.
Furioso – North Star Lótenyésztő Országos Egyesület tenyésztési Programja. 2008. Bugac
URL1: www.kwpn.org/inspections/linear-scoring (2014.01.22)
Postal Address:
MSc Zita Gergely
University of West Hungary
Faculty of Agricultural and Food Sciences
Institute of Animal Science
Department of Cattle and Sheep Breeding
146
Marta Głogowska
Opiekun naukowy: dr hab. Robert Stawarz, prof. UP
EPISTEME
22/2014, t. I
s. 147-153
ISSN 1895-2241
STĘŻENIE RTĘCI W PRZEŁYKU I JELICIE
CIENKIM U LUDZI W RÓŻNYM WIEKU
CONCENTRATION OF MERCURY IN ESOPHAGUS AND
SMALL INTESTINE OF PEOPLE IN DIFFERENT AGE
Abstrakt. Badania przeprowadzono na tkankach pochodzących z przełyku (n=24 próbki) i jelita cienkiego (n=24 próbki). Tkanki pobierano w trakcie sekcji zwłok od kobiet i mężczyzn w różnym wieku. Zawartość rtęci
w każdej z próbek zmierzono metodą spektrofotometryczną zimnych par
(CVAAS). Średnia zawartość rtęci w przełyku wyniosła odpowiednio dla
kobiet mających mniej niż 50 lat 0,008±0,0005 ppm; dla kobiet mających
więcej niż 50 lat 0,011±0,009 ppm. W przypadku mężczyzn średnia zawartość rtęci wyniosła dla mężczyzn mających mniej niż 50 lat 0,002±0,0001
ppm; dla mężczyzn mających więcej niż 50 lat 0,029±0,022 ppm. Średnia
zawartość rtęci w jelicie cienkim kobiet mających mniej niż 50 lat wyniosła 0,0003±0,00001 ppm natomiast u kobiet mających więcej niż 50
lat 0,004±0,0009 ppm. W przypadku mężczyzn średnia zawartość rtęci
wyniosła dla mężczyzn mających mniej niż 50 lat 0,003±0,0002 ppm; dla
mężczyzn mających więcej niż 50 lat 0,032±0,028 ppm.
Słowa kluczowe: rtęć, przełyk, jelito cienkie
Summary. Research were performed on tissues from the esophagus (n=24
samples) and from small intestine (n=24 samples). Tissues were collected
during autopsy of women and men of different ages. Mercury content of
each sample was measured by cold vapor atomic absorption spectrofotometry (CVAAS). The average content of mercury in esophagus was appropriate for younger women (<50 years old) 0,008±0,0005 ppm; for women have
more than 50 years old 0,011±0,009 ppm. For men, the average content
of mercury was for men have less than 50 years old 0,002±0,0001 ppm,
and for men have more than 50 years old 0,029±0,022 ppm. The average content of mercury in the small intestine in women have less than 50
years old 0,0003±0,00001 ppm and in women have more than 50 years old
0,004±0,0009 ppm. For men, the average content of mercury was for men
have less than 50 years old 0,003±0,0002 ppm, and for men have more than
50 years old 0,032±0,028 ppm.
Key words: mercury, esophagus, small intestine
147
Marta Głogowska, Robert Stawarz
Wstęp
Drogą pokarmową przedostaje się do organizmu najwięcej trucizn.
Wchłanianie niektórych ksenobiotyków rozpoczyna się już w jamie ustnej, gdzie absorbowane są np.: nikotyna, kokaina, cyjanki,
alkohol. Dla większości substancji pokarmowych, ale także dla niewielkiej liczby toksykantów, trawienie jest konieczne, aby nastąpiła
ich sorpcja do organizmu. Jakiekolwiek działanie systemowe substancji toksycznej wymaga absorpcji przez komórki śluzowe, które
wyściełają od wewnątrz układ pokarmowy. W ustach lub przełyku
wyjątkowo łatwo absorbowana jest nitrogliceryna.
W dwunastnicy i w jelicie czczym wchłanianie następuje głównie
przez pory wraz z wodą podążającą za substancjami aktywnie wchłanianymi przez enterocyty, w celu wyrównania gradientu osmotycznego [Konturek 1990]. Wchłanianie ksenobiotyków w jelitach odbywa
się za pomocą różnych mechanizmów transportu, największą rolę
we wchłanianiu substancji niezjonizowanych odgrywa dyfuzja bierna. Ksenobiotyki rozpuszczalne w wodzie wchłaniają się za pomocą
dyfuzji przez pory, substancje wielkocząsteczkowe wchłaniają się przez endocytozę. Przy wchłanianiu substratów naturalnych duże znaczenie ma transport przenośnikowy. Za pomocą transportu aktywnego są absorbowane tylko nieliczne ksenobiotyki o budowie zbliżonej
do substratów naturalnych. Metale ciężkie w postaci zjonizowanej
dość trudno wchłaniają się z przewodu pokarmowego. Wydajność
absorpcji nieorganicznych związków rtęci, ołowiu i kadmu wynosi od
kilku do kilkunastu procent i zwiększa się przy diecie bogatobiałkowej,
natomiast połączenia organiczne metali, np. metylortęć, wchłaniają
się prawie całkowicie. Ze względu na dużą powierzchnię wchłaniania,
długi czas przebywania ksenobiotyków w jelitach i silne ukrwienie
błon śluzowych, absorpcja zachodzi z dużą wydajnością, nie wchłaniają
się jedynie substancje całkowicie zjonizowane, nietrwałe lub nierozpuszczalne w soku jelitowym. Wchłanianie z przewodu pokarmowego zależy od wielu czynników - środki zmniejszające perystaltykę jelit
przyspieszają wchłanianie, natomiast środki zwiększające perystaltykę
zmniejszają wchłanianie. Przepuszczalność błon komórkowych
w młodym wieku jest znacznie większa, stąd u niemowląt i małych
dzieci wchłanianie ksenobiotyków z przewodu pokarmowego jest
większe niż u osób dorosłych [Zalewski 2000].
148
Stężenie rtęci w przełyku i jelicie cienkim u ludzi w różnym wieku
Związki metylowe rtęci wchłaniane są w ponad 90% przez
człowieka drogą pokarmową [Kowalak 1991], z kolei rtęć metaliczna (pary) praktycznie nie wchłania się z przewodu pokarmowego
[Orłowski 2008]. Przeciętne dobowe pobieranie rtęci przez dorosłego człowieka w Polsce wynosi najczęściej 9-33μg [Kabata-Pendias
i Pendias 1999]. Większość soli rtęciowych i połączeń organicznych
dobrze i szybko wchłania się z przewodu pokarmowego i to jest
najczęściej przyczyną zatruć ostrych [Rusiecki i Kubikowski 1977].
Metylortęć styka się z mikroflorą jelita krętego i grubego
[Rowland i in. 1983], następnie jest degradowana do nieorganicznej rtęci i wydalana przez błony śluzowe jelita cienkiego i okrężnicy
[Berlin i Ullberg 1963]. Toksyczny metal w postaci metylortęci może
wiązać się do aminokwasu biogennego - cysteiny, formując w ten
sposób kompleks, który przypomina budową strukturalną metioninę, będącą aminokwasem endogennym, dzięki czemu może być
transportowana do wnętrza komórki przy pomocy przenośnika
aminokwasów typu L [Aschner i Clarkson 1988; Kerper i in. 1992].
W dodatku przenośniki glutationu mogą transportować metylortęć
skompleksowaną z glutationem [Ballatori i Clarkson 1984a; 1984b;
Dutczak i Ballatori 1994].
Materiał i metody
Badaniom poddano próbki ludzkich tkanek pochodzących z przełyku
i jelita cienkiego. Materiał do badań pochodził od osób z Krakowa
i okolic i był bezpośrednio odbierany z Zakładu Patomorfologii 5 Wojskowego Szpitala Klinicznego z Polikliniką w Krakowie, Niepublicznego Zakładu Opieki Zdrowotnej PROSMED w Krakowie i Szpitala
Onkologicznego im. Marii Skłodowskiej-Curie w Krakowie. Badania przeprowadzono na tkankach pochodzących z przełyku (n=24
próbki) i jelita cienkiego (n=24 próbki). Tkanki pobierano w trakcie
sekcji zwłok od kobiet i mężczyzn w różnym wieku, a średnia masa
każdego wycinka wynosiła 0,5-2 g. Materiał pozyskiwany był przez
wyspecjalizowanego w tym zadaniu patomorfologa, który bezpośrednio po pobraniu niezmienionej morfologicznie tkanki, umieszczał
ją w sterylnej, polietylenowej probówce o pojemności 10 cm3 wkładał do zamrażarki o ustalonej temperaturze -20°C.
149
Marta Głogowska, Robert Stawarz
Zawartość rtęci w próbkach zmierzono metodą spektrofotometryczną zimnych par (CVAAS). Metoda ta nie wymaga mineralizacji wstępnej i umożliwia precyzyjny pomiar bezpośrednio w tkance. Niewielkie fragmenty tkanek, umieszczano w specjalnym tyglu
bezpośrednio po rozmrożeniu i uprzednim precyzyjnym zważeniu
ich. Tkanka na tyglu zasypywana była dwoma rodzajami wyprażonych
wcześniej proszków – tzw. „Dodatkiem M” i „Dodatkiem P”. Wyniki
ważenia wpisywano do programu obsługującego spektrofotometr
MA2, dzięki czemu, po zakończeniu 15-minutowego cyklu pomiarowego, uzyskiwano automatycznie wynik wyliczony na podstawie
krzywej kalibracyjnej. Pomiar dla każdej próbki powtarzano trzy
razy, następnie z otrzymanych trzech wyników wyliczono średnią,
określającą ostateczne stężenie Hg w mierzonej tkance. Uzyskane
wyniki wyrażono w ppm.
W opisie statystycznym badanych cech wykorzystano średnią
arytmetyczną i odchylenie standardowe. Wyniki pomiarów opracowano statystycznie za pomocą pakietu Statistica wersja 10. Za
pomocą testu W Shapiro-Wilka określono normalność rozkładu
w poszczególnych grupach badawczych. W celu zbadania, które
z porównywanych średnich różnią się istotnie, a które nie, zastosowano test Kruskala-Wallisa dla prób niezależnych. Po odrzuceniu hipotezy zerowej zastosowano właściwy dla tego testu, test wielokrotnych
porównań. Dla sprawdzenia hipotezy o braku istotnej różnicy między
dwoma próbami zastosowano test U Manna Whitney’a. Wszystkie
hipotezy zerowe były falsyfikowane na poziomie istotności α=0.05.
Wyniki zilustrowano na wykresach.
Wyniki
Średnie stwierdzone stężenie rtęci wyniosło odpowiednio:
0,008±0,0005 ppm dla kobiet mających mniej niż 50 lat oraz
0,011±0,009 ppm dla kobiet mających więcej niż 50 lat. W przypadku mężczyzn średnie stężenie rtęci wyniosło: 0,002±0,0001 ppm
dla mężczyzn mających mniej niż 50 lat oraz 0,029±0,022 ppm dla
mężczyzn mających więcej niż 50 lat. Omówione wyniki zilustrowano na wykresie 1. Analiza testem U-Manna Whitneya wykazała
istnienie statystycznie istotnych różnic pomiędzy średnim stężeniem rtęci w tkankach przełyku mężczyzn mających mniej niż 50 lat
i więcej niż 50 lat (p=0,000).
150
Stężenie rtęci w przełyku i jelicie cienkim u ludzi w różnym wieku
Wyk. 1. Średnia zawartość rtęci w przełyku kobiet i mężczyzn
w różnym wieku (ppm).
Średnie stężenie rtęci w jelicie cienkim kobiet mających mniej niż
50 lat wyniosło 0,0003±0,00001 ppm natomiast u kobiet mających
więcej niż 50 lat 0,004±0,0009 ppm. W przypadku mężczyzn średnie
stężenie rtęci wyniosło 0,003±0,0002 ppm dla mężczyzn mających
mniej niż 50 lat oraz 0,032±0,028 ppm dla mężczyzn mających
więcej niż 50 lat. Omówione wyniki zilustrowano na wykresie 2.
Analiza testem U-Manna Whitneya wykazała istnienie statystycznie
istotnych różnic pomiędzy średnim stężeniem rtęci w tkankach jelita cienkiego kobiet mających mniej niż 50 lat i mężczyzn mających
więcej niż 50 lat (p=0,000).
Wyk. 2. Średnia zawartość rtęci w jelicie cienkim kobiet i mężczyzn
w różnym wieku (ppm).
151
Marta Głogowska, Robert Stawarz
Dyskusja i wnioski
Ksenobiotyki mogą przenikać do ustroju różnymi drogami, co ma duże znaczenie dla przebiegu i intensywności zatruć. W warunkach przemysłowych drogami wchłaniania są: przewód pokarmowy, skóra
i układ oddechowy [Sapota 2008]. Pierwiastki podlegające kumulacji
w narządach miąższowych wykazują na ogół wyższy stopień toksyczności od pierwiastków nagromadzonych w tkankach twardych
i w skórze [Gawlik i in. 1999].
Kumulacja rtęci w tkankach przełyku jest najwyższa u mężczyzn
w wieku 50-90 lat (0,03 ppm) zaś najniższa u mężczyzn w wieku
20-50 lat (0,002 ppm). Należy podkreślić, że wyniki te są wyższe od
wyników uzyskanych w tkankach jelita cienkiego, gdzie najwyższą
zawartość rtęci stwierdzono również w tkankach mężczyzn w wieku
50-90 lat (0,031 ppm), zaś najniższą w tkankach kobiet w wieku
20-50 lat (0,0003 ppm). Otrzymane zależności nasuwają wniosek,
że kumulacja rtęci związana jest z wiekiem pacjenta – tkanki osób
starszych kumulują Hg w większym stopniu niż tkanki osób młodych,
co najprawdopodobniej związane jest z dłuższą czasem ekspozycji
na ten metal. Zbyt duża zawartość rtęci w tkankach przewodu pokarmowego może powodować zmiany neurotoksyczne indukowane
przez rtęć nieorganiczną – chlorek rtęci (II) i pary rtęci. Zmiany te
są spowodowane przez dwa mechanizmy - jeden polega na lokalnym
obkurczeniu naczyń krwionośnych przez uwalnianą reninę, natomiast drugi na bezpośrednim cytotoksycznym działaniu jonów rtęci (II)
na komórki nabłonkowe.
Bibliografia
1. Aschner, M. Clarkson, T.W. 1988. Uptake of methylmercury in the rat
brain: effects of amino acid. W: Brain Research, 462: 31-39.
2. Ballatori, N., Clarkson, T.W. 1984. Dependence of biliary secretion of inorganic mercury on the biliary transport of glutathione. W: Biochemical Pharmacology, 33: 1093-1098.
3. Ballatori, N., Clarkson, T.W. 1984. Inorganic mercury secretion into bile
as a low molecular weight complex. W: Biochemical Pharmacology, 33:
1087-1092.
4. Berlin, M., Ullberg, S. 1963. Accumulation and retention of mercury in
the mouse. III. An autoradiographic comparison of methylmercuric
152
Stężenie rtęci w przełyku i jelicie cienkim u ludzi w różnym wieku
dicyandiamide with inorganic mercury. W: Archives of Environmental
Health, 6: 586-609.
5. Dutczak, W.J., Ballatori, N. 1994. Transport of the glutathione-methylmercury complex across liver canalicular membranes on reduced glutathione carriers. W: Journal of Biological Chemistry, 269, 13: 97469751.
6. Gawlik, M., Gawlik, M., Moniczewski, A. 1999. Toksykologia szczegółowa.
W: Brandys, J.: Toksykologia, wybrane zagadnienia. Kraków. Wydawnictwo Uniwersytetu Jagiellońskiego, 219-230.
7. Kabata-Pendias, A., Pendias, H. 1999. Biogeochemia pierwiastków śladowych. Warszawa. Wydawnictwo Naukowe PWN, 103-170, 215-245,
329-355.
8. Kerper, L.E., Ballatori, N., Clarkson, T.W. 1992. Methylmercury transport
across the blood-brain barrier by an amino acid carrier. W: The American Journal of Physiology, 262, 5-2, 761-5.
9. Konturek, S. 1990. Układ trawienny. W: Traczyk, W.Z., Trzebski,
A.: Fizjologia człowieka z elementami fizjologii stosowanej i klinicznej.
Warszawa. Państwowy Zakład Wydawnictw Lekarskich, 271-342.
10. Kowalak, A. 1991. Metale śmierci. Krosno. CEEW, 18-27.
11. Orłowski, Cz. 2008. Metale. W: Piotrowski, J. K.: Podstawy toksykologii.
Warszawa. Wydawnictwa Naukowo-Techniczne, 148-194.
12. Rowland, L.R., Robinson, R.D., Doherty, R.A. 1983, 745-758.
13. Rusiecki, W., Kubikowski, P. 1977. Toksykologia współczesna. Warszawa.
Wydawnictwo Lekarskie PZWL, 88-185.
14. Sapota, A. 2008. Drogi wchłaniania, metabolizm i wydalanie ksenobiotyków. W: Piotrowski, J. K.: Podstawy toksykologii. Warszawa.
Wydawnictwa Naukowo-Techniczne, 63-86.
15. Zalewski, T. 2000. Fizjologia rozwojowa przewodu pokarmowego.
W: Zalewski, T.: Choroby przewodu pokarmowego. Warszawa. Akademia Medyczna, 14-29.
Adres do korespondencji:
mgr Marta Głogowska
Zakład Zoologii Kręgowców i Biologii Człowieka,
Uniwersytet Pedagogiczny im. Komisji
Edukacji Narodowej w Krakowie
e-mail: [email protected]
153
Marta Głogowska
Opiekun naukowy: dr hab. Robert Stawarz, prof. UP
EPISTEME
22/2014, t. I
s. 155-162
ISSN 1895-2241
STĘŻENIE RTĘCI W TKANKACH
NOWOTWOROWYCH I NIEZMIENIONYCH
PATOLOGICZNIE LUDZKIEGO ŻOŁĄDKA
ACCUMULATION OF MERCURY IN CANCEROUS
AND UNCHANGED PATHOLOGICALLY TISSUES
OF HUMAN STOMACH
Abstrakt. Materiał badawczy stanowiły tkanki ludzkiego żołądka (zdrowe
i nowotworowe) pobierane podczas autopsji i operacji. Zawartość rtęci
w tkankach zmierzono metodą spektrofotometryczną płomieniową
zimnych par CVAAS. U obu płci, we wszystkich badanych przedziałach
wiekowych, w zdrowych tkankach żołądka stwierdzono najniższą zawartość
rtęci. U mężczyzn tkanki oddalone od guza nowotworowego żołądka kumulują rtęć w najwyższym stopniu, natomiast u kobiet najwyższą kumulacją
rtęci charakteryzują się tkanki przyległe do guza.
Słowa kluczowe: rtęć, żołądek, tkanki nowotworowe
Summary. The research material was human stomach tissue (healthy and
cancerous) collected during autopsy and surgery. Mercury content in the
tissues was measured by cold vapor atomic absorption spectrophotometry
(CVAAS). In both sex, in all studied age ranges, in healthy tissues of the
stomach is the lowest mercury content. In men, the tissues away from the
stomach tumor accumulate mercury in the highest degree, while in women
the highest accumulation of mercury characterized tissues adjacent to the
tumor.
Key words: mercury, stomach, cancerous tissues
155
Marta Głogowska, Robert Stawarz
Wstęp
Zatrucie metalami ciężkimi przebiega w sposób utajony i jest
prawdopodobnie najbardziej niebezpieczne dla człowieka. Istnieje
wiele źródeł, które stopniowo zatruwają nasz organizm rtęcią. Na
początku XIX wieku rozpoczęto wypełnianie zębów amalgamatem,
składającym się w 50% z rtęci, która ulega wymywaniu, a jej ilość
wzrasta ponad 15-krotnie podczas spożywania gorących i kwaśnych
produktów. Niektórzy stomatolodzy upierają się przy twierdzeniu,
że rtęć pozostaje w plombie, jednak badania dowodzą, iż po 5-10
latach wypełnienie zawiera tylko 25% rtęci, a po 20 latach jedynie
5%. Ponadto około 80% rtęci przedostaje się do atmosfery na skutek niewłaściwego deponowania baterii [Vago 1997]. Ryby takie jak
tuńczyk i miecznik, mogą w swoim mięsie gromadzić duże ilości rtęci.
Jedząc te ryby zwiększamy prawdopodobieństwo dostawania się do
organizmu rtęci [Pressman i Buff 2006].
Żołądek jest pierwszą częścią układu pokarmowego, gdzie
zachodzi znaczna absorpcja metali oraz ich translokacja do innych
części organizmu. Wchłanianie w tym narządzie uzależnione jest od
pH soku żołądkowego, obecności enzymów trawiennych i treści pokarmowej. Żołądek to organ wyjątkowy ze względu na dużą zawartość w nim kwasu solnego i wynikające z tego niskie pH (ok. 1,0),
dlatego niektóre jony łatwo przenikają przez jego ścianki [Manahan 2006; Smythe i in. 1992]. Rtęć może wpływać na sygnał transdukcyjny przez promowanie zaburzeń w ekspresji genów i komunikacji wewnątrzkomórkowej, a także może powodować efekt w postaci
odpowiedzi immunologicznej i zaburzeń homeostazy komórkowej.
Wpływ metali na kancerogenezę jest określony przez liczne czynniki
tj.: typ metalu, interakcje metal – metal, specjację, rozpuszczalność i
inne [Hayes 1997].
Materiał i metody
Materiał badawczy stanowiły zdrowe tkanki ludzkie pochodzące z żołądka (n=24), stanowiące grupę kontrolną oraz tkanki ze zmianami
nowotworowymi żołądka (n=18), stanowiące grupę eksperymentalną. W grupie eksperymentalnej tkanki pochodziły z:
I - guza nowotworowego (n=18)
156
Stężenie rtęci w tkankach nowotworowych i niezmienionych patologicznie...
II – obszaru przylegającego do guza nowotworowego (n=18)
III – obszaru oddalonego od guza nowotworowego (n=18).
Niezmienione patologicznie, zdrowe tkanki pobierano w trakcie sekcji zwłok od kobiet i mężczyzn w różnym wieku, a tkanki
nowotworowe w czasie operacji (średnia masa każdego wycinka
wynosiła 0,5-2 g). Wiek wszystkich pacjentów mieścił się w przedziale 20-90 lat. Materiał do badań pochodził z Zakładu Patomorfologii 5 Wojskowego Szpitala Klinicznego z Polikliniką w Krakowie,
Niepublicznego Zakładu Opieki Zdrowotnej PROSMED w Krakowie
i Szpitala Onkologicznego im. Marii Skłodowskiej-Curie w Krakowie.
Każdą próbkę poddano procedurom umożliwiającym oznaczanie
w tkankach zawartości rtęci. Zawartość rtęci w próbkach zmierzono metodą spektrofotometryczną zimnych par (CVAAS). Pomiar dla
każdej próbki powtarzano trzy razy, następnie z otrzymanych trzech wyników wyliczono średnią, określającą ostateczną zawartość Hg
w badanej tkance. Wyniki wyrażono w ppm.
W opisie statystycznym wykorzystano średnią arytmetyczną
i odchylenie standardowe. Wyniki pomiarów opracowano statystycznie za pomocą pakietu Statistica wersja 10. Za pomocą testu W Shapiro-Wilka określono normalność rozkładu w poszczególnych grupach badawczych. W celu zbadania, które z porównywanych średnich
różnią się istotnie zastosowano test Kruskala-Wallisa dla prób niezależnych. Po odrzuceniu hipotezy zerowej zastosowano test wielokrotnych porównań. Wszystkie hipotezy zerowe były falsyfikowane
na poziomie istotności α=0.05. Wyniki zilustrowano na wykresach.
Wyniki
Średnia zawartość rtęci u mężczyzn (20-50 lat) wyniosła w tkankach
kontrolnych żołądka 0,003±0,0007 ppm; w tkankach oddalonych
od guza nowotworowego żołądka 0,025±0,005 ppm; w tkankach
przyległych do guza żołądka 0,02±0,005 ppm; w tkankach guza
żołądka 0,022±0,005 ppm (Ryc. 1). Analiza wielokrotnego porównania średnich rang wykazała istnienie różnic wysoce istotnych
statystycznie pomiędzy średnią zawartością rtęci w tkankach kontrolnych żołądka, a średnią zawartością tego pierwiastka w tkankach
oddalonych od guza żołądka (*p=0,000).
157
Marta Głogowska, Robert Stawarz
Ryc. 1. Średnie stężenie rtęci w tkankach zdrowych i nowotworowych
żołądka mężczyzn w wieku 20-50 lat (ppm).
Średnia zawartość rtęci u mężczyzn (50-90 lat) wyniosła w tkankach kontrolnych żołądka 0,026±0,019 ppm; w tkankach oddalonych
od guza nowotworowego żołądka 0,054±0,002 ppm; w tkankach
przyległych do guza żołądka 0,032±0,024 ppm; w tkankach guza
żołądka 0,04±0,002 ppm (Ryc. 2). Analiza wielokrotnego porównania średnich rang wykazała istnienie różnic istotnych statystycznie
pomiędzy średnią zawartością rtęci w tkankach kontrolnych żołądka,
a średnią zawartością tego pierwiastka w tkankach oddalonych od
guza żołądka (*p=0,038).
Ryc. 2. Średnie stężenie rtęci w tkankach zdrowych i nowotworowych
żołądka mężczyzn w wieku 50-90 lat (ppm).
158
Stężenie rtęci w tkankach nowotworowych i niezmienionych patologicznie...
Średnia zawartość rtęci u kobiet (20-50 lat) wyniosła w tkankach
kontrolnych żołądka 0,0002±0,0001 ppm; w tkankach oddalonych
od guza nowotworowego żołądka 0,023±0,012 ppm; w tkankach
przyległych do guza żołądka 0,026±0,001 ppm; w tkankach guza
żołądka 0,025±0,006 ppm (Ryc. 3). Analiza wielokrotnego porównania średnich rang wykazała istnienie różnic wysoce istotnych
statystycznie pomiędzy średnią zawartością rtęci w tkan kach kontrolnych żołądka, a średnią zawartością tego pierwiastka w tkankach
przylegających do guza i w tkankach guza żołądka (*p=0,000).
Ryc. 3. Średnie stężenie rtęci w tkankach zdrowych i nowotworowych
żołądka kobiet w wieku 20-50 lat (ppm).
Średnia zawartość rtęci u kobiet (50-90 lat) wyniosła w tkankach kontrolnych żołądka 0,005±0,003 ppm; w tkankach oddalonych
od guza nowotworowego żołądka 0,022±0,001 ppm; w tkankach
przyległych do guza żołądka 0,045±0,038 ppm; w tkankach guza
żołądka 0,027±0,012 ppm (Ryc. 4). Analiza wielokrotnego porównania średnich rang wykazała istnienie różnic wysoce istotnych
statystycznie pomiędzy średnią zawartością rtęci w tkankach kontrolnych żołądka, a średnią zawartością tego pierwiastka w tkankach
oddalonych od guza żołądka (*p=0,000).
159
Marta Głogowska, Robert Stawarz
Ryc. 4. Średnie stężenie rtęci w tkankach zdrowych i nowotworowych
żołądka kobiet w wieku 50-90 lat (ppm).
Dyskusja i wnioski
Lista produktów żywnościowych zanieczyszczonych rtęcią jest bardzo długa i obejmuje ponad 3000 pozycji. Niektóre nasiona są spryskiwane środkami grzybobójczymi zawierającymi metylortęć, która jest
najbardziej trującą postacią rtęci. Większość chorób nowotworowych
wynika z zaburzeń transportu i metabolizmu określonych pierwiastków [Ballatori 2002; Clarkson 1993; Goyer 1997], a większość metali
toksycznych ma słabą zdolność do bezpośrednich interakcji z DNA
i metale te są słabymi mutagenami. Metale nie mające bezpośredniej zdolności do wywoływania kancerogenezy, mogą wchodzić w reakcje z innymi czynnikami kancerogennymi, np. rtęć może hamować
proces naprawy DNA, zwiększając prawdopodobieństwo mutacji,
a co za tym idzie – wystąpienia nowotworu [Hartwig 1998; Hu i in.
2004a, 2004b]. Stwierdzono wpływ metylortęci na ryzyko rozwoju
raka żołądka [Yorifuji i in. 2007]. Wyniki jednoznacznie wskazują na
różnice pomiędzy zawartością rtęci w tkankach niezmienionych patologicznie i tkankach nowotworowych, co potwierdza doniesienia, że
rakotwórcze procesy są powiązane z nierównowagą metali śladowych
w płynach ustrojowych i w tkankach [Pasha i in. 2010]. Wyniki sugerują, że zarówno kobiety, jak i mężczyźni starsi (50-90 lat) kumulują znacznie więcej rtęci niż kobiety i mężczyźni młodsi (20-50 lat),
160
Stężenie rtęci w tkankach nowotworowych i niezmienionych patologicznie...
z kolei biorąc pod uwagę płeć można stwierdzić, że w tkankach żołądka
kobiet jest znacznie mniej rtęci, niż w tkankach mężczyzn – być może
ma to związek z wyższą zawartością estrogenów u kobiet, które - jak
dowodzą badania – chronią przed rozwojem nowotworów. Różna koncentracja rtęci w tkankach zdrowych i nowotworowych najprawdopodobniej wynika z mechanizmów obronnych komórek, które związane są ze aktywnością enzymów antyoksydacyjnych. Tkanki zdrowe
(kontrolne) nie narażone na stres kancerogenny, mają zwykle wysoki
poziom glutationu i enzymów antyoksydacyjnych, co zapobiega kumulacji ksenobiotyków w ich komórkach. Z przeprowadzonych badań wynika, że podobny mechanizm obronny występuje w tkankach
guza nowotworowego żołądka, którego komórki „bronią się” i nie dopuszczają do akumulacji ksenobiotyków. Może być to także związane
z faktem, że tkanka nowotworowa, która jest fizjologicznie młodą
tkanką, jest paradoksalnie krócej narażona na toksyczne działanie
metali ciężkich, w porównaniu do tkanek które ją otaczają i z których
się wywodzi.
Bibliografia
Ballatori N. 2002. Transport of toxic metals by molecular mimicry. Environmental Health Perspectives. 110, 5: 689-694.
Clarkson T.W. 1993. Molecular and ionic mimicry of toxic metals. Annual
Review Pharmacology and Toxicology. 33: 545-571.
Goyer R.A. 1997. Toxic and essential metal interactions. Annual Review of
Nutrition. 17: 37-50.
Hartwig A. 1998. Carcinogenicity of metal compounds: possible role of DNA
repair inhibition. Toxicology Letters. 102-103, 235-239.
Hayes R.B. 1997. The carcinogenicity of metals in humans. Cancer Causes
and Control. 8: 371-385.
Hu W., Feng Z., Tang M.S. 2004. Chromium(VI) enhances (+/-)-anti-7beta,
8alpha-dihydroxy-9alpha,10alpha-epoxy-7,8,9,10 tetrahydrobenzo[a]
pyrene-induced cytotoxicity and mutagenicity in mammalian cells
through its inhibitory effect on nucleotide excision repair. Biochemistry. 43: 14282-14289.
Hu W., Feng Z., Tang M.S. 2004. Nickel (II) enhances benzo[a]pyrene diol
epoxide-induced mutagenesis through inhibition of nucleotide excision repair in human cells: a possible mechanism for nickel (II)-induced
carcinogenesis. Carcinogenesis. 25: 455-462.
161
Marta Głogowska, Robert Stawarz
Manahan S.E. 2006. Toksykologia środowiska, aspekty chemiczne i biochemiczne. Warszawa. Wydawnictwo Naukowe PWN. 102-122, 146-176,
230-296.
Pasha Q., Malik S.A., Shaheen N., Shah M.H. 2010. Investigation of trace
metals in the blood plasma and scalp hair of gastrointestinal cancer
patients in comparison with controls. Clinica Chimica Acta. 411: 531539.
Pressman A.H., Buff S. 2006. Witaminy i minerały. Przewodnik dla każdego.
Warszawa. KDC. 219-294.
Smythe A., Bird N.C., Johnson A.G. 1992. Continuous monitoring of sodium ion concentration in the human stomach-a new technique for the
detection of duodenogastric reflux. Digestion. 52, 1: 20-5.
Vago K. 1997. Odtruwanie organizmu, jak zapobiegać zatruciu toksynami?
Wrocław. Wydawnictwo ASTRUM. 16-22, 26-36, 38-41, 57-58.
Yorifuji T., Tsuda T., Kawakami N. 2007. Age standardized cancer mortality
ratios in areas heavily exposed to methyl mercury. International Archives Occupational Environmental Health. 80: 679-688.
Adres do korespondencji:
mgr Marta Głogowska
Zakład Zoologii Kręgowców i Biologii Człowieka
Uniwersytet Pedagogiczny w Krakowie
e-mail: [email protected]
162
Joanna Grygier, Tomasz Schwarz
Maciej Murawski, Adam Zięcik
Dorota Zięba-Przybylska
Opiekun Naukowy: prof. dr hab. Dorota Zięba-Przybylska
EPISTEME
22/2014, t. I
s. 163-171
ISSN 1895-2241
WPŁYW KONTAKTU Z KNUREM NA WYDZIELANIE
KORTYZOLU I LH U DOJRZAŁYCH PŁCIOWO
LOSZEK W OKRESIE OKOŁORUJOWYM
THE INFLUENCE OF BOAR EXPOSURE ON CORTISOL
AND LH SECRETION IN MATURE GILTS
DURING THE NEAR ESTRUS TIME
Abstrakt. Celem badań było określenie wpływu regularnych kontaktów
z knurem na poziom wydzielania, i zmiany stężenia kortyzolu u dojrzałych
loszek. Badanie zostało przeprowadzone na 12 loszkach mieszańcach
pbz x wbp, podzielonych na 2 grupy po 6 zwierząt. Grupa kontrolna (CG)
znajdowała się w izolacji od samca, podczas gdy w grupie eksperymentalnej (EG) zapewniono codzienny kontakt z knurem. Próbki krwi pobierano
codziennie 4 h przed, podczas i 4 h po ekspozycji na knura. Odnotowano
istotnie wyższy (P≤0,01) sekrecja kortyzolu w EG w porównaniu do CG
(odpowiednio 16,01±12,35 i 9,22±6,32 ng/ml) oraz wyższy (P≤0,01) poziom wahań stężeń (odp. 28,77±12,63 i 14,62±6,87 ng/ml), szczególnie
w czasie przedowulacyjnego wylewu LH (odp. 43,17±11,75 i 13,89±0,93
ng/ml). Wysokość przedowulacyjnego wylewu LH była istotnie wyższa
(P≤0,05) w EG niż w CG (odpowiednio 28,6±5,57 & 22,91±2,54 ng/ml).
W każdym z badanych aspektów wyniki wykazały znaczące różnice na
korzyść EG względem CG.
Słowa kluczowe: kortyzol, loszka, efekt samca, owulacja, stres.
Summary. The aim of the study was to determine the effect of regular contact with the boar on the level of secretion, and fluctuations of cortisol in
mature gilts. The study was conducted on 12 crossbreds gilts, Polish Landrace x Polish Large White, divided into 2 groups of 6 animals. Control group
(CG) was housed in isolation from the male, while the experimental group
(EG) was provided daily contact with the boar. Blood samples were collected
every day 4h before, during and 4h after boar exposure. Significantly higher
(P≤0.01) level of cortisol seceretion was noted in EG as compared to CG
163
Grygier Joanna, Schwarz Tomasz, Murawski Maciej, Zięcik Adam...
(16.01±12.35 & 9.22±6.32 ng/ml respectively) as well as higher level of fluctuations (28.77±12.63 & 14.62±6.87 ng/ml resp.) especially during preouovulatory LH surge (43.17±11.75 & 13.89±0.93 ng/ml resp.). The level of
LH surge was significantly higher (P≤0.05) in EG than in CG (28.6±5.57
& 22.91±2.54 ng/ml resp.). The findings shown relevant difference in each
physiological indicator to advance for experimental group.
Key words: cortisol, gilt, male effect, ovulation, stress.
Introduction
Ovarian hormone secretion is closely interrelated with endocrine
system called the hypothalamus-pituitary-ovarian axis, and acting
on the basis of feedbacks on the nature of the negative or positive
depending on the phase of the estrous cycle [Knox et al. 2003]. LH
is one of the most important hormones that belong to this axis, and
is produced by the anterior pituitary gland. It is responsible for final
maturation of ovarian follicles and secretion of estradiol, as well as
for stimulation of ovulation that ends the estrous cycle [Evans 2003].
Its concentration during the preovulatory period is considered to be
one of the most important factors in determining the ovulation onset and efficient in pigs and other poliovulatory animals [van den
Brand et al. 2000]. There are many possible techniques to improve
LH secretion and ovulation rate in pigs. A common way in breeding
practice is the use of method called a boar (male) effect. It involves
gilts stimulation by male pheromones to reach sexual maturation, or
sows to induce estrus [Langendijk et al. 2000]. Pheromones impact
on the central nervous system, stimulating secretion of neuropeptides, involved in the regulation of LH secretion [Booth and Baldwin,
1983]. Male presence in pen is a strong stimulus acting on the females sense of sight, smell and hearing, increasing the intensity of
activities, through stimulation of the genital tract [Kozumplik and
Kudlač, 1980]. It causes more efficient ovulation and increased secretion of LH in gilts [Kemp et al., 2005]. Most likely stimulation
of gilts reproductive functions is the result of an acute short-term
stress which is caused by male presence [Pearce and Hughes 1987].
However, some other results of studies on impact of acute stress,
occurring with a short-term increase of cortisol concentration, on
the HPG axis secretion did not confirm this theory [Pearce and Pa164
Wpływ kontaktu z knurem na wydzielanie kortyzolu i lh u dojrzałych płciowo...
terson 1992, Zięcik and Ziemińska1995]. Therefore, the aim of the
study was to determine the impact of regular boar contact on cortisol
and LH secretion and reproductive performance of gilts.
Material and methods
All experimental procedures used were in compliance with the EC
guidelines for animal experimentation and have been approved by
the local animal care committee. The study was conducted on 12 sexually mature gilts pbz x wbp half-breeds in the F1 generation. The
animals were housed in individual pens in the experimental Station
of the Department of Swine and Small Ruminants Breeding of Agricultural University in Cracow. The average age of gilts was 214 days,
and bodyweight 128.9 (± 9.3) kg. Twice a day they have received
a fullportion mixture for breeding gilts (13 MJ and 170 g of total
protein). In the first stage of the experiment, seven days before main
procedures, the gilts were subjected to vena cava anterior cannulation to allow stress-free collection of blood at any frequency during
experiment. The animals were divided into two equal size groups.
Every day at 11.45 a.m gilts from experimental group (EG) were lead
out into the room where had provided nose to nose contact with mature boar for 15 min. Gilts from control group (CG) were completely
deprived of boar contact, however, at the same time for 15 min were
also lead to another room, to make the experimental conditions uniform (the move and change of place could be a distress as the boar
contact). After observing the tolerance reflex gilts were conducted
to double insemination. During the near estrus period 6 times a day
(every 4 hours) 7 cm3 of blood were collected into the heparinized
vacutainers. Blood samples were spin for 10 min at 3000 rpm (800
g). After blood plasma collection samples were chilled to the 4°C and
then frozen. Further analysis were performed in the laboratory of
Department of Hormone Action Mechanisms of the Institute of Animal Reproduction and Food Research Polish Academy of Sciences in
Olsztyn, where to samples were delivered on dry ice. Plasma samples
were analyzed in duplicate. The concentration of LH in the blood serum were analyzed by radioimmunoassay (RIA) using specific antibodies obtained from rabbits by the method described by Zięcik et
165
Grygier Joanna, Schwarz Tomasz, Murawski Maciej, Zięcik Adam...
al. (1992). Iodated standard swine LH samples were used as antigens. The sensitivity of the method for the LH determination was
0.1 ng×ml-1. The coefficient of variation within and between series by
turns was 7.4% and 16.8%. using a radiation counter WIZARD 1470
(Wallac, Finland). Due to exact time of ovulation determine inability
preovulatory LH peak was defined as point zero. The data obtained
from all animals were standardized for this point. The concentration
of LH was analyzed from day -3 to 4 in blood samples taken every
4 hours for the purpose of determining the amount and duration
of preovulatory surge. The concentration of cortisol was analyzed
from day -3 to 3 in relation to the preovulatory LH surge. Each day
3 blood samples were collected, 4 hours prior to contact with the boar,
immediately, and 4 hours after animals contact. The concentration of
cortisol was analyzed by radioimmunoassay (RIA) with the use of set
menus Spectria (Orion Diagnostica, Finland). Radioactivity measurements were made using a gamma counter WIZARD 1470 (Wallac,
Finland). The sensitivity of the method for the determination of cortisol was 1.8 ng×ml-1. During the analysis of data physiological indicators were determined: the mean concentration of cortisol and LH,
basic level of cortisol and LH, mean peak height of cortisol and LH,
LH levels during preovulatory surge, and duration of preovulatory
LH surge. All data were compared between experimental and control
group using the T- Student’s test, in order to determine the impact of
boar contact on hormones estimation in gilts.
Results
It was found that experimental group reached a statistically significant advantage (P ≤ 0.01) over the control group in terms of the
mean concentration of cortisol secreted in the preovulatory period,
as well as in the peaks emerging after boar contact. Additionally, there has been a significant difference (P ≤ 0.01) between the average
height of the peak of cortisol during preovulatory LH surge, when it
was close twice the height of the peak from not preovulatory period
in the experimental group. In the control group such a difference was
not noticed.
166
Wpływ kontaktu z knurem na wydzielanie kortyzolu i lh u dojrzałych płciowo...
Tab. 1. Cortisol and LH concentration analysis
Indicator
CG without boar
EG with boar
Mean concentration (ng/ml)
9.22 ± 6.32A
16.01 ± 12.35B
Average peak (ng/ml)
14.62 ± 6.87A
28.77 ± 12.63BX
Average peak during preov. LH
surge (ng/ml)
13.89 ± 0.93A
43.17 ± 11.75BY
Mean concentration (ng/ml)
4.51 ± 6.28
4.89 ± 6.86
Average peak (ng/ml)
4.21 ± 2.96
4.72 ± 3.15
Max. concentration during preov.
surge (ng/ml)
22.91 ± 2.51a
28.60 ± 5.57b
Preovulatory surge duration (h)
31.00 ± 3.78A
36.00 ± 2.31B
CORTISOL
LH
different letters denotes significant differences between values in row between columns (P≤0.05)
AB
different letters denotes highly significant differences between values in row
between columns (P≤0.01)
XY
different letters denotes highly significant differences between values in column
between rows (P≤0.01)
ab
Cortisol concentration profile in the experimental group, was
characterized by an emergence of regular peaks, in a few minutes after boar contact. Over the next 4 hours cortisol concentration was
clearly decreasing, and at such reduced level remained until the next
contact with the male. Consequently, within 8 days 8 cortisol peaks
occurred always right after time spent with male. During 8 days there have been 7 cortisol peaks in CG, but they were not as regular as
in the EG and were not closely related to the stimulus understood as
the change of room. There was no significant difference in the average concentration of LH between the two observed groups during
experiment, as in the average peak beyond preovulatory surge. There
has been an important experimental group advantage in preovulatory LH surge length (P ≤ 0.01), and the maximum concentration of
the hormone at surge time. LH secretion profiles were similar in both
groups, and were characterized by regularly occurring peaks increasing closer to preovulatory surge, and decreasing again after its com167
Grygier Joanna, Schwarz Tomasz, Murawski Maciej, Zięcik Adam...
pletion. Preovulatory surge began earlier in pigs from ED, but ended
up at the same time in both groups. The number of piglets born in
ED was 10.40 ± 1.95 did not differ significantly from CG 9.60 ± 2.61.
Discussion
The male effect in the herd is a phenomenon commonly used in livestock production. Its effectiveness is undeniable [Kemp et al.
2005], although the physiological mechanism remains poorly recognized. For gilts kept in isolation from the male, momentary contact
with boar is an environmental stimulus, calling on them to stress respond [Turner et al. 2005]. As the acute short-term stress it does not
have a negative impact on the body of a female. In fact, sometimes it
may be a kind of mobilization of organism with positive effects for
its physiology and function. Many studies have found a clear stress
reaction to boar presence in gilts. Pearce and Hughes [1987] found
that stress caused by contact with mature male causes an increased
concentration of cortisol. In our experiment the hypothesis of Pearce
and Hughes [1987] has been confirmed analyzing two phenomena.
It was a significant difference in the cortisol concentration between
groups. The average concentration and peak height was substantially
higher in the EG. In addition, the secretion of cortisol in the EG was
subjected to a scheme, in which low hormone level was noticed 4 hours before the females entrance into the room with a mature male,
with rapid increase shortly after contact, followed by a return to
a normal level after further 4 hours [Turner et al. 1998]. Consequently, there have been eight distinct peaks of cortisol in the EG,
within eight days of the estrus period, closely related in time to the
moment of female exposure to the boar. Such explicit schema was
not noticed in CG. Another interesting observation in EG were the
occurrence of two peaks during preovulatory LH surge that were significantly higher than the other peaks in experimental period. This
allows to assume for the first time, that females response to male
depends very closely on the phase of the estrous cycle. An increase
in the concentration of cortisol in reaction to the presence of mature male causes a chain of physiological changes leading to restoring
the homeostatic regime. Additional effect is an increase in LH level.
168
Wpływ kontaktu z knurem na wydzielanie kortyzolu i lh u dojrzałych płciowo...
Luteinizing hormone plays a key role for ovarian function, including the final development of follicles, ovulation, and luteogenesis,
as well as the synthesis and secretion of steroid hormones [Britt et
al., 1984]. It is believed that the higher the concentration of LH in
the preovulatory surge period the higher expected rate of ovulation [Langendijk et al. 2000, Kemp et al., 2005]. Boar effect impact
on LH secretion appears more clear than in the case of cortisol. In
a recent experiment preovulatory LH surge in EG was significantly
higher and lasted much longer than in the CG. Longer duration of LH
secretion during ovation period may be associated with faster development and larger number of growing follicles during the follicular
phase [Shaw and Foxcroft, 1985]. This shows the mutual dependencies of hormones produced in the hypothalamus-pituitary-gonadal
axis. The number of piglets born per litter did not differ significantly,
however the numerical difference seem to be relevant, especially
for breeding practice. The lack of significance is probably due to low
number of animals in groups being compared.
Conclusions
In conclusion, recent study has shown significant changes in endocrine function in mature gilts influenced by a boar contact, which was
a factor that triggered physiological response in gilts similar to shortterm stress, that goes with the release of cortisol. There has been
a clear link between responsible for responding to external stimuli
cortisol and controlling the ovarian function during near estrus period luteinizing hormone. The duration of LH preovulatory surge in
gilts stimulated with male was significantly longer, which was related
into increased levels of ovulation. From point of view of production
practice, the difference between groups in the litter size was relevant
and indicates the effectiveness of the application of the boar effect as
cheap, safe, non-invasive and very effective method to stimulate the
reproductive processes in gilts.
References
Booth W. D., Baldwin B. A., 1983. Changes in oestrous cyclicity following olfactory bulbectomy inpost-pubertal pigs, J. Reprod. Fertil. 67, 143-150.
169
Grygier Joanna, Schwarz Tomasz, Murawski Maciej, Zięcik Adam...
Britt J. H., Esbenshade K. L., Heller K., 1984. Response of seasonally acyclic
gilts and weaned primiparous sows to pregnant mare’s gonadotropin
(PMSG) and Regumate., J. Anim. Sci. 59, Suppl. 1, 20-21.
Kemp B., Soede N.M., Langendijk P., 2005. Effects of boar contact and housing conditions on estrus expression in sows, Theriogenology 63,
643–656.
Knox R. V., Vatzias G., Naber C. H., Zimmerman D. R., 2003. Plasma gonadotropins and ovarian hormones during the estrous cycle in high
compared to low ovulation rate gilts., J. Anim. Sci,. 81, 249–260.
Kozumplik J., Kudláč E., 1980. Rozród świń w chowie wielkostadnym, 139145, 218-220
Langendijk P., Van den Brand H., Soede N. M., Kemp B, 2000. Effect of boar
contact on follicular development and on estrus expression after weaning in primiparous sows, Theriogendogy, 54, 1295–1303.
Pearce G. P., Hughes P. E., 1987. An investigation of the roles of boar component stimuli in the expression of proceptivity in the female pig, Appl
Anim Behav Sci;18, 287–99.
Pearce G. P., Paterson A. M., 1992. Physical contact with the boar is required for maximum stimulation of puberty in the gilt because it allows
transfer of boar pheromones and not because it induces cortisol release, Anim. Reprod. Sci., 27, 209-224.
Schwarz t., Murawski M., Zięcik A., Wierzchoś E., Szymanowicz J., The influence of boar contact on LH releasing in gilts during estrus, VI Zjazd
Towarzystwa Biologii Rozrodu, Polanćzyk- Rzeszów 8- 10.04.2011
Shaw H. J., Foxcroft G. R., 1985. Relationships between L. H., FSH and prolactin secretion and reproductive activity in the weaned sow, J Reprod
Fertil;75, 17–28.
Turner A. I., Hemsworth P. H., Hughes P. E., Tilbrook A. J., 1998. Repeated
acute activation of the hypothalamo-pituitary adrenal axis prior to and
during estrus did not affect reproductive performance in gilts, Biol. Reprod., 58, 1458–62.
Turner A. I., Hemsworth P. H., Tilbrook A. J., 2005, Susceptibility of reproduction in female pigs to impairment by stress or elevation of cortisol,
Domestic Animal Endocrinology, 29, 398–410.
Van den Brand H., Dieleman S. J., Soede N. M., Kemp B., 2000. Dietary
energy source at two feeding levels during lactation of primiparous
sows: I. Effects on glucose, insulin, and luteinizing hormone and on
follicle development, weaning-to-estrus interval, and ovulation rate,
J. Anim. Sci., 78, 396–404.
170
Wpływ kontaktu z knurem na wydzielanie kortyzolu i lh u dojrzałych płciowo...
Zięcik A. J, Jedlinska M., Rzucidlo S. J., 1992. Effect of estradiol and progesterone on myometrial LH/hCG receptors in pigs, Acta Endocrinologica,
127, 185-188.
Zięcik A. J., Zieminska A., 1995. Effect of transport stress and hydrocortisone on the estrogen-induced luteinizing hormone surge in pigs, Anim.
Rep. Sci., 37, 333-347.
Adres do korespondencji:
Joanna Grygier
e-mail: [email protected]
Tomasz Schwarz
e-mail: [email protected]
Maciej Murawski
e-mail: [email protected]
Adam Zięcik
e-mail: [email protected]
Dorota Zięba-Przybylska
e-mail: [email protected]
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
Uniwersytet Rolniczy w Krakowie
Zakład Mechanizmów Działania Hormonów
Instytut Rozrodu Zwierząt i Badań Żywności PAN w Olsztynie
Project carried out of the grant received from the Polish Ministry of Science
and Higher Education (N N311 370837).
171
Karolina Konieczna
Zbigniew W. Czerniakowski
Tomasz Olbrycht
Opiekun naukowy:
dr inż. hab. prof. UR Zbigniew W. Czerniakowski
EPISTEME
22/2014, t. I
s. 173-184
ISSN 1895-2241
MATERIAŁY DO POZNANIA ZGRUPOWAŃ
CHRZĄSZCZY OMARLICOWATYCH (COL., SILPHIDAE)
W UPRAWACH ZIEMNIAKA I BIOCENOZACH
LEŚNYCH WYBRANYCH REGIONÓW POLSKI
POŁUDNIOWO-WSCHODNIEJ
CONTRIBUTION TO THE KNOWLEGDE OF CARRION
BEETLES (COL., SILPHIDAE) ASSEMBLAGES
IN POTATO CULTURES AND FORESTS IN SELECTED
REGIONS OF SOUTH-EASTERN POLAND
Abstrakt. Chrząszcze z rodziny omarlicowatych (Col., Silphidae), oprócz niewielkiej liczby fitofagów i zoofagów, w większości reprezentowane są przez
gatunki nekrofagiczne. Poprzez odżywianie się martwą tkanką zwierzęcą,
a tym samym jej rozkład, pełnią istotne funkcje ekologiczne, przyczyniając
się do obiegu pierwiastków w przyrodzie. Ma to szczególne znaczenie
w aspekcie rolniczym, ponieważ w ten sposób udostępniane są roślinom niezbędne związki proste, a w dalszej konsekwencji przetwarzania materii organicznej następuje poprawa żyzności gleby. Utylizując szczątki zwierzęce,
omarlicowate pełnią istotne funkcje sanitarne, a ograniczając rozwój bakterii chorobotwórczych doprowadzają do biologicznej dezynsekcji środowiska.
Krajowa fauna Silphidae opracowana jest dosyć dobrze, aczkolwiek większość
publikacji dotyczy terenów zurbanizowanych, ekosystemów naturalnych
lub seminaturalnych. Dane faunistyczne z terenów użytkowanych rolniczo są nadal fragmentaryczne i wymagają pełniejszego opracowania. Celem pracy było przedstawienie struktury ilościowo-jakościowej chrząszczy
omarlicowatych występujących w uprawach ziemniaka i sąsiadujących
z nimi biocenozami leśnymi wybranych regionów Podkarpacia.
Słowa kluczowe: omarlicowate, Silphidae, uprawa ziemniaka, las
Summary. Carrion beetles (Col., Silphidae) apart from a small number of
phytophagous and zoophagous, are represented by most necrophagous
species. Consuming dead animals, play important ecological functions in
173
Karolina Konieczna, Zbigniew W. Czerniakowski, Tomasz Olbrycht...
nutrient cycling. This is important in agriculture aspect, because in this way
are made available to the plants a simple compounds and in consequence
improve soil fertility occurs. Utilizing animal remains, carrion beetles attend sanitary function and limiting the spread of pathogenic bacteria lead
to biological disinfestation. National fauna of Silphidae is quite well described, although the most of publications covers urban areas, natural or seminaturals ecosystems. Faunistic data of agricultural lands is still fragmented
and require a fuller description. The aim of the study was to present the
quantitative and qualitative structure of carrion beetles occurring in potato
culture and adjacent forests in selected stands of Subcarpathian regions.
Key words: carrion beetles, Silphidae, potato culture, forest
WSTĘP
Wegług Löbla i Smetany [2004] krajowa fauna jest reprezentowana
przez 22 gatunki.
Poprzez odżywianie się martwą tkanką zwierzęcą, a tym samym
jej rozkład, pełnią istotne funkcje ekologiczne, przyczyniając się do
obiegu pierwiastków w przyrodzie. Ma to szczególne znaczenie w aspekcie rolniczym, ponieważ w ten sposób udostępniane są roślinom
niezbędne związki proste, a w dalszej konsekwencji przetwarzania
materii organicznej następuje poprawa żyzności gleby.
Krajowa fauna Silphidae opracowana jest dosyć dobrze,
aczkolwiek większość publikacji dotyczy terenów zurbanizowanych,
ekosystemów naturalnych lub seminaturalnych. Występowanie
omarlicowatych na terenach użytkowanych rolniczo poznane jest
niedostatecznie, a wśród nielicznych prac można wymienić badania
Kopyłówny [1935] oraz Kamińskiej [1989]. Wiele danych ma charakter fragmentaryczny, wymagający pełniejszego opracowania oraz
aktualizacji danych.
Celem pracy było przedstawienie struktury ilościowo-jakościowej
chrząszczy omarlicowatych występujących w uprawach ziemniaka
i sąsiadujących z nimi biocenozami leśnymi wybranych regionów
Podkarpacia.
MATERIAŁ I METODY
Obserwacje nad składem gatunkowym i liczebnością chrząszczy
omarlicowatych (Col., Silphidae) prowadzono w wybranych
miejscowościach południowo-wschodniej Polski w dwóch okresach
174
Materiały do poznania zgrupowań chrząszczy omarlicowatych...
wegetacyjnych (2012 i 2013). Teren badań stanowiły uprawy ziemniaków oraz sąsiadujące z nimi biocenozy leśne. W środkowej części
każdego stanowiska zakopano po dwie pułapki glebowe Barbera,
oddalone od siebie o około 2 m. Pułapki stanowiły pojemniki o średnicy 9 cm i pojemności 500 ml, wkopane równo z powierzchnią gleby
i zabezpieczone daszkiem. Zostały one wypełnione w 1/3 pojemności
płynem konserwującym (25% roztwór glikolu etylenowego). Pułapki
na poszczególnych stanowiskach opróżniano co 2 tygodnie, przez
cały okres wegetacji ziemniaków (rozpoczynając od ostatniej dekady
kwietnia, kończąc w pierwszej dekadzie września). Jako jedną próbę
traktowano zawartość dwóch pułapek z jednego zbioru na jednym
stanowisku. Łącznie, w okresie dwuletnich badań, na obserwowanym
terenie pobrano do analizy 130 prób.
Próby pobrane w uprawach ziemniaków w obydwu sezonach
badawczych dotyczyły stanowisk w miejscowościach Pakoszówka
oraz Wiśniowa. Dodatkowo w 2013 roku były to: Drohojów, Kosina,
Równia oraz Wacławice. Charakterystyka geograficzna (lokalizacja
terenu badań w systemie kartograficznym UTM- Universal
Transverse Mercator; kwadrat o długości 10 km), klasy bonitacji gleb
oraz wykaz odmian ziemniaków i stosowanych w ich uprawie środków
ochrony roślin zostały przedstawione w tabeli 1. Analiza składu
gatunkowego Silphidae w drzewostanach w 2012 roku obejmowała
lasy zlokalizowane w Bystrzycy (EA53) i Jaćmierzu (EV79). Obydwa
te stanowiska charakteryzowały się podobnym składem dendroflory,
z dominującym bukiem (50%) oraz grabem, jodłą i olszą czarną.
W 2013 roku poddano analizie lasy graniczące z uprawami ziemniaków
w Pakoszówce, Równi i Wacławicach. W wymienionych biocenozach
leśnych struktura dendroflory kształtowała się podobnie. Były to lasy
mieszane z przewagą buka (40%) oraz: jodłą, sosną, dębem, grabem,
modrzewiem, świerkiem, jaworem, jesionem, brzozą, olchą, lipą
i osiką.
175
Karolina Konieczna, Zbigniew W. Czerniakowski, Tomasz Olbrycht...
Tab. 1. Charakterystyka geograficzna, klasy bonitacji gleb oraz wykaz
odmian ziemniaków i stosowanych środków ochrony roślin
w uprawie ziemniaka na badanych stanowiskach.
Table 1. Geographical characteristics, soil quality class and the list of
varieties of potatoes and plant protection products used in the potato
cultures in the study area.
Miejscowość / Location / UTM / UTM
Powierzchnia [a] / Acreage [a]
Odmiana ziemniaka / Potato varieties
Klasa bonitacyjna gleb / Soil quality classes
Stosowane środki ochrony roślin /
Crop protection chemicals
Drohojów / UTM FA22 / 51 / Inova / III a
Kosmik 360 SL, sól potasowa / potassium salt 60% K, fosforan amonu
/ ammonium phosphate 46% P, 17
% N, saletrzak /nitrochalk 27% N,
Afalon+Comand, Titus 25 WG+Trend
90 EC, Pyton Consento 450 S.C., Basfoliar, Proteus 110OD, Revus 250 SC
Kosina / UTM EA94 / 50 / Żagiel, Denar /III
Polifoska, Linurex, Pleoparat, ACTARA
25 WG, HELM-Cymi 72,5 WP,
Ekonom 72 WP
Pakoszówka / UTM EV79 / 20 / b. d. /III
Decis 2,5 EC
Równia / UTM FV17 / 15 / b. d. / IV i / and V
Chwastox Extra 300SL, Decis 2,5 EC
Wacławice / UTM FA22 / 60 / Denar /
II i/and III
saletra amonowa / ammonium sulphate 32%N, Polifoska 4, Ministral 70
WG, Pyton Consento 450 S.C., Infinito,
Proteus 110OD
Wiśniowa / UTM EA53 / 15 / Atol / III
Alverde 240 SC
b. d. – brak danych / not available datav
Zebrany materiał entomologiczny poddano analizie w warunkach laboratoryjnych. Układ systematyczny oraz nomenklaturę omarlicowatych
przyjęto zgodnie z opracowaniem Löbla i Smetany [2004], zaś oznaczeń chrząszczy dokonano korzystając z pracy Mroczkowskiego [1955].
Strukturę dominacji (d) opisano przyjmując klasy dominacji zaproponowane przez Kasprzaka i Niedbałę [1981]: eudominanty (> 10% osobników zgrupowania), dominanty (5,1–10%), subdominanty (2,1–5%),
recedenty (1,1–2%), subrecedenty (< 1%). Indeks bogactwa gatunkowego
Simpsona (D) określono za Szujeckim (1980), a charakterystykę ekologiczną i zoogeograficzną omarlicowatych w oparciu o prace Burakowskiego i in. [1978], Mroczkowskiego [1955] i Kocha [1989]. Aktywność dobową Silphidae przyjęto za Dekeirsschieter i in. [2011].
176
Materiały do poznania zgrupowań chrząszczy omarlicowatych...
WYNIKI I DYSKUSJA
Ogółem zebrano 740 chrząszcze należące do 10 gatunków. W uprawach ziemniaka odnotowano łącznie obecność 406 osobników
należących do 8 gatunków, zaś w biocenozach leśnych zebrano 334
chrząszczy reprezentujących 7 taksonów. Różnice w liczbie odłowionych chrząszczy wynikają głównie z większej liczby badanych upraw
ziemniaków w 2013 roku. Struktura dominacji omarlicowatych
występujących na polach uprawnych oraz indeks bogactwa gatunkowego Simpsona zostały przedstawione w tabeli 2.
Tab. 2. Porównanie stosunków dominacyjnych gatunków Silphidae
odłowionych w uprawie ziemniaka [%].
Tab. 2. Comparison of the dominance index of Silphidae caught in the
potato cultures [%].
Rok / Year
Gatunek /
Species
2012
Wiśniowa
Pakoszówka
2013
Wiśniowa
Pakoszówka
Równia
Drohojów
91,67
ED
100,00
ED
5,0
SD
Silpha
obscura
5,00
SD
Silpha tristis
Thanatophilus sinuatus
2,04
SD
Nicrophorus
interruptus
2,04
SD
Nicrophorus
vespillo
95,92
ED
10,00
D
80,00
ED
16,67
ED
8,57
D
16,67
ED
1,43
R
7,69
D
92,31
ED
9,68
D
33,33
ED
4,28
SD
33,33
ED
55,72
ED
90,32
ED
28,57
ED
Nicrophorus
vespilloides
Bogactwo D/
Richness D
Kosina
1,43
R
Oiceoptoma
thoracicum
Phosphuga
atrata
Wacławice
1,18
2,30
0,70
3,85
2,70
8,33
D
0,44
0,92
0
ED - eudominanty, D - dominanty, SD - subdominanty, R - recedenty,
SR - subrecedenty
ED - eudominants, D - dominants, SD - subdominants, R - recedents,
SR - subrecedents
177
Karolina Konieczna, Zbigniew W. Czerniakowski, Tomasz Olbrycht...
Analiza składu jakościowego Silphidae odnotowanych w uprawie
ziemniaka potwierdza preferencje siedliskowe gatunków określanych
jako charakterystycznych dla terenów otwartych i pól uprawnych. Natomiast występowanie gatunków leśnych (Oiceoptoma thoracicum, Phosphuga atrata, Nicrophorus vespilloides) jest zgodne ze zdolnościami migracyjnymi omarlicowatych, które prawdopodobnie przemieszczały się
z sąsiadujących biocenoz leśnych. Gatunkiem występującym najliczniej na wszystkich stanowiskach przez cały okres badań okazał się Nicrophorus vespillo, który został zaliczony do klasy eudominantów. Klasy
dominacji były reprezentowane przez gatunki występujące najliczniej
(eudominanty, dominanty oraz subdominanty) przy niewielkim udziale gatunków określających bioróżnorodność (recedenty i subrecedenty). Największe zróżnicowanie klas dominacji zaobserwowano
w Wacławicach, gdzie odnotowano gatunki zaliczone do eudominantów, dominantów, subdominantów oraz recedentów.
Struktura dominacji w biocenozach leśnych została przedstawiona w tabeli 3. Klasy dominacji przedstawiają się podobnie jak
w przypadku upraw ziemniaków. Widoczny jest silnie wyrażony udział gatunków dominujących, przy minimalnym udziale gatunków
mniej licznych. Taki rozkład można porównać do zdegradowanego
[TROJAN 1998], który charakteryzuje tereny uproszczone, poddane
antropopresji i będący przykładem synantropizacji fauny.
Charakterystyka ekologiczna oraz preferencje siedliskowe
odłowionych Silphidae zostały przedstawione w tabeli 4. Otrzymane wyniki są zgodne z doniesieniami innych autorów [ALEKSANDROWICZ i KRZĘTOWSKI 2004, BŁAŻEJEWICZ-ZAWADZIŃSKA
i ŻELAZNA 2011], którzy wykazali, że tereny poddawane antropopresji predysponują zmiany w kształcie struktury jakościowej omarlicowatych, czego dowodem jest mniejsza liczba wykazywanych gatunków na terenach objętych działalnością człowieka. W środowiskach naturalnych liczba stwierdzonych gatunków jest wyższa i w badaniach Błażejewskiego [1956] wyniosła 11, zaś Aleksandrowicz i Komosiński [2004] potwierdzili występowanie 19 gatunków. Synantropizacja siedlisk wpływa na ubożenie fauny w aspekcie jakościowym,
protegując występowanie gatunków eurytopowych, o szerokiej walencji ekologicznej, często w charakterze gatunków dominujących.
178
Materiały do poznania zgrupowań chrząszczy omarlicowatych...
Tab. 3. Porównanie stosunków dominacyjnych gatunków Silphidae
odłowionych w biocenozach leśnych [%].
Tab. 3. Comparison of the dominance index of Silphidae caught in the
forest’s biocenosis [%].
Gatunek /
Species
Rok / Year
2012
Bystrzyca
Oiceoptoma
thoracicum
Phosphuga
atrata
2013
Jaćmierz
Pakoszówka
39,68 ED
1,08 R
66,67 ED
Wacławice
Równia
6,11D
Nicrophorus
humator
4,76 SD
0,76 SR
Nicrophorus
interruptus
9,53 D
9,93 D
Nicrophorus
investigator
6,67 D
2,22 SD
Nicrophorus
vespillo
15,87 ED
46,56 ED
Nicrophorus
vespilloides
33,3 ED
30,16 ED
98,92 ED
36,64 ED
91,11 ED
Bogactwo D/
Richness D
2,09
2,22
0,50
1,88
1,20
ED - eudominanty, D - dominanty, SD - subdominanty, R - recedenty,
SR - subrecedenty
ED - eudominants, D - dominants, SD - subdominants, R - recedents,
SR - subrecedents
Tab. 4. Charakterystyka ekologiczna Silphidae odłowionych na terenie badań [na podstawie: Burakowski i in. [1978], Dekeirsschieter i in. [2011],
Mroczkowski [1955], Koch [1989].
179
Karolina Konieczna, Zbigniew W. Czerniakowski, Tomasz Olbrycht...
Gatunek /
Species
Charakterystyka ekologiczna /
Ecological characteristic
I
II
III
IV
V
Liczebność bezwględna [szt.]
Absolute number [exx.]
Uprawy ziemniaka /
Potato cultures
2012
2013
Las /
Forest
2012 2013
Oiceoptoma
thoracicum
L
N, P
D
g, n,
p
T
-
1
25
1
Phosphuga
atrata
L
P
b.d.
b.d.
T
1
-
2
8
L,To N, P b.d.
n, p
ES
-
7
-
-
b.d.
ES
1
2
-
-
Silpha obscura
Silpha tristis
P
Thanatophilus
sinuatus
To,
P
N, P
D
p
T
3
20
-
-
Nicrophorus
humator
L
N
N
p, r
W
-
-
3
4
Nicrophorus
interruptus
P
N
Z
n,
p, r
T
1
5
6
13
Nicrophorus
investigator
L,
To
N
Z
p
ES
-
-
-
1
Nicrophorus
vespillo
To,
P
N
Z,
N
p
H
63
281
10
61
Nicrophorus
vespilloides
L
N
D
p, r
T
-
21
20
180
69
337
66
268
Razem szt. / Total exx.
N, P b.d.
Charakterystyka ekologiczna – Ecological characteristic:
I – środowisko życia / habitat: L – las / forest, To – tereny otwarte / open
area, P – pola uprawne / fields
II – grupa troficzna / trophic level: N – nekrofag / necrophagous,
D – drapieżnik / predaceous
III – aktywność dobowa / daily activity: D – dzienny / diurnal, N – nocny /
nocturnal, Z – zmierzchowy / crepuscular
IV – preferencje siedliskowe / habitat preferences: p – padlina / cadaver,
g – grzyby / fungi, n – nawóz / dung, r – rozkładające się grzyby / rotten fungi,
V – charakterystyka zoogeograficzna / zoogeographical characteristic:
W – zachodniopalearktyczny / Westpalearctic, T – trans palearktyczny /
Transpalearctic, H – hol arktyczny / Holarctic, ES – euro syberyjski / EuroSiberian
b. d. – brak danych / not available data
180
Materiały do poznania zgrupowań chrząszczy omarlicowatych...
Kolejnym czynnikiem wpływającym na zmiany w składzie gatunkowym pożytecznej entomofauny w agrocenozach jest
wykonywanie zabiegów agrotechnicznych, w tym nawożenie mineralne i stosowanie środków ochrony roślin. W przypadku Silphidae brak
jest aktualnych danych dotyczących wpływu chemizacji środowiska
rolniczego na strukturę zgrupowań tych chrząszczy, a jedną z niewielu opisujących to zagadnienie jest publikacja Aleksandrowicza
[2002]. Autor wykazał wzrost liczebności omarlicowatych w uprawie
ziemniaka, gdzie zastosowano insektycyd Decis, przy jednoczesnym
spadku liczby biegaczowatych (Col., Carabidae). Występujące różnice w metodologii badań nie pozwalają na jednoznaczne porównanie
wyników, jednak można wysunąć hipotezę, że stosowanie środków
ochrony roślin nie ma większego wpływu na kształtowanie się
struktury ilościowej- jakościowej omarlicowatych.
WNIOSKI
W badanych uprawach ziemniaków dominował Nicrophorus vespillo, zaś w biocenozach leśnych N. vespilloides.
Najwyższą liczbę chrząszczy odnotowano w Wacławicach, w obydwu typach badanych siedlisk.
Na podstawie otrzymanych wyników można wysunąć hipotezę,
że stosowanie środków ochrony roślin nie ma większego wpływu na
kształtowanie się struktury ilościowo-jakościowej omarlicowatych.
BIBLIOGRAFIA:
ALEKSANDROWICZ O. 2002. Influence of Decis spraying on the community structure and species composition of beetles (Insecta: Coleoptera)
on a potato field. Baltic J. Coleopterol. 2(2): 145–153.
ALEKSANDROWICZ O., KRZĘTOWSKI B. 2004. Zgrupowania epigeicznych
chrząszczy (Insecta: Coleoptera) na skarpie Łyny w Olsztynie. s. 213–
224. W: Fauna miast Europy Środkowej 21. wieku. P. Indykiewicz,
T. Barczak (red.). Wyd. LOGO, Bydgoszcz, 584 ss.
181
Karolina Konieczna, Zbigniew W. Czerniakowski, Tomasz Olbrycht...
ALEKSANDROWICZ O., KOMOSIŃSKI K. 2004. On the fauna carrion beetles (Coleptera, Silphidae) of Mazurian Lakeland (North-Eastern Poland). s.147–153. W: Protection of Coleoptera in the Baltic Sea Region.
J. Skłodowski, S. Huruk, A. Barševkis, S. Tarasiuk (red.). Warsaw Agricultural University Press, 240 ss.
BŁAŻEJEWICZ-ZAWADZIŃSKA M., ŻELAZNA E. 2011. Kopro i nekrofagiczne chrząszcze obszarów zurbanizowanych Bydgoszczy. Zeszyty
Problemowe Postępów Nauk Rolniczych, 562: 21–28.
BŁAŻEJEWSKI F. 1956. Chrząszcze trupożerne rezerwatu cisowego Wierzchlas. Zesz. Nauk. UMK, Biol., Poznań, 1: 63-88.
BURAKOWSKI B., MROCZKOWSKI M., STEFAŃSKA J. 1978. Chrząszcze
Coleoptera, Histeroidea i Staphylinoidea prócz Staphylinidae. Katalog Fauny Polski. PWN, Warszawa, XXIII, 5, 356 ss.
DEKEIRSSCHIETER J., VERHEGGEN F., LOGNAY G., HAUBRUGE E. 2011.
Large carrion beetles (Coleoptera, Silphidae) in Western Europe: a review. Biotechnology, Agronomy, Society and Environment, 15 (3):
435–447.
GREBENNIKOV V. V., NEWTON A. F. 2012. Detecting the basal dichotomies in the monophylum of carrion and rove beetles (Insecta: Coleoptera: Silphidae and Staphylinidae) with emphasis on the Oxyteline group
of subfamilies. Arthropod Systematics & Phylogeny 70: 133–165.
KAMIŃSKA D. 1989. Występowanie chrząszczy omarlicowatych (Silphidae)
na polach uprawnych w okresie wiosenno-letnim. Acta Univ. Nicolai
Copernici, Biol., 33: 45-57.
KASPRZAK K., NIEDBAŁA W. 1981. Wskaźniki biocenotyczne stosowane
przy porządkowaniu i analizie danych w badanych ilościowych. s. 397–
409. W: Metody Stosowane w Zoologii Gleby. Górny M., Grüm L.(red.).
PWN, Warszawa, 483 ss.
KOCH K. 1989. Die Käfer Mitteleuropas. Ökologie. Band 1. Goecke & Evers,
Krefeld, 440 pp.
KOPYŁÓWNA N. 1935. Z badań nad chrząszczami nekrotycznemi pow.
dziśnieńskiego. Prace Tow. Przyj. Nauk w Wilnie, 9: 29–65.
MROCZKOWSKI M. 1955. Omarlicowate – Silphidae. Klucze do Oznaczania
Owadów Polski. Warszawa, XIX, 25, 29 ss.
SZUJECKI A. 1980. Ekologia Owadów Leśnych. PWN, Warszawa, 603 ss.
TROJAN P. 1998. Nowe perspektywy w badaniach faunistycznych. s. 137–
155. W: Materiały Zjazdowe 43. Zjazdu Polskiego Towarzystwa Entomologicznego, Poznań, 4–6 września 1998, Wiad. Entomol. 17, Supl. 207 ss.
182
Materiały do poznania zgrupowań chrząszczy omarlicowatych...
Adres do korespondencji:
mgr Karolina Konieczna
dr inż. hab. prof. UR Zbigniew W. Czerniakowski
dr inż. Tomasz Olbrycht
Uniwersytet Rzeszowski
Wydział Biologiczno-Rolniczy
Katedra Agroekologii
Ul. Ćwiklińskiej 1A, budynek D3
Rzeszów 35-601
Autorzy składają podziękowania Paniom:
Paulinie Żuk, Alicji Szczepańskiej, Kindze Ochał,
Annie Wronie, Anecie Kapałowskiej i Annie Tokarczyk
za udział w pracach terenowych.
183
Iwona Kozikowska
Katarzyna Suprewicz
Helena Sławska
Opiekun naukowy: prof. nadzw. dr hab. Robert Stawarz
EPISTEME
22/2014, t. I
s. 185-193
ISSN 1895-2241
KUMULACJA WYBRANYCH PIERWIASTKÓW
BIOGENNYCH W PĘPOWINIE I KRWI PĘPOWINOWEJ
NOWORODKÓW Z RÓŻNĄ MASĄ URODZENIOWĄ
ACCUMULATION OF SELECTED BIOGENIC METALS
IN UMBILICAL CORD BLOOD AND UMBILICAL CORD
OF NEWBORNS WITH DIFFERENT BIRTH WEIGHT
Abstrakt. Celem badań było określenie średniej zawartości pierwiastków
biogennych (cynku, miedzi, oraz żelaza) w tkankach pępowiny oraz krwi
pępowinowej. Próbki zostały pobrane od kobiet i ich dzieci podczas porodu
ze szpitala w Bytomiu (Polska). Noworodki zostały podzielone na dwie grupy
ze względu na masę urodzeniową: noworodki z niedowagą oraz noworodki
z prawidłową wagą urodzeniową. Zawartości pierwiastków w badanych
tkankach były mierzone metodą FAAS. Przeprowadzone badania wykazały,
że Zn, Cu i Fe są obecne we wszystkich analizowanych tkankach, zarówno
w grupie noworodków z niedowagą jak i z prawidłową masą ciała. Najwyższa
zawartość żelaza zarówno w pępowinie jak i we krwi pępowinowej została
zaobserwowana w grupie noworodków z prawidłową masą ciała. W pępowinie noworodków z niedowagą zaobserwowano wyższą zawartość cynku oraz
miedzi niż w grupie noworodków z prawidłową masą ciała. Podsumowując,
masa ciała noworodków odgrywa istotna rolę w kumulacji pierwiastków tak
w pępowinie, jak i we krwi pępowinowej.
Słowa kluczowe: pępowina, krew pępowinowa, pier wiastki biogenne
Summary. The purpose of the thesis was to determine the average content
of biogenic elements (zinc, copper and iron) in umbilical cord and umbilical
cord blood. The samples were taken from women and their babies during
delivery from hospital in Bytom (Poland). Newborns were divided into two
groups depending on their birth weight: low birth weight and normal birth
weight. The content of elements in all samples were measured using FAAS
method. The conducted study demonstrates that Cu, Zn and Fe were no185
Iwona Kozikowska, Katarzyna Suprewicz, Helena Sławska...
ted in all tissues, both newborns with low birth weight and normal birth
weight. The maximum concentration of iron both in umbilical cord blood
and in umbilical cord was observed among newborns with normal birth
weight. In umbilical cord the group of newborns with low birth weight
higher concentration of Zn and Cu was observed than in newborns with normal birth weight. To summarize, weight of newborns has an impact on medium concentration of elements in umbilical cord blood and umbilical cord.
Key words: umbilical cord, umbilical cord blood, biogenic elements
Wstęp
Niska masa urodzeniowa noworodków jest rezultatem niedostatecznego odżywiania płodów w życiu macicznym [Takaya i in. 2004].
Wiele makro i mikroelementów odgrywa kluczowa rolę w procesie
prawidłowego wzrostu i rozwoju organizmu. Niska masa urodzeniowa noworodków jest głównym czynnikiem wpływającym na śmiertelność, zachorowalność oraz niepełnosprawność w okresie niemowlęcym i dzieciństwie, a także może wpływać na stan zdrowia
w dorosłym życiu, jeśli niska masa ciała utrzymuje się przez długi
okres czasu [WHO 2006]. Ponadto waga urodzeniowa noworodków
wpływa na koncentrację we krwi pępowinowej pierwiastków takich jak miedź czy selen, co może wskazywać na dodatkowe korzyści
w redukcji porodów przedwczesnych [Wells i in. 2011]. Miedź, cynk
i żelazo należą do pierwiastków niezbędnych do życia, odgrywają
kluczową rolę w prawidłowym rozwoju i wzroście płodu [Raghunath
i in. 2000; Ramakrishnan i in. 1999]. Ilość skumulowanych pierwiastków w organizmie człowieka jest zależna od rodzaju pożywienia
oraz środowiska [Vavilis i in. 1997]. Niewiele doniesień naukowych
opisuje stopień koncentracji pierwiastków biogennych w pępowinie
noworodków.
Celem niniejszej pracy było określenie stopnia kumulacji cynku,
miedzi oraz żelaza we krwi pępowinowej oraz w pępowinie noworodków z różną masą urodzeniową.
Materiał i metody
Materiał badawczy stanowiły tkanka pępowiny oraz krew pępowinowa noworodków. Fragmenty tkanek pobrano bezpośrednio w czasie trwania porodu w Klinice Położnictwa i Ginekologii Onkologicz186
Kumulacja wybranych pierwiastków biogennych w pępowinie i krwi pępowinowej...
nej w Bytomiu. W celu dokonania analizy statystycznej, materiał badawczy (tkanka pępowiny, krew pępowinowa) został podzielony ze
względu na masę ciała noworodka. Kryterium podziału pozwoliło
wyodrębnić II grupy: noworodki z niską wagą urodzeniową (I grupa)
oraz noworodki z prawidłową wagą urodzeniową (II grupa). Noworodki z I grupy stanowiły dzieci z masa ciała ≤2500g i były określane
jako niedowaga podczas gdy noworodki z II grupy stanowiły dzieci
z masą ciała >2500g i były określane jako noworodki z normą wagową. Na badania uzyskano pisemną zgodę komisji bioetycznej (Nr
75/KBL/OIL/2010).
Zawartość pierwiastków biogennych (Zn, Cu, Fe) w tkankach
oznaczono stosując metodę płomieniowej atomowej spektrometrii
absorpcyjnej (FAAS) przy użyciu spektrometru Cole-Palmer model
BUCK 200A. Wysuszony i zważony materiał badawczy umieszczono
w kolbach mineralizatora, zalano 2 cm3 kwasu azotowego o stężeniu 65% i ogrzewano przez 2 godziny. Mineralizaty przeniesiono do
kolbek miarowych o pojemności 10 cm3 i dopełniono wodą redestylowaną.
W celu sprawdzenia czy rozkład uzyskanych wyników w próbach
był normalny wykonano test Shapiro­Wilka. Ponieważ założenia normalnego rozkładu nie zostały spełnione, dalsze statystyki oparte
były na teście U Manna­W hitneya. Wszystkie hipotezy zerowe były
falsyfikowane na poziomie istotności α=0.05. Obliczenia statystyczne i analizy zostały przeprowadzone w programie Microsoft Excel
2007 oraz Statistica 10.
Wyniki
W wyniku przeprowadzonych badań we krwi pępowinowej oraz
pępowinie noworodków stwierdzono obecność cynku, miedzi oraz
żelaza. Uzyskane wyniki poddano szczegółowej analizie statystycznej. Średnie zawartości badanych pierwiastków biogennych w tkankach przedstawiono na rycinie 1­3.
Krew pępowinowa charakteryzowała się wyższą niż pępowina średnią zawartością miedzi tak w grupie kobiet których dzieci
urodziły się z niedowagą, jak i w grupie z prawidłową masą ciała
noworodków. W pępowinie noworodków niższy poziom tego metalu (1.567±0.083 μg∙g-1 s.m.) odnotowano w grupie noworodków
187
Iwona Kozikowska, Katarzyna Suprewicz, Helena Sławska...
o prawidłowej masie urodzeniowej. Średnia zawartość miedzi we
krwi pępowinowej noworodków z normą wagową (3.555±0.104
μg∙g-1 s.m.) była niższa niż średnia zawartość tego pierwiastka we
krwi pępowinowej noworodków z niedowagą (4.185±0.341 μg∙g1
s.m.). Wyniki analizy statystycznej zobrazowano na rycinie nr 1.
Analiza statystyczna wykazała istnienie statystycznie istotnych
różnic pomiędzy zawartością miedzi w pępowinie a zawartością tego
pierwiastka we krwi pępowinowej obu grup badawczych (I grupa:
p=0.000, II grupa: p=0.000). Analiza statystyczna wykazała również
występowanie istotnych statystycznie różnic pomiędzy zawartością
miedzi w pępowinie z grupy noworodków z niedowagą a jej zawartością w pępowinie noworodków urodzonych z prawidłową masą ciała (p=0.035).
Ryc. 1. Średnia zawartość miedzi we krwi pępowinowej oraz w pępowinie
noworodków z różną masą ciała [μg∙g-1 s.m.±SE].
Średnia zawartość żelaza we krwi pępowinowej występowała na
zbliżonym poziomie w obu grupach badawczych. Krew pępowinowa
charakteryzowała się istotnie wyższą średnią zawartością żelaza
w porównaniu z pępowiną zarówno w grupie noworodków z niedowagą (2536.634±66.106 μg∙g -1 s.m) jak i noworodków z prawidłową
masą ciała (2557.714±22.462 μg∙g-1 s.m.). Najniższa średnia zawartość tego pierwiastka została stwierdzona w pępowinie noworodków
z niedowagą (61.363±6.17 μg∙g-1 s.m.). Wyniki analizy statystycznej
188
Kumulacja wybranych pierwiastków biogennych w pępowinie i krwi pępowinowej...
zobrazowano na rycinie nr 2. Analiza statystyczna wykazała istnienie statystycznie istotnych różnic pomiędzy zawartością żelaza
w pępowinie a jego zawartością we krwi pępowinowej noworodków
zarówno z grupy noworodków z niedowagą (p=0.000) oraz noworodków z prawidłową masą ciała (p=0.000).
Ryc. 2. Średnia zawartość żelaza we krwi pępowinowej oraz pępowinie
noworodków z różną masą ciała [μg∙g-1 s.m.±SE].
Najniższą średnią zawartość cynku odnotowano we krwi pępowinowej noworodków z niską waga urodzeniową (14.503±1.339 μg∙g -1
s.m). W grupie noworodków z prawidłową masą ciała, najwyższą
średnią zawartość cynku odnotowano w pępowinie (21.128±0.722
μg∙g-1 s.m.). Zarówno w grupie noworodków z niską wagą urodzeniową jak i w grupie noworodków z prawidłową masą ciała średnia zawartość cynku we krwi pępowinowej była bardzo zbliżona.
Wyniki analizy statystycznej zobrazowano na rycinie nr 3. Analiza
statystyczna wykazała istnienie statystycznie istotnych różnic pomiędzy zawartością cynku w pępowinie a jego zawartością we krwi
pępowinowej noworodków z niską wagą urodzeniową (p=0.000)
oraz noworodków z prawidłową masą ciała (p=0.000). Różnice istotne statystycznie odnotowano również pomiędzy zawartością cynku
w pępowinie noworodków z niedowagą a zawartością tego pierwiastka w pępowinie noworodków z prawidłową masą ciała (p=0.009).
189
Iwona Kozikowska, Katarzyna Suprewicz, Helena Sławska...
Ryc. 3. Średnia zawartość cynku we krwi pępowinowej oraz w pępowinie
noworodków z różną masą ciała [μg∙g-1 s.m.±SE].
Dyskusja i wnioski
Do prawidłowego funkcjonowania organizmu niezbędne są zarówno
makro jak i mikroelementy. Uzyskane wyniki badań własnych wykazały obecność pierwiastków biogennych (cynku, miedzi i żelaza)
zarówno we krwi pępowinowej jak i w pępowinie noworodków. Zaobserwowano istotną różnice pomiędzy średnią zawartością miedzi
w pępowinie noworodków z niedowagą a zawartością Cu u noworodków z prawidłową masą ciała. Zaobserwowano także, iż średnie
zawartości tego pierwiastka we krwi pępowinowej noworodków
z niedowagą oraz o prawidłowej wadze urodzeniowej występują
na zbliżonym poziomie. Badania Llanos i Ronco [2009] wykazały,
iż średnia zawartość miedzi w łożysku kobiet których dzieci miały
niską wagę urodzeniową oraz z grupy noworodków z normą wagową
są zbliżone.
Ponadto w badaniach prowadzonych na terenie Śląska stwierdzono, iż średnie zawartości cynku we krwi pępowinowej noworodków
z niedowagą oraz o prawidłowej wadze urodzeniowej są zbliżone, co
zostało wcześniej potwierdzone w badaniach Srivastava i in. [2002].
Prasad i in. [1974] również nie znaleźli żadnych znaczących relacji pomiędzy wagą urodzeniową noworodków a zawartością cynku we krwi
pępowinowej. Średnia zawartość cynku we krwi pępowinowej nowo190
Kumulacja wybranych pierwiastków biogennych w pępowinie i krwi pępowinowej...
rodków z Portugalii określona w badaniach Custódio i in. [2005] była
zbliżona do średniej zawartości tego pierwiastka we krwi pępowinowej noworodków z Bytomia. W badaniach przeprowadzonych na
Śląsku zaobserwowano również, iż noworodki z niską wagą urodzeniową kumulują większe ilości cynku w pępowinie niż noworodki
z prawidłową masą ciała. Prawdopodobnie są to rezerwy mineralne
niezbędne płodowi do dalszego, prawidłowego rozwoju. Zapotrzebowanie na miedź i cynk przez płód wydaje się być silne i oba pierwiastki w znacznym stopniu są niezbędne dla prawidłowego rozwoju
płodu, o czym świadczy dodatnia korelacja pomiędzy zawartością
miedzi a zawartością cynku we krwi pępowinowej noworodków [Parajuli i Fujiwara 2012].
W okresie ciąży, a zwłaszcza w trzecim trymestrze, zapotrzebowanie organizmu ciężarnej kobiety na żelazo jest zwiększone
i może ono być kilka razy wyższe niż w pozostałych okresach życia
[Hallberg 1992]. W literaturze niewiele jest doniesień naukowych
dotyczących kumulacji żelaza w pępowinie noworodków. W badaniach własnych stwierdzono, iż masa ciała noworodków nie wpływa na
kumulację żelaza w pępowinie. Wyniki przeprowadzonych badań wskazują również, iż kumulacja żelaza w tkankach krwi pępowinowej
występuje na zbliżonym poziomie zarówno w grupie noworodków
z niedowagą jak i o prawidłowej wadze urodzeniowej. Srivastava
i in. [2002] zaobserwował z kolei dodatnią korelacja pomiędzy zawartością żelaza we krwi pępowinowej noworodków a wagą urodzeniową
oraz wiekiem ciążowym kobiety. Masa ciała noworodków wpływa zatem na kumulację wybranych pierwiastków biogennych w tkankach
pępowiny i krwi pępowinowej.
191
Iwona Kozikowska, Katarzyna Suprewicz, Helena Sławska...
Bibliografia
Custódio, P. J., Carvalho, M. L., Nunes, F., Pedroso, S., Campos, A. 2005.
“Direct Analysis of Human Blood (mothers and Newborns) by Energy
Dispersive X­R ay Fluorescence.” Journal of Trace Elements in Medicine and Biology : organ of the Society for Minerals and Trace Elements
(GMS) 19(2­3):151–58.
Hallberg, L. 1992. “Iron Balance in Pregnancy and Lactation. In: Fomon SJ,
Zlotkin S (eds) New York.” Nutritional Anemias. Raven 13–25.
Llanos, M. N., and Ronco, A. M. 2009. “Fetal Growth Restriction Is Related to Placental Levels of Cadmium, Lead and Arsenic but Not with
Antioxidant Activities.” Reproductive toxicology (Elmsford, N.Y.)
27(1):88 -92.
Parajuli, Rajendra Prasad, and Takeo Fujiwara. 2012. “Cord Blood Levels of
Toxic and Essential Trace Elements and Their Determinants in the Terai Region of Nepal : A Birth Cohort Study.” Biological Trace Element
Research (147):75–83.
Prasad, L. S. N., Ganguly, S. K., and Vasuki, K. 1974. “Role of Zinc in Fetal
Nutrition.” Indian Pediatrics (11):799–802.
Raghunath, R., Tripathi, R.M., Sastry, V.N., and Krishnamoorthy, T.M.
2000. “Heavy Metals in Maternal and Cord Blood.” The Science of the
Total Environment 250(1­3):135–41.
Ramakrishnan, U., Manjrekar, R., Rivera, J., Gonzalescossio, T., and Martorell, R. 1999. “Micronutrients and Pregnancy Outcome. A Review of
the Literature.” Nutrition Research 19:103–12.
Srivastava, S., Mehrotra, P.K., Srivastava, S.P., and Sddiqui, M.K.J. 2002.
“Some Essential Elements in Maternal and Cord Blood in Relation to
Birth Weight and Gestational Age of the Baby.” Biological Trace Element Research 86:97–105.
Takaya, J., Yamato, F., Higashino, H., and Kobayashi, Y. 2004. “Relationship
of Intracellular Magnesium of Cord Blood Platelets to Birth Weight.”
Metabolism 53(12):1544–47.
Vavilis, D., Bontis J., Agorastos T., i wsp. 1997. “Lead Concentrations in
Early Human Milk of Urban and Rural Mothers.” Clinical & Experimental Obstetrics & Gynecology 4(XXIV).
Wells, E. M., Jarrett, J. M., Lin, Y. H., Caldwell, K. L., Hibbeln, J. R., Apelberg, B. J., Herbstman, J., Halden, R. U., Witter, F.R., Goldman, L. R.
2011. “Body Burdens of Mercury, Lead, Selenium and Copper among
Baltimore Newborns.” Environmental Research 111(3):411–17.
WHO. 2006. “Promoting Optimal Fetal Development—Report of a Technical Consultation.” World Health Organization, Geneva.
192
Kumulacja wybranych pierwiastków biogennych w pępowinie i krwi pępowinowej...
Adres do korespondencji:
mgr Iwona Kozikowska
Instytut Biologii, Zakład Zoologii Kręgowców i Biologii
Człowieka, Uniwersytet Pedagogiczny w Krakowie
ul. Podbrzezie 3, 31­054 Kraków
e-mail: [email protected]
mgr Katarzyna Suprewicz
Instytut Biologii, Zakład Zoologii Kręgowców i Biologii
Człowieka, Uniwersytet Pedagogiczny w Krakowie
e-mail: [email protected]
dr hab. Helena Sławska
Kliniki Położnictwa i Ginekologii Onkologicznej w Bytomiu
Katedra Ginekologii i Położnictwa, Oddział
Noworodków, Śląski Uniwersytet Medyczny
e-mail: [email protected]
193
Kinga Kraska, Grzegorz Formicki
Edyta Kapusta, Magdalena Semla
Marta Batoryna, Martyna Błaszczyk
Opiekun naukowy: dr hab. Grzegorz Formicki prof. UP
EPISTEME
22/2014, t. I
s. 195-203
ISSN 1895-2241
WPŁYW ALKOHOLU ETYLOWEGO NA POZIOM
GLUTATIONU ZREDUKOWANEGO W WĄTROBIE
I NERKACH U MYSZY
THE CONTENT OF REDUCED GLUTATHIONE
IN LIVER AND KIDNEYS AFTER ETHYL
ALCOHOL ADMINISTRATION
Abstrakt. Alkohol etylowy dostaje się do organizmu wraz ze spożywanymi
napojami. Łatwo i szybko przenika przez błony komórkowe do tkanek
i krwi. Miejscem największej absorpcji są żołądek i jelita. W organizmie utlenia się do aldehydu octowego, który zwiększa jego negatywny wpływ. Celem
przeprowadzonego eksperymentu było zbadanie poziomu glutationu zredukowanego w wątrobie, która odgrywa szczególną rolę w detoksykacji alkoholu i nerkach, gdzie w kanalikach proksymalnych zwiększoną aktywność
wykazuje b-liaza. Przeprowadzony eksperyment wykazał, iż alkohol etylowy
wpływa na obniżenie poziomu glutationu zredukowanego w wątrobie i nieznaczne podwyższenie w nerkach. Zmiany poziomu glutationu zredukowanego mogą być związane z tworzeniem reaktywnych form tlenu w wyniku
reakcji glutationu zredukowanego z ksenobiotykiem jakim jest alkohol.
Słowa kluczowe: alkohol etylowy, glutation zredukowany, myszy, nerki,
wątroba
Summary. Ethyl alcohol easily and readily passes through cell membranes
to the blood and next to different tissues and organs. The highest absorption occurs in stomach and intestine. Ethyl alcohol is oxidized to acetaldehyde, which shows high toxicity, especially to neural tissue. The aim of
the experiment was to examine the level of reduced glutathione in the liver,
which plays a special role in the detoxification of alcohol and kidneys, where
the proximal tubules has an increased activity of b-lyase. The experiment
showed that application of ethyl alcohol leads to the decrease of reduced
glutathione concentration in the liver and slight increase of its concentra195
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta, Magdalena Semla...
tion in the kidneys. Changes in the concentrations of reduced glutathione
after administration of ethyl alcohol lead to the suggestion that imbalance
in redox reactions is one of the mechanisms of toxic action of ethanol.
Key words: ethyl alcohol, reduced glutathione, mice, kidney, liver
Introduction
Ethyl alcohol can be an effect of the glucose metabolism during alcohol fermentation conducted by microorganisms, such as fungi and
bacteria. Ethanol enters the body usually via ingestion of consumed
liquids. It is metabolized by the organism. One of the ways of alcohol
alteration occurs via alcohol oxidation to acetaldehyde by means of
alcohol dehydrogenase, using NAD and producing NADH. The ethyl
alcohol itself is not as harmful for our organism as its oxidation product, i.e. acetaldehyde. Negative consequences of alcohol consumption may be heightened by the fact that ethanol easily penetrates cell
membranes and further goes to tissues and blood, i.e. in the mouth.
The greatest absorption of alcohol takes place in our stomach and
intestines. There are four pathways of biochemical alcohol alterations. The first pathway of alcohol alteration consists in ethanol oxidation to acetaldehyde by means of alcohol dehydrogenase and subsequently to acetate by means of aldehyde dehydrogenase and takes
place in liver. The first stage of the alteration cycle is formation of
the complex of alcohol dehydrogenase/NAD+. The second pathway
of microsomal ethanol-oxidizing system (MEOS) proceeds in the
endoplasmic reticulum of liver cells and is crucial for the process of
catabolism of larger, more frequently consumed amounts of alcohol.
The microvilli pathway is active, when the system of both dehydrogenases of the first pathway, i.e. alcohol dehydrogenase and aldehyde dehydrogenase, is insufficient. In this pathway there is an active
system supporting cytochrome P-450, mostly isoenzyme II E1 [Bartosz 2003], which utilizes about 6 percent of the dose of alcohol consumed [Małkowska & Szutowski 2009]. The microvilli system takes
part in the metabolism of methyl alcohol, which is particularly toxic,
as well as other alcohols with their particles longer than ethanol and
methanol. Some kind of jeopardy connected with the existence of
this pathway constitutes the formation of free hydroxyl radicals. The
third metabolic pathway is a biochemical system including catalase
196
Wpływ alkoholu etylowego na poziom glutationu zredukowanego w wątrobie...
that occurs as a result of addition by means of hydrogen peroxide
H202. Catalase shows two properties – catalase and peroxide, depending on the availability of hydrogen peroxide. With higher concentration of H202 dominant is catalase activity that causes the hydrogen
peroxide to decompose into water and oxygen. With lower concentration dominant is however peroxide activity, with i.e. hydrogen, ethanol and methanol being the substrates [Ścibor & Czeczot 2006]. The
alcohol alteration is probably much more intensive in stomach than
in liver because of the lower availability of hydrogen peroxide. According to the above suggestion people showing higher catalase activity
in blood cells can consume more alcohol than on average. The fourth
pathway consists in the non-oxidative reactions – coupling with glucuronic acid, sulfuric acid or free fatty acids through esterification.
Although this pathway is not that important it can lead to damage of
parenchymatous organs, such as liver [Kumański & Kamińska 2012].
The fastest and most effective are the two first pathways, in case of
which the first metabolite constitutes acetaldehyde.
Glutathione is a tripeptide composed of three amino acids
cysteine​​, glutamic acid and glycine. It is a very powerful antioxidant [Bukowska 2004], while alcohol affects the redox state of cells,
changing the ratio of GSH/GSSG and impairs their function. Particularly vulnerable to the adverse effects of ethanol are liver, skeletal muscles, lung, the heart muscle. The effects of alcohol can also
affect the immune mechanisms and apoptosis in cells [Kamińska and
Kumański 2012].The high concentration of glutathione is in the kidneys and liver. The concentration of intracellular glutathione is 3-4
times higher than extracellular concentration. According to Łukaszewicz-Hussain [2003] the highest concentration of glutathione was
recorded in liver and is associated with the ability of the hepatocyte
to convert cysteine-methionine by transsulfuration. Glutathione is
formed in the hepatocyte cytosol and is transported into the mitochondria as they have no possibility of synthesizing GSH. High reactivity is related to the presence of the thiol group in GSH molecule.
The main role of glutathione is related to leveling damage caused by
reactive oxygen species (ROS).
197
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta, Magdalena Semla...
Material and methods
The study was performed in twenty 12 weeks old males of Swiss
mice. Animals were fed with standard diet and grown in 12/12 light/
dark photoperiod, weight 26g. Animals were segregated into three
experimental groups and one control group. Total number of animals
was n=24. Each animal consumed from drinking bowls 6 ml of ethanol solution per day. The animals from control group were given water. The experiment lasted 14 days. Animals of the first experimental
group were treated orally with ethanol (5% solution). The daily dose
of ethyl alcohol was of 0.24 mg / day. Animals of the second experimental group were treated with ethanol (10% solution). The daily
dose of ethyl alcohol was of 0.42 mg / day. Animals of the third experimental group were poisoned with ethanol (15% solution). The daily
dose of ethyl alcohol was of 0.585 mg / day. We used for the analyzes
0.5 g of the right lobe of the liver and left kidney. Each kidney weighted 200mg. 24h after the last oral administration the animals were
introduced into a state of deep anesthesia and decapitated. The level
of reduced glutathione was determined in liver and kidneys. Dissected organs were weighed and washed with physiological saline. Then
homogenized in 0.1 M phosphate buffer, pH 7.4 containing EDTA.
The homogenate was centrifuged for 15 min in a centrifuge MPW365 at 4°C and 15 000 rpm. The resulting supernatant was deproteinized by adding 500 μl of the supernatant and 500 μl of 10% TCA
and 500 ml EDTA. The mixture was put into the refrigerator for 10
min, next centrifuged for 5 min at 6300 rpm. GSH was determined
by the colorimetric method of Ellman (1970). The concentrations of
GSH were measured with microplate reader Sunrise TECAN. To determine the differences between the groups one way ANOVA test was
used followed by post hoc analysis using Tukey’s test. The significant
level was established at p<0.05. The used procedures were accepted
by the Local Ethical Committee, Resolution No. 132/2013.
Results
During the experiment, there was no change in the body weight. The
studies showed a decrease in the concentration of reduced glutathione in all experimental groups. The largest decrease was observed in
198
Wpływ alkoholu etylowego na poziom glutationu zredukowanego w wątrobie...
the first experimental group after alcohol administration at a dose of
0.24 mg / day for a period of 14 days. Differences between the groups
were not statistically significant (F = 0.34, p = 0.80) (Fig. 1.)
Fig. 1. The content of reduced glutathione (µM/g) in liver of mice after fourteen days of ethanol administration; a – no significant differences detected
GSH concentrations in experimental groups I and II were somewhat higher than in control animals. Whereas kidneys of animals
from the III experimental group contained lower concentration of
GSH than kidneys of control animals. On the other hand ANOVA
showed insignificant differences between animals from the consecutive groups (F=0.35, p=0.79) – Figure 2.
Fig. 2. The content of reduced glutathione (µM/g) in kidneys of mice after fourteen days of ethanol administration; a – no significant differences detected
Discussion
Animal study indicated that alcohol reduces the level of reduced glutathione which may cause an oxidative stress. GSH strongly acts on
199
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta, Magdalena Semla...
tissues being in the state of oxidative stress caused by the action of
alcohol [Kamińska and Kumański 2012]. In physiological conditions
the changes are removed by enzymatic and non-enzymatic antioxidant system. The oxidative stress and impaired GSH level arise from
the imbalance between the formation and removal of free radicals
[Świderska et al. 2012]. According to Bailey et al [2001] alcohol can
decrease in the concentration of GSH in liver cells by the induction of
oxidative stress, changes in the GSH / GSH-Px ration and the oxidative modification of liver proteins. Reduced level of GSH occurs in alcoholism, diabetes [Yu and in.2001] and AIDS [Clarke and in.2002].
Pro-oxidative effect of ethanol according to Bilska [2007] depends on
the induction of cytochrome P450 isoform CYP 2 E1, which can accelerate the production of reactive forms of oxygen and have negative
impact on nucleic acids and other energetic substrates.
The processes of biosynthesis and biodegradation of glutathione belong to the most interesting metabolic processes, known as gglutamyl cycle. The basic substrates in biosynthesis are three amino acids: L-a glutamate, L-a cysteine and glycine. The availability of
cysteine is a factor that can influence the speed of glutathione formation. Liver and kidneys, in which the enzymes connected with
the amino acid biodegradation are located, can take advantage of
methionine as a cysteine precursor. In other tissues plasma is the
only source of cysteine.
The decline in reduced glutathione level can be caused by the
reactions of formation of S-conjugates with electrophile, toxic, exoand endogenous substances (GSX). The detoxification process leads
to the increase of the substance hydrophilicity and their better excretion through kidneys. Most of S-conjugates of cysteine undergo
a reaction of N-acetylation and turn into non-toxic mercapturic acids
excreted in urine. However, some of the S-conjugates are decomposed by b-lyase and release pyruvate, ammonia and other toxic thiols.
The toxicity is intensified in kidneys due to high activity of b-lyase
in proximal tubules that leads to the release of toxic RTF and thiols.
In kidneys there is also higher activity of N-deacetylase that enables
the transformation of mercapturates into S-conjugates. The formation of such connection of xenobiotic with GSH not only has negative
impact, but also can damage the cell or even lead to carcinogenesis
200
Wpływ alkoholu etylowego na poziom glutationu zredukowanego w wątrobie...
[Bilska 2007]. This process results in a loss of the rest of cysteine and
thus depletes the cellular GSH pool, what could explain the depletion
of the reduced glutathione concentration in the examined organs.
Conclusions
Ethyl alcohol insignificantly influences the concentration of reduced
glutathione in the liver and kidneys of mice. The largest decrease in
GSH concentration was observed in the liver. Lowering the level of
reduced glutathione may cause oxidative stress and disturbances in
the functioning of cells and organs.
References
Bailey S.M. Patel V.B. Young T.A. Asayama K. 2001. Cunningham C.C. Chronic ethanol consumption alters the glutathione/glutathione peroxidase-1 system and protein oxidation status in rat liver. Alcohol Clin. Exp.
Res., 25, 726-733.
Bartosz G. 2003. Druga twarz tlenu. Wolne rodniki w przyrodzie. PWN,
Warszawa.
Bilska A. Kryczyk A. Włodek L. 2007. Różne oblicza biologicznej roli glutationu. Postepy High Med. Dos. (online), 61:438-453.
Bukowska B. 2004. Glutation: Biosynteza, czynniki indukujące oraz stężenie
w wybranych jednostkach chorobowych. Medycyna Pracy, 55(6): 501-509.
Clarke S.F. Guy P.L. Burritt D.J. Jameson P.E. 2002. Changes in the activities
of antioxidant enzymes in response to virus infection and hormone
treatment. Pysiol. Plant.,114, 157-164.
Ellman G.L. 1970. SH groups determination in biological fluids. Analytical
Biochemistry, 46, 237.
Kamińska A. Kumański K. 2012. Alkohol a glutation. Kosmos problemy
nauk biologicznych, Polskie Towarzystwo Przyrodników im. Kopernika, 61, 1 (294), 105–120.
Kumański K. Kamińska A. 2012. Różne drogi metaboliczne alkoholu etylowego w tkankach. Kosmos problemy nauk biologicznych, Polskie
Towarzystwo Przyrodników im. Kopernika, 61, 1 (294) : 29-35.
Łukaszewicz - Hussain A. 2003. Rola glutationu i enzymów z nim związanych
w procesach antyoksydacyjnych organizmu. Medycyna Pracy, 54 (5): 473479.
201
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta, Magdalena Semla...
Małkowska A. Szutowski M. 2009. Wartość diagnostyczna etyloglukuronianu (EtG) jako wskaźnika konsumpcji alkoholu. Alkoholizm Narkomania 22, 189-201.
Ścibor D. Czeczot A. 2006. Katalaza – budowa, właściwości, funkcje. Postępy
Higieny Medycyny Doświadczalnej (online), 60: 170-180.
Świderska-Kołacz G. Kumański K. Parka B. 2012. Alkohol a stres oksydacyjny.
Kosmos problemy nauk biologicznych, Polskie Towarzystwo Przyrodników im. Kopernika, 61, 1 (294), 93-103.
Yu B.P. Chung H.Y. 2001. Oxidative stress and vascular aging. Diabetes Res.
Clin. Pract., 54: S73-S80.
202
Wpływ alkoholu etylowego na poziom glutationu zredukowanego w wątrobie...
Adres do korespondencji:
mgr Kinga Kraska
Pedagogical University of Cracow
Faculty of Geography and Biology, Institute of Biology,
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland,
+48 126626720
e-mail: [email protected]
dr hab. Grzegorz Formicki prof. UP
Pedagogical University of Cracow
Faculty of Geography and Biology, Institute of Biology
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland,
+48 126626720
e-mail: [email protected]
jmgr Edyta Kapusta
Pedagogical University of Cracow
Faculty of Geography and Biology, Institute of Biology
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland
+48 126626720
e-mail: [email protected]
mgr Magdalena Semla
Pedagogical University of Cracow
Faculty of Geography and Biology, Institute of Biology
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland,
+48 126626720
e-mail: [email protected]
mgr Martyna Błaszczyk
Pedagogical University of Cracow
Faculty of Geography and Biology, Institute of Biology,
Department of Vertebrates Zoology and Human Biology
Podbrzezie 3, 31-054 Cracow, Poland,
+48 126626720
e-mail: [email protected]
203
Dawid Król, Edyta Bańcyr
Paulina Jawor, Tadeusz Stefaniak
Opiekun naukowy: Wojciech Nowacki
EPISTEME
22/2014, t. I
s. 205-211
ISSN 1895-2241
ROZPOZNANIE CIĘŻKIEGO PORODU
NA PODSTAWIE ZMIAN SEKCYJNYCH
U MARTWO URODZONYCH CIELĄT
THE DIAGNOSIS OF DIFFICULT CALVING DURING
NECROPSY IN STILLBORN CALVES
Abstrakt. Martwo urodzone cielęta są stratą w hodowli bydła, nie tylko
z powodu zmniejszenia ilości zwierząt do remontu, ale również ze względu
na wzrost ryzyka komplikacji poporodowych u matki. Trudny poród i niedotlenienie są jednymi z najczęściej wymienianych przyczyn śmierci okołoporodowej. Notowane są także przypadki, gdzie poród nie był nadzorowany
i martwe cielę zostaje znalezione w porodówce. W takich sytuacjach badanie
sekcyjne może pomóc w rozpoznaniu przyczyny śmierci cielęcia. Celem pracy
było określenie przydatności badania sekcyjnego w rozpoznaniu ciężkiego
porodu. Materiał do badań stanowiło 18 martwo urodzonych cieląt po ciąży
trwającej co najmniej 260 dni. Podczas badania obserwowano głównie zmiany
wskazujące na niedotlenienie płodu oraz widoczne podczas badania sekcyjnego urazy mechaniczne. Przeprowadzone badania sekcyjne mogą być cenną
informacją dla lekarzy weterynarii na temat przebiegu porodu.
Słowa kluczowe: ciężki poród, zmiany sekcyjne, cielę martwo urodzone
Summary. Stillborn calves generates losses in cattle production. It decreases numbers of heifers for the replacement and increases risk of complications in dam after calving. Dystocia and hypoxia are one of the most important causes of death. There are cases when calving was not supervised
and calf have been found in calving pen. In those situations the necropsy
could be helpful in identifying the cause of death. The aim of the study was
to determine the usefulness of necropsy in the diagnosis of difficult calving.
Eighteen stillborn calves, after at least 260 days of pregnancy were included to study. During internal examination changes indicating fetal hypoxia
and damage due to mechanical injures were mostly noticed. The most commonly observed changes were attributable to fetal hypoxia and mechanical
injuries. The necropsy could be the good indicator of calving difficulty for
veterinarians.
Key words: dystocia, necropsy changes, stillborn calf
205
Dawid Król, Edyta Bańcyr, Paulina Jawor, Tadeusz Stefaniak, Wojciech Nowacki
Wstęp
Ciężki poród występuje w każdym gospodarstwie zajmującym się hodowlą bydła. Ma on najczęściej podłoże wieloczynnikowe, na które
składają się błędy hodowlane takie jak: niewłaściwy odchów jałówek,
zbyt wczesny termin krycia, błędy żywieniowe prowadzące do nadmiernego otłuszczenia, niewłaściwy dobór buhaja, błędy podczas udzielania pomocy porodowej, brak dozorowania porodów [Mee 2011].
Niekiedy, pomimo zachowania wszelkich norm hodowlanych, problem
ciężkiego porodu i tak się pojawia. Może być to związane z wystąpieniem dysproporcji płodowo-matczynej, niewłaściwego ułożenia cielęcia
w trakcie porodu, wad wrodzonych cielęcia, ciąży mnogiej, problemów
z przebiegiem akcji porodowej. Od wielu lat obserwowany jest na świecie wzrost odsetka porodów kwalifikowanych jako trudny [Gustafsson i in. 2007]. Wzrost ten jest związany z postępem hodowlanym
szczególnie widocznym na przykładzie rasy Holsztyńsko-Fryzyjskiej
nastawionej na wysoką produkcyjność mleczną. Ciężki poród przeważnie jest kojarzony z pomocą personelu podczas wycielenia lub
z koniecznością interwencji lekarsko-weterynaryjnej. Problem ten
jest niekorzystny nie tylko z punktu widzenia hodowlanego ale i także
ekonomicznego. Konieczność udzielenia pomocy porodowej generuje
dodatkowe koszty lekarsko-weterynaryjne jak również często skutkuje także stratami w postaci problemów poporodowych u matki, takich jak: urazy mechaniczne, stany zapalne narządu rodnego, problemy
z płodnością, wzrost ryzyka brakowania, zmniejszona produkcja mleka
[Dematawewa i Berger, 1997].
Częstym następstwem ciężkiego porodu jest śmierć cielęcia, które w przypadku samicy mogło by zostać potencjalną matką
o dużej wartości hodowlanej albo w przypadku osobników płci
męskiej - opasem lub buhajem zarodowym. Przebieg porodu jest
wyznacznikiem stanu rodzących się cieląt. Mimo braku widocznych
zmian zewnętrznych w organizmie cieląt zachodzi wiele zmian,
których rozpoznanie jest możliwe jedynie w trakcie przeprowadzonego badania sekcyjnego u cieląt martwo urodzonych.
Obecnie przyjęte normy definiują martwe urodzenia u bydła jako
urodzenie się martwego cielęcia po 260 dniu ciąży. Jeśli cielę urodzi
się żywe, ale padnie w ciągu 24 godzin po porodzie, jest również kwalifikowane jako martwo urodzone [Berglund i in. 2003]. Pomimo
206
Rozpoznanie ciężkiego porodu na podstawie zmian sekcyjnych...
kojarzenia martwo urodzonych cieląt przede wszystkim z ciężkim
porodem (związanym z dużymi gabarytami cielęcia w stosunku do
rozmiarów matki, czy niewłaściwym ułożeniem podczas porodu)
wyniki badań naukowych na temat przyczyn śmierci noworodków
podają także inne możliwości: urazy mechaniczne, zmiany w narządach wskutek niedotlenienia, aspiracja smółki, wady wrodzone. Do
możliwych powodów śmierci cieląt zalicza się także czynniki niebędące
bezpośrednią przyczyną śmierci lecz osłabiające żywotność cielęcia.
Wśród czynników osłabiających żywotność cielęcia wymienia się: infekcje śródmaciczne, niedobór surfaktantu, przedwczesne odklejanie się łożyska, niewydolność łożyska, śródmaciczne zahamowanie
wzrostu, przedłużający się poród, zatrucia, niedobory mikroelementów
[Mee 2011]. Należy podkreślić, iż czynniki osłabiające żywotność cielęcia mogą wystąpić także u cieląt, które urodziły się w wyniku łatwego
porodu i w takich przypadkach ich śmierć, podobnie jak w przypadku
poronień, jest niemiłym zaskoczeniem.
Materiał i metody
Materiał badawczy stanowiło 18 martwo urodzonych cieląt
urodzonych po 260. dniu ciąży, które zostały poddane badaniu
sekcyjnemu w Zakładzie Patomorfologii Uniwersytetu Przyrodniczego we Wrocławiu w ramach grantu NCBiR nr PBS2/A8/20/2013.
Procedura sekcji obejmowała ważenie cielęcia, oględziny zewnętrzne oraz oględziny wewnętrzne wraz z pobraniem prób materiału do
badań. Badanie każdego cielęcia odbywało się według opracowanego
protokołu badania sekcyjnego.
Wyniki
Przeprowadzone badania sekcyjne wykazały różne zmiany w badanym materiale. Dominującą grupą były zmiany związane z niedotlenieniem płodu w trakcie akcji porodowej. Niedotlenienie płodu
manifestowane jest poprzez powstawanie wybroczyn w szczególności
w narządach klatki piersiowej i szyi. W 15 przypadkach (83%) zaobserwowano obecność wybroczyn, zwiększoną ilość płynów w jamach
ciała, przekrwienie mózgu, oddanie smółki. Lokalizację zmian charakterystycznych dla niedotlenienia i ich częstotliwość występowa207
Dawid Król, Edyta Bańcyr, Paulina Jawor, Tadeusz Stefaniak, Wojciech Nowacki
nia przedstawia tab.1. W przypadku 9 cieląt (50%) zaobserwowano
zmiany w okolicach ucisku linek porodowych, obrażenia obejmowały
głównie uszkodzenia naczyń, pochewek ścięgnowych i okostnej
w okolicy ucisku. W dwóch przypadkach (11%) stwierdzono przecięcie języka przez zęby cieląt. W 8 przypadkach (44%) zaobserwowano krwiaki w tkankach miękkich zlokalizowane w tkance podskórnej, mięśniach kończyn, kręgosłupa lub na ścianie klatki piersiowej.
U 3 osobników (17%) w trakcie sekcji stwierdzono złamania żeber,
a w jednym przypadku złamanie żeber i kręgosłupa (5%).
Tab. 1. Stwierdzane sekcyjnie zmiany wskazujące na niedotlenienie
u martwo urodzonych cieląt
Zmiana
Liczba cieląt ze
stwierdzoną
zmianą
Procent ogółu
1.
Wybroczyny na ścianie klatki
piersiowej
11
61
2.
Wybroczyny pod nasierdziem
6
33
3.
Wybroczyny w świetle
tchawicy
8
44
4.
Wybroczyny na grasicy
7
39
5.
Wybroczyny na spojówkach
4
22
6.
Obecność płynów w jamach
ciała (brzusznej i/lub piersiowej)
10
55
7.
Płyn w worku osierdziowym
3
17
8.
Ślady smółki na sierści
7
39
9.
Przekrwienie mózgu
6
33
L.p.
Dyskusja
Ciężki poród wymaga udzielenia pomocy cielącej się krowie/jałowicy.
Pomoc ta z reguły polega na wspomaganiu wypierania płodu poprzez
mechaniczne pociąganie cielęcia. W celu ułatwienia wypierania cielęcia personel porodowy korzysta z różnych narzędzi, wśród których
najczęściej używane są linki porodowe. Zakładane są głównie na
208
Rozpoznanie ciężkiego porodu na podstawie zmian sekcyjnych...
kończyny cielęcia, w zależności od położenia są to kończyny piersiowe lub miedniczne. Wykorzystuje się także inne dostępne części
ciała w celu poprawy skuteczności ciągnięcia cielęcia. Użycie dużej
siły ciągnącej poprzez personel lub przystosowany to tego zabiegu
sprzęt powoduje powstawanie dużych naprężeń i przeciążeń. Silne
naciągnięcie linek porodowych zakładanych na kończyny w postaci
pętli powyżej stawów pęcinowych powoduje ich zaciskanie się, co
wpływa na zmiany w tkankach znajdujących się pod linią ucisku linek.
Ponadto zbyt silne ciągnięcie cielęcia może prowadzić do naderwania mięśni, pękania naczyń krwionośnych i kości, które nawet jeśli
zwierzę przeżyje poród utrudnią/uniemożliwią mu dalsze funkcjonowanie. Różnica pomiędzy wielkością kanału rodnego a rozmiarami
cielęcia powoduje także wzrost ucisku na organizm cielęcia w trakcie jego przechodzenia przez kanał miednicy, co skutkuje spowolnieniem wypierania płodu, oraz silniejszym ciągnięciem. Duży nacisk
na kości głowy przy przechodzeniu przez kanał miednicy prawdopodobnie spowodował przecięcie języka u dwóch cieląt przez zęby.
Zaobserwowane w trakcie sekcji urazy mechaniczne (krwiaki, złamania) wskazują na ciężki przebieg porodu, na co wskazuje obecność
wybroczyn w zaobserwowanych w trakcie sekcji. Połączenie ciężkiego porodu oraz rozwoju niedotlenienia było najczęściej stwierdzaną
przyczyną martwych urodzeń cieląt [Mee i in. 2013]. Silny stres
u cieląt w stanie hipoksji porodowej skutkuje także przedwczesnym
wydalaniem smółki, co można było zaobserwować na sierści noworodków. Pojawienie się wybroczyn na narządach i spojówkach wynika
ze spowolnienia przepływu żylnego z powodu ucisku na tkanki przy
jednoczesnym napływie krwi tętniczej. Ciągły napływ krwi tętniczej powoduje przepełnienie naczyń włosowatych i w konsekwencji
prowadzi do pękania tych drobnych naczyń krwionośnych [Ely i Hirsch 2000]. Obecność wynaczynień i krwiaków szczególnie w tkance
podskórnej wynika z dysproporcji pomiędzy rozmiarem dróg rodnych
matki a wielkością cielęcia i wskazuje na ciężki przebieg akcji porodowej [Berglund i in. 2003]. U 22% cieląt zaobserwowano złamania
żeber, najczęściej w połowie długości klatki piersiowej. Związane to
jest z obecnością elementów układu kostnego kończyny piersiowej
z towarzyszącymi mięśniami, które poszerzają obrys klatki piersiowej. Przyczyna złamań żeber u noworodków najczęściej wynika,
209
Dawid Król, Edyta Bańcyr, Paulina Jawor, Tadeusz Stefaniak, Wojciech Nowacki
z trudnego porodu lub/i nieumiejętnie prowadzonej resuscytacji cielęcia przez personel. Złamanie kręgosłupa o charakterze awulsyjnym
jest spotykane u cieląt ze zmienną częstotliwością (3-25%) [Mee
2011]. Duże znaczenie w wystąpieniu tego urazu ma sposób udzielania pomocy porodowej jak również stan rozkładu cielęcia w przypadku obumarcia w jamie macicy.
Wnioski
Analiza sekcyjna cieląt martwo urodzonych wskazuje, iż najczęstszą
przyczyną śmierci cieląt jest zaawansowana hipoksja w następstwie
ciężkiego porodu. W celu ograniczenia problemu śmiertelności cieląt
w okresie okołoporodowym należy się skupić na istotnych aspektach
hodowlanych:
• ocenie pokroju i dojrzałości somatycznej sztuk kierowanych
do krycia,
• doborze nasienia buhaja uwzględniającym parametry sztuk
przeznaczonych do unasienniania,
• profesjonalnym przygotowaniu położniczym personelu
odbierającego porody i stosowaniu najnowszych metod resuscytacji.
• kontroli stanu kondycji matek.
Ponadto zmiany będące skutkiem ciężkiego porodu mogą
odwrócić uwagę od innych, słabiej wyrażonych czynników jak niedobory lub infekcje śródmaciczne, które dodatkowo osłabiają żywotność cieląt . Wieloprzyczynowość problemu śmiertelności okołoporodowej cieląt wymaga wdrożenia kompleksowego planu profilaktycznego, co pozwoli na znaczące poprawienie parametrów produkcyjnych w wielu stadach bydła.
Bibliografia
Berglund B, Steinbock L, Elvander M 2003: Causes of stillbirth and time
of death in Swedish Holstein calves examined post mortem. Acta Vet.
Scand. 44: 111-120.
Dematawewa C.M., Berger P.J. 1997. Effect of dystocia on yield, fertility,
and cow losses and an economic evaluation of dystocia scores for Holsteins. Journal of Dairy Science 80:754-61.
Ely S.F., Hirsch C.S. 2000. Asphyxial deaths and petechiae: a review. Journal
of Forensic Sciences 45:1274–1277.
210
Rozpoznanie ciężkiego porodu na podstawie zmian sekcyjnych...
Gustafsson H., Kindahl H., Berglund B. 2007. Stillbirths in Holstein heifers
– some results from Swedish research Acta Veterinaria Scandinavica
49 (Suppl 1).
Mee J. 2011. Bovine Neonatal Survival Is Improvement Possible? WCDS
Advances in Dairy Technology, 23: 161-174.
Mee J.F., Sanchez-Miguel C., Doherty M. 2013. Current causes of perinatal mortality in dairy calves based on a necropsy study. W 31st World
Veterinary Congress, Prague, Czech Republic, 17-20 wrzesień, str. 34.
Adres do korespondencji:
lek. wet. Dawid Król
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
mgr inż. Edyta Bańcyr
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
dr Paulina Jawor
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
prof. dr hab. Tadeusz Stefaniak
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
prof. dr hab. Wojciech Nowacki
Katedra Immunologii, Patofizjologii i Prewencji Weterynaryjnej
Uniwersytet Przyrodniczy we Wrocławiu
Praca finansowana z Grantu NCBiR nr PBS2/A8/20/2013. „Diagnozowanie infekcji śródmacicznej u cieląt słabej żywotności i martwo urodzonych. Ocena
przydatności wybranych parametrów jako potencjalnych markerów”
This work was supported by NCBiRnr PBS2/A8/20/2013. Diagnosis of intrauterine infection in weak and stillborn calves. Evaluation of selected parameters
as a potential markers.
211
Katarzyna Kruczek
Barbara Danielak-Czech
Opiekun naukowy: dr hab. Barbara Danielak- Czech
EPISTEME
22/2014, t. I
s. 213-219
ISSN 1895-2241
FIZYCZNA LOKALIZACJA GENÓW MKBP I CRYAB
W GENOMIE BYDŁA
PHYSICAL MAPPING OF MKBP I CRYAB GENES
IN THE BOVINE GENOME
Abstrakt. Produkty genów MKBP (myotonic dystrophy kinase binding protein) i CRYAB (alphaB-crystallin), należące do rodziny małych białek szoku
cieplnego, charakteryzują się konserwatywną domeną krystalinową i aktywnością chaperonową. Wykazują aktywność ochronną, odpowiadają za
utrzymanie równowagi komórkowej w warunkach stresu oksydacyjnego
i termicznego, stabilizując cytoszkielet komórki. Celem badań była lokalizacja genów MKBP i CRYAB w genomie bydlęcym techniką FISH. Sondę uzyskano z klonu zawierającego sekwencje tych genów, pochodzącego z biblioteki genomowej BAC: CHORI-240 Bovine BAC Library, co umożliwiło identyfikację loci MKBP i CRYAB w regionie chromosomu bydła BTA15q14-q21.
Cytomolekularna analiza struktury genów MKBP i CRYAB może dostarczyć
istotnych informacji na temat uwarunkowań genetycznych i patomechanizmu rozwoju chorób neurodegeneracyjnych u zwierząt hodowlanych.
Słowa kluczowe: bydło, mapowanie genów, technika FISH, geny MKBP, gen
CRYAB
Summary. The MKBP (myotonic dystrophy kinase binding protein) and CRYAB
(alphaB-crystallin) genes, belonging to the family of small heat shock protein genes, are characterized by conserved crystalline domain and chaperone
activity. The MKBP and CRYAB genes are effective to protect cytoskeletal
architecture homeostasis which is altered in response to thermal or oxidative stress. The aim of this study was the physical localization of MKBP and
CRYAB genes in the bovine genome by FISH technique. Clone, containing
sequences of these genes, derived from the CHORI-240 Bovine BAC library
was used as probe which facilitated assignment of MKBP and CRYAB loci to
the BTA15q14-q21 bovine chromosome region. Cytomolecular analysis of
MKBP and CRYAB genes structure and their physical mapping may supply
information concerning genetic background of neuropathies and neurodegenerative disorders.
Key words: cattle, gene mapping, FISH technique, MKBP gene, CRYAB gene
213
Katarzyna Kruczek, Barbara Danielak-Czech
Wstęp
Małe białka szoku cieplnego (small heat shock proteins - sHSPs)
tworzą podrodzinę małocząsteczkowych białek opiekuńczych. Charakteryzują się niską masą cząsteczkową mieszczącą się w przedziale 15-40kDa. W budowie małych białek szoku cieplnego można wyróżnić wysoce konserwatywną, centralną, około 90-aminokwasową domenę α-krystaliny oraz zmienną domenę N-końcową,
której zadaniem jest modulacja oligomeryzacji i regulacja szybkości
zmian konformacyjnych białka, a także region C-końcowy, który
odpowiada za wewnątrzdomenową dimeryzację. Małe białka szoku
cieplnego występują zarówno u organizmów jednokomórkowych jak
i wielokomórkowych, a najliczniejszą ich grupę zawierającą ponad 30
białek, stanowią roślinne sHSPs [Laskowska 2007]. Najlepiej poznane są ludzkie sHSPs, kodowane przez dziesięć genów funkcjonalnych
i dwa pseudogeny umiejscowione na 10 chromosomach (1, 5, 7, 8, 9,
11, 12, 17, 19, X). Białka opiekuńcze stanowią pierwszą linię obrony
komórki w walce z nieprawidłowo zwiniętymi i niefunkcjonalnymi
białkami, chronią komórki przed stresem oksydacyjnym i cieplnym,
biorą udział w kancerogenezie i apoptozie, wpływają na stabilność
błon oraz architekturę cytoszkieletu. Geny kodujące HSPB regulują
metabolizm białek neuronowych i poziom transkrypcji genu białka
prionowego, a ich mutacje lub nieprawidłowa ekspresja prowadzą do
rozwoju chorób neurodegeneracyjnych i prionowych. Przedmiotem
prezentowanej pracy jest fizyczna lokalizacja genów MKBP (HspB2)
i CRYAB (HspB5) - przedstawicieli rodziny małych białek szoku cieplnego w genomie bydlęcym.
Materiał i metody
Preparaty chromosomów metafazowych bydła, uzyskane po
rutynowej hodowli limfocytów in vitro, poddano barwieniu technikami prążkowymi QFQ/DAPI [Iannuzzi i Di Berardino 2008], co
umożliwiło identyfikację par chromosomów homologicznych na podstawie porównania osobniczych wzorów prążkowych z międzynarodowym standardem kariotypu bydła [Di Berardino i i in. 2001].
W celu wyselekcjonowania klonów bakteryjnych, zawierających
wektor BAC z insertem sekwencji genów MKBP i CRYAB, zaprojektowano startery specyficzne dla fragmentów genów (http://pri214
Fizyczna lokalizacja genów mkbp i cryab w genomie bydła
mer3.sourceforge.net/webif.php.), które wykorzystano w reakcjach
PCR do przeszukania biblioteki genomowej BAC bydła - CHORI-240:
Bovine BAC Library (http://bacpac.chori.org./libraries.php) (Tab.1).
Wyselekcjonowany klon zawierał sekwencje obu mapowanych genów,
położonych w genomie bydła w odległości 1035pz (http://www.ncbi.
nlm.nih.gov/genome/guide/cow). DNA, wyizolowane z klonu BAC:
CH240-134C10 przy użyciu komercyjnego kitu do lizy alkalicznej
(Qiagen), wyznakowano biotyną-16-dUTP metodą random – priming
i zastosowano jako sondę w procedurze FISH [Iannuzzi i Di Berardino 2008]. Sondę z dodatkiem bydlęcego DNA denaturowano przez 10
min. w temp. 70o, inkubowano przez 30 min. w temp. 37o i nanoszono na preparaty zdenaturowanych chromosomów. Detekcję i amplifikację sygnału prowadzono stosując avidynę-FITC i anty-avidynę,
a chromosomy barwiono DAPI. Uzyskane sygnały hybrydyzacyjne
analizowano w mikroskopie fluorescencyjnym Axio Imager.D2 (Zeiss) wyposażonym w potrójne filtry pobudzające DAPI / FITC / Texas
Red. Wybrane płytki chromosomów metafazowych bydła rejestrowano przy wykorzystaniu systemu komputerowej analizy obrazu Axio
Vision.
Tab. 1. Klon bakteryjny wykorzystany w eksperymentach FISH i produkty
PCR weryfikujące obecność badanych genów w genomie bydła.
Gen
HspB2
HspB5
Nazwa
klonu
CH240134C10
CH240134C10
Nr akceStartery
syjny
(GenBank) (sekwencja 5’-3’)
AB605262
AF02979
ccgagatcaccattcccgtc
ggctatagtggtaagggcag
tggaccctctcgccattact
gaggcctgtttccttggtcc
PCRv
Ta
(°C)
Dł.
produktu
(bp)
Fragment
genu
58
87
exon 2
57
76
exon 3
215
Katarzyna Kruczek, Barbara Danielak-Czech
Wyniki i dyskusja
W wyniku eksperymentów mapowania genów techniką FISH uzyskano sygnały fluorescencyjne w regionie BTA15q14-q21 kariotypu
bydła, co umożliwiło określenie lokalizacji genów MKBP i CRYAB
na cytogenetycznej mapie genomu bydła (Bos taurus) (Ryc. 1). Przeprowadzone badania dostarczyły kolejnych informacji, przydatnych
do uaktualnienia wcześniejszych cytogenetycznych map bydła
domowego (BOVMAP http://dga.jouy.inra.fr/cgi-bin/Igbc/main.
pl?BASE=), a uzyskane rezultaty są zgodne z wynikami mapowania
fizycznego (przy wykorzystaniu paneli hybrydowych komórek somatycznych – panel RH) i mapowania genetycznego (na podstawie
analizy sprzężeń) oraz międzygatunkowego mapowania porównawczego [Everts-van der Wind i in. 2005, Snelling i in. 2007]. Z informacji dostępnych w międzynarodowych bazach danych GenBank
i Ensembl (http://www.ncbi.nlm.nih.gov/guide/.; http://www.ensembl.org/index.html.) wynika, że odległość między loci MKBP
i CRYAB w regionie BTA15q14-q21 wynosi 1035pz, podobnie jak w
homologicznym regionie HSA11q22-q23 chromosomów człowieka,
w którym geny te dzieli dystans 966pz [Zimin i in. 2009]. Geny MKBP
i CRYAB składają się u obu porównywanych gatunków, odpowiednio,
z 2 i 3 egzonów, a ich sekwencje są w 98% homologiczne (http://
genome.ucsc.edu/cgi-bin/hgBlast), co potwierdza wysoki stopnień
konserwatyzmu bydlęcych i ludzkich genów z rodziny małych białek
szoku cieplnego.
U wielu gatunków ssaków wymapowano, homologiczne do
ludzkich, sekwencje genów HSPB, jednak tylko nieliczne loci zidentyfikowano dotąd na chromosomach zwierząt hodowlanych
określając ich lokalizację na cytogenetycznych mapach genomowych. U bydła geny MKBP i CRYAB nie są jeszcze dobrze poznane,
jednak badania z ostatnich lat potwierdziły ekspresję genu CRYAB
w komórkach mięśni szkieletowych oraz soczewki oka bydła i wykazały, że produkt tego genu zapobiega agregacji komórek sarkoplazmatycznych pod wpływem szoku termicznego [Pulford i in. 2008].
Na podstawie tych badań stwierdzono również, że gen CRYAB asocjuje z licznymi cechami jakości mięsa, warunkując między innymi kolor
mięsa wołowego [Reverter-Gomez i in. 2008].
216
Fizyczna lokalizacja genów mkbp i cryab w genomie bydła
Ryc. 1. Fizyczna lokalizacja genów MKBP and CRYAB w genomie bydła – technika FISH z gatunkowo specyficzną sondą wektorową BAC.
Ekspresja genów z rodziny małych białek szoku cieplnego była
również przedmiotem badań u bydła Zebu (Bos indicus, Bos taurus
indicus). Z opisanych eksperymentów wynika, że ekspresja tych
genów jest indukowana ekspozycją organizmu na wyższą temperaturę (42°C), przy czym najwyższą ekspresję (zwłaszcza w przypadku
genu HspB1) odnotowano 4 godziny po zadziałaniu bodźca cieplnego, podczas gdy ekspresję innych genów HSPB (głównie genu HspB6)
dopiero po 24 godzinach [Kusum i in. 2014]. W ramach analizy polimorficznych wariantów genów związanych z chorobami u zwierząt
gospodarskich z uwzględnieniem genów HSP (http://www.omia.
angis.org.au/), wykryto delecję jednego ze zduplikowanych genów
HSP70 (HSPA1B) w locus MHC klasy III (BTA 23q21-22) powodującą dziedziczną miotonię mięśni przeponowych (HMDM) u bydła
holsztyńsko-fryzyjskiego. Efektem mutacji jest niski poziom ekspresji genu Hsp70 ograniczający interakcję jego produktu z białkami
HSPB (m in. z MKBP) oraz białkami metabolizmu energetycznego
(m. in. miofosforylazą PYGM), co wywołuje zaburzenia konformacyjne i agregację tych białek, a w konsekwencji degenerację włókien
mięśniowych [Sugimoto i in., 2003].
217
Katarzyna Kruczek, Barbara Danielak-Czech
Badania dotyczące struktury i funkcji genów HSPB, z uwzględnieniem ich fizycznej lokalizacji w genomach zwierząt hodowlanych,
mogą być źródłem istotnych informacji na temat uwarunkowań
genetycznych i patomechanizmu rozwoju chorób neurodegeneracyjnych.
Wnioski:
• Fizyczna lokalizacja genów MKBP i CRYAB na chromosomach bydła z zastosowaniem techniki FISH i gatunkowo-specyficznych
sond wektorowych (BAC) dla tych genów stanowi uzupełnienie cytogenetycznej mapy genomowej gatunku Bos taurus oraz międzygatunkowych porównawczych map markerowych.
• Przeprowadzone badania mogą być podstawą dalszych analiz
dotyczących roli genów małych białek szoku cieplnego w patogenezie
zaburzeń neurodegeneracyjnych u zwierząt hodowlanych.
Bibliografia
Di Berardino D., Di Meo G.P., Gallagher D.S., Hayes H., Iannuzzi L. 2001.
ISCNDB 2000. International System for Chromosome Nomenclature
of Domestic Bovids. Cytogenetics and Cell Genetics, 92: 283-299.
Everts-van der Wind A., Larkin D.M., Green C.A., Elliott J.S., Olmstead
C.A., Chiu R., Schein J.E., Marra M.A., Womack J.E., Lewin H.A. 2005.
A high-resolution whole-genome cattle-human comparative map reveals details of mammalian chromosome evolution. Proceedings of the
National Academy of Sciences, 10: 18526-18531.
Iannuzzi L., Di Berardino D. 2008. Tool of the trade: diagnostics and research in domestic animal cytogenetics. Journal of Applied Genetics, 49:
357-366.
Kusum M., Ankit M., Jyoti C., Singh A., Mohanty A., Upadhhyay R., Surendran S., Pankaj G., Neelam C., Bristo A., Farheen K. 2014. Genome-wide analysis of the heat stress response in Zebu (Sahiwal) cattle. Gene,
533: 500-507.
Laskowska E. 2007. Małe białka szoku termicznego - rola w apoptozie, kancerogenezie i chorobach związanych z agragacją białek. Postępy Biochemii, 53, 19- 26.
Pulford D., Frost F., Lomiwes D., Farouk M.2008. Preliminary studies to
determine the chaperoning properties of bovine casein and crystallin
proteins at reducing beef muscle protein aggregation during heating.
218
Fizyczna lokalizacja genów mkbp i cryab w genomie bydła
International Journal of food Science and Technology, 43: 2143-2150.
Reverter-Gomez A., Chan E.K.F.., Lehnert S., Barris W., McWilliam S.,
Dalrymple B., Barendse W. 2008. Dissection of beef quality phenotypes
using a Myogenin network-anchored systems biology approach. Australian Journal of Experimental Agriculture, 48(8): 1053– 1061.
Sugimoto M., Furuoka H., Sugimoto Y. 2003. Deletion of one of the duplicated HSP70 genes causes hereditary myopathy of diaphragmatic muscles in Holstein-Fresian cattle. Animal Genetics, 34.191-197.
Snelling W.M, Chiu R, Schein J.E, Hobbs M, Abbey C.A, Adelson D.L, et al.
2007. A physical map of the bovine genome. Genome Biology, 8: R165.
Zimin A.V., Delcher A.L., Florea L., Kelley D.R., Schatz M.C., Puiu D., Hanrahan F., Pertea G., Van Tassell C.P., Sonstegard T.S., Marçais G., Roberts
M., Subramanian P., Yorke J.A., Salzberg S.L. 2009. A whole-genome
assembly of the domestic cow, Bos taurus. Genome Biology, 10 (4):
R42.
Adres do korespondencji:
mgr Katarzyna Kruczek
Instytut Zootechniki –Państwowy Instytut Badawczy
Dział Cytogenetyki i Genetyki Molekularnej Zwierząt
e-mail: [email protected]
dr hab. Barbara Danielak­Czech
Instytut Zootechniki –Państwowy Instytut Badawczy
Dział Cytogenetyki i Genetyki Molekularnej Zwierząt
*Praca finansowana z działalności statutowej Instytutu Zootechniki
Pąństwowego Instytutu Badawczego­zadanie 04­005.1
219
Martyna Małopolska, Ryszard Tuz
Opiekun naukowy: dr hab. inż. Ryszard Tuz
EPISTEME
22/2014, t. I
s. 221-228
ISSN 1895-2241
THE INFLUENCE OF PIGLET BIRTH WEIGHT
ON THE AMOUNT OF LOSSES
IN CROSS-FOSTERED LITTERS
WPŁYW MASY URODZENIOWEJ PROSIĄT NA
WIELKOŚĆ STRAT W MIOTACH STANDARYZOWANYCH
Abstrakt. Śmiertelność prosiąt w znaczący sposób wpływa na ekonomikę
produkcji trzody chlewnej. Celem przeprowadzonych badań było określenie
wielkości strat w okresie odchowu prosiąt z uwzględnieniem strat okołoporodowych. Obserwacjami objęto 95 prosiąt pochodzących z siedmiu miotów
uzyskanych od loch mieszańców pbz x wbp. Po 12 godzinach przeprowadzono standaryzację miotów zarówno pod względem liczbowym jak i pod
względem wyrównania mas ciała prosiąt. Przyjmuje się, że prosięta urodzone martwo nie powinny przekraczać 7% ogólnej liczby prosiąt urodzonych
w danym miocie. W badaniach własnych tylko trzy mioty uzyskały wartość mniejszą niż 7% martwo urodzonych prosiąt w miocie. Ogółem straty
w okresie okołoporodowym wynosiły 10,47% dla wszystkich miotów. Natomiast upadki prosiąt w okresie całego odchowu wyniosły 6,17%. Największe
straty odnotowano w grupie prosiąt, których masa ciała w dniu urodzenia
wynosiła <1,3 kg. Podsumowując należy stwierdzić, iż wraz ze wzrostem
masy ciała prosiąt w dniu urodzenia wielkość strat w okresie odchowu ulega
zmniejszeniu.
Summary. The mortality of piglets significantly affects the economics of
pig production. The basic aim of conducting this study was to determine the
size of losses during the rearing of piglets with regard to perinatal losses.
The observed sample consisted of 95 piglets from seven litters of crossbreed
sows obtained from pbz x wbp. After 12 hours, cross-fostering was conducted both in terms of numbers and piglet body weight equalisation. It is assumed that the still-born piglets should not exceed 7% of the total number
of piglets born in a litter. In this study only three litters obtained a value
less than 7% of stillborn piglets per litter. Total losses in the perinatal period amounted to 10.47% for all litters. In contrast, piglet mortality during
the rearing period amounted to 6.18%. The largest losses were recorded in
221
Martyna Małopolska, Ryszard Tuz
a group of piglets whose weights at birth were below 1,3 kg. In conclusion,
it should be noted that with the increase in body weight of piglets at birth
the amount of losses during the rearing is reduced.
Key words: piglet mortality, stillborn piglets, perinatal losses, rearing period
Introduction
The economics of pig production is governed by a lot of factors. One
of the most important and also the most difficult factor, is piglet rearing period. The losses in the pig farm which occur within the first
3 days after birth amount to an average of 50%, while 40% appear after weaning (Honeyman et al. 2000). The period following the birth is
very hard for the piglets as their immune system is confronted with
a large number of antigens from the environment (Tomala–Piotrowska 2011). The maturation of resistance mechanisms acquired
after birth is the result of factors such as the delivery of maternal
antibodies through colostrums and interaction with microbes originating from the external environment. It is necessary for the proper functioning of the piglet body to receive the colostrums as soon
as possible after birth, in order to obtain specific passive immunity
(Bugnacka 2008). The occurrence of factors weakening and interfering with the immune system in piglets results in a drastic increase
in the risk of falls. These factors include: stress, failure to abide by the
temperature and/or humidity regulations in the piggery and hygiene negligence in rooms. When considering the issues of mortality
we should take into account losses arising in the perinatal period,
birth of stillborn piglets and losses associated with mortality of piglets born alive which are lost in the subsequent stages of production
(Wróbel 2012). The piglets in a litter are usually very diverse in terms
of size and vitality. Numerous results of studies indicate that the
diversity of piglet body weight in the litter is associated with their
increased morbidity and mortality (Rząsa 2007; Rekiel 2012). Therefore, cross-fostering is one of the best methods of limiting losses
during the piglet rearing period.
The basic aim of conducting this study was to determine the size
of losses during the rearing of piglets with regard to perinatal losses.
222
The influence of piglet birth weight on the amount of losses in...
Material and methods
The study was conducted on the production farm “Cisowa” belonging
to the Agricultural Production Cooperative in Kędzierzyn–Koźle.
The observed sample consisted of 95 piglets from seven litters of
crossbreed sows (pbz x wbp). The sows were kept in farrowing crates. The litter sizes used in the study ranged from 8 to 16 live born
piglets. After 12 hours, cross fostering was conducted both in terms
of numbers (12 animals) and piglet body weight equalisation. The
following parameters were monitored: piglet birth weight, the size of
losses and the influence of birth weight on mortality.
Results and Discussion
Five gilts and two multiparous sows were used for this study. A total
number of born piglets amount to 95, including 9 stillborn. One of
the main reasons for the losses of piglets is fetal hypoxia occurring
during labor (Mazurowski 2012). Kołodziejczyk (2011) described the
natural duration of labor at 6 to 7 hours with intervals between newborns not longer than 30 minutes. Prolonged time of labor increases intrapartum mortality and affects the vitality of piglets born.
The frequent cause of intrapartum mortality is premature rupture
of umbilical cord, which causes cerebral hypoxia (Mazurowski 2012).
It is assumed that the stillborn piglets should not exceed 7% of
the total number of piglets born in a litter (Wróbel 2012). According
to sources (Grudniewska 1998; Jarczyk and Drągowski 2006), the
natural number of stillborn piglets is 0.5 piglet per litter (about 4 –
4.5%), provided that the stock is in good health. Furthermore, larger
number of piglets per litter increases the amount of stillborn piglets
to 0.9 piglet. In researches conducted by Matysiak et al. (2010) the
largest (8.59%) share of stillborn piglets in litters occurred in a group
of sows with the largest meatiness in the carcass, while in groups
with lower meatiness and larger fatness the number of stillborn
piglets was 4.54% (0.25) per litter. In this study only three litters
reached a value less than 7% (0.00%, 6.67%, 5.88%) of stillborn piglets per litter. The highest value was recorded in the litter number
4, where the percentage of stillborn piglets was 27.27%. The cause of
increased mortality is the occurrence of the phenomenon called In223
Martyna Małopolska, Ryszard Tuz
trauterine Growth Restriction (IUGR), during which a large number
of embryos develop in both uterine horns. This syndrome is defined
as the impaired growth and development of embryos and fetuses or
their organs during mammal pregnancy (Rekiel 2012).
It is considered that normal piglets birth weight is not less than
1.2 kg to 1.3 kg. However, according to the Kamyczek (2012), the
average of piglet body weight at birth should be a bit higher and range from 1.4 to 1.5 kg. In practice, we can observe a large span in piglet
birth weight ranging from less than 1 kg to higher than 2 kg. Wolf et
al. (2008) conducted a study on about 40.000 piglets observing an
average of piglet body weight of 1.18 kg and variation of the body
weight at birth ranging from 0.50 kg to 2.40 kg. In this study piglet
body weight ranged from 0.73 kg to 2.13 kg, reaching a high average
of 1.54 kg.
The piglets whose birth weight ranges from 1.2 to 1.6 kg are
most desired by the producers (Václavková et al. 2012). The larger
individuals weighing more than 1.6 kg may be undesirable from the
standpoint of production as labor can be dangerous, especially for
gilts (Wróbel 2012). It is assumed that piglets weighing less than
1 kg have little chance of survival. This observation is confirmed by
Kamyczek (2006), which showed losses for piglets weighing below
1 kg at about 40%. According to the economic simulation the minimum birth weight of piglets allowing for survival is 0.85 kg (Boulot
et al. 2008). This is confirmed by the results of Gondret et al. (2005)
in which 86% of piglets weighing less than 0.80 kg died. Whereas
Włodarczyk and Budvytis (2012) showed in their study that mortality of piglets weighing less than 1 kg is about 83%. In our study the
mortality of piglets (body weight less than 1 kg), reached a value of
100%.
The highest losses of all piglets are observed in the first week of
life - 58% (Wasiczek 2006). During this period piglets are the most
vulnerable and require the most intensive care. The results shown in
Tab. 1 confirm that the majority (in this case all) of the losses occurred in the first week of rearing. According to Wróbel (2012) standard losses of postnatal live-born piglets from the day of birth until
weaning (t.28 day lactation) usually vary from 8 to 15%. The much
224
The influence of piglet birth weight on the amount of losses in...
larger percentage of piglet losses during rearing period (to day 21) is
estimated by Boruta et al. (2009) at 20-30%. Many authors describe
the admissible mortality in rearing period as not exceeding 10% of
the number of piglets born recognizing this phenomenon as a natural form of selection. In this study the loss of piglets between the day
of birth and 21 days of rearing amounted to 6.17%, reaching a very
good level in relation to the literature data.
There is a relationship between the age of the sows as well as the
size of the litter and piglet mortality. Higher piglet mortality is noted among the gilts rather than multiparous sows. However, there is
a higher mortality among litters that are too small or too numerous,
while the mortality is lowest among medium litters (Grudniewska
1998). Our study did not show a relationship between age of sows
and the size of piglet losess. However, results indicate that birth weight had effect on piglet weight gain during the first weeks of rearing
and the size of piglet mortality. Total losses in the perinatal period
amounted to 10.47% for all litters, while piglet losses during the entire rearing (1 - 21 days) amounted to 6.17%.
Tab. 1. The mortality of piglets in rearing periods.
Piglets losses
%
1
7,69
16
1
5,88
3
3
15
13
2
13,33
4
1
11
8
3
27,27
5
1
15
14
1
6,67
6
2
11
11
0
0,00
7
1
13
12
1
7,69
n
%
total (%)
10,47
3
25,0
2
15,4
14-21
total
(%)
6,17
n
12
17
7-14
%
live-born (n)
13
1
1-7
n
total (n)
1
2
stillborn
%
Number of litter
1
Day of rearing
n
Item
Number of piglets at birth
225
Martyna Małopolska, Ryszard Tuz
Tab. 2. The losses of piglets according to birth weight
Item
Body weight at birth (kg)
<1,3
1,3 – 1,6
1,6-2,0
>2,0
Number of piglets
at birth
22
21
38
5
At 21 days of age
19
20
37
5
The losses of
piglets
13,64%
4,76%
2,63 %
0,00%
Conclusion
Based on the survey and the results achieved, the following observations are obtained:
• With the increasing weight of piglets at birth the amount of losses during rearing is reduced.
• The highest losses were recorded in the group of piglets whose birth weight was less than 1.3 kg (13.64%). In the group of piglets
with birth weight higher than 2 kg there were no losses.
• Cross-fostering in both terms: numbers and size caused a reduction in losses during rearing period (even in the group of piglets
with small body weight at birth).
Bibliography
Boruta O., Jasek S., Gorajewska E., 2009. Zmienność składu chemicznego
mleka loch w zależności od rasy, sutka i strony gruczołu mlekowego
oraz parametry odchowu prosiąt. Zeszyty Naukowe Uniwersytetu
Przyzrodniczego we Wrocławiu, wyd. LVIII, 572: 9 - 19
Boulot S., Quesnel H., Quiniou N., 2008. Managment od High Prolificacy in
French Herds: Can we Alleviate Side Effects on Piglet Survival?. Advances in Pork Production, 19: 213 - 220
Bugnacka D., 2008. Odporność prosiąt. Hodowca Trzody Chlewnej, 5: 36–40
Gondret F., Lefaucheur L., Loveau I., Lebret B., Pichodo X., Le Cozler Y.,
2005. Influence of piglet birth weight on postnatal growth performance, tissue lipogenic capacity and muscle histological traits at market
weight. Livestock Producion Science, 93, 2: 137 - 146
Grudniewska B., 1998. Hodowla i użytkowanie świń. Olsztyn : Wydawnictwo Akademii Rolniczo - Technicznej
226
The influence of piglet birth weight on the amount of losses in...
Honeyman, M. S., Roush, W. B., Penner, A. D. 2000. Piglet Mortality in Various Hut Types for Outdoor Farrowing, 7–9
Jarczyk A., Drągowski D., 2006. Próba określenia przyczyn rodzenia się prosiąt martwych. Materiały konferencyjne LXXI Zjazdu Polskiego Towarzystwa Zootechnicznego. Sekcja Chowu i Hodowli Trzody Chlewnej.
Bydgoszcz.
Kamyczek M., 2006. Jaki start taki finisz, czyli najważniejsze dwa tygodnie.
Hoduj z głową świnie, 3
Kamyczek M., 2012. Parametry wzrostu prosiąt. Farmer - portal nowoczesnego rolnika. www.farmer.pl.
Kołodziejczyk P., 2011. Efektywna produkcja prosiąt. Trzoda Chlewna, 11:
84 - 87
Matysiak B., Kawęcka M., Pietruszka A., Jacyno E., Kołodziej-Skalska A.,
2010. Użytkowość rozpłodowa loch w zalezności od stopnia umięśnienia w dniu pierwszego krycia. Acta Scientiarum Polonorum Zootechnica 9, 4: 153–160.
Mazurowski A., 2012. Czynniki wpływające na śmiertelność prosiąt. Hodowca Trzody Chlewnej, 11-12: 28 - 31
Rekiel A., 2012. Liczny miot, niska masa. Farmer.pl - portal nowoczesnego
rolnika. www.farmer.pl.
Rząsa A., 2007. Wpływ budowy anatomicznej gruczołu sutkowego loch lub
zastosowania surowicy anty-h somnus na wyniki odchowu prosiąt.
Zeszyty Naukowe Uniwersytetu Przyrodniczego we Wrocławiu, 549,
rozprawy CCXLIV
Tomala - Piotrowska K., 2011. Świnia przychodzi na świat pozbawiona
ochrony immunobiologicznej. Hodowca trzody chlewnej, 6
Václavková E., Daněk P., Rozkot M., 2012. The Influence Of Piglet Birth
Weight On Growth Performance. Research In Pig Breeding. Praga. 6,
1: 59 - 61
Wasiczek A., 2006 Jak zmniejszyć śmiertelność przedodsadzeniową? (techniki przemieszczania prosiąt). III Forum Pig Improvement Company
Włodarczyk R., Budvytis M., 2012. Zasady utrzymania oraz żywienia prosiąt dające najlepsze wyniki produkcyjne. Życie Weterynaryjne, 2: 102
- 108
Wolf J., Žáková E., Groeneveld E., 2008. Within-litter variation of birth weight in hyperprolific Czech Large White sows and its relation to litter
size traits, stillborn piglets and losses until weaning. Livestock Science,
115: 195 - 205
Wróbel P., 2012. Śmiertelność prosiąt - główne czynniki ryzyka strat przedi okołoporodowych cz.1 Hoduj z Głową - Świnie, 2: 39 - 43
227
Martyna Małopolska, Ryszard Tuz
Adres do korespondencji:
mgr inż. Martyna Małopolska
dr hab. inż. Ryszard Tuz
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Hodowli i Biologii Zwierząt
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
e-mail: [email protected], [email protected]
228
Józef Koczanowski
Monika Petrynka
Katarzyna Olczak
Czesław Klocek
Mariusz Głownia
EPISTEME
22/2014, t. I
s. 229-236
ISSN 1895-2241
Opiekun naukowy: prof. dr hab. inż. Czesław Klocek
WPŁYW SPOSOBU ŻYWIENIA TUCZNIKÓW
O ZRÓŻNICOWANYM GENOTYPIE
NA ICH WARTOŚĆ TUCZNĄ I RZEŹNĄ
EFFECT OF FEEDING PIGS OF DIFFERENT
GENOTYPE ON THEIR FATTENING
AND SLAUGHTER VALUE
Abstrakt. Celem pracy było określenie wpływu systemu żywienia na wartość tuczną i rzeźną świń. Badania przeprowadzono na 60 tuczników z trzech grup genetycznych: A - ♀ pbz x ♂ (D x P); B - ♀ (pbz x wbp) x ♂ P; C - ♀
(pbz x wbp) x ♂ (D x P). Każdą z grup podzielono na połowę, jedną karmiono zgodnie z normami, a drugą karmiono ad libitum. Wyniki wskazują,
że świnie karmione ad libitum osiągały znacznie wyższe dzienne przyrosty
masy ciała niż zwierzęta karmione systemem dawkowanym (P<0,05). Tuczniki z 50% udziałem rasy pietrain osiągały mniejsze dzienne przyrosty masy
ciała niż osobniki z innych grup genetycznych - 690g karmione systemem
dawkowanym, 713g karmione ad libitum i miały znacznie większą wagę
podstawowych wyrębów, niezależnie od zastosowanego systemu żywienia. Zużycie paszy na 1 kg przyrostu masy nie różniło się istotnie (P<0,05)
pomiędzy grupami doświadczalnymi. Najniższą wydajnośćą rzeźną charakteryzowały się świnie grupy C karmione ad libitum. Masa szynki w grupie B była istotnie wyższa niż w grupach A i C. Waga polędwicy w grupie
B żywionej ad libitum była istotnie wyższa niż w innych grupach.
Słowa kluczowe: tuczniki, wartość tuczna, wartość rzeźna
Summary. The aim of this study was to determine how applied feeding
system affects slaughter and fattening performance of different hybrid pigs.
The study was conducted on 60 pigs from three genetic groups: A - ♀ pbz x
♂ (D x P); B - ♀ (pbz x wbp) x ♂ P; C - ♀ (pbz x wbp) x ♂ (D x P). Each group
was divided by half, one was fed according to norms, and the other was fed
ad libitum. The results show that pigs fed ad libitum achieved significantly
229
Koczanowski Józef, Monika Petrynka, Katarzyna Olczak, Czesław Klocek...
higher daily weight gain than animals fed with dosed system (P <0.05). Finishers that were 50% pietrain achieved smaller daily weight gain than individuals from other genetic groups - 690g fed with dosed system, 713g fed ad
libitum and had significantly greater weight of primary cuts, not depending
upon the feeding system. Feed efficiency per 1 kg of weight gain did not
differ significantly (P> 0.05) between dietary groups. The lowest slaughter
efficiency had pigs of C group fed ad libitum. Ham’s weight of B group was
significantly higher than groups A and C. Tenderloin weight in group B feeding ad libitum was significantly higher than the others.
Key words: slaughter performance, fattening performance, finishers, porkers
Wstęp
Celem chowu trzody chlewnej jest poprawa parametrów tuczu oraz
uzyskanie świń o dużej mięsności przy zachowaniu wysokiej jakości
tusz. Ze względów ekonomicznych producenci wieprzowiny skupiają
się na poprawie opłacalności produkcji poprzez stosowanie różnych
wariantów żywienia świń oraz wykorzystywanie mieszańców różnych
raz. Ocena wartości tucznej i rzeźnej knurów hodowlanych pozwala
na prowadzenie odpowiedniej selekcji, a badania naukowe dotyczące
żywienia dostarczają informacji pozwalających wybrać najkorzystniejszy sposób żywienia świń.
Przy wyborze metody tuczu i systemu utrzymania należy
zwrócić uwagę na dobór odpowiedniej rasy, poziom żywienia oraz
zakładaną końcową masę ciała tuczników przeznaczonych na ubój.
Wartość tuczną określa się na podstawie dobowych przyrostów masy
ciała, pobrania oraz wykorzystania paszy na kilogram przyrostu oraz
wieku osiągnięcia przez świnie masy ubojowej. Trzoda chlewna należy do zwierząt, które bardzo dobrze wykorzystują paszę. Zależy
to jednak od różnych czynników, takich jak: rodzaj i jakość pasz,
zawartość włókna surowego, poziom białka wraz ze składem aminokwasowym, sposób przygotowania i zadawania paszy (żywienie na
sucho lub na mokro), oraz od rasy i wieku świń [Zin i Krupa 1990].
Tuczniki osiągające wysokie dobowe przyrosty odznaczają się wysokim współczynnikiem wykorzystania paszy [Kujawiak 2012]. To
właśnie pasza stanowi 70% wszystkich kosztów produkcji i decyduje
o opłacalności produkcji świń. Dlatego policzenie FCR, ilości pobranej paszy i przyrostów dziennych jest niezwykle ważne dla weryfikacji opłacalności produkcji.
230
Wpływ sposobu żywienia tuczników o zróżnicowanym genotypie na ich...
Wartość rzeźna oceniana jest na podstawie udziału mięsa
w tuszy, grubości słoniny, powierzchni „oka” polędwicy, barwy
i pH mięsa. Najważniejszym parametrem z punktu widzenia ekonomicznego jest mięsność tuczników. Udział mięsa w tuszy określa się
na podstawie pomiarów grubości słoniny oraz wysokości mięśnia
najdłuższego grzbietu (polędwicy). Wyższa masa ciała pozwala na
uzyskanie większej ilości mięsa nawet przy niższym procentowym
udziale mięsa w tuszy. Na przykład przy mięsności wynoszącej 60%
z 90 kg tuszy uzyskujemy 54 kg mięsa, natomiast przy 57% mięsności
ze 100 kg tuszy uzyskujemy 57 kg mięsa, czyli 3 kg więcej [Kujawiak
2012].
Rozwój technik komputerowych pozwala na szybkie uzyskanie informacji wartości tucznej i rzeźnej zwierząt hodowlanych, co
przyczynia się do większej skuteczności selekcji. W dalszym ciągu
jednak nie w pełni poznano wpływ sposobu żywienia na tuczniki
o różnym genotypie.
Celem doświadczenia było określenie wpływu sposobu żywienia tuczników o zróżnicowanym genotypie na ich wartość tuczną
i rzeźną.
Materiał i Metody
Badania przeprowadzono na 60 tucznikach, mieszańcach należących
do trzech grup genetycznych: A - ♀ pbz x ♂ (D x P); B - ♀ (pbz x wbp)
x ♂ P; C - ♀ (pbz x wbp) x ♂ (D x P). Każda grupa genetyczna składała się z 20 osobników (10 sztuk loszek i 10 sztuk knurków). Świnie
utrzymywano systemem grupowym na ściółce, w kojcach po 5 sztuk.
Wszystkie grupy zostały podzielone na dwie części. Połowę zwierząt z każdej grupy genetycznej żywiono do woli przy pomocy automatów paszowych, natomiast drugiej połowie grupie zwierząt paszę
zadawaną dwa razy dziennie zgodnie z „Normami żywienia 1993”.
W żywieniu tuczników zastosowano mieszankę pełnoporcjową składającą się z pszenicy, jęczmienia, pszenżyta oraz Koncentratu R-433
(tab.1). Ponadto, zwierzęta miały zapewniony całodobowy dostęp do
świeżej wody.
231
Koczanowski Józef, Monika Petrynka, Katarzyna Olczak, Czesław Klocek...
Tab. 1. Skład mieszanki pełnoporcjowej
Wyszczególnienie
Zawartość (%)
Pszenica
30
Jęczmień
25
Pszenżyto
30
Koncentrat R-433
15
Energia metaboliczna MJ
12,60
Białko ogólne (g)
156,0
Lizyna %
0,95
Metionina %
0,26
Met. + Cyst. %
0,56
Tryptofan %
0,17
Jako wskaźniki użytkowości tucznej wykorzystano dobowe
przyrosty masy ciała, pobranie oraz wykorzystanie paszy na kilogram
przyrostu, wiek osiągnięcia masy ubojowej i zużycie energii metabolicznej (MJ) w okresie tuczu od 30 do 100 kg masy ciała.
Oceny zawartości mięsa w tuszy dokonywano przy pomocy aparatu ultradźwiękowego piglog 105. Po zakończonym tuczu, wszystkie
tuczniki ubito zgodnie z technologią obowiązującą w zakładach
mięsnych. Przed ubojem tuczniki były poddane głodówce ok. 12
h. Ubite świnie poddano obróbce: oparzanie, usuwanie szczeciny,
raciczek, gałek ocznych, przewodu pokarmowego, oraz narządów
rodnych. Po obróbce poubojowej tusze zważono, waga tusz stanowiła
podstawę do obliczenia wskaźnika wydajności rzeźnej. Ocenę rzeźną
przeprowadzono w oparciu o metody oceny użytkowości tucznej
i rzeźnej stosowanej w stacjach kontroli.
Wyniki badań podano analizie statystycznej, uwzględniając
średnią arytmetyczną i istotność różnic pomiędzy grupami.
Wyniki
O wartości tucznej i rzeźnej zwierząt oprócz czynników genetycznych
takich jak rasa świń, typ użytkowy oraz masa ubojowa decydują rów232
Wpływ sposobu żywienia tuczników o zróżnicowanym genotypie na ich...
nież czynniki środowiskowe do których można zaliczyć żywienie
oraz system tuczu [Zin i Krupa 1990, Sosiński 1996]. Średnie wyniki
użytkowości tucznej i rzeźnej wszystkich grup genetycznych zestawiono w tabelach 2i 3.
Tab. 1. Wyniki tuczu (30 -100 kg)
Dyskusja i wnioski
Głównym celem doskonalenia świń czystorasowych w Krajowym
Programie Hodowlanym jest ich zastosowanie w tzw. krzyżowaniu
towarowym określającym schemat łączenia loch i knurów odpowiednich ras w pary, w celu uzyskania mieszańców przeznaczonych do
tuczu, a następnie uboju. Urbańczyk i in. [1999, 2000] przedstawili
wartości tuczne i rzeźne dwóch grup mieszańców (pbz x wbp) x pietrain, wbp x pbz. Stwierdzili, że tuczniki pochodzące po knurach
rasy pietrain charakteryzowały się gorszym pobraniem paszy, ale za
to lepszą jakością tusz niż mieszańce pbz x wbp. Według badań Stasiaka [2003] mieszańce trójrasowe charakteryzowały się lepszymi
wskaźnikami tucznymi i rzeźnymi w porównaniu z mieszańcami
233
Koczanowski Józef, Monika Petrynka, Katarzyna Olczak, Czesław Klocek...
dwurasowymi. Autor poleca model krzyżowania trójrasowego do
zastosowania w praktyce. W badaniach własnych stwierdzono, że
mieszańce z 50% udziałem rasy pietrain osiągnęły gorsze wartości
tuczne, natomiast wartości rzeźne osiągały wyższe niż w pozostałych grupach co potwierdza badania cytowanych wcześniej autorów. Świnie rasy pietrain odznaczające się największą mięsnością,
wykorzystywane są w programach krzyżowania do produkcji tuczników o wysokiej mięsności. Obserwowanie przez wielu badaczy
zmniejszenie się otłuszczenia i zwiększenie umięśnienia tuszy świń
w okresie ostatnich dziesięcioleci wiąże się z bardziej efektywnym
wykorzystaniem paszy na przyrost masy ciała [Petersen i in. 1996,
Marks i in. 1997, Oksbjerg i in. 1997]. Wyniki uzyskane w badaniach własnych potwierdzają rezultaty uzyskane przez w/w autorów.
Mieszańce pochodzące po ojcu rasy pietrain wykazały wyższe wartości tuczne niż zwierzęta pochodzące w męskiej linii po mieszańcach
ras (duroc x pietrain).
Z przeprowadzonych badań wynika, że tuczniki z 25% udziałem
krwi świń rasy pietrain przy żywieniu do woli, pobierały istotnie
(P<0,05) więcej paszy na dobę niż tuczniki żywione według norm.
Natomiast bez względu na zastosowany system żywienia tuczniki
z 50% udziałem krwi rasy Pietrain pobierały zbliżoną ilość paszy w
ciągu doby. Ponad to mieszańce z 25% udziałem rasy pietrain żywione do woli osiągały istotnie wyższe (P<0,05) przyrosty dzienne
niż tuczniki żywione według Norm, w porównaniu do mieszańców
z udziałem 50% rasy pietrain, które bez względu na system żywienia osiągały zbliżone przyrosty dzienne. Zarówno trzy jak i czterorasowe mieszańce bez względu na zastosowany system żywienia
osiągały zbliżone wyniki tuczne i rzeźne. Tylko tuczniki z 50% udziałem krwi świń rasy pietrain charakteryzowały się istotnie wyższą
(P<0,05) masą wyrębów podstawowych tj. masa szynki, polędwicy
i mięsa w wyrębach podstawowych oraz posiadały większy udział
mięsa w tuszy niż tuczniki z 25% udziałem krwi świń rasy pietrain.
Na parametry tuczu oraz wartość rzeźną duży wpływ ma sposób
żywienia. Wyniki przedstawione w tabeli 2 pokrywają się z wynikami badań przeprowadzonych przez Tuza i in. [1999], w którym
porównano wpływ żywienia według norm i do woli. Obie grupy
zwierząt otrzymywały tę samą mieszankę. Świnie tuczono do 100 kg
234
Wpływ sposobu żywienia tuczników o zróżnicowanym genotypie na ich...
masy ciała. Zauważono różnicę w dobowych przyrostach masy ciała.
Zwierzęta żywione do woli osiągały wyższe przyrosty dzienne (752,1
g) niż mieszańce żywione według norm (688,8 g) Pobranie paszy za
okres tuczu było wyższe u tuczników żywionych do woli (2,64 kg),
niż żywionych według norm (2,39 kg). Wykorzystanie paszy na 1 kilogram przyrostu masy ciała, była na podobnym poziomie (3,51 kg
i 3,47 kg). Oceniając wartość rzeźną stwierdzono, ze procent mięsa
w tuszy kształtował się na podobnym poziomie (ok. 57±3% w obu
zastosowanych systemach żywienia). Średnia grubość słoniny z 5 pomiarów wynosiła u tuczników żywionych do woli 19,11 mm,
a u tuczników przy żywieniu według norm 17,64. Wynika z tego, że
świnie żywione według norm mniej się otłuszczają niż świnie żywione do woli. W powierzchni „oka” polędwicy nie stwierdzono istotnych
różnic u świń żywionych do woli 54,44 cm2, a według norm 54,30
cm2. Zastosowanie systemu żywienia nie wpłynęło na jakość tuszy.
Autorzy, sugerują że żywienie do woli powodowało przyspieszenie
tempa wzrostu, co wpłynęło na większe się otłuszczenie tusz.
Bibliografia:
Kujawiak R. 2012. O opłacalności tuczu decyduje głównie żywienie. Sano
magazyn nr 1, marzec/kwiecień 2012, 28-31.
Marks J.J.M., Haneberg E.H.A.T., van Erp A.J.M. 1997. Effect of selection for leanness in pig on genetic parameters and ultrasonic backfat
thickness. 48th Annual Meeting EAAP, Vienna, 25 – 28, August
Oksberg N., Petersen J.S., Henckel P., Stoier S. 1997. Meat Colour and muscle pigment in Danish Landrace Anno 1976 and Anno 1995. 48th Annual Meeting EAAP, Vienna, 25 – 28, August.
Petersen J.S., Henckel P., Stoir S. 1997. Muscle physiological traits and meat
quality in Danish Landrace pigs Anno 1976 and 1995. 48th Annual
Meeting EAAP, Vienna, 25 – 28, August.
Sosinski A., Scheller K.K., Wilson E.R., De Veries A.G., Van der Steen H.,
Mclaren D.G. 1996. Genetyczne i środowiskowe czynniki wpływające
na jakość mięsa wieprzowego. Seminarium Międzynarodowe: „Postęp
hodowlano- produkcyjny, a jakość i ilość surowca mięsnego”, Akademia
Rolnicza, Poznań 21-22 sierpnia 1996.
Stasiak A., Kamyk P., Lechowski J. 2003. Ocena cech tucznych i rzeźnych
świń mieszańców ras puławskiej wbp i duroc. Annales Universitatis
235
Koczanowski Józef, Monika Petrynka, Katarzyna Olczak, Czesław Klocek...
Mariae Curie-Skłodowska Lublin – Polonia, Vol. XXI, N1,40, section
EE: zootechnica, 307 - 311
Tuz R., Koczanowski J., Wantuła M., Migdał W. 1999. Wpływ sposobu żywienia na efektywność tuczu i wartość poubojową tuczników mieszańców.
Zesz. Nauk. AR w Krakowie, sesja naukowa, z 67, 271 – 276.
Urbańczyk J., Hanczakowska E., Świątkiewicz M. 1999. Wpływ genotypu na
niektóre wskaźniki biochemiczne krwi oraz cechy tuczne i rzeźne świń.
Zesz. Nauk. AR w Krakowie. Sesja Naukowa, z 67, 277 - 284
Urbańczyk J. Hanczakowska E. Świątkiewicz M. 2000. Wpływ knurów rasy
pietrain na cechy tuczne i rzeźne oraz wskaźniki biochemiczne krwi
świń. Roczniki Naukowe Zootechniki. Suplement, z 5, 131 – 135.
Zin M., Krupa J. 1990. Wpływ masy przedubojowej tuczników pochodzących
z gospodarstw indywidualnych na jakość szynek. Materiały Międzynarodowej Konferencji Naukowej nt. „Czynniki wzrostu efektywności
gospodarowania w rolnictwie na terenach południowo - wschodniej
Polski”, Filia AR, Rzeszów 10-11 września 1990, 3, 129-134.
236
Katarzyna Olczak, Monika Petrynka
Martyna Małopolska, Czesław Klocek
Opiekun naukowy: prof. dr hab. inż. Czesław Klocek
EPISTEME
22/2014, t. I
s. 237-244
ISSN 1895-2241
REAKCJE STRESOWE U PSÓW
I ICH BIOLOGICZNE UWARUNKOWANIA
DOGS STRESS BEHAVIOUR
AND ITS BIOLOGICAL DETERMINANTS
Abstrakt. W wielu domach utrzymywane są psy jako zwierzęta towarzyszące. Równie często wykorzystuje się je do wykonywania różnego
rodzaju wyspecjalizowanych zadań. Pragnąc zapewnić psom wysoki poziom
komfortu psychicznego człowiek powinien znać potrzeby tych zwierząt,
a także rozpoznawać oznaki stresu. Przewlekły stres ma bardzo niekorzystny
wpływ na funkcjonowanie organizmu, powodując zmiany strukturalne
i funkcjonalne w mózgu, które mogą prowadzić do zaburzeń emocjonalnych.
Z praktycznego punktu widzenia dla właścicieli psów najlepszą i najłatwiejszą
metodą określania stanu psychicznego zwierzęcia jest obserwacja ich
zachowania. Pomimo iż psy mogą znacznie różnić się reaktywnością to szereg sygnałów behawioralnych świadczących o stanie chronicznego stresu
jest wspólnych dla wszystkich przedstawicieli tego gatunku. Na zachowanie
psa wpływa wiele czynników takich jak: wiek, płeć, doświadczenie życiowe,
rasa i inne uwarunkowania genetyczne, a także kondycja fizyczna matki
w czasie ciaży, czy zabiegi weterynaryjne, np. sterylizacja, która wpływa na
poziom hormonów.
Słowa kluczowe: pies, stres, hormony
Summary. Nowaydays dogs are very popular as companion animal in many
families. They are also used for very specialized works as a police, rescue,
therapeutic dogs etc. Knowledge about dogs’ needs and stress signals will
help to ensure them a good level of welfare. Chronic stress have a negative influence on brain and can cause emotional disorders. From a practical
point of view, for dogs owners the best and easiest method to determine the
mental state of an animal is to observe its behaviour. There is a huge variety
in reactivity among dogs, but some important signals that indicate chronic
stress are the same for all. The behavior may be affected by many factors
such as: age, sex, life experience, breed, genetic, physical condition of a bitch
during pregnancy, or some veterinary treatments such as sterilization or
castration that affect the level of hormones.
Key words: dogs, stress, hormones
237
Katarzyna Olczak, Monika Petrynka, Martyna Małopolska, Czesław Klocek
W ostatnich latach obserwuje się wzrost zainteresowania opinii publicznej problematyką dobrostanu zwierząt gospodarskich, laboratoryjnych i towarzyszących [Beerda i in., 1997]. Coraz więcej mówi
się również o warunkach bytowych psów utrzymywanych w hodowlach oraz w schroniskach, a także o skrajnych przypadkach ich
złego traktowania przez właścicieli. Psy obecne są prawie w każdym
społeczeństwie, pełniąc różnorodne funkcje: zwierząt domowych,
stróżujących, terapeutycznych, policyjnych, ratowniczych etc.
Zapewnienie im wysokiego poziomu dobrostanu przekłada się na
łatwiejszą współpracę z człowiekiem, tym samym na efektywniejszy
trening, oraz na bezpieczeństwo zarówno ludzi jak i zwierząt [Beerda
i in., 1997].
Stan stresu jest przeciwieństwem dobrostanu, z jednej strony
jest nieodzownym elementem życia każdego organizmu, jednak
może być przyczyną wielu niepożądanych reakcji [Beerda i in., 1997].
Rozpoznanie nagłego, ostrego stresu u psów jest kluczowe podczas
interakcji człowiek - pies, lub pies - pies, gdyż wystraszone zwierzę może okazać się niebezpieczne (na przykład może zaatakować
w sytuacji zagrozenia, ze strachu). Jednak to przewlekły stres jest
zjawiskiem najbardziej niekorzystnym, prowadzącym do zaburzeń
fizjologicznych organizmu oraz przejawiania nieprawidłowych reakcji behawioralnych [Beerda i in., 1999a; Beerda i in., 1999b].
Bodziec stresowy wywołuje kaskadę fizjologicznych i psychicznych zmian, które umożliwiają jednostce reakcję zgodną z wyzwaniem stawianym przez otoczenie (z ang. coping behaviour). W odpowiedzi na stresor jądro przykomorowe podwzgórza uwalnia
kortykoliberynę (hormon uwalniający kortykotropinę), która pobudza przysadkę mózgową do uwolnienia hormonu adrenokortykotropowego (ACTH), pobudzajac nadnercza do uwalniania kortykosterydów.
Szlak ten nazywany jest osią podwzgórze-przysadka-nadnercza.
Przewlekły stres ma negatywny wpływ na układ limbiczny, długotrwałe wydzielanie hormonów kortykotropowych może powodować
zmiany strukturalne i funkcjonalne hipokampa, ciała migdałowatego
i kory przedczołowej, co w rezultacie może prowadzić do zaburzeń
emocjonalnych. Takie osobniki przejawiają zwiększony niepokój,
impulsywnością oraz zaburzeniami kontroli hamowania. Co więcej,
chroniczny stres obniża odporność organizmu, a zmiany w ilości ne238
Reakcje stresowe u psów i ich biologiczne uwarunkowania
utrofilów w krwi widoczne są już po krótkotrwałym oddziaływaniu
czynnika stresogennego [Beerda i in., 1999b].
W celu wyeliminowania nadmiernego czy chronicznego stresu u psów kluczowe jest opracowanie metod, które pozwolą na jego
ewaluację. Oczywiście istnieją metody pozwalające określić poziom
stresu, takie jak tętno czy stężenie kortyzolu, jednak z praktycznego punktu widzenia najłatwiejszym wskaźnikiem jest ocena sposobu zachowania, gdyż nie wymaga specjalistycznego sprzętu [Beerda
i in., 1998]. Strach może wywołać odmienne reakcje u różnych zwierząt. Znanych jest pięć podstawowych taktyk w odpowiedzi na stres:
walka, ucieczka, znieruchomienie, omdlenie, załagodzenie jest to
tak zwane 5F (z angielskiego: fight, flight, freeze, faint, fiddle about)
[Bracha, 2004]. Psy mogą znacznie różnić się miedzy sobą sposobem
reakcji na określone bodźce stresogenne, zarówno pod wzgledem reakcji fizjologicznych jak i taktyki postępowania. Najczęściej obserwuje się podjęcie walki lub ucieczki albo próbę załagodzenia sytuacji
[Ottenheimer i in., 2013]. Wpływ na reakcję psa ma wiele czynników
takich jak rasa, wiek, płeć, temperament, uwarunkowania genetyczne czy doświadczenie osobnicze. Reakcja tego samego osobnika może
być inna wobec odmiennych bodźców. Beerda i in. [1999a] wykazał,
że suki rasy Beagle były bardziej reaktywne niż samce przy ekspozycji
na ostry stres, aczkolwiek nie stwierdzono między nimi różnicy w odniesieniu do stresu chronicznego. Istnieje szereg sygnałów behawioralnych świadczących o chronicznym stresie psów, które są wspólne dla wszystkich przedstawicieli tego gatunku, jednak nie zawsze
wszystkie występują jednocześnie [Beerda i in., 1999b]. W zależności
od indywidualnych cech osobnika mogą być również przejawiane
z odmienną intensywnością, należą do nich między innymi: natężenie wokalizacji, przyjmowanie „niskiej postawy”, jedzenie odchodów,
zwiększony autogrooming (samopielęgnacja), częste powtarzanie
tych samych czynności (stereotypia) lub inne. Ponadto, ograniczenie kontaktów socjalnych, czy ubogie w bodźce środowisko mogą
modyfikować zachowanie psów, powodując u jednych nadmierne reakcje pobudzenia i ekscytacji (merdanie ogonem, wąchanie, kręcenie
się w kółko, oddawanie moczu i kału, zwiększona ogólna lokomocja),
inne będą częściej eksponować zachowania związane z agresją, czy
dominacją (nastroszoną sierść, warczenie, kładzenie łap na innych
239
Katarzyna Olczak, Monika Petrynka, Martyna Małopolska, Czesław Klocek
psach i osobach), jeszcze inne stają się bardzo niepewne, wręcz bojaźliwe [Beerda i in., 1999].
Jednym z sygnałów uważanych za oznakę stresu u psów jest
oblizywanie, które również zalicza się do sygnałów uspokajających.
Jednak wyniki badań Rehn’a i wsp. [2013] sugerują, ze może to być
typowy sygnał przy witaniu się oraz oznaka przywiązania do innego
osobnika. Psy po separacji od właściciela i jego ponownym pojawieniu
się wykazywały większą częstotliwość oblizywania, gdy rozłąka była
dłuższa. Możliwe, że jest to również próba komunikacji z człowiekiem i zwrócenia na siebie uwagi np. przy proszeniu o zabawkę, czy o
jedzenie. W tej sytuacji jednak nie ma pewności, czy nie jest to objaw
stresu związany z nie otrzymaniem pożądanej rzeczy.
Doskonałym miejscem do obserwacji zachowań zwierząt są
parki dla psów, gdyż stwarzają możliwości kontaktu społecznego
z innymi psami i obcymi ludźmi. Wiele psów w parkach przejawia
zachowania uznawane za sygnały świadczące o stresie - oblizywanie,
unoszenie łap. Pomiary poziomu kortyzolu wykazały jednak brak
korelacji w stosunku do pojedynczych sygnałów. Wyniki te mogą
świadczyć o tym, iż zachowanie to jest przejawem próby „poradzenia” sobie z daną sytuacją, a nie wskaźnikiem stresu u psów. Ponadto,
psy używały tych sygnałów również w zabawie. Zachowaniem, które
może świadczyć o stresie jest obniżona postawa ciała. Ottenheimer
[2013] wykazała pozytywną korelację między poziomem kortyzolu
a przyjmowaniem obniżonej postawy psa. W dodatku okazało się, iż
psy określone przez właścicieli, jako neurotyczne (niezrównoważone
emocjonalnie) o wiele częściej prezentowały to zachowanie.
Bardzo istotny wpływ na zachowanie psa, oraz sposób reakcji na
różnorodne bodźce środowiskowe ma jego życiowe doświadczenie,
a w szczególności z okresu szczenięcego. Co ciekawe, zachowanie psa
może być uwarunkowane jeszcze w łonie matki [Sadowski, 2001].
Stwierdzono, że nadmierna ekspozycja nienarodzonych suczek na
androgeny może powodować, iż będą one bardziej niezależne i dominujące. Niedożywienie matki w okresie ciąży i karmienia powoduje,
iż szczenięta z takiego miotu mogą być bardziej podatne na stres.
Co więcej, jeżeli szczeniętom ograniczy się kontakt z matką może
mieć to brzemienny wpływ na ich późniejsze zachowanie. Badania
przeprowadzone na rezusach wykazały, że zupełne ograniczenie kon240
Reakcje stresowe u psów i ich biologiczne uwarunkowania
taktu z matką i innymi osobnikami w okresie krytycznym powoduje, że osobniki takie stają się bardzo nieufne, lękliwe i niezdolne do
nawiązywania prawidłowych relacji.
U psów można wyróżnić krytyczne okresy o tzw. zwiększonej
wrażliwości:
a) okres neonatalny (od urodzenia do ok. 12 dnia),
b) okres przejściowy (do ok. 20 dnia),
c) okres socjalizacji (do ok 14–16 tygodni),
d) okres młodzieńczy.
Okres socjalizacji jest najważniejszym momentem w życiu psa,
bowiem to, co się wydarzy w tym czasie determinuje jego przyszłe
zachowania. Szczenięta przed ukończeniem osiemnastego tygodnia są bardzo ciekawe świata i szybko się uczą, po tym czasie stają
się o wiele bardziej ostrożne i nieufne wobec nowości. Jeżeli w tym
okresie będą dorastać w ograniczonym środowisku mogą stać się
bardzo bojaźliwe wobec wielu elementów życia codziennego. Ponadto, brak kontaktów socjalnych z człowiekiem i innymi psami może
doprowadzić do tego, iż zwierzę nie będzie zdolne do prawidłowych
interakcji wykazując strach lub agresję. Jednocześnie u osobników,
które doświadczyły negatywnych relacji społecznych w młodości obserwuje się intensywniejszą produkcję kortyzolu w sytuacjach stresowych, oraz wydłużony czas spadku stężenia tego hormonu [Walker
i McGlone, 2013].
Bardzo silny, nagły stres może wpłynąć na zachowanie psa i jego
późniejsze postrzeganie niektórych bodźców. Praktycznie wszystkie
ssaki zostały bardzo dobrze zaopatrzone w systemy szybkiego reagowania w sytuacjach zagrożenia, co jest niezwykle istotne dla przetrwania. Reakcje te często zostają uwarunkowane już na podstawie
jednej próby. Decydującą rolę odgrywa tu jądro migdałowate, które
odpowiada za zapamiętywanie emocjonalne. Jeżeli pies znajdzie
się w sytuacji wywołującej strach, impulsy nerwowe mózgu mogą
przebiegać z wykorzystaniem kory asocjacyjnej, wtedy dochodzi
do analizy sytuacji i wyboru najlepszej taktyki działania. Istnieje jednak drugi, szybszy szlak, w którym sygnał biegnie wprost ze
wzgórza do jądra migdałowatego, które porównuje dane zdarzenie
z informacjami zachowanymi z przeszłości. Czasem dochodzi do sytuacji, w której nowe zdarzenie nie jest podobne do wcześniejszego,
241
Katarzyna Olczak, Monika Petrynka, Martyna Małopolska, Czesław Klocek
jednak jadro migdałowate powiąże jeden podobny element, przez
co zostaje uruchomiona wdrukowana poprzednio reakcja. Zrozumienie tych procesów ma niezwykle istotne znaczenie w związku
z traumatycznymi zdarzeniami z wczesnego okresu życia. W trakcie
rozwoju systemu pamięci to właśnie jądro migdałowate u młodych
osobników zaczyna przechowywać informacje jako pierwsze, zanim
pozostałe części systemu pamięci staną się funkcjonalne czyli, zanim
rozwinie się pamięć deklaratywna i racjonalne myślenie (hipokamp
i kora asocjacyjna).
U prawidłowo zsocjalizowanych psów można łatwo załagodzić
skutki stresu poprzez kontakt fizyczny. Badania wykazały, iż głaskanie psa uspokaja go obniżając poziom kortyzolu i ciśnienie krwi.
Jednocześnie następuje wzrost wydzielania oksytocyny do ciała
migdałowatego. Oksytocyna odpowiedzialna jest za „zacieśnianie
się więzi miedzy osobnikami”, reguluje zachowania społeczne i stymuluje interakcje między - osobnicze [Rehn i in., 2013]. Ponadto
dowiedziono, że u ludzi w pewnym stopniu zdolność do radzenia sobie ze stresem jest uwarunkowana genetycznie. Okazuje się, że receptor (CRHR1) i transporter 5-HT gen (5-HTT) zmniejszają wpływ
przykrych przeżyć z „dzieciństwa” oraz ryzyko wystąpienia depresji
w dorosłym życiu [Walker i McGlone, 2013]. Możliwe, że u psów
istnieją podobne uwarunkowania, które nie zostały jeszcze zbadane. Współczynnik dziedziczalności temperamentu u owczarka niemieckiego oszacowano na poziomie 0,51, natomiast „nerwowości”
u labradorów 0,58. Te wysokie współczynniki wskazują, iż genotyp
psa w znacznym stopniu warunkuje jego zachowanie [Takeuchi
i Houpt, 2004].
Znajomość związku między poziomem kortyzolu, zachowaniami społecznymi, sygnałami świadczącymi o stresie oraz osobowości
psów pozwoli na szerokie i kompleksowe analizowanie ich zachowań. Zrozumienie tych zależności ma szczególne znaczenie w odniesieniu do stresu przewlekłego, który ma bardzo niekorzystny wpływ
na organizm i prowadzi do znacznego pogorszenia dobrostanu psów.
Ponadto, wiedza o procesach uczenia się oraz reakcjach wywołanych
strachem, umiejetność rozpoznania objawów ostrego stresu psów
umożliwi dobranie odpowiedniego sposobu postępowania z takim
zwierzęciem. Można stwiedzić, że taka wiedza polepsza relacje na li242
Reakcje stresowe u psów i ich biologiczne uwarunkowania
nii człowiek-zwierzę oraz jest niezwykle istotna w celu zapewniania
bezpieczeństwa zarówno ludzi jak i psów.
literatura
Beerda B., Schilder M. B., van Hooff J., de Vries. 1997. Manifestations of
chronic and acute stress in dogs. Applied Animal Behaviour Science 52,
307-319.
Beerda B., Schilder M. B., van Hooff J., de Vries H. , Mol J. 1998. Behavioural, saliva cortisol and heart rate responses to different types of
stimuli in dogs. Applied Animal Behaviour Science, 58 (3-4), 365–381.
doi:10.1016/S0168-1591(97)00145-7
Beerda B., Schilder M. B., van Hooff J., de Vries H. , Mol J. 1999a. Chronic
stress in dogs subjected to social and spatial restriction. I. Behavioral responses. Physiology & Behavior, 66(2), 233–42. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/10336149
Beerda B., Schilder M. B., Bernadina W., van Hooff J., de Vries H. W., Mol
J. 1999b. Chronic stress in dogs subjected to social and spatial restriction. II. Hormonal and immunological responses. Physiology & Behavior, 66(2), 243–54. Retrieved from http://www.ncbi.nlm.nih.gov/
pubmed/10336150
Bracha H. 2004. Freeze, flight, fight, fright, faint: adaptationist perspectives on the acute stress response spectrum. CNS Spectrums, 9(9), 679–
85. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/15337864
Ottenheimer Carrier L., Cyr A., Anderson R. E., Walsh C. J. 2013. Exploring
the dog park: Relationships between social behaviours, personality and
cortisol in companion dogs. Applied Animal Behaviour Science, 146(14), 96–106. doi:10.1016/j.applanim.2013.04.002
Rehn T., Handlin L., Uvnäs-Moberg K., Keeling L. J. 2013. Dogs’ endocrine
and behavioural responses at reunion are affected by how the human
initiates contact. Physiology & Behavior, 124, 45–53. doi:10.1016/j.
physbeh.2013.10.009
Sadowski B., 2001. rozdz. 19-20, Biologiczne mechanizmy zachowania się
ludzi i zwierząt, s.466-520 PWN, Warszawa.
Takeuchi Y., Houpt K. 2004. Behavior genetics. Clinical Techniques in Small
Animal Practice, 19(4), 194–204. doi:10.1053/j.ctsap.2004.10.001
Walker S. C., McGlone F. P. 2013. The social brain: neurobiological basis of
affiliative behaviours and psychological well-being. Neuropeptides,
47(6), 379–93. doi:10.1016/j.npep.2013.10.008
243
Katarzyna Olczak, Monika Petrynka, Martyna Małopolska, Czesław Klocek
Adres do korespondencji:
Katarzyna Olczak
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
Uniwersytet Rolniczy w Krakowie
Al. Mickiewicza 24/28 30-059 Kraków
e-mail: [email protected]
244
Mateusz Malinowski
Bartłomiej Rospond
Jakub Sikora
EPISTEME
22/2014, t. I
s. 245-253
ISSN 1895-2241
TERMOGRAFICZNA ANALIZA POWIERZCHNI
CIAŁA SZCZURA LABORATORYJNEGO
THERMOGRAPHY ANALYSIS OF RAT BODY SURFACE
Abstrakt. Termografia jest metodą rejestracji temperatury stosowaną
w różnych dziedzinach nauki, w tym w medycynie i naukach przyrodniczych, która polega na zobrazowaniu rozkładu temperatur na powierzchni
obiektu (obiektów) za pomocą detektora promieniowania podczerwonego.
Głównym celem badań było ustalenie wzorcowych parametrów temperatury
zewnętrznej powierzchni ciała szczurów odmiany Wistar. Do wykonania
pomiarów termograficznych wykorzystano kamerę FLIR ThermaCAM e300
oraz program Quick Report, w którym analizowano uzyskane termogramy.
Badaniom poddano 24 szczury, dla których wykonano i przeanalizowano
140 termogramów. Na podstawie wyników badań określono różnice w temperaturze powierzchni ciała szczurów. Analiza uzyskanych wyników pozwoliła stwierdzić, iż temperatura okrywy włosowej na powierzchni grzbietu,
głowy i brzucha szczura odmiany Wistar hodowanego w temperaturze 22oC
(wilgotność względna powietrza: 55 +5%) jest zbliżona i wynosi około 33,0
+1oC. Najchłodniejszymi częściami ciała są łapy (tylne i przednie) oraz nos,
zaś najcieplejszymi oczodoły i uszy. Najniższymi wartościami współczynnika zmienności charakteryzują się temperatury okrywy włosowej na gardle
i podudzi kończynach tylnych, zaś największymi temperatura ogona
(główny narząd biorący udział w termoregulacji), nosa oraz uszu (rozstęp
przekracza 9oC).
Słowa kluczowe: szczur laboratoryjny, termografia, promieniowanie podczerwone.
Abstrakt. Thermography is a popular method of surface temperature recording that is used in different fields of science, especially in medicine
and natural science. It is based on illustrating the temperature distribution
along the surface of an object with the use of an infrared radiation detector. The main aim of the study was to describe the reference temperature
of the external body surface of Wistar rats. The analysis was performed by
thermography camera FLIR ThermaCAM e300 and Quick Report program
245
Mateusz Malinowski, Bartłomiej Rospond, Jakub Sikorai
which was used to analyze the obtained thermograms. The study involved
24 rats for which140 thermograms were made and analyzed. On the basis
of the study performed, the differences of external radiation temperature
of various parts of rats’ body were revealed. The analysis showed that the
temperature of the surface coat on the back, head and abdomen of Wistar
rats being kept at 22 °C (relative air humidity 55+5%) is similar and is about
33.0 +1°C. The coldest parts of the body are the feet (front and back) and
nose, whereas the warmest are eye sockets and ears. The lowest values ​​of the
coefficient of variation were found in the dewlap surface and shanks, whereas the highest in the tail (the main organ involved in thermoregulation
process), nose, and ears (9oC difference).
Key words: rat, thermography, infrared radiation
Wstęp
U ssaków temperatura powierzchni ciała zależy od temperatury
otoczenia, produkcji ciepła w wyniku procesów metabolicznych,
izolacyjności termicznej skóry oraz przepływu krwi w organizmie
[Shmidt-Nilsen, 2008]. Obszary ciała, które odpowiadają za wymianę ciepła nazywane są oknami termicznymi (powierzchnie termoregulacji) i są one najczęściej nagie lub pokryte krótkimi włoskami
(okrywą włosową). Zwierzęta mogą aktywnie wpływać na straty
ciepła poprzez kontrolowanie przepływu krwi – skurcze i rozszerzenie naczyń krwionośnych [Sumbera i inni, 2007]. Wiele badań
dotyczących białek, genów, testów leków oraz metod leczenia opiera się na hodowli oraz eksperymentach prowadzonych z użyciem
gryzoni i innych zwierząt laboratoryjnych (świnki morskie, chomiki,
króliki, psy, przepiórki, zwierzęta naczelne). Dogodnymi modelami
badawczymi są w szczególności myszy i szczury. Szczury są łatwe do
utrzymania, cechują się łagodnym usposobieniem, szybką rotacją
pokoleń, wykazują duży współczynnik reprodukcji. Szczury osiągają
wyższą wagę, zawartość tkanki tłuszczowej i temperaturę ciała niż
myszy, są więc lepszym modelem do badań termograficznych. Zwierzęta laboratoryjne w przeciwieństwie do zwierząt doświadczalnych
(w tym gospodarskich), nie są narażone na działanie czynników
zewnętrznych takich jak: wpływ pór roku, wahania temperatury,
zmienna długość dnia i nocy, różne cykle żywieniowe.
W przeprowadzonych badaniach wykorzystano odmianę
szczurów Wistar ze względu na ich powszechne zastosowanie w testa246
Termograficzna analiza powierzchni ciała szczura laboratoryjnego
ch medycznych, farmaceutycznych, żywieniowych i behawioralnych.
Szczury te są stosowane często jako organizm modelowy. Wistar
jest albinotyczną odmianą gatunku Rattus norvegicus. Dojrzałość
płciową samice osiągają między 37-67 dniem, samce nieco później
[Sławiński, 1981]. Badania termograficzne na szczurach laboratoryjnych prowadzone są od lat 70 XX wieku [Goldie i in., 1972; Bielec, Szmigielski, 1976, Jasemian i in., 2012; Snekhalatha i in., 2013;
Kastek i in., 2013]. Pomiar parametrów promieniowania elektromagnetycznego (podczerwonego, cieplnego) emitowanego przez
ciało o temperaturze wyższej niż 0 bezwzględne jest jedną z coraz
popularniejszych metod rejestracji temperatury stosowaną również w medycynie i naukach przyrodniczych. Pomiar ten nazywany
jest termografią i polega na zobrazowaniu rozkładu temperatur na
powierzchni obiektu (obiektów) za pomocą detektora promieniowania podczerwonego. Największą zaletą tego pomiaru jest jego nieinwazyjność. Termografia wykorzystywana jest w takich dziedzinach jak: budownictwo, ciepłownictwo, diagnostyka układów energoelektronicznych i mechanicznych, medycyna, ogrodnictwo, inżynieria
środowiska [Wróbel, 2010; Malinowski, Sikora, 2012, Malinowski
i in. 2013]. Termografia, jako nieinwazyjna metoda pomiaru zewnętrznej temperatury ciała zwierząt była wielokrotnie wykorzystywana
w badaniach na zwierzętach gospodarskich [Alsaaod i in. 2012; Kulesza, Kaczorowski, 2004; Kotrba i in. 2007; Łapiński i in., 2011;
Weschenfelder i in. 2013].
Głównym celem badań było opracowanie ustalenie wzorcowych
(modelowych) parametrów temperatury zewnętrznej powierzchni
ciała szczurów odmiany Wistar. Poznanie tych parametrów jest niezwykle potrzebnym z punktu widzenia dalszego wykorzystania metod termograficznych w badaniach z użyciem zwierząt.
Materiał i metody
Badaniom poddano 24 samce szczura (po 8 szczurów w 3 seriach
badań realizowanych co miesiąc), dla których wykonano i przeanalizowano łącznie 140 termogramów. Samce szczura o początkowej
masie (280 +20 g) były hodowane pojedynczo w klatkach w temperaturze pokojowej ok. 22ºC i wilgotności względnej powietrza 55 +5%
247
Mateusz Malinowski, Bartłomiej Rospond, Jakub Sikorai
w odwróconym cyklu 12 godzin noc/dzień. Odwrócony cykl dobowy
powodował, że maksymalna aktywność metaboliczna przypadała
na czas poboru pokarmu czyli na ok. 8.00 godzinę rano. Zwierzęta
przez siedem dni w tygodniu posiadały wolny dostęp do diety i wody.
Termogramy wykonywano około godziny 10 rano. W każdej serii,
szczury „sfotografowano” od strony brzusznej i grzbietowej. Pomiary temperatury przeprowadzono kamerą termograficzną ThermaCAM e300 firmy FLIR, będącą na wyposażeniu Instytutu Inżynierii
Rolniczej i Informatyki UR w Krakowie. Rozdzielczość temperaturowa kamery wynosi 0,1 oC. Pomiary wykonywano z odległości 1m.
Jeden piksel na termogramie odpowiadał obszarowi o powierzchni
0,6mm2 w rzeczywistości. Powierzchnia mierzonych obszarów ciała szczura zawierała się w zakresie od 50 (oczodoły, uszy) do 1 500
pikseli (brzuch, grzbiet). Badania prowadzono w laboratoriach Collegium Medicum UJ w Krakowie.
Wyniki pomiarów termograficznych zostały przedstawiane
na cyfrowym zdjęciu termograficznym (termogramie – ryc. 1), na
którym poszczególnym wartościom temperatury (zapisanym jako
osobny plik z danymi liczbowymi) przyporządkowane są kolory.
W czasie wykonania pomiaru i analizy termogramu uwzględniono
współczynnik emisyjności badanego obiektu (materiału okrywy włosowej) oraz wpływ temperatury otoczenia. Analizie poddano różne
części powierzchni zewnętrznej szczura: brzuch, grzbiet, głowa,
gardło, nos, oczodoły, uszy, ogon, łapy tylne, łapy przednie, kończyny
tylne (od strony wewnętrznej). Temperatura wewnętrznej powierzchni kończyn przednich nie została zrejestrowana na termogramach. Ponadto wykonano termogramy skóry szczurów pozbawionych
okrywy włosowej od strony brzusznej oraz termogramy otwartej
jamy brzusznej zwierząt w chwili wykonywania sekcji. Termogramy
te zostały wykonane w celu obliczenia różnic pomiędzy temperaturą
okrywy włosowej brzucha a temperaturą skóry oraz temperaturą
wewnętrzną szczura.
Do określenia i zbadania wpływu obszaru ciała na rozkład temperatury na jego powierzchni wykorzystano jedno i dwuczynnikową
analizę wariancji, a istotność różnic pomiędzy temperaturą powierzchni poszczególnych obszarów określono przy pomocy testu
Tukey’a. Analizy statystyczne wykonano w pakiecie STATISTICA 10.
248
Termograficzna analiza powierzchni ciała szczura laboratoryjnego
Wyniki i dyskusja
Na rysunku 1 przedstawiono przykładowy termogram szczura wykonany w czasie pomiarów. Boczna część ciała szczura widoczna na termogramie odznacza się niższą temperaturą, w stosunku do innych
części jego ciała, co wynika z kąta wykonania pomiaru.
Ryc. 1. Termogram badanego szczura od strony grzbietowej
Z analizy termogramów wynika, iż oczodoły oraz obszar uszu to
powierzchnie charakteryzujące się najwyższymi wartościami temperatury (36,9 – 37,3oC), co wynika z braku naturalnej osłony termicznej (okrywy włosowej) w tych miejscach, a także występowania
otworów w czaszce (tab. 1). Najniższymi wartościami temperatury
charakteryzują się powierzchnie nosa, łap tylnych i łap przednich. Obszary ciała o największej powierzchni tj., brzuch, boki, część
grzbietowa oraz głowa charakteryzują się zbliżoną średnią temperaturą okrywy włosowej tj. 33+1,0oC, zaś współczynnik zmienności dla
tych obszarów wynosi około 3%. Najmniejszą amplitudą temperatury okrywy włosowej oraz najniższymi wartościami współczynnika
zmienności cechują się powierzchnie kończyn tylnych oraz gardła.
Największą różnicą pomiędzy temperaturą maksymalną a minimalną oraz największymi wartościami współczynników zmienności
charakteryzują się: ogon (główny narząd biorący udział w termoregulacji) i nos. Różnica pomiędzy maksymalną a minimalną wartością
temperatur w tych miejscach przekracza 9oC. Ponadto zauważono, iż
249
Mateusz Malinowski, Bartłomiej Rospond, Jakub Sikorai
temperatura ogona maleje w kierunku jego końca. Pomiędzy średnimi
temperaturami dla poszczególnych powierzchni ciała analizowanych
samców szczura na różnym etapie ich wzrostu nie stwierdzono
statystycznie istotnych różnic.
Tab. 1. Zestawienie temperatur powierzchni ciała szczura laboratoryjnego
Część ciała
szczura
Brzuch
Średnia temperatura
Średnia temperatura
Średnia temperatura
Średnia temperatura
Pomiar 1
Pomiar 2
Pomiar 3
[oC]
[oC]
[oC]
[oC]
33,0+0,93
33,1+0,99
32,6+059
33,3+0,73
Grzbiet
32,9+1,00
32,7+0,46
33,3+0,37
32,9+0,61
Głowa
32,9+1,12
32,8+0,55
33,2+0,55
33,0+0,35
Ogon
31,8+2,78
32,6+0,81
32,0+1,56
30,2+1,49
Oczodoły
36,9+1,41
37,4+1,11
37,1+0,54
36,3+1,14
Uszy
37,3+2,21
36,8+0,90
38,6+2,04
37,8+1,21
Nos
27,5+2,76
26,9+1,73
25,3+0,42
28,3+1,51
Gardło
34,1+0,47
34,1+0,51
34,5+0,50
33,8+0,28
Łapy tylne
27,4+1,30
26,7+1,46
27,2+1,04
27,9+1,29
Łapy przednie
26,2+0,98
25,6+0,78
26,6+0,54
26,0+0,30
Kończyny
tylne
35,5+072
36,1+0,49
34,9+0,90
35,1+0,53
Test Tukey’a (tab. 2) wykazał brak istotnych różnic pomiędzy
temperaturami okrywy włosowej na powierzchni głowy, grzbietu
i brzucha, a także pomiędzy temperaturą powierzchni uszu i oczodołów oraz pomiędzy łapami (przednimi i tylnymi) a nosem i pomiędzy oczodołami a kończynami tylnymi. Różnice pomiędzy temperaturami pozostałych mierzonych obszarów są statystycznie istotne.
Średnia temperatura wewnętrzna szczurów, uzyskana w pomiarze
termograficznym była taka sama jak w badaniach wykonanych przez
Gautier’a [2000], zaś średnie temperatury powierzchni zewnętrznej
szczurów były nieznacznie wyższe (około 1 oC) od wartości dla tych
samych obszarów ciała uzyskanych przez Sumbera i innych [2007]
w badaniach nad odmianami dziko występującymi.
Temperatura skóry szczura (pozbawiona okrywy włosowej)
mierzona na obszarze brzucha wynosi średnio 37,5 oC +0,6 oC, zaś
250
Termograficzna analiza powierzchni ciała szczura laboratoryjnego
temperatura wewnętrzna szczura wynosi 38,6 oC +0,6 oC. Baumgartner [2011] podaje, iż temperatura wewnętrzna szczura wynosi
37,5 – 39,5oC. Różnica pomiędzy temperaturą powierzchni okrywy
włosowej na brzuchu a temperaturą wewnętrzną szczura wynosi
około 4,5 oC i może wynikać z warstwy tłuszczu chroniącej narządy
wewnętrzne.
5.
Oczodoły
6.
Uszy
7.
Ogon
8.
Nos
9.
Łapy
tylne
10.
Łapy
przednie
11.
Kończyny
tylne
9
10
11
35,5
8
26,2
Gardło
7
27,4
4.
6
34,1
Głowa
5
27,5
Grzbiet
4
37,3
2.
3.
3
36,9
Brzuch
2
31,8
1.
1
32,9
Obszar
32,9
L.p
33,0
Tab. 2. Istotność różnic temperatur dla różnych obszarów ciała
według testu Tukey’a
o
o
o
x
x
x
x
x
x
x
o
o
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
o
Ocena istotności statystycznych zależności
pomiędzy średnią
temperaturą wybranych
elementów budowy
zewnętrznej szczura
x
x
x
x
o
x
x
x
x
x
x
x
x
x
o
o
x
o
x
x
x – zależności istotne na poziomie α = 0,05 (o – brak istotnych różnic)
Wnioski
Uzyskane wyniki pozwoliły na ustalenie wzorcowych (modelowych)
parametrów temperatury zewnętrznej powierzchni ciała szczurów
odmiany Wistar. W wyniku przeprowadzonych analiz stwierdzono,
iż pomiędzy temperaturą grzbietu, brzucha oraz głowy nie ma istotnych statystycznie różnic, natomiast ogon i nos charakteryzują
się wysokimi wartościami współczynnika zmienności. Niskimi war251
Mateusz Malinowski, Bartłomiej Rospond, Jakub Sikorai
tościami współczynnika zmienności cechują się obszar gardła (brak
kontaktu z podłożem) oraz kończyny tylnej. Obszarami o najwyższej
temperaturze są oczodoły oraz obszar uszu, zaś obszary nosa, łap
tylnych i przednich należą do najchłodniejszych elementów budowy
szczura. Analiza uzyskanych wyników jednocześnie wskazuje na konieczność kontynuowania badań w tym zakresie.
Literatura
Alsaaod A., Büscher W. 2012. Detection of hoof lesions using digital infrared
thermography in dairy cows. Journal of Dairy Science, 2012;95/2:735742
Baumgartner W. 2011. Diagnostyka kliniczna zwierząt, wyd. I polskie, red.
J. Twardoń, Elsevier
Bielec M, Szmigielski S. (1976) Proceedings: Use of thermography for quantitation of energy absorption in animals irradiated with microwaves.
J Microw Power. 11:152-153.
Gautier H., 2000. Body temperature regulation in the rat. Journal of Thermal
Biology. 25 (2000):273-279.
Goldie I, Brunius U, Nilsson K. (1972) Early reactions in skin incisions in
the rat. A thermographic, microangiographic and histologic study Acta
Chir Scand. 1972;138:465-70.
Jasemian, Y. , Gazerani, P., Dagnaes-Hansen, F. (2012) Infrared thermography in serotonin-induced itch model in rats. Open Dermatology Journal.
6:1-7
Kastek M., Piątkowski T., Polakowski H., Czernicki Z., Koźniewska E., Kaczmarska K., Przykaza Ł. (2013) Analiza zmian temperatury powierzchni mózgu podczas wymuszonych zmian przepływu krwi w korze mózgowej szczura. Pomiary, Automatyka, Kontrola, 59: 867-870.
Kotrba R., Knížková I., Kunc P., Bartoš L. 2007. Comparison between the coat
temperature of the eland and dairy cattle by infrared thermography.
Journal of Thermal Biology, 32/6 (2007), 355-359. doi.org/10.1016/j.
jtherbio.2007.05.006
Kulesza O., Kaczorowski M. (2004) Termografia jako jedna z technik diagnostyki obrazowej. Medycyna. Weterynaryjna, 60 :1143-1146.
Łapiński S., Augustyn J., Lis M.W., Kanik W., Niedbała P., Lisowska-Lis A.
(2011) Zmiany w obrazie termograficznym królika domowego (Oryctolagus cuniculus) w zależności od wieku i stanu fizjologicznego. Pomiary,
Automatyka, Kontrola, 57: 1154-1157.
252
Termograficzna analiza powierzchni ciała szczura laboratoryjnego
Malinowski M. Sikora J. 2013. Termograficzna analiza wybranych przegród
budowlanych w aspekcie ich termoizolacyjności. Infrastruktura i Ekologia
Terenów Wiejskich. Nr 3/IV/2013. Kraków. s. 91-104
Malinowski M., Sikora J., Krzystanek I., Kurdziel S. 2012. Wykorzystanie
termografii do nieinwazyjnej analizy wewnętrznych uszkodzeń miąższu
jabłek. Episteme. Nr 15/2012. Kraków. s. 169-176
Shmidt-Nilsen K. Fizjologia zwierząt – adaptacja do środowiska, PWN
Warszawa, 2008
Sławiński T. 1981. Zasady hodowli zwierząt laboratoryjnych, PWN,
Warszawa.
Snekhalatha U, Anburajan M, Venkatraman B, Menaka M. (2013) Evaluation of complete Freund’s adjuvant-induced arthritis in a Wistar rat
model. Comparison of thermography and histopathology. Z Rheumatol.
72:375-82. doi: 10.1007/s00393-012-1083-8.
Sumbera R., Zelova J., Kunc P., Knízkova I., Burda H., 2007. Patterns of
surface temperatures in two mole-rats (Bathyergidae) with different
social systems as revealed by IR-thermography. Physiology & Behavior
2007;92:526–532.
Weschenfelder A.V., Saucier L., Maldague X., Rocha L.M., Schaefer A.L.,
2013. Faucitano L. Use of infrared ocular thermography to assess
physiological conditions of pigs prior to slaughter and predict pork
quality variation. Meat Science, 2013;95/3:616-620 doi:10.1016/j.meatsci.2013.06.003
Wróbel, A. 2010. Termografia w pomiarach inwentarskich obiektów budowlanych (rozprawa habilitacyjna). Monografie 209, Wyd. AGH.
Kraków
Adres do korespondencji:
dr inż. Mateusz Malinowski, dr inż. Jakub Sikora
Instytut Inżynierii Rolniczej i Informatyki,
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]; [email protected]
mgr inż. Bartłomiej Rospond
Katedra Toksykologii, Collegium Medicum,
Uniwersytet Jagielloński w Krakowie
e-mail: [email protected]
253
Katarzyna Słota, Piotr Micek
Opiekun naukowy: dr hab. inż. Piotr Micek
EPISTEME
22/2014, t. I
s. 255-262
ISSN 1895-2241
Wpływ temperatury i lignosulfonianów
na skład chemiczny, rozpuszczalność
azotu i strawność in vitro
makuchu rzepakowego
Effect of heat- or lignosulfonate-treatment on chemical composition,
nitrogen solubility and
in vitro digestibility of rapeseed cake
Abstrakt. Celem badań było określenie wpływu temperatury i lignosulfonianów (LSO3) różnego pochodzenia na przydatność paszową makuchu
rzepakowego (RSC) dla przeżuwaczy oznaczoną przy użyciu testów in vitro. Próbki RSC bez dodatku lub z dodatkiem LSO3 różnego pochodzenia
(5 rodzajów) stosowanym w ilości 2,5 lub 5% suchej masy ogrzewano
w suszarce przewiewowej w temperaturze 90, 110 lub 140oC przez 60
minut. W reprezentatywnych próbkach oznaczono skład chemiczny, rozpuszczalność azotu metodą Licitra i in. (1996) oraz rzeczywistą strawność
in vitro (IVTD, Ankom 2013). Niezależnie od ilości oraz pochodzenia zastosowanego dodatku LSO3 ogrzewanie RSC powodowało istotne (P<0,05)
zmiany rozpuszczalności azotu oraz IVTD. Bez względu na temperaturę ogrzewania zastosowany dodatek LSO3 zmniejszał rozpuszczalność azotu oraz
powodował zmiany w składzie chemicznym uzyskanych produktów.
Słowa kluczowe: makuch rzepakowy, lignosulfoniany, ogrzewanie, azot rozpuszczalny, IVTD
Summary. The aim of the study was to determine the effect of heat- or
lignosulfonate-treatment of rapeseed cake (RSC) on its nutritive usefulness for ruminants using in vitro methods. Samples of RSC were heated in
oven with forced air circulation without any additive or with lignosulfonates (LSO3, 5 different origins) supplementation at 2 dosages (2.5 or 5% of
dry matter) and then heated at 90, 110 or 140oC for 60 minutes. In representative samples chemical composition, nitrogen solubility by Licitra et al.
(1996) method and in vitro true digestibility (IVTD, Ankom method 2013)
255
Katarzyna Słota, Piotr Micek
were determined. Regardless of the proportion and the origin of LSO3 heating of RSC caused statistically significant (P<0.05) changes in their N solubility and IVTD digestibility. Irrespective of temperature of heating supplementation of LSO3 reduced N solubility and made changes in the chemical
composition of RSC.
Key words: rapeseed cake, lignosulfonates, heat-treatment, nitrogen solubility,
IVTD
Wstęp
Zwiększające się ceny pasz treściwych oraz wysoka podatność ich
białka na rozkład w żwaczu są przyczyną poszukiwania nowych metod ochrony tego składnika przed działaniem enzymów bakteryjnych.
Obniżona podatność białka na fermentację w żwaczu wpływa
korzystnie nie tylko na wykorzystanie białka, ale również na wyniki
produkcyjne zwierząt oraz ograniczenie emisji azotu do środowiska
(Kamalak i in. 2005). Stosowane metody ochrony nie mogą jednak
powodować zmian w metabolizmie żwacza ani wpływać negatywnie
na strawność białka w dalszych odcinkach przewodu pokarmowego.
Właściwości ochraniające przypisywane działaniu na pasze wysokich temperatur prowadzą do tworzenia się kompleksów białko-cukier
w wyniku nieenzymatycznej reakcji brązowienia, tzw. reakcji Maillarda. Powstające kompleksy ograniczają nie tylko strawność białka
w żwaczu, ale także dostępność jelitową lizyny (Finot 2005). Źródłem
cukrów mogą być lignosulfoniany, które są produktami ubocznymi
powstającym przy produkcji papieru. Charakteryzują się one różnym
składem chemicznym w zależności od pochodzenia i technologii produkcji (wapniowe, sodowe, magnezowe). Lignosulfoniany zawierają
duże ilości ksylanów, których składniki mogą wchodzić w reakcję
z białkiem paszowym (Neves i in. 2009; Toledo i Kuznesof 2008).
Badania przeprowadzone na śrucie poekstrakcyjnej sojowej ogrzewanej w temperaturze 150oC w obecności ksylozy (wyizolowanej
z lignosulfonianów) potwierdzają ochronne właściwości tej metod
bez wpływu na strawność jelitową białka. Podobny efekt nie był
możliwy przy zastosowaniu samej temperatury (Wallace i Falconer
1992). Hipoteza pracy zakłada, że dostarczenie do paszy wysokobiałkowej (makuchu rzepakowego) cukrów wraz lignosulfonianami
ułatwi tworzenie się kompleksów białko-cukier w niższej tempera256
Wpływ temperatury i lignosulfonianów na skład chemiczny, rozpuszczalność...
turze ogrzewania, a przez to zmniejszy stopień uszkodzenia termicznego białka. Z nielicznych badań przeprowadzonych na produktach
rzepakowych wynika, że nie jest jednoznacznie ustalona optymalna
ilość lignosulfonianów w produkcie końcowym oraz temperatura,
w jakiej powinien przebiegać ten proces. Celem badań było określenie
wpływu temperatury i lignosulfonianów (LSO3) różnego pochodzenia na przydatność paszową makuchu rzepakowego (RSC) dla przeżuwaczy oznaczoną przy użyciu testów in vitro.
Materiał i metody
Materiałem badawczym był makuch rzepakowy (RSC) uzyskany po
drugim tłoczeniu oleju, który poddano ogrzewaniu bez dodatku lub
z dodatkiem lignosulfornianów (LSO3). Użyto pięciu rodzajów LSO3
pochodzących z różnych państw: dwa wapniowe (LSO3-Ca1 Norwegia, LSO3-Ca2 Hiszpania), dwa sodowe (LSO3-Na1 Szwecja, LSO3Na2 Rosja) i jeden magnezowy (LSO3-Mg Czechy). Uprzednio rozdrobniony (1,5 mm) makuch rzepakowy ogrzewano w temperaturze 90,
110, lub 140oC przez 60 minut bez dodatku lub z dodatkiem płynnych lignosulfonianów w ilości 2,5 lub 5,0% suchej masy, którymi
spryskiwano RSC. Ogrzewanie prowadzono na sucho w suszarce
przewiewowej. W reprezentatywnych próbkach pasz określono
zawartość suchej masy (SM) oraz białka ogólnego (BO) metodami
standardowymi (AOAC 2001). Dodatkowo oznaczono zawartość
ADF metodą wg Goering i Van Soest (1970), zawartość azotu nierozpuszczalnego w kwaśnym detergencie (ADIN) oraz rozpuszczalność
azotu in vitro (N-rozp.) metodą Licitra i in. (1996). Rzeczywistą
strawność in vitro (IVTD) oznaczono w aparacie DaisyII Incubator
metodą woreczków filtracyjnych (Ankom 2013). Płyn żwacza pobrano przez kaniule żwaczowe od dwóch zasuszonych krów rasy polskiej
HF żywionych standardowymi dawkami pokarmowymi. Wyniki poddano analizie statystycznej przy użyciu pakietu statystycznego SAS
(wersja 9.2). Zastosowano dwuczynnikową analizę wariancji. Analizowanymi czynnikami były: pochodzenie LSO3 oraz temperatura
ogrzewania. Średnie pomiędzy grupami porównywano za pomocą
testu Student-Newman-Keuls dla P<0,05.
257
Katarzyna Słota, Piotr Micek
Wyniki i dyskusja
Uśredniony wpływ ogrzewania oraz dodatku lignosulfonianów
na skład chemiczny, rozpuszczalność azotu oraz IVTD makuchu
rzepakowego przedstawiono w Tab.1. Ogrzewanie RSC bez dodatku LSO3 nie spowodowało istotnych zmian w zawartości ADIN.
W stosunku do makuchu surowego obserwowano zmniejszenie rozpuszczalności azotu (43,9 vs 37,8% N-og.) oraz IVTD (88,1 vs
85,8%), co może świadczyć o zmniejszeniu podatności białka na
rozkład w żwaczu pod wypływem ogrzewania. Wprowadzenie do
makuchu lignosulfonianów w ilości 2,5 lub 5,0% SM obniżyło koncentrację białka i ADF. Ponadto zaobserwowano zmniejszenie rozpuszczalności azotu, szczególnie w przypadku 5% udziału tego dodatku. IVTD utrzymywała się na zbliżonym poziomie we wszystkich
makuchach poddanych ogrzewaniu, niezależnie od zastosowanego
dodatku. Obserwowane różnice w IVTD w stosunku do makuchu
surowego bez dodatku LSO3 sugerują stosunkowo dużą czułość tego
wskaźnika na działanie temperatury natomiast niewielką w odniesieniu do dodatku LSO3. Potwierdzają to wyniki badań zestawione na
rycinie 1, które z jednej strony obrazują wpływ pochodzenia lignosulfonianów, natomiast z drugiej wpływ temperatury na IVTD RSC.
Brak statystycznie istotnych różnic (P>0,05) pomiędzy IVTD makuchów ogrzewanych w temperaturze 90 i 110oC, może sugerować, że
przy przyjętym poziomie LSO3 niezależnie od pochodzenia wymienione temperatury są zbyt niskie, aby spowodować efekt uwidoczniony przy użyciu metody IVTD. Zastosowanie wyższej temperatury
(140oC) powodowało istotne (P<0,05) zmniejszenie IVTD. Wyniki
badań wskazują, że rozpuszczalność azotu, w porównaniu z IVTD,
jest wskaźnikiem bardziej czułym na zmiany dotyczące podatności
białka na rozkład w żwaczu i lepiej odzwierciedla zarówno wpływ
ogrzewania jak i dodatku LSO3. IVTD szacuje strawności suchej masy
paszy, stąd jest mniej przydatny do oceny degradacji białka. W tym
celu dla tego składnika bardziej przydatne wydają się być także metody in sacco. W doświadczeniach przeprowadzonych na zwierzętach
przez McAllister i in. (1993) oraz Wright i in. (2005) obserwowano
obniżenie strawności masy organicznej śruty poekstrakcyjnej sojowej i rzepakowej przy jednoczesnym zastosowaniu temperatury
i dodatku LSO3.
258
Wpływ temperatury i lignosulfonianów na skład chemiczny, rozpuszczalność...
Przyjmuje się, że rozpuszczalność azotu in vitro (metoda Licitra
i in. 1996) jest w wysokim stopniu skorelowana z podatnością białka
na rozkład w żwaczu. Zatem wysokiej rozpuszczalności azotu towarzyszy wysoka podatność białka badanej paszy na rozkład w żwaczu
i odwrotnie. W bieżących badaniach (Tab. 2) wykazano, że wraz ze
zwiększającą się temperaturą ogrzewania rozpuszczalność azotu
zmniejszała się a różnice pomiędzy średnimi były statystycznie istotnie (P<0,05). Dotyczyło to zwłaszcza temperatury 140oC, która
spowodowała również statystycznie istotne zmniejszenie IVTD (87,4
vs 81,4%). Wyniki te są zgodne z obserwacjami innych autorów (Lin
i Kung 1999, Micek i in. 2008), którzy sugerują, że prawdopodobnie spowodowane jest to zachodzącą reakcją Maillarda. Przy użyciu
zbyt wysokiej temperatury powstające kompleksy białko-cukier mają
charakter trwały, co prowadzi do ograniczenia strawności żwaczowej
białka i jednocześnie zmniejszenia wchłaniania aminokwasów egzogennych w jelicie cienkim. W badaniach własnych zawartość białka
ogólnego i ADF nie różniła się statystycznie pomiędzy makuchami
doświadczalnymi poddanymi działaniu temperatury i LSO3 różnego
pochodzenia (Tab. 2).
Tab. 1. Średni skład chemiczny, rozpuszczalność azotu (N-rozp.) oraz rzeczywista strawność in vitro (IVTD) makuchu rzepakowego bez dodatku lub
z dodatkiem lignosulfonianów
Udział
LSO3
w makuchu (%)
Ogrzewanie1
bez dodatku
surowy
368,1
243,2
7,01
43,9
88,1
bez dodatku
ogrzewany
371,3
235,1
6,77
37,8
85,8
2,5
ogrzewany
356,6
224,2
7,36
32,9
84,9
5,0
ogrzewany
349,2
224,4
7,84
30,9
85,9
BO
ADF
(g·kg-1 SM)
ADIN
N-rozp.
IVTD
(%)
(% N-ogólnego)
wartości średnie dla temperatur 90, 110 i 140oC
1
259
Katarzyna Słota, Piotr Micek
Tab. 2. Zawartość BO, ADF, ADIN, azotu rozpuszczalnego (N-rozp.) oraz
rzeczywista strawność in vitro (IVTD) makuchu rzepakowego poddanego
działaniu temperatury i lignosulfonianów – analiza dwuczynnikowa1
Wyszczególnienie
BO
90oC
354,2 a
230,3 a
7,23 a
39,47 a
87,44 a
110oC
357,2 a
227,2 a
6,99 a
28,47 a
87,40 a
140 C
356,4 a
220,9 a
8,17 b
20,73 b
81,37 b
bez dodatku
371,3 a
235,1 a
6,77 a
37,79 a
85,72 a
LSO3Ca1
343,4 b
231,7 a
8,40 b
29,76 b
85,37 a
LSO3Ca2
354,7 b
227,8 a
7,53 ab
33,30 b
84,77 a
LSO3Na1
356,5 b
213,0 a
7,19 a
31,29 b
85,70 a
LSO3Na2
353,9 b
225,9 a
7,39 ab
32,06 b
85,41 a
LSO3Mg
355,9 b
220,3 a
7,48 ab
33,16 b
85,75 a
Interakcja
NS
NS
NS
NS
0,018
SEM
0,19
0,25
0,16
1,56
0,60
temperatura
ogrzewania
Efekt
pochodzenie LSO3
o
ADF
(g·kg-1 SM)
ADIN
N-rozp.
(% N-ogólnego)
IVTD
(%)
Średnie w kolumnie oznaczone różnymi literami różnią się statystycznie (P<0,05).
1
Wnioski
Ogrzewanie w 140oC powoduje zmniejszenie rozpuszczalności azotu i IVTD
makuchu rzepakowego. Jednoczesne zastosowanie ogrzewania i dodatku
lignosulfonianów ogranicza rozpuszczalność azotu, bez istotnego wpływu
na zmiany IVTD. Przy ocenie podatności białka na rozkład w żwaczu w warunkach in vitro bardziej przydatna jest metoda oceny rozpuszczalności azotu.
260
Wpływ temperatury i lignosulfonianów na skład chemiczny, rozpuszczalność...
Ryc. 1. Strawność in vitro makuchu rzepakowego (IVTD) poddanego działaniu temperatury i lignosulfonianów różnego pochodzenia. Słupki oznaczone różnymi literami różnią statystycznie (P<0,05)
Literatura
ANKOM 2013. Procedures for fibre and in vitro analysis. URL: http:\\www.
ankom.com
AOAC 2001. Association of Official Analytical Chemists. Official methods
of analysis, 17th edition, Virginia, USA
Finot P.A. 2005. Historical Perspective of the Maillard Reaction in Food Science. Ann. New York Academy of Sciences, 1043, 1–8
Goering H.K., Van Soest P.J. 1970. Forage fiber analyses (apparatus, reagents, procedures and some application). Agric. Handbook, 379, ARSUSDA, Washington, 1-20
Kamalak A., Canbolat Ö., Gürbüz Y., Özay O. 2005. Protected protein and
amino acids in ruminant nutrition. J. Sci. Eng., 8(2), 84-88
Licitra G., Hernandez T.M., Van Soest P.J. 1996. Standardization procedures
for nitrogen fractionation of ruminant feeds. Anim. Feed Sci. Technol.,
57, 347–358
Lin Ch., Kung L. 1999. Heat treated soybeans and soybean meal in ruminant nutrition. Technical Bulletin of American Soybean Association &
United Soybean Board, 1-18
McAllister T.A., Cheng K.-J., Beauchemin K.A., Bailey D.R.C., Pickard M.D.,
Gilbert R.P. 1993. Use of lignosulfonate to decrease the rumen degradability of canola meal protein. Can. J. of Anim. Sci., 73(1), 211-215
261
Katarzyna Słota, Piotr Micek
Micek P., Kowalski Z.M., Borowiec F., Giza J. 2008. Próby ograniczenia rozkładu w żwaczu białka makuchu rzepakowego. Materiały Konferencyjne XXXVII Sesji Naukowej Komisji Żywienia Zwierząt KNZ PAN,
Szczecin
Neves C.A., Santos W.B., Santos G.T., Silva D.C., Jobim C.C., Santos F.S.,
Visentainer J., Petit H.V. 2009. Production performance and milk composition of cows fed extruded canola seeds treated with or without
lignosulfonate. Anim. Feed Sci. Tech. 154, 83-92
Toledo M.C.F., Kuznesof P.M. 2008. Calcium Lignosulfonate (40-65), Chemical and Technical Assessment. Joint FAO/WHO Expert Committee
on Food Additives, Switzerland
Wallace R.J., Falconer M.L. 1992. In vitro studies of conditions required to
protect protein from ruminal degradation by heating in the presence of
sugars. Anim. Feed Sci. Tech., 37, 129-141
Wright C.F., von Keyserlingk M.A.G., Swift M.L., Fisher L.J. 2005. Heat- and
lignosulfonate-treated canola meal as a source of ruminal undegradable protein for lactating dairy cows. J. Dairy Sci., 88, 238-243
Adres do korespondencji:
mgr inż. Katarzyna Słota, dr hab. inż. Piotr Micek;
Katedra Żywienia Zwierząt i Paszoznawstwa
Uniwersytet Rolniczy im. H. Kołłątaja w Krakowie
e-mail: [email protected]
262
M. Stefaniuk, Z. Podstawski
W. Młodawska
Opiekun naukowy: Prof. dr hab. Maria Kulisa
EPISTEME
22/2014, t. I
s. 263-269
ISSN 1895-2241
Chemotaksja plemników ogiera
Chemotaxis of stallion spermatozoa
Abstrakt. Chemotaksja jest zjawiskiem definiującym ukierunkowane przemieszczanie się obiektu, którym mogą być wolno żyjące organizmy lub
komórki, w środowisku, w którym występują kierunkowe bodźce chemiczne. Mechanizm ten został dokładnie zbadany i opisany u bakterii, natomiast u ludzi i zwierząt wciąż pozostaje nie do końca poznany. Celem pracy
była obserwacja chemotaktycznego oddziaływania przed owulacyjnego
płyn pęcherzykowego pochodzącego z jajników klaczy na skapacytowane w warunkach in vitro plemniki ogiera. Przeprowadzono 38 obserwacji,
w których użyto przed owulacyjny płyn pęcherzykowy klaczy (FF, follicular
fluid), oraz zbuforowany roztwór soli fizjologicznej (PBS, phospate bufered
saline) jako kontroli. Obserwacjom poddano skapacytowane in vitro plemniki ogierów pochodzące ze świeżego ejakulatu i z nasienia rozmrożonego.
Dla każdego nasienia (świeże i rozmrożone) wykonano po 19 obserwacji.
W 37,5% obserwacji przeprowadzonych na nasieniu świeżym, większą liczbę
plemników stwierdzono w zbiornikach zawierających FF. W pozostałych
62,5 % obserwacjach większą liczbę plemników notowano w zbiornikach
zawierających PBS. Wykazano, że w 41,1% obserwacji z użyciem nasienia
rozmrożonego większą liczbę plemników stwierdzano w zbiornikach zawierających FF. W pozostałych obserwacjach (58,9%) większą liczbę plemników
stwierdzono w zbiornikach zawierających PBS.
Słowa kluczowe: Chemotaksja, nasienie ogiera, płyn pęcherzykowy.
Summary. Chemotaxis is phenomenon that defines object –oriented movement which may be free-living organisms or cells in an environment where
are directional chemical stimuli. This mechanism has been carefully examined and described in bacteria, while in humans and animals is still not fully
understood. The aim of this study was to observe the impact of preovulotary
follicular fluid from ovaries of slaughtered mares on chemotactic activity
of stallion sperms. Conducted 38 observations, which were used experimentally preovulatory FF in mares and PBS as control. Observations were
capacitated in vitro stallion spermatozoa from fresh ejaculate and semen
263
M. Stefaniuk, Z. Podstawski, W. Młodawska, Maria Kulisa
thawed. For each semen (fresh or thawed) 19 observations were performed.
Among observations in fresh semen in 37,5% of them had a greater number
of sperms in the thanks containing FF. In other observations (62,5%) a greater number of sperm s in thanks containing the PBS have been reported,
it may mean that in follicular fluid shifted toward, the chemotactic active
spearms, which are part of the population capacitated spermatozoa. Were
shown that 41.1% of observations using thawed semen, the highest level
of spermatozoa were in tanks containing FF. In other observations (58,9%)
greater number of sperms has been found in the tanks containing PBS.
Keywords: chemotaxis, stallion semen, follicular fluid.
Wstęp
Prowadzone badania nad zapłodnieniem in vitro u koniowatych
wskazują na niską skuteczność tej metody. Niesie to za sobą konieczność lepszego poznania procesów prowadzących do zapłodnienia
komórki jajowej [Alm i in. 2001]. Fizjologia okresu około owulacyjnego u klaczy nie odbiega znacząco od innych gatunków ssaków. U koniowatych wydzielanie LH, stopniowo wzrasta podczas estrus osiągając
maksymalny poziom 1-2 dni po owulacji. Ponadto odsetek dojrzewających oocytów in vitro u klaczy, jak również udanych zapłodnień
in vitro jest dość niski, co pozwala stwierdzić, że muszą występować
pewne gatunkowo specyficzne mechanizmy ograniczające skuteczność metod in vitro stosowanych z powodzeniem u innych gatunków. Spośród wielu czynników niezbędnych w procesie zapłodnienia wymienia się przeżywalność plemników w drogach rodnych
samicy, kapacytację, reakcję akrosomową i chemotaksję plemników.
Są one zależne od kontaktu plemników ze składnikami środowiska
w którym się znalazły po opuszczeniu męskiego układu rozrodczego. Chemotaksja jest zjawiskiem definiującym ukierunkowane przemieszczanie się obiektu, którym mogą być wolno żyjące organizmy
lub komórki, w środowisku, w którym występują kierunkowe bodźce
chemiczne. Została opisana u gatunków bezkręgowców morskich
[Miller 1985], ssaków tj: u myszy [Giojalas i Rovasio 1998], królików
[Fabro i in. 2002], koni [Navarro i in. 1998] i świń [Serrano i in. 2001],
oraz u człowieka [Eisenbach i Tur-Kaspa 1999]. Badania sugerują, że
chemotaksja jest generalnym mechanizmem naprowadzania, niezależnie od tego czy zapłodnienie jest pozaustrojowe jak u większości
gatunków morskich [Cosson 1990], czy też wewnątrzustrojowe jak
264
Chemotaksja plemników ogiera
u ssaków [Eisenbach 2004]. Pomimo tego podobieństwa jest wiele
podstawowych różnic pomiędzy chemotaksją plemników ssaków
a bezkręgowców morskich. U ssaków, przed zapłodnieniem muszą
zajść główne modyfikacje: hiperaktywacja, kapacytacja, reakcja akrosomowa, które zależą od kontaktu plemników ze składnikami środowiska układu rozrodczego samicy [Davies Morel 1999].W związku
z tym liczba plemników, które są w stanie dotrzeć do komórki jajowej jest stosunkowo niewielka. U człowieka wynosi on zaledwie
zaledwie 10 % ejakulowanych plemników. Szanse na to, że tak mała
frakcja plemników trafi na oocyt przez przypadek są równie małe [Eisenbach i Giojalas 2006]. Badania in vitro wykazały, że skapacytowane plemniki są prowadzone do oocytu przede wszystkim na drodze
kombinacji termotaksji z chemotaksją. Prawdopodobnie procesy te
wspomagane są przez skurcze mięśniówki i ruch migawkowy wypustek nabłonka jajowodu. Wykazano że u myszy, płyn jajowodowy
zawiera przynajmniej jeden lub więcej chemoatraktantów, co podnosi prawdopodobieństwo, że różne chemoatraktanty są wydzielane
w różnych odcinkach jajowodu [Oliveira i in. 1999]. Stan kapacytacji
i gotowości chemotaktycznej jest stosunkowo statyczny, raczej krótki
(1-4 godzin u ludzi, u koni brak danych) i zachodzi tylko raz w „życiu”
plemnika. Niemniej jednak różne plemniki przechodzą kapacytację
w różnym czasie a kontynuacja wymiany skapacytowanych plemników w nasieniu gwarantuje, że gotowe do zapłodnienia plemniki
są dostępne w żeńskim układzie rozrodczym przez cały wymagany
do zapłodnienia okres[Cohen Dayag i in. 1995]. Tylko plemniki po
kapacytacji reagują chemoaktywnie na atraktant wydzielany przez
oocyt [Eisenbach i Giojalas 2006]. Rolą chemotaksji nasienia nie jest
nakierowanie największej możliwej ilości plemników w stronę oocytu, lecz rekrutacja wyselekcjonowanej ich frakcji w celu zapłodnienia komórki jajowej. Reasumując, chemotaksja nasienia wydaje się
efektywnym sposobem na selekcję plemników zdolnych do zapłodnienia komórki jajowej, dzięki czemu podnosi szansę na zapłodnienie oocytu [Cohen–Dayag i in. 1995]. Celem pracy była obserwacja
chemotaktycznego oddziaływania przed owulacyjnego płynu pęcherzykowego pochodzącego z jajników klaczy na skapacytowane w warunkach in vitro plemniki ogiera.
265
M. Stefaniuk, Z. Podstawski, W. Młodawska, Maria Kulisa
Materiał i metody
Do doświadczeń użyto świeżego i rozmrożonego nasienia. Nasienie świeże pobierano dwukrotnie zachowując 7 dniową przerwę.
Natomiast nasienie zamrożone w ciekłym azocie zdeponowane
w słomkach o pojemności 0,25 ml, pochodziło z Centrum Rozrodu
Koni SO Łąck sp. z o.o. [do doświadczeń użyto dwóch słomek nasienia]. Przeprowadzono po dwie serie obserwacji z każdym rodzajem
nasienia. Łącznie wykonano 38 obserwacji.
Płyn pęcherzykowy przygotowano wg metodyki Navarro i in. 1998.
Nasienie świeże: Nasienie pobrane zostało przy użyciu sztucznej pochwy model ”Kraków 1981”, od ogiera rasy konik polski stanowiącego klacze w Stacji Doświadczalnej Katedry Rozrodu i Anatomii Zwierząt UR w Krakowie w Przegorzałach. Pozyskano jedynie
frakcję bogatą w plemniki tj., pierwsze dwa wyrzuty ejakulatu [Tischner 2010]. Po pobraniu i ocenie ejakulat rozrzedzono w stosunku 1:2
rozcieńczalnikiem wg Kenney i in. [1975].
W laboratorium nasienie ekwilibrowano przez 30 min w temperaturze pokojowej, następnie rozdzielono do probówek o pojemności
1 ml i ponownie ogrzewano w cieplarce o temperaturze 370C przez
5 minut. Po tym czasie nasienie odwirowano [2500 obrotów przez
10 min-1] i odciągnięto supernatant. Nasienie poddano procedurze
swim-up wg metodyki Parrisha i Footea [1988]. Następnie aspirowano do probówek 0,8 ml. pożywki zawierającej plemniki i odwirowano
(2500 obrotów przez 10 min-1). Do tak przygotowanych probówek
dodano 7,14 µMol jonoforu wapnia i pozostawiono w cieplarce
o temperaturze 370C przez 10 minut. Po upływie wyznaczonego czasu dodano po 1 ml TALP w celu zatrzymania działania jonoforu. Tak
przygotowane nasienie użyto do dalszych badań.
Nasienie mrożone: Słomki rozmrożono w łaźni wodnej o temperaturze 430C przez 15 s. Po przeprowadzonej ocenie nasienia,
dalsze postępowanie metodyczne prowadzono według metodyki
postępowania z nasieniem świeżym. Wydłużono czas inkubacji do 40
minut w cieplarce przy 370C (dla nasienia świeżego wynosił on 30
minut).
Przebieg doświadczenia: Do przeprowadzenia doświadczenia
wykonano zestaw naczyń wg metodyki Navarro i in. 1998. W doświadczeniu wykorzystano zasadę „próby wyboru”, polegającą na wyborze
środowiska (FF lub PBS) przez plemniki. W każdym układzie kapilarę
266
Chemotaksja plemników ogiera
wypełniono 70 μl 0.01% roztworem kwasu hialuronowego i odstawiono na 1 godzinę w celu ustabilizowania układu. Po tym czasie, do
opisanych zbiorników odmierzano po 1,5 cm3 roztworu PBS i przygotowanego płynu pęcherzykowego. W dalszej kolejności do każdego
otworu w kapilarze pipetowano po 10 µl wcześniej przygotowanego nasienia [świeżego lub rozmrożonego]. Tak przygotowane układy
inkubowano w cieplarce w temperaturze 370C przez 2 godziny. Po
zakończonej inkubacji przenoszono ilościowo zawartość z poszczególnych zbiorników oraz kapilar do probówek, celem odwirowania, pozostawiając frakcje zawierającą plemniki. Liczbę plemników
w poszczególnych zbiornikach zawierających FF, PBS, oraz w kapilarze, określono przy użyciu komory Bürkera wyliczając średnie
w dwóch powtórzeniach z każdej obserwacji.
Analiza statystyczna.
Analizę wariancji przeprowadzono w oparciu o model liniowy obserwacji uwzględniający stałe efekty: dnia doświadczenia, rodzaju
nasienia oraz środowiska dla plemników. Średnie najmniejszych kwadratów porównano przy pomocy zmodyfikowanego testu Tukeya.
Wyniki i ich omówienie
Analiza statystyczna nie wykazała istotnych różnic między migracją
plemników do poszczególnych zbiorników. W trzech na 38 wykonanych obserwacji nie uzyskano spodziewanego wyniku w postaci migracji plemników w kierunku jednego ze zbiorników układu
zawierającego FF lub PBS. W obserwacjach, w których użyto nasienie świeże stwierdzono 31,4%, 44.2% i 24,4% plemników komorach
z FF i PBS i w kapilarach. W obserwacjach z nasieniem rozmrożonym
do zbiornika zawierającego płyn pęcherzykowy [FF] przemieściło się
29,7% plemników do zbiornika z PBS 49,7% a w kapilarze pozostało
20,6%. Uzyskane wyniki różnią się znacznie od przedstawionych
w literaturze [Navarro i in. 1998]. Mogło być to spowodowane kilkoma czynnikami takimi jak kumulacją nasienia w optymalnym stężeniu chemoatraktantów - co jest jedną z cech charakterystycznych
chemotaksji, ale może być spowodowana również innymi zjawiskami
takimi jak chemokineza czy trapping [Eisenbach 2004].
267
M. Stefaniuk, Z. Podstawski, W. Młodawska, Maria Kulisa
Tylko skapacytowane plemniki odpowiadają chemotaktycznie
w kierunku oocytu i otaczających go komórek wydzielających chemoatraktant, co sugeruje, że w warunkach in vivo rolą chemotaksji
nie jest pokierowanie jak największej ilości plemników do komórki
jajowej ale „rekrutacja” wyselekcjonowanej populacji plemników
zdolnej do zapłodnienia [Cohen – Dayag i in. 1995]. Badania niepublikowane (Młodawska informacja ustna) wykazały, że procentowy
udział skapacytowanych plemników w badaniach in vitro przy użyciu
opisanej metodyki pracy w nasieniu mrożonym wahał się pomiędzy
17,5% a 21 %. Porównując te dane z wynikami badań własnych przeprowadzonych na nasieniu rozmrożonym, gdzie ogólny odsetek
plemników przemieszczony w kierunku płynu pęcherzykowego
wyniósł 27 % można przypuszczać, że do zbiorników z FF migrowały
te plemniki które były również chemoaktywne.
Bibliografia:
Alm H. Torner H. Blottner G. Nurnberg G. Kanitz W. 2001. Efect of sperm
cryopreservation and treatment with calcium ionophore or heparin on
in vitro fertilization of horse oocytes. Theriogenology, 56: 817-829.
Cohen-Dayag A. Tur-Kaspa I. Dor J. Mashiach S. Eisenbach M. 1995. Sperm
capacitation in humans is transient and correlates with chemotactic
responsiveness to follicular factors. Proceedings of the National Academy of Sciences of the United States of America, 92: 11039-11043.
Cosson M.P. 1990. Controls of sperm motility: Biological and Clinical Aspects. CRC press, Boca Raton. Florida, 103-135.
Davis Morel M.C.G. 1999. Equine artificial insemination. CABI Publishing.
UK,
Eisenbach M. Tur-Kaspa I. 1999. Do human eggs attract spermatozoa? Bio
Essays, 21: 203-210.
Eisenbach M. 2004. Towards understanding the molecular mechanism of
sperm chemotaxis. The Journal of General Physiology, The Rockefeller
University Press, 124: 105-108.
Eisenbach M. Giojalas L.C. 2006. Sperm guidance in mammals -an unpaved
road to the egg. Nature. VII: 276-285.
Fabro G. Rovasio R.A. Civalero S. Frenkel A. Caplan S.R. Eisenbach M. Giojalas L.C. 2002. Chemotaxis of capacitated rabbit spermatozoa to follicular fluid revelated by a novel directionality based assay. Biology of
Reproduction, 67: 1565-1571.
268
Chemotaksja plemników ogiera
Giojalas L.C. Rovasio R.A. 1998. Mouse spermatozoa modify their dynamic parameters and chemotactic response to factors from the oocyte
microenvironment. International Journal of Andrology, 21: 201-206.
Ginter O. Bergfelt R. 1993. Growth of small follicles and concentrations of
FSH during equine oestrus cycle. Journal of Reproduction and Fertility, 9:105-111.
Kenney R. Bergman R.V. Cooper W.L. Morse W. 1975. Minimal contamination techniques for breeding mares: Technique and preliminary findings.
Protocols of American Association of Equine Practitioners, 327-335.
Miller R.L. 1985. Sperm chemo-orientation in the metazoan. Biology of fertilization, 28: 275-337.
Navarro MC. Valencia J. Vazquez C. Cozar E. Villanueva C. 1998. Crude
mare follicular fluid exerts chemottactic effects on stallion spermatozoa, Reproduction of Domestic Animals, 33: 321-32429.
Oliveira R.G., Tomasi L., Rovasio R.A., Giojalas L.C. 1999. Increased velocity
and induction of chemotactic response in mouse spermatozoa by follicular and oviductal fluids. The Journal of the Society for Reproduction
and Fertility. 115: 23–27.
Parrish J.J. Foote RH. 1988. Quantification of bovine sperm separation by
a swim-up method. Theriogenology, 29: 1375-1381.
Serrano H. Canchola E. Garcia – Suarez R.A. 2001. Sperm attracting activity
in follicular fluid associated to an 8.6 kDa protein. Biochemical and
Biophysical Research Communications, 283: 782-784.
Tishner M. 2010. Weterynaryjne i hodowlane aspekty rozrodu koni-ogier.
Drukpol. Kraków.
269
Katarzyna Suprewicz
Iwona Kozikowska
Opiekun naukowy: prof. nadzw. dr hab. Robert Stawarz
EPISTEME
22/2014, t. I
s. 271-279
ISSN 1895-2241
STĘŻENIE RTĘCI W ŁOŻYSKU I BŁONIE
PŁODOWEJ KOBIET ORAZ WE KRWI PĘPOWINOWEJ
A MASA URODZENIOWA NOWORODKÓW
CONCENTRATION OF MERCURY IN THE PLACENTA,
FETAL MEMBRANE OF WOMEN
AND IN CORD BLOODS OF NEWBORNS
AND THE BIRTH WEIGHT OF INFANTS
Abstrakt. Celem badań było określenie stężenie rtęci w łożysku, błonie płodowej kobiet oraz we krwi pępowinowej noworodków oraz określenie korelacji pomiędzy zawartością rtęci w badanych tkankach a wagą noworodków.
Materiał biologiczny był pobierany zaraz po porodzie od 40 kobiet (n=40
z Kliniki Położnictwa i Ginekologii w Katowicach. Noworodki zostały
podzielone na trzy grupy ze względu na osiągniętą wagę urodzeniową:
I grupa (≤2500g), II grupa (2500-3500g), III grupa (≥3500g). W wyniku
przeprowadzonych badań stwierdzono obecność rtęci we wszystkich poddanych analizie próbkach. Najwyższe stężenie rtęci (0,04282 µg∙g-1 w.m)
odnotowano w badanych tkankach u noworodków z niską masą urodzeniową (≤2500g) a najmniejszą u noworodków z wysoką masą urodzeniową
(≥3500g) (0,03508 µg∙g-1 w.m). Stwierdzono istnienie pozytywnych korelacji
pomiędzy kumulacją rtęci w łożysku oraz błonie płodowej a masą urodzeniową u noworodków, które osiągnęły masę urodzeniową ≥3500g. Istnienie
pozytywnej korelacji u noworodków z dużą masą urodzeniową świadczy
o istnieniu mechanizmów, które uniemożliwiają przenikaniu rtęci do płodu
przy jednoczesnym zwiększonym przepływie związków odżywczych.
Słowa kluczowe: rtęć, metale ciężkie, łożysko, krew pępowinowa, błona płodowa
Summary. The aim of the study was to determine the levels of mercury in
the placenta, fetal membrane women and in cord blood of newborns and
the correlation between the content of mercury in the tissues examined and
the weight of the newborn. The biological material was collected immediately after delivery from 40 women (n = 40 from the Department of Obstetrics and Gynecology in Katowice. Neonates were divided into three groups
271
Katarzyna Suprewicz, Iwona Kozikowska
according to the achieved birth weight: group I (≤2500g), group II (2500 3500g), group III (≥3500g). The studies revealed the presence of mercury in
all samples analyzed. The highest average mercury content of the 0.04282
µg g-1m.m was recorded in the tissues examined newborns with low birth
weight (≤ 2500g) and the lowest in neonates with high birth weight (≥ 3500
g) (0.03508 µg g-1m.m). It was the existence of a positive correlation between the accumulation of mercury in the placenta and fetal membranes in newborns who have attained birth weight ≥ 3500g. The existence of a positive
correlation in neonates with high birth weight indicates the existence of
mechanisms that prevent the penetration of mercury to the fetus by an increased flow of nutrients.
Key words: mercury, heavy metals, placenta, cord blood, amnion
Wstęp
Zanieczyszczenie środowiska przemysłem oraz działalnością
człowieka w niekorzystny sposób wpływa na rozwój organizmu.
Życie płodowe uważane jest za najbardziej wrażliwy etap rozwoju
człowieka [Wells i in. 2010]. Narażenie organizmu na ekspozycję
metali ciężkich w czasie fazy rozwojowej powoduje trwałe zmiany
strukturalne [Sly i Flack 2008]. Dzieci, których matki były wystawione na ekspozycję rtęci mają problemy z chodzeniem, mówieniem.
Poważniejszymi skutkami są uszkodzenia mózgu z upośledzeniem
umysłowym [Myers i in. 2003] oraz problemy sercowo-naczyniowe
[Karagas i in. 2012]. Metale ciężkie są dostarczane do płodu przez
barierę łożyskową [Reus i in. 2003]. W przypadku rtęci nie istnieje
żadna bariera, która przeciwdziałałby transmisji rtęci z organizmu
matki do organizmu płodu [Grandjean in. 1998]. Rtęć jest naturalnie
występującym elementem w przyrodzie. Występuje w trzech postaciach chemicznych: rtęć nieorganiczna (amalgamatowe wypełnienia dentystyczne), metylortęć (ryby i owoce morza), etylortęć
(szczepionki i preparaty medyczne) [Clarkosn 2002]. Najbardziej
niebezpieczną formą rtęci jest metylortęć, która dostaje się do organizmu człowieka wraz ze spożywaniem owoców morza [Myers i in.
2003].
Celem badań było określenie zawartości rtęci w łożysku, błonie
płodowej kobiet oraz we krwi pępowinowej noworodków z różną
272
Stężenie rtęci w łożysku i błonie płodowej kobiet oraz we krwi pępowinowej a masa
wagą urodzeniową oraz określenie korelacji pomiędzy zawartością
rtęci w badanych tkankach a wagą noworodków.
Materiał i metody
Materiał biologiczny (brzeżna część łożyska, centralna część łożyska,
błona płodowa owodnia), krew pępowinowa) został pobrany zaraz po
porodzie z Kliniki Położnictwa i Ginekologii w Katowicach. Łącznie
uzyskano i przebadano 120 próbek tkanek (n=120) pochodzących od
40 kobiet. Noworodki zostały podzielone na trzy grupy ze względu
na osiągniętą wagę urodzeniową: I grupa ( 2500g), II grupa (25003500g), III grupa (≥3500g). Komisja Bioetyczna wyraziła zgodę na
przeprowadzenie badań (No. 48/KBL/OIL / 2010 of 7 May 2010).
Koncentrację rtęci w łożysku, owodni i we krwi pępowinowej
określono metodą zimnych par (CV-AAS) z wykorzystaniem analizatora rtęci MA-2.Wyniki pomiarów wyrażono w mikrogramach
na gram mokrej masy (µg∙g-1 m.m). Uzyskane dane opracowano za
pomocą pakietu Statistica 9.0. W celu określenia istotności różnic
w zawartości rtęci w części centralnej łożyska, części brzeżnej łożyska, błonie płodowej (owodni) oraz we krwi pępowinowej noworodków
zakwalifikowanych do trzech grup ze względu na wagę urodzeniową
wykonano test ANOVA Kruskala – Wallisa. Dla wszystkich testów
przyjęto poziom istotności p≤0,05.
Wyniki
W wyniku przeprowadzonych badań stwierdzono obecność rtęci we
wszystkich poddanych analizie próbkach (ryc.1, 2, 3). Największą
średnią zawartość rtęci zanotowano w badanych tkankach w grupie
noworodków, które osiągnęły najniższą wagę urodzeniową (≥2500g)
(0,010224875 µg∙g-1 m.m). Najmniejszą średnią zawartość rtęci zanotowano w badanych tkankach w grupie noworodków, które osiągnęły
największą wagę (≤3500g) (0,0088 µg∙g-1 m.m).
273
Katarzyna Suprewicz, Iwona Kozikowska
Ryc. 1. Stężenie Hg w grupie noworodków o masie ≤2500g
Ryc. 2. Stężenie Hg w grupie noworodków o masie 2500g-3500g
274
Stężenie rtęci w łożysku i błonie płodowej kobiet oraz we krwi pępowinowej a masa
Ryc. 3. Stężenie Hg w grupie noworodków o masie ≥3500g
W wyniku przeprowadzonego eksperymentu stwierdzono istnienie statystycznie istotnych różnic w średniej zawartości rtęci pomiędzy
badanymi tkankami u noworodków z masą urodzeniową ≤2500g (pomiędzy brzeżną częścią łożyska a krwią pępowinową (p=0,002503),
centralną częścią łożyska a krwią pępowinową (p=0,001869) oraz
błoną płodową (owodnią) a krwią pępowinową (p=0,004897) oraz
u noworodków z masą urodzeniową 2500g-3500g (pomiędzy;
brzeżną częścią łożyska a krwią pępowinową (p=0,001925), centralną częścią łożyska a krwią pępowinową (p=0,007504) oraz błoną
płodową (owodnią) a krwią pępowinową (p=0,025255).
Istnienie statystycznie istotnych, pozytywnych korelacji
stwierdzono pomiędzy zawartością rtęci w błonie płodowej
(p=0,046492), brzeżnej części łożyska (p=0,009117) oraz centralnej części łożyska (p=0,032830) a masą urodzeniową noworodków
z grupy o wysokiej masie urodzeniowe (>3500g).
275
Katarzyna Suprewicz, Iwona Kozikowska
Tab. 1. Korelacja pomiędzy zawartością rtęci w badanych tkankach a masą
urodzeniową noworodków (wyniki testu macierz korelacji, p≤0.05).
Masa noworodków
≤2500g
2500-3500g
>3500g
p=0,766227
p=0,455103
p=0,046492*
Badana tkanka
Błona płodowa
Brzeżna część łożyska
Centralna część łożyska
Krew pępowinowa
r(X,Y)=-0,108123
r(X,Y)=-0,217496
r(X,Y)=0,67401
r2=0,011691
r2=0,047305
r2=0,454318
p=0,867582
p=0,445018
p=0,009117*
r(X,Y)=-0,060758
r(X,Y)=-0,222269
r(X,Y)=0,80322
r2=0,003691
r2=0,049403
r2=0,645262
p=0,591616
p=0,339131
p=0,032830*
r(X,Y)=-0,193807
r(X,Y)=-0,276204
r(X,Y)=0,70796
r2=0,037561
r2=0,076289
r2=0,501245
p=0,680285
p=0,325531
p=0,703820
r(X,Y)=0,1494449
r(X,Y)=-0,283761
r(X,Y)=0,14806
r2=0,022335
r2=0,080520
r2=0,021923
Dyskusja
Okres wewnątrzmacicznego wzrostu i rozwoju jest jednym z najważniejszych okresów w życiu człowieka. Masa ciała dziecka po
urodzeniu jest istotnym wskaźnikiem wzrost i przeżywalność niemowlęcia. Dzieci z niską masą urodzeniową mają mniejsze rezerwy
zgromadzonych składników odżywczych [Elizabeth 2008].
Prezentowanie w niniejszej pracy wyniki badań wskazują, że rozkład rtęci w różnych częściach łożyska, błonie płodowej (owodni)
oraz we krwi pępowinowej u noworodków o różnej masie urodzeniowej nie jest równomierny. Najwyższe stężenie rtęci odnotowano
w łożysku oraz w błonie płodowej a najniższe we krwi pępowinowej
noworodków we wszystkich poddanych analizie próbkach. Świadczy
to o niecałkowitym przenikaniu toksycznego związku przez barierę łożyskową [Corbitt i in. 2011] oraz o pełnieniu przez łożysko
funkcji ochronnej. Metale są przenoszone oraz zatrzymywane przez
łożysko w różnych ilościach. Poziom rtęci we krwi pępowinowej jest
zazwyczaj wyższy [Gundacker i Hengstschläger 2011], co może być
związane z transportem aktywnym do płodu [Stern i Smith 2003].
276
Stężenie rtęci w łożysku i błonie płodowej kobiet oraz we krwi pępowinowej a masa
Wysoka zawartość rtęci we krwi pępowinowej może być skutkiem
wiązania i zatrzymywania ksenobiotyku przez albuminy, których poziom w osoczu krwi pępowinowej jest dosyć wysoki [Manson 1986].
Białko surowicy (α-fetoproteina), może również wiązać metylortęć
(MeHg), zwiększając jej stężenie we krwi płodu [Deutsch 1991]. Badania przeprowadzone przez Hubermont i in. [1978] w Belgii wykazały, że poziom rtęci w próbkach krwi pępowinowej był wyższy niż
poziom rtęci we krwi matki i w łożysku. W naszych badaniach wykonanych na Górnym Śląsku uzyskano odmienne wyniki. Najwyższy
poziom rtęci zaobserwowano w badanych częściach łożyska oraz
w owodni kobiet, najniższy zaś poziom zanotowano we krwi pępowinowej noworodków. Wyniki te potwierdzają badania prowadzone
przez Tsuchiya in. [1984] przeprowadzone w mieście Nagoya w Japoni.
Stężenie rtęci wzrasta wraz ze wzrostem wagi noworodków.
Łożysko matek, których dzieci osiągnęły wysoka masę urodzeniowa stanowi lepszą barierę niż łożysko matek, które urodziły małe
dzieci. Istnienie statystycznie istotnej korelacji z wysoką masą
urodzeniową (tab.1) może świadczy o istnieniu mechanizmów,
które uniemożliwiają przenikanie rtęci do płodu przy jednoczesnym
zwiększonym przepływie związków odżywczych. Istnieje prawdopodobieństwo, iż rtęć nie wpływa na wewnątrzmaciczny wzrost płodu
[Grandjean i in. 2001], jednak obserwuje się ryzyko wcześniejszego
terminu porodu [Hue i in. 2006].
Wnioski
Stężenie rtęci nie jest równomierne w badanych tkankach. Stwierdzona zawartość rtęci we krwi pępowinowej przy zwiększonej zawartości
w łożysku może świadczyć o jej ograniczonym przenikaniu przez barierę łożyskową do płodu.
Stężenie rtęci w poszczególnych grupach wagowych noworodków nie jest taka sama. Wraz ze wzrostem masy urodzeniowej
noworodków zmniejsza się średnia zawartość rtęci w badanych
tkankach. Świadczy to o istnieniu specyficznych barier, które uniemożliwiają przenikanie ksenobiotyku do płodu.
Istnienie pozytywnej korelacji badanych parametrów u noworodków z dużą masą urodzeniową (≤3500g) świadczy o istnieniu
277
Katarzyna Suprewicz, Iwona Kozikowska
mechanizmów, które uniemożliwiają przenikaniu rtęci do płodu przy
jednoczesnym zwiększonym przepływie związków odżywczych.
Bibliografia
Clarkson T.W. 2002. The three modern faces of mercury. EnvironHealth
perspect, 110 (S1); 11-23.
Corbitt ES., Jacob DJ., Holmes CD., Streets DG. and Sunderland EM. 2011.
Global source-receptor relationships for mercury deposition under
present-day and 2050 emissions scenarios. Environmental Science &
Technology 45:10477-10484.
Deutsch H.F. 1991. Chemistry and biology of alpha-fetoprotein. Adv Cancer
Res 56:253–312.
Elizabeth K.E., Krishnan V., Vijayakumar T. 2008. Umbilical cord blood nutrients in low birth weight babies in relation birth weight and gestational age. Indian J Med Res 128(2):104–106
Grandjean P., Weihe P., White R., Debes F. 1998. Cognitive performance of
children prenatally exposed to ‘safe’ levels of methylmercury. Environ
Res, 21:165–72.
Grandjean P., Bjerve K.S., Weihe P. 2001. Birthweight in a fishing community; significance of essentianl fatty acids and marine food contaminants. Int J Epidemiol, 30;1272-1278.
Grandjean P. and Korrick S. 2012. Evidence on the human health effects of
low level methylmercury exposure. Environmental Health Perspectives
120:799-806.
Gundacker C. and Hengstschläger M. 2011. The role of the placenta in fetal
exposure to heavy metals. Institute of Medical Genetics, Medical University of Vienna, Vienna, Austria Received. 162/9–10: 201–206.
Hubermont G., Buchet JP, Roels H, Lauwerys R. 1978. Placental transfer
of lead, mercury and cadmium in women in a rural area. Intern Arch
Occup Environ Health (41): 117-124
Hujoel P.P., Lydon-Rochelle M., Bollen AM. 2005. Mercury exposure from
dental filling placement during pregnancy and low birth weight risc.
Am J Epidemiol, 161; 734-740.
Karagas M.R., Choi AL., E. Oken E., Horvat M., Schoeny R., Kamai E.,
Cowell W.,
Manson J.M. 1986. Teratogens. In: Casarett and Doull’s Toxicology—The
Basic Science of Poisons (Klassen CD, Amdur MO, Doull J, eds). 3rd ed.
New York:Macmillan, 195–220.
278
Stężenie rtęci w łożysku i błonie płodowej kobiet oraz we krwi pępowinowej a masa
Myers G.J., Davidson P.W., Cox C. 2003. Prenatal methylmercury exposure from ocean fish consumption in the Seychelles child development
study. Lancet, 361:1686–92.
Reus I.S., Bando I., Andres D., Cascales M. 2003.Relationship between expression of HSP70 and metallothionein and oxidative stress during
mercury chloride induced acute liver injury in rats. J Biochem Mol Toxicol, 17:161–8.
Sly P.D., Flack TE. 2008. Environmental exposures, toxicologic mechanism,
ad adverse pregnancy outcomes. Am. J. Obstet. Gynecl. 192. S11-21.
Stern AH., Smith AE. 2003. An assessment of the cord blood; material blood
methylmarcury ratio;implications for risk assessment. Environ Health
Perspect, 111;1465-1470.
Tsuchiya H., Mitani K., Kodama K., Nakata T. (1984) Placental transfer
of heavy metals in normal pregnant Japanese women. Arch Environ
Health (1):11-17
Weil M., Bressler J., Parsons P., Bolla K., Glass T., Schwartz B. 2005.Blood
mercury levels and neurobehavioral function. JAMA, 293: 1875–82.
Adres do korespondencji:
mgr Katarzyna Suprewicz, mgr Kozikowska Iwona
Zakład Zoologii Kręgowców i Biologii Człowieka
Instytut Biologii
ul. Podbrzezie 3, 31-054 Kraków
e-mail: [email protected]
279
Hanna Szczukowska
Radomir Graczyk
Anna Seniczak
Opiekun naukowy: dr hab. inż. Anna Seniczak
prof. nadzw. UTP
EPISTEME
22/2014, t. I
s. 281-291
ISSN 1895-2241
WPŁYW NAWOŻENIA OBORNIKIEM ŚWIŃSKIM
I KOZIM NA MECHOWCE
(ACARI: ORIBATIDA) ŁĄKOWE
THE IMPACT OF PIG AND GOAT MANURE FERTILIZATION
ON ORIBATID MITES (ACARI: ORIBATIDA) OF THE MEADOW
Abstrakt. Celem badań było określenie wpływu nawożenia obornikiem
świńskim i kozim na mechowce łąkowe. Łąka, stanowiąca teren badań, należy do Rolniczego Zakładu Doświadczalnego w Minikowie. W doświadczeniu zastosowano dwa rodzaje obornika w 3 dawkach (80, 140 i 200 kg N/
ha). Próby w 10 powtórzeniach pobrano z 3 warstw, w 3 kolejnych sezonach 2012 roku. Łącznie pobrano 630 prób. Roztocze wypłaszano z prób
w aparatach Tullgren’a i konserwowano w 70% etanolu. Następnie, oznaczano gatunki mechowców, włącznie ze stadiami młodocianymi. Łącznie oznaczono 27 gatunków mechowców, wśród których tylko niektóre
występowały licznie. Liczebność mechowców różniła się znacząco w poszczególnych sezonach, a także w zależności od rodzaju i dawki zastosowanego
nawozu. Największą liczebność stwierdzono w sezonie wiosennym, na poletkach nawożonych najniższą dawką obornika. Wśród mechowców zwykle
dominowały osobniki dorosłe.
Słowa kluczowe: obornik świński, obornik kozi, łąka, mechowce
Summary. The aim of the study was to determine the impact of pig and
goat manure fertilization on the meadow’s oribatid mites. The research area
belongs to The Agricultural Experiment Station in Minikowo. Two types of
manure were used in 3 doses (80, 140 and 200 kg N per ha). Then ten replicate samples were taken from 3 layers in 3 consecutive seasons in 2012,
so 630 samples in total were gathered. The mites from the samples were
extracted in Tullgren funnels and preserved in 70% ethanol. Next, the Oribatida were determined to species, including the juvenile stages. In total, 27
species of the oribatid mites were investigated, but only few of them were
abundant. The density of Oribatida differed significantly, depending on the
281
Hanna Szczukowska, Radomir Graczyk, Anna Seniczak
manure type and dose as well as among particular seasons. The highest density was discovered in spring, from the fields fertilized with the lowest dose
of the manure. Among the oribatid mites, adults usually dominated. Key words: pig manure fertilization, goat manure fertilization, meadow, oribatid mites
Wstęp
Łąki są zwykle zbiorowiskami antropogenicznymi, a sposób użytkowania i układ stosunków wodnych decydują o ich jakości. Warunkiem
zapewniającym utrzymanie korzystnego składu gatunkowego łąk
i poprawę ich produktywności jest systematyczne nawożenie [Lorimor
i Powers 2000]. Nawóz dostarcza roślinom składników mineralnych
i substancji organicznej [Burs i in. 2004]. Nawozem naturalnym o
dużej zawartości azotu jest obornik, stosowany zarówno na grunty
orne, jak i łąki. Użycie obornika na łące zwiększa biomasę roślin, pełni
rolę ochronną dla gleby i poprawia jej właściwości [Wesołowski 2008].
Wzrost zawartości substancji organicznej w glebie wpływa
korzystnie na aktywność biologiczną, w tym na roztocze glebowe.
Roztocze (Acari), do których zaliczane są mechowce (Oribatida),
stanowią istotny składnik ekosystemów nadziemnych i glebowych.
Mechowce należą głównie do saprofagów i odgrywają ważną rolę
w procesie rozkładu martwej materii organicznej, gdyż są jednymi
z pierwszych zwierząt glebowych rozkładających materię organiczną.
Mechowce słabo wykorzystują pobrany pokarm, dlatego muszą go
dużo zjadać. Ten sposób odżywiania odbija się korzystnie na biocenozie, ponieważ większa aktywność odżywcza Oribatida to szybszy
rozkład materii. Pobierając resztki organiczne roztocze wykorzystują
je jako źródło energii do życia. W wyniku procesów metabolicznych
następuje mineralizacja, dzięki której substancje organiczne stają
się łatwiej przystępne dla innych organizmów oraz mogą stanowić
pokarm dla roślin. Pozytywna rola mechowców wynika też z mechanicznego rozdrabniania materii oraz zwiększania jej powierzchni.
Umożliwia to bowiem nasilenie inwazji bakterii i grzybów, które są
właściwymi reducentami materii organicznej. Ponadto, mechowce
stanowią źródło pożywienia dla wielu zwierząt glebowych (np. drapieżnych roztoczy, owadów), pełnią rolę glebotwórczą, a także biorą
udział w przenoszeniu niektórych pasożytów. Istotną rolę odgrywają
282
Wpływ nawożenia obornikiem świńskim i kozim na mechowce...
tu pewne gatunki mechowców, związane zarówno z rozwojem tasiemców Moniezia expansa (Rud.) i Moniezia benedeni (Moniez), których
żywicielami ostatecznymi są owce, kozy i bydło, jak oraz z rozwojem
tasiemców występujących głownie w lasach i zarażających zwierzęta dzikie. Sarny, jelenie czy dziki mogą zarażać pastwiska lub łąki,
a w konsekwencji prowadzi to do zarażenia zwierząt gospodarskich
i poważnych strat w hodowli [Boczek 1980, Boczek i Błaszak 2005,
Goralski 1968, Moore i in. 1988, Niedbała 1980, Norton 1986, Rajski
1959].
Przeprowadzone badania miały na celu sprawdzenie, jak wpływa
obornik na mechowce łąkowe. Postawiono dwie hipotezy badawcze: 1. wpływ nawożenia obornikiem na mechowce zależy od rodzaju
i dawki obornika; 2. niewielkie dawki obornika stymulują, a duże
ograniczają mechowców i zmieniają jej skład gatunkowy.
Materiał i metody
Badania prowadzono na łące dwukośnej w Minikowie na terenie Rolniczego Zakładu Doświadczalnego UTP (ok. 25 km od Bydgoszczy).
Wyznaczono 7 poletek o wymiarach 4m x 4m, rozdzielonych 5-metrowymi pasami izolacyjnymi. Wczesną wiosną 2012 roku zastosowano na 3 poletkach obornik świński w 3 dawkach (80 kg N•ha-1,
140 kg N•ha-1, 200 kg N•ha-1), na 3 kolejnych poletkach obornik kozi
w takich samych 3 dawkach, a jedno poletko kontrolne nie zostało
nawożone. Obornik kozi i świński pochodził od polskich ras zwierząt [Tyszka 1994, Grudniewska 1998]. Próby o powierzchni 17 cm2
i objętości 50 cm3 pobierano z 3 warstw (dolnej części roślin, górnej
i dolnej warstwy gleby) w 10 powtórzeniach, w 3 kolejnych porach
roku (wiosna, lato, jesień). Łącznie uzyskano w całym badaniu 630
prób. Materiał poddano procesowi wypłaszania w zmodyfikowanych
aparatach Tullgrena przez 8 dób. Roztocze konserwowano w 70%
alkoholu etylowym i preparowano przy użyciu mikroskopu stereoskopowego. Łącznie oznaczono 6872 mechowce wraz ze stadiami młodocianymi (zarówno larwami, jak i nimfami). Mechowce oznaczono
do gatunku wg Weigmann’a [2006]. Uzyskany materiał poddano analizie przy pomocy wskaźników syntetycznych i analitycznych: abundancji (A); liczby gatunków mechowców (S); dominacji (D); ogólnej
różnorodności Shannona (H’) [Górny 1975; Odum 1982].
283
Hanna Szczukowska, Radomir Graczyk, Anna Seniczak
Uzyskane dane poddano analizie statystycznej przy użyciu
pakietu Statistica 10.0 [Stanisz 2006a,b]. W celu określenia istotności różnic w bogactwie i obfitości mechowców pomiędzy badanymi
poletkami przeprowadzono „ANOVA rang Kruskal-Wallis”. Jeśli test
Kruskal’a-Wallis’a był pozytywny (p<0,05) przeprowadzono test wielokrotnych porównań średnich rang. Poziom istotności dla wszystkich testów statystycznych przyjęto α = 0,05.
Wyniki
Najwyższą liczbę mechowców stwierdzono wiosną, a najniższą jesienią. Oribatida występowały najliczniej na poletkach nawożonych
najniższą dawką, zarówno obornika świńskiego, jak i koziego,
a najmniej licznie na poletkach nawożonych najwyższą dawką.
Wzrost ich liczebności, w porównaniu do poletka kontrolnego, zanotowano jedynie przy dawce nawozów 80 kg N•ha-1 (tab. 1, ryc. 1). Na
badanej łące we wszystkich sezonach udział osobników dorosłych
był wyższy niż juwenilnych. Udział osobników młodocianych był
najwyższy wiosną, przy czym nawożenie obornikiem świńskim i kozim ograniczyło ich liczebność w poszczególnych sezonach. Na badanej łące stwierdzono łącznie 26 taksonów mechowców, z których
18 było na każdym poletku w każdym sezonie. Najwięcej taksonów
stwierdzono wiosną, najmniej jesienią. Najwięcej gatunków wystąpiło
na poletkach nawożonych dawką 80 kg N•ha-1 (14–20 gatunków),
a najmniej gdzie nawożono dawką 200 kg N•ha-1 (9–14 gatunków).
Po zastosowanym nawożenia, wskaźnik różnorodności gatunkowej
Shannona miał najwyższe wartości na poletkach z obornikiem kozim
w dawce 80 kg N•ha-1, a najniższe uzyskał na poletkach z obornikiem
świńskim w dawce 200 kg N•ha-1.
Wśród Oribatida najliczniejszymi gatunkami były Achipteria coleoptrata, Eupelops occultus, Liebstadia similis i Scheloribates laevigatus
(tab. 2). Achipteria coleoptrata po nawożeniu obornikiem kozim zareagował wzrostem liczebności, zwłaszcza w dawce 80 kg N•ha-1 i 140 kg
N•ha-1, gdzie uzyskał najwyższy wskaźnik dominacji. Wzrostem liczebności na najniższą dawkę nawozów zareagował Eupelops occultus.
W populacjach Achipteria coleoptrata i Eupelops occultus na wszystkich
badanych poletkach przeważały osobniki dorosłe. Formy młodociane
u Liebstadia similis zareagowały wzrostem liczebności na nawożenie
284
Wpływ nawożenia obornikiem świńskim i kozim na mechowce...
obornikiem świńskim wiosną i latem, gdzie przeważały nad osobnikami dorosłymi. Scheloribates laevigatus był najliczniejszy wiosną i latem oraz uzyskał najwyższe wskaźniki dominacji spośród wszystkich
gatunków. Jego formy młodociane przeważały po nawożeniu obornikiem świńskim w dawkach 80 kg N•ha-1 i 140 kg N•ha-1 w sezonie
letnim.
Tab. 1. Liczebność (A w tys. osobn.•m-2), liczba gatunków (S) i wskaźnik
różnorodności gatunkowej Shannona (H’) Oribatida na badanej łące.
W – wiosna, L – lato, J – jesień
Dawka (kg
N•ha-1)
0
80
140
200
80
140
200
26.3
35.0
21.6
10.5
28.0
22.0
15.9
H’
Osobniki
dorosłe
Obornik kozi (OK)
W
L
20.2
12.2
5.9
9.0
21.1
16.3
5.6
J
18.1
14.6
5.8
3.4
16.7
11.2
2.8
W
7.7
6.3
5.4
3.4
8.1
5.0
6.7
L
7.2
6.6
6.3
2.3
3.0
3.4
3.6
J
3.3
4.2
2.0
2.5
2.4
1.6
1.0
W
34.0
41.4
26.9
13.9AB
36.1D
27.0
22.6
L
27.4
18.7
12.2
11.3
24.1
19.7
9.2A
J
21.4
18.8
7.8
5.8A
19.1
12.8
3.8A
Razem
S
Obornik świński (OŚ)
Formy
młodociane
A
Poletko
kontrolne
(PK)
Oribatida
Nawóz
W
17
20
15
13
19
18
14
L
16
17
12
9
18
14
14
J
15
14
9
10
14
12
9
W
2.00
1.97
1.84
1.49
2.13
2.10
1.86
L
1.99
1.95
1.67
1.54
2.20
1.98
1.57
J
2.25
2.14
1.87
1.90
1.96
1.83
1.88
Różnice istotne statystycznie przy p <0,05: A między PK a poletkami
nawożonymi; B między O.Ś. 80 a O.Ś. 140, O.Ś. 200, O.K. 80, O.K. 140, O.K.
200; C między O.Ś. 140 a O.Ś. 200, O.K. 80, O.K. 140, O.K. 200; D między
O.Ś. 200 a O.K. 80, O.K. 140, O.K. 200; E między O.K. 80 a O.K. 140, O.K.
200; F między O.K. 140 a O.K. 200.
285
Hanna Szczukowska, Radomir Graczyk, Anna Seniczak
Poletko kontrolne (PK)
Tab. 2. Liczebność (w tys. osobn.•m-2) i wskaźnik dominacji (D w %)
wybranych gatunków mechowców na badanej łące. W – wiosna, L – lato,
J – jesień, d – osobniki dorosłe, r – razem
Nawóz
Achipteria coleoptrata
(Linnaeus, 1758)
Dawka (kg N•ha-1)
W
L
J
Eupelops occultus
(C.L. Koch, 1835)
W
L
J
286
Obornik świński
(OŚ)
Obornik kozi (OK)
0
80
140
200
80
140
200
d
2.2
2.3
2.2
0.4
2.3
2.8
2.3
r
2.6
2.4
2.2
0.4
2.8
E
3.0
2.6F
D
7.6
5.7
8.3
3.0
7.9
10.9
11.5
d
1.5
1.9
0.7
0.5
4.1
1.8
0.2
r
1.6
2.2
0.8
0.5B
4.1D
1.8
0.2B
D
5.7
11.6
6.4
4.8
17.0
9.2
2.6
d
3.2
2.4
0.7
0.5
4.4
2.8
0.5
r
3.3
2.6
0.7AB
0.5AB
4.4CD
2.9CD
0.5AB
D
15.2
13.8
8.5
8.3
23.0
22.6
14.3
d
5.6
14.9
8.2
3.7
7.8
7.1
5.4
r
6.4
15.9
8.7
4.1
9.0
7.8
6.7
D
18.8
38.4
32.4
29.6
25.0
28.8
29.9
d
5.2
3.6
1.3
1.1
3.3
5.7
0.6
r
5.4
3.7
1.3
1.1
3.5
6.0
0.7AF
D
19.6
19.9
10.9
10.2
14.5
30.6
7.2
d
3.4
2.4
1.4
1.3
3.1
3.6
1.0
r
3.5
2.8
1.7
1.6
3.4
3.8
1.1
D
16.3
14.7
21.7
26.8
17.9
29.7
28.6
A
D
Wpływ nawożenia obornikiem świńskim i kozim na mechowce...
Liebstadia similis
(Michael, 1888)
W
L
Scheloribates laevigatus
(C.L. Koch, 1835)
J
W
L
J
d
3.0
1.9
0.7
0.5
2.5
1.5
0.1
r
3.7
3.1
1.6
1.3
4.2
2.1
1.3
D
10.1
7.4
6.0
9.1
11.7
7.6
5.9
d
1.8
1.1
0.2
0.6
2.2
1.1
0.1
r
2.5
2.2
1.4
1.3
2.7
1.8
0.3ABE
D
9.2
11.6
11.9
11.8
11.0
9.2
3.3
d
1.5
0.5
0.5
0.3
1.0
0.5
0.1
r
2.3
1.7
0.8
0.8
1.4
0.8
0.2A
D
10.7
9.0
10.9
14.4
7.6
6.6
4.8
d
7.3
6.9
5.7
4.9
6.6
4.2
4.5
r
11.3
8.2
8.3
6.6
9.0
5.7
7.6
D
33.1
19.8
30.9
47.8
24.9
21.2
33.6
d
4.6
2.5
2.1
4.9
4.6
3.4
2.6
r
9.2
6.4
6.3
6.0
5.8
5.1
4.1
D
33.6
34.4
52.0
52.9
24.3
26.0
44.4
d
2.8
3.1
1.6
0.8
4.7
2.5
0.5
r
3.1
3.9
2.6
1.6
5.4
3.0
0.7
D
14.4
20.8
33.3
26.8
28.0
23.1
17.5
Różnice istotne statystycznie przy p <0,05: A między PK a poletkami
nawożonymi; B między O.Ś. 80 a O.Ś. 140, O.Ś. 200, O.K. 80, O.K. 140, O.K.
200; C między O.Ś. 140 a O.Ś. 200, O.K. 80, O.K. 140, O.K. 200; D między
O.Ś. 200 a O.K. 80, O.K. 140, O.K. 200; E między O.K. 80 a O.K. 140, O.K.
200; F między O.K. 140 a O.K. 200
Ryc. 1. Rozkład procentowy mechowców na badanych poletkach
(poletka wg rodzaju nawozu: O.Ś. – obornik świński,
O.K. – obornik kozi oraz wg dawki obornika w kg N•ha-1)
287
Hanna Szczukowska, Radomir Graczyk, Anna Seniczak
Dyskusja i wnioski
Niewielkie dawki azotu stymulują wzrost roślin i plon zielonej masy,
wzbogacają glebę w materię organiczną i wpływają pozytywnie na
liczebność, różnorodność gatunkową, strukturę wiekową roztoczy.
Wysokie dawki azotu działają z reguły na edafon ograniczająco. Użyte w badaniu nawożenie ograniczyło ogólną liczebność Oribatida
w porównaniu z poletkiem kontrolnym. Mogło być to spowodowane
wysokim stężeniem form amonowych w glebie, które są toksyczne dla
stawonogów glebowych [Warren 1962]. Na badanej łące największą
liczebność mechowców zanotowano wiosną, a najmniejszą jesienią.
Liczebność w różnych sezonach zależy od roślinności, gleby i biologii dominujących gatunków. Podobny układ liczebności roztoczy
zaobserwował Schuster [1988]. Seniczak i in. [2005], nawożąc łąki
azotem w dawkach 6,50 i 200 kg N•ha-1 zaobserwowali największą
liczebność Oribatida latem, a najniższą wiosną. Trojanowski i Baluk
[1992] wykazali, że nawożenie dawką 180 kg N•ha-1 nie zmieniło
dynamiki liczebności mechowców, a wyższa dawka azotu wyraźnie
ograniczyła liczebność. Wśród Oribatida dominowały Achipteria coleoptrata, Eupelops occultus, Liebstadia similis i Scheloribates laevigatus,
które wyraźnie zmieniły dynamikę liczebności pod wpływem obornika świńskiego i koziego. Barutzki i Parwar [1986] zanotowali dominację liczebności Liebstadia similis latem, a Scheloribates laevigatus
zimą. Poszczególne gatunki mechowców w tym samym środowisku
wykazują optimum liczebności w różnych porach roku [Barutzki
i Parwar 1986, Stamou i Sgardelis 1989]. Dynamika sezonowa Oribatida jest jeszcze niedostatecznie poznana, gdyż zależy od wielu
czynników środowiskowych, np. niska wilgotność latem czy niska
temperatura wiosną mogą ograniczać rozrodczość i powodować spadek liczebności mechowców [Niedbała 1980].
Bibliografia
Barutzki D. Parwar M.S. 1986. Untersuchungen zur Saisondynamik von
Zwischenwirten sowie Überlebensfähigkeit von Eiern des Schafbandwurmes Moniezia expansa (Rudolphi, 1810). Journal of Veterinary
Medicine, 32: 284-293.
Boczek J. 1980. Zarys akarologii rolniczej. PWN. Warszawa.
288
Wpływ nawożenia obornikiem świńskim i kozim na mechowce...
Boczek J. Błaszak C. 2005. Roztocze (Acari) – znaczenie w życiu i gospodarce
człowieka. Wydawnictwo SGGW. Warszawa.
Burs W. Jankowska-Huflejt H. Wróbel B. Zastawny J. 2004. Użytkowanie
kośne użytków zielonych. Materiały dla rolników. MRiRW. Radom.
Goralski J. 1968. Żywienie roślin i nawożenie. PWRiL, Warszawa.
Górny M. 1975. Zooekologia gleb leśnych. PWRiL, Warszawa.
Grudniewska B. (red.) 1998. Hodowla i użytkowanie świń. Wydawnictwo
ART. Olsztyn.
Lorimor J. Powers W. 2000. Manure characteristics. Manure Management
Systems Series. MWPS, 18, Section 1.
Moore J.C. Walter D.E. Hunt H.W. 1988. Arthropod regulation of microand mesobiota in below-ground detrital food webs. Annual Review Entomology 33: 419–439.
Niedbała W. 1980. Mechowce – roztocze ekosystemów lądowych. PWN.
Warszawa.
Norton R.A. 1986. Aspects of the biology and systematics of soil arachnids
particulary saprophagous and mycophagous mites. Quaestiones Entomologicae 21: 523–541.
Odum E.P. 1982. Podstawy ekologii. PWN, Warszawa.
Rajski A. 1959 Mechowce (Acari: Oribatei) jako żywiciele pośredni tasiemców (Cestodes: Anoplocephalata) w świetle literatury. Zeszyty Naukowe UAM 2: 163–192.
Schuster von R. 1988. Untersuchungen zur Epizootiologie der Monieziose des Schafes in der DDR, unter besonderer Berücksichtigung Zwischenwirte. Monatshefte fur Veterinarmedizin, 43: 233-235.
Seniczak S. Chachaj B. Wasińska B. Graczyk R. 2005. Wpływ nawożenia łąki
wodą amoniakalną na dynamikę sezonową roztoczy glebowych (Acari).
Zeszyty Naukowe Akademii Techniczno-Rolniczej w Bydgoszczy, Zootechnika 35: 27–35.
Stamou G.P. Sgardelis S.P. 1989. Seasonal distribution patterns of oribatid
mites (Acari: Cryptostigmata) in a forest ecosystem. Journal of Animal
Ecology 58: 839-904.
Stanisz A. 2006a. Przystępny kurs statystyki z zastosowaniem Statistica PL
na przykładach z medycyny 1. Statystyki podstawowe. StatSoft Polska,
Kraków.
Stanisz A. 2006b. Przystępny kurs statystyki z zastosowaniem Statistica PL
na przykładach z medycyny 2. Modele liniowe i nieliniowe. StatSoft
Polska, Kraków.
Trojanowski H. Baluk A. 1992. Wpływ nawożenia azotowego na drobne
bezkręgowce glebowe – roztocze i skoczogonki. Roczniki Nauk Rolniczych Seria E, T.22, Z. 1/2.
289
Hanna Szczukowska, Radomir Graczyk, Anna Seniczak
Tyszka Z.J. 1994. Kozy. Poradnik Chowu. PWRiL. Warszawa.
Warren K.S. 1962. Ammonia toxicity and pH. Nature, London, 195: 47-49.
Weigmann G. 2006. Die Tierwelt Deutschlands, Hornmilben (Oribatida).
Verlag Goecke & Evers. Keltern – Deutschland.
Wesołowski P. 2008. Nawożenie łąk nawozami naturalnymi. Wydawnictwo
IMUZ. Falenty – Szczecin.
Adres do korespondencji:
mgr inż. Hanna Szczukowska
Zakład Ekologii, Uniwersytet Technologiczno-Przyrodniczy
im. J. i J. Śniadeckich w Bydgoszczy
e-mail: [email protected]
dr inż. Radomir Graczyk
Zakład Ekologii, Uniwersytet Technologiczno-Przyrodniczy
im. J. i J. Śniadeckich w Bydgoszczy
e-mail: [email protected]
dr hab. inż. Anna Seniczak, prof. nadzw. UTP
Zakład Ekologii, Uniwersytet Technologiczno-Przyrodniczy
im. J. i J. Śniadeckich w Bydgoszczy
e-Mail: [email protected]
290
Agnieszka Szumiec, Anna Radko,
Anna Koseniuk, Tadeusz Rychlik
Opiekun naukowy: dr hab. Anna Radko
EPISTEME
22/2014, t. I
s. 291-299
ISSN 1895-2241
KONSERWATYZM GENETYCZNY WYBRANYCH
SEKWENCJI MIKROSATELITARNYCH U BOVIDAE
GENETIC CONSERVATISM BASED ON SELECTED
MICROSATELLITES SEQUENCES IN BOVIDAE
Abstrakt. Markery mikrosatelitarne są regionami DNA wykazującymi
krótkie powtarzalne motywy sekwencji nukleotydowych. Ze względu
na ich wysoki stopień polimorfizmu, losowe rozmieszczenie w genomie
i możliwość automatycznego określania genotypów, markery te okazały się
jednym z najpotężniejszych narzędzi w badaniach populacyjnych. Znalazły
szerokie zastosowanie w ocenie zróżnicowania genetycznego i szacowaniu genetycznej odległości między rasami i populacjami. Konserwatyzm
genetyczny Bovidae umożliwia zastosowanie markerów specyficznych dla
bydła i owiec u kóz. Celem pracy było określenie możliwości zastosowania
STR specyficznych dla bydła i owiec do badania polimorfizmu genetycznego u kóz. Przebadano 16 kóz różnych ras u których przetestowano 26 loci
mikrosatelitarnych – 12 specyficznych dla bydła oraz 14 specyficznych dla
owiec. Określono polimorfizm badanych markerów, spośród których zostanie utworzony panel STR o najwyższej zmienności, który będzie mógł być
stosowany do oceny struktury genetycznej i identyfikacji osobniczej kóz.
Słowa kluczowe: Bovidae, kozy, sekwencje mikrosatelitarne DNA, identyfikacja osobnicza
Summary. Microsatellite markers are regions of DNA with short repetitive motifs of nucleotide sequences. These markers proved to be one of the
most powerful tools in the study population due to their high degree of
polymorphism, a random distribution in the genome and ability to determine the genotypes automatically. They are also widely used in the evaluation
of genetic diversity and estimation of genetic distance between breeds and
populations. Genetic conservatism in Bovidae allows to use for goats the
specific markers for cattle and sheep. Research aim was to apply STR specific
for cattle and sheep and searched of genetic polymorphism in goats. The
study involved 16 goats representive various breeds. The 26 microsatellite
291
Agnieszka Szumiec, Anna Radko, Anna Koseniuk, Tadeusz Rychlik
loci were used in this study - 12 specific for cattle and 14 specific for sheep.
The polymorphism of investigated markers was determined. It will be created STR panel based on the highest variation of alleles, which can be used to
evaluate the genetic structure and individual identification of goats.
Key words: Bovidae, goats, microsatellite DNA sequences, identification of individuals
WSTĘP
Konserwatyzm genetyczny polega na występowaniu podobieństw
w genomie gatunków spokrewnionych ze sobą w procesie ewolucji.
Wiele badań wykazało wspólne pochodzenie bydła (Bos taurus),
owiec (Ovis aries) i kóz (Capra hircus), łącząc je w jedną rodzinę Bovidae. Badania, mające na celu ocenę polimorfizmu wybranych mikrosatelitów, opracowanie zestawów multiplexowych STR, stosowanych
w badaniach populacyjnych oraz identyfikacyjnych u Bovidae przeprowadzono w wielu krajach na całym świecie. Kemp i in. [1995]
przebadali 197 markerów, z czego 97 było polimorficznych dla bydła,
39 dla owiec oraz 32 dla kóz. Na podstawie badań określili 18 markerów, które wykazywały największy polimorfizm u wszystkich trzech
gatunków. Inne badania przeprowadzone przez Luikart’a i in. [1999]
przedstawiają analizę 22 mikrosatelitarnych loci występujących
u kóz, bydła i owiec oraz ich zastosowanie w kontroli rodowodów
i identyfikacji osobniczej kóz. Ocena różnorodności genetycznej
u 11 ras szwajcarskich kóz, przy użyciu 20 bydlęcych markerów
mikrosatelitarnych wykazała wysoki polimorfizm dla wszystkich
loci a obserwowana liczba alleli wynosiła od 2 (INRABERN148) do
19 (ILSTS030) [Saitbekova i in. 1999]. W 2004 roku Maudet i in.
przetestowali 60 markerów mikrosatelitarnych charakterystycznych
dla bydła, owiec i kóz, spośród których 30 wykazało polimorfizm
u wszystkich badanych gatunków (Capra spp., Ovis spp., Rupicapra
spp.)
W Polsce dominującą grupą kóz są obecnie kozy bezrasowe. Są to
zwierzęta bardzo odporne na niekorzystne warunki środowiskowe,
różnorodne pod względem wyglądu i cech użytkowości produkcyjnej.
W ostatnich latach XX wieku, po załamaniu się hodowli w roku 1996,
zwiększyła się liczba kóz i zwierząt zarodowych objętych kontrolą
użytkowości oraz ilość kóz w stadzie [Sikora 2005].
292
Konserwatyzm genetyczny wybranych sekwencji mikrosatelitarnych u bovidae
Podstawą w procesie oceny wartości hodowlanej jest prawidłowa
identyfikacja zwierząt – prawidłowe ustalenie pochodzenia, zarówno ze
strony ojca jak i matki. Zła identyfikacja zwierząt powoduje błędy oceny
wartości hodowlanej. Przy błędnych danych o pochodzeniu, danemu
zwierzęciu zostaną przypisane informacje nie dotyczące jego krewnych.
Może to wpłynąć na zawyżenie bądź zaniżenie oceny [Bagnicka
i Łukaszewicz 2005]. Celowym wydaje się więc przeprowadzenie badań
obejmujących analizę polimorfizmu DNA u kóz krajowych i stworzenie
panelu STR o najwyższej zmienności, który będzie mógł być stosowany
do oceny struktury genetycznej i identyfikacji osobniczej kóz.
MATERIAŁ I METODY
Materiałem doświadczalnym do identyfikacji polimorfizmu sekwencji mikrosatelitarnych DNA były próbki krwi obwodowej pobranej od
16 kóz bezrasowych.
Metody badań obejmowały określenie polimorfizmu 26 markerów mikrosatelitarnych DNA, 12 specyficznych dla bydła (BM1818,
BM1824, BM2113, ETH3, ETH10, ETH225, INRA23, SPS115,
TGLA53, TGLA122, TGLA126, TGLA227) oraz 14 specyficznych
dla owiec w 2 panelach: I panel owczy (CSRD247, HSC, INRA63,
MAF214, OarAE129, OarCP49, OarFCB11, OarFCB304) oraz II panel
owczy (D5S2, INRA005, MAF65, McM527, OarFCB320, SPS113)
Genomowe DNA izolowano z próbek krwi obwodowej przy pomocy zestawu Sherlock AX firmy A&A Biotechnology.
Na bazie wyizolowanego DNA przeprowadzono amplifikację metodą łańcuchowej reakcji polimerazy PCR-multiplex, przy użyciu fluorescencyjnie znakowanych sekwencji starterowych przygotowanych
przez firmę BIONOVO. Multipleksową reakcję PCR wykonano
w mieszaninie reakcyjnej Master Mix przygotowanej przez firmę QIAGEN. Proces termiczny przeprowadzono na amplifikatorze Veriti 96
Well Thermal Cycler firmy Applied Biosystems stosując następujące
temperatury:
• dla panelu bydlęcego i I-go owczego: wstępna denaturacja 95ºCx5’, 29 cykli (95ºCx30’’ - 61ºCx3’ - 72ºCx30’’), wydłużanie
końcowe 60ºCx45’
293
Agnieszka Szumiec, Anna Radko, Anna Koseniuk, Tadeusz Rychlik
• dla II-go panelu owczego: wstępna denaturacja 95ºCx10’, 31
cykli (94ºCx30’’ - 55ºCx30’’ - 72ºCx1’), wydłużanie końcowe 72ºCx15’
Otrzymane produkty PCR poddano elektroforezie, w denaturującym 7% żelu poliakryloamidowym w obecności standardu długości 500 ROX, w sekwenatorze Applied Biosystems 3100xl Genetic Analyzer. Wynik rozdziału elektroforetycznego, fragmenty DNA
o różnej długości, odczytano w programie GeneMapper® Software 4.0.
Częstość występowania alleli obliczono w programie Microsoft
Excel.
WYNIKI I DYSKUSJA
Spośród 26 badanych markerów mikrosatelitarnych, dla 8 markerów nie uzyskano produktów PCR (BM1818, BM1824, ETH3,
TGLA53, TGLA126, TGLA227, MAF214, OarFCB11). Dla markera
BM1818 analizy przeprowadzone przez Maudet i in. [2004] wykazały
u kóz (Capra agagrus) 2 allele o długości 254 i 258 pz, przy zastosowaniu temperatury amplifikacji 50°C, natomiast Serrano i in. [2009]
zidentyfikowali 11 alleli, jednak amplifikacja była problematyczna
i produkt PCR uzyskano tylko u 1371 z 6635 badanych osobników.
Dla locus TGLA53, Luikart i in. [1999] otrzymali od 3 do 5 alleli
(w zależności od badanej rasy) o zakresie długości od 137 do 153 pz,
przy temperaturze amplifikacji 55°C.
W przedstawianych badaniach, dla pozostałych 18 markerów
STR otrzymano produkty PCR (Tab. 1). Spośród markerów z panelu bydlęcego i I-go panelu owczego polimorficznych było po 6 loci,
dla bydła: BM2113, ETH10, ETH225, INRA23, SPS115 i TGLA122
oraz dla owiec: CSRD247, HSC, INRA63, OarAE129, OarCP49
i OarFCB304. Z II-go panelu owczego wszystkie markery (D5S2,
INRA005, MAF65, McM527, OarFCB320, SPS113) okazały się polimorficzne.
294
Konserwatyzm genetyczny wybranych sekwencji mikrosatelitarnych u bovidae
Tab 1. Wyniki testowania wybranych do badań markerów mikrosatelitarnych, specyficznych dla bydła i owiec, przeprowadzone u 16 kóz.
częstość Locus
0,5
67
0,5
0,06
0,22
198
0,69
137
0,06
200
0,25
147
0,06
149
0,09
271
0,06
151
0,03
207
0,22
273
0,13
155
0,31
209
0,66
277
0,06
157
0,38
211
0,13
279
0,06
159
0,03
150
0,66
281
0,06
165
0,09
152
0,34
283
0,06
169
0,03
196
0,03
285
0,03
127
0,03
198
0,25
287
0,41
129
0,06
200
0,03
289
0,06
135
0,09
202
0,09
297
0,03
137
0,31
210
0,09
299
0,03
212
0,44
113
0,53
214
0,06
115
248
0,13
250
0,59
252
0,28
OarAE129
145
63
0,03
OarFCB304
141
częstość
194
139
0,09
152
0,09
0,28
154
0,28
117
0,19
178
0,03
169
0,03
91
0,25
173
0,13
93
0,34
OarFCB320
0,09
Allele
(pz)
0,03
D5S2
131
częstość Locus
192
HSC
0,53
INRA005
129
Allele
(pz)
OarCP49
Allele
(pz)
INRA63
SPS115
INRA23
ETH225
ETH10
BM2113
Locus
295
139
141
145
217
229
231
233
0,38
0,38
0,03
0,06
0,09
0,41
0,06
241
0,38
0,66
177
0,19
121
127
131
133
135
154
156
164
166
0,5
0,06
0,13
0,25
0,06
0,66
0,06
0,13
0,16
OarFCB320
0,06
175
SPS113
135
INRA63
0,16
MAF65
133
McM527
CSRD247
TGLA122
Agnieszka Szumiec, Anna Radko, Anna Koseniuk, Tadeusz Rychlik
95
0,38
97
0,03
136
138
140
142
144
148
0,13
0,13
0,25
0,09
0,22
0,03
152
0,16
W analizowanym materiale pobranym od 16 kóz, wykryto 90 alleli
występujących ze zróżnicowaną częstością w poszczególnych loci (Tab 2).
Liczba alleli w locus wynosiła od 2 dla ETH225 i OarCP49 do 11 dla HSC.
Tab 2. Częstość występowania alleli u badanych kóz.
Locus
spec. dla gatunku
T amp
Polimorfizm
Zakres
wielkości
(pz)
Liczba alleli
BM1818
61°C
-
-
-
BM1824
61°C
-
-
-
BM2113
61°C
polimorficzny
129-149
5
ETH3
61°C
-
-
-
ETH10
61°C
polimorficzny
207-211
3
Bydło
296
ETH225
61°C
polimorficzny
150-152
2
INRA23
61°C
polimorficzny
196-214
7
SPS115
61°C
polimorficzny
248-252
3
TGLA53
61°C
-
-
-
TGLA122
61°C
polimorficzny
133-145
5
TGLA126
61°C
-
-
-
TGLA227
61°C
-
-
-
Konserwatyzm genetyczny wybranych sekwencji mikrosatelitarnych u bovidae
Locus
T amp
Polimorfizm
Zakres
wielkości (pz)
Liczba alleli
spec. dla
gatunku
T amp
Polimorfizm
Zakres
wielkości (pz)
Liczba alleli
61°C
polimorficzny
217-241
5
D5S2
55°C
polimorficzny
192-200
4
HSC
61°C
polimorficzny
271-299
11
INRA005
55°C
polimorficzny
113-117
3
Owce
CSRD247
INRA63
61°C
polimorficzny
169-177
4
MAF65
55°C
polimorficzny
121-135
5
MAF214
61°C
-
-
-
McM527
55°C
polimorficzny
154-166
4
OarFCB11
61°C
-
-
-
OarCP49
61°C
polimorficzny
63-67
2
OarAE129
61°C
polimorficzny
137-169
8
OarFCB304
61°C
polimorficzny
127-178
8
OarFCB320
55°C
polimorficzny
91-97
4
SPS113
55°C
polimorficzny
136-152
7
„T amp” temperatura amplifikacji;
„-” brak produktu PCR.
W locus ETH225 w badaniach własnych zaobserwowano jedynie
2 allele o długości 150 i 152 pz, podobnie jak Maudet i in.[2004],
którzy też otrzymali 2 allele o długości 148 i 150 pz, przy zastosowaniu niskiej temperatury amplifikacji 50°C. Natomiast Satibekova i in.
[1999] uzyskali 4 allele dla tego locus przy testowaniu temperatury
amplifikacji w zakresie od 58 do 65°C.
W locus ETH10 zidentyfikowano 3 allele o długości 207, 209
i 211 pz. Luikart i in. [1999] uzyskali od 3 do 5 alleli w zależności
od badanej rasy, o długości 204 – 280 pz natomiast Satibekova i in.
[1999] otrzymali dla tego locus 7 alleli przy zastosowaniu temperatury amplifikacji 65°C. W locus INRA005 również zaobserwowano
3 allele o długości 113, 115 i 117 pz. Maudet i in. [2004] uzyskali
2 allele o długości 139 i 141 pz, przy niskiej temperaturze amplifi297
Agnieszka Szumiec, Anna Radko, Anna Koseniuk, Tadeusz Rychlik
kacji 45°C. Natomiast badania Pépin i in. [1995] oraz Satibekova i in.
[1999] wykazały po 5 alleli przy temperaturze amplifikacji odpowiednio 55°C i 50-59°C.
W locus INRA63 zgenotypowano 4 allele o długości 169 – 177
pz, większą liczbę alleli uzyskali Luikart i in. [1999] od 5 do 6 alleli
w zależności od badanej rasy o długości 154 – 170 pz. Podobną ilość 6 alleli podali Pépin i in. [1995] przy temperaturze amplifikacji 55°C.
Największą liczbę alleli otrzymali Satibekova i in. [1999] wykazując
7 alleli dla tego locus przy temperaturze amplifikacji 58-65°C.
W prezentowanych badaniach w locus OarFCB20 wykazano również 4 allele o długości 91 – 97 pz. Maudet i in.[2004] otrzymali tylko
2 allele o długości 99 i 101 pz a Luikart i in. [1999] uzyskali 4 - 7 alleli
(w zależności od badanej rasy) o długości 96 - 112 pz.
W locus TGLA122 oraz MAF65 zgenotypowano 5 alleli odpowiednio o długości 133 – 155 pz oraz 121 – 135 pz. Dla TGLA122 Maudet
i in. [2004] uzyskali 3 allele o długości 135 – 139 pz, natomiast dla
MAF65 Luikart i in. [1999] uzyskali 8 - 11 alleli (w zależności od badanej rasy) o długości 116 – 146 pz.
Dużą liczbę alleli zaobserwowano w locus INRA23, gdzie zidentyfikowano 7 alleli o długości od 196 do 214 pz. Pépin i in.[1995]
otrzymali dla tego markera 6 alleli.
WNIOSKI
1. Markery, które uległy amplifikacji mogą być wykorzystane do oceny
struktury genetycznej i identyfikacji osobniczej kóz.
2.Dla loci OarCP49 i ETH225, dla których w badanej grupie kóz zidentyfikowano tylko 2 allele, należy przeprowadzić dalsze badania na
szerszej grupie osobników, szczególnie, że inne badania [Satibekova
i in. 1999] wskazują na możliwość wystąpienia większej ilości alleli.
3. Proponowany zestaw 16 markerów: ETH10, ETH225, INRA23,
SPS115, TGLA122, CSRD247, D5S2, HSC, INRA005, INRA63, MAF65,
McM527, OarAE129, OarFCB304, OarFCB20, SPS113 z powodzeniem
może mieć zastosowanie w badaniach polimorfizmu kóz.
4. Zastosowanie w Polsce polimorfizmu mikrosatelitarnego do kontroli
pochodzenia kóz, należałoby poprzedzić szerszymi badaniami na
różnych rasach kóz, mającymi na celu uzupełnienie i udoskonalenie
wskazanego zestawu wysokopolimorficznych loci, gwarantujących
wysokie prawdopodobieństwo wskazania błędów w rodowodach.
298
Konserwatyzm genetyczny wybranych sekwencji mikrosatelitarnych u bovidae
BIBLIOGRAFIA
1.
2.
3.
4.
5.
6.
7.
8.
Bagnicka E. i Łukaszewicz M. 2005. Możliwość wprowadzenia w Polsce
oceny wartości hodowlanej kóz mlecznych metodą BLUP. Wiadomości
Zootechniczne, R.XLIII, 4: 11-28.
Kemp S.J. Hishida O. Wambugu J. Rink A. Longeri M.L. Ma R.Z. Da
Y. Lewin H.A. Barendse W. Teale A.J. 1995. A panel of polymorphic
bovine, ovine and caprine microsatellite markers. Animal Genetics 26:
299-306.
Luikart G. Biju-Duval M.P. Ertugrul O. Zagdsuren Y. Maudet C. Taberlet P. 1999. Power of 22 microsatellite markers in fluorescent multiplexes for parentage testing in goats (Capra hircus). Animal Genetics 30:
431-438.
Maudet C. Beja-Pereira A. Zeyl E. Nagash H. Kence A. Ozüt D. Biju-duval S. Boolormaa S. Coltman D.W. Taberle P. Luikart G. 2004. A standard set of polymorphic microsatellites for threatened mountain ungulates (Caprini, Artiodactyla). Molecular Ecology Notes 4: 49–55
Pépin L. Amiguest Y. Lépingle A. Berthier J.-L. Bensaid A. Vaiman D.
1995. Sequence conservation of microsatellites between Bos taurus
(cattle), Capra hircus (goat) and related species. Examples of use in parentage testing and phylogeny analysis. Heredity 74: 53-61.
Saitbekova N. Gaillard C. Obexer-Ruff G. Dolf G. 1999. Genetic diversity in Swiss goat breeds on microsatellite analysis. Animal Genetics
30: 36-41.
Serrano M. Calvo J.H. Martínez M. Marcos-Carcavilla A. Cuevas J.
González C. Jurado J.J. Díez de Tejada P. 2009. Microsatellite based
genetic diversity and population structure ofthe endangered Spanish
Guadarrama goat breed. BMC Genetics 10: 61.
Sikora J. 2005. Aktualny stan hodowli kóz w Polsce. Wiadomości Zootechniczne, R.XLIII, 4: 3-10.
Ades do korespondencj:
mgr inż. Agnieszka Szumiec
dr hab. Anna Radko, dr Tadeusz Rychlik
Instytut Zootechniki Państwowy Instytut Badawczy
Dział Cytogenetyki i Genetyki Molekularnej Zwierząt
e-mail: [email protected]
299
Technologia żywności
Magda Filipczak-Fiutak
Monika Wszołek
Opiekun naukowy:
dr hab. inż. Monika Wszołek prof. UR
EPISTEME
22/2014, t. I
s. 301-309
ISSN 1895-2241
WPŁYW DODATKU β-GLUKANU NA MIKROFLORĘ
KEFIRÓW OTRZYMANYCH Z RÓŻNYCH
KULTUR STATRTOWYCH
THE EFFECT OF ADDITION ß-GLUCANS ON THE
COUNT OF MICROFLORA KEFIR’S MADE FROM DIFFERENT KINDS OF STARTER CULTURES
Abstrakt. Właściwości terapeutyczne i żywieniowe kefiru znane są od wielu lat. Na cechy kefiru wpływa nie tylko sposób przeprowadzenia fermentacji, ale również rodzaj zastosowanego surowca. Kefir jest mlekiem fermentowanym, tradycyjnie produkowanym
z użyciem ziaren kefirowych,
w którym zachodzi fermentacja mlekowa jak i alkoholowa. Przemysłowo
kefir produkowany jest z zastosowaniem szczepionek do bezpośredniego
zaszczepiania mleka przerobowego typu DVS, zawierających mikroflorę
ziaren kefirowych. Obydwa wspomniane aspekty wpływają na różnice we
właściwościach i składzie końcowego produktu. Celem pracy było porównanie mikroflory ośmiu rodzajów kefirów. Pasteryzowane mleko krowie i kozie zaszczepiono szczepionką DVS Biolacta-Danisco oraz zakwasem macierzystym z ziaren kefirowych. Próbki kefirów analizowano po 1, 7 i 14 dniach
chłodniczego przechowywania w temp. 4°C. W czasie badań zaobserwowano, że ani rodzaj mleka, ani dodatek β-glukanu nie wpłynął na liczebność
mikroorganizmów w kefirach, wpływ miał jedynie rodzaj kultury. Niezależnie od rodzaju użytego mleka, podczas przechowywania odnotowano
wzrost liczebności ziarniaków z rodzaju Leuconostoc.
Summary. Therapeutic and nutritional properties of kefir are known for
many years. The characteristics of kefir are affected not only by the way the
fermentation is being performed, but also by the type of milk used in the
process. Kefir is fermented milk traditionally made with kefir grains during
lactic acid and alcoholic fermentation. Industrially kefir is made with DVS
starter cultures that include microflora of kefir grains. Both aspects influence final results which differ in composition and properties. The aim of
this study was to compare microflora of eight kinds of kefirs. Pasteurized
301
Magda Filipczak-Fiutak, Monika Wszołek
cow’s and goat’s milk was inoculated of DVS inoculum Biolacta-Danisco and
mother culture from kefir grains. Kefir samples were analyzed after 1, 7 and
14 days cold storage at 4°C. During the study it was observed that neither
the type of milk or addition of ß-glucans does not influence on number of
microorganism in kefirs, only type of starter cultures does. Regardless of
the type of milk used in the study, it has been noticed increase in number of
caryopsis of type of Leuconostoc during storage process.
Wstęp
Korzystne działanie kefiru na organizm człowieka zostało udowodnione w wielu badaniach, jednakże brakuje jednoznacznego określenia mechanizmu działania tego produktu na organizm człowieka.
W skład produktów probiotycznych wchodzą duże ilości mało zróżnicowanych bakterii. Natomiast ze względu na właściwości i skład
mikroflory kefiru można wnioskować, że jest on znacznie bogatszym
kompleksem probiotycznym. W składzie różnych ziaren kefirowych
wielu badaczy stwierdziło obecność m.in.: Bifidobacterium sp, L.
acidophilus, L.rhamnossus, L.brevis, L. casei, [Wszołek i in. 2006]. Βetaglukany są naturalnymi polisacharydami występującymi w grzybach,
roślinach i niektórych bakteriach [Tzianabos 2000; Johansson i in.
2006; Tsoni i in. 2008; Novak i in. 2008]. Szczególnie interesujące
cechy fizykochemiczne, jak zdolność żelowania β-(1,3)-D-glukanów,
spowodowały wzrost zainteresowania ich wykorzystaniem w przemyśle spożywczym. Dodatkowo substancje te wykazują aktywność
biologiczną, docenioną w branży farmaceutycznej, medycznej oraz
kosmetycznej.
Celem pracy była ocena wpływu dodatku β-glukanu na mikroflorę kefirów wyprodukowanym z dwóch gatunków mleka wykorzystując dwa rodzaje kultury startowej.
Materiał i metody
Kefiry wyprodukowano metodą termostatową ze znormalizowanego
(1,5 % tłuszczu) pasteryzowanego (85˚C/20 min.) mleka krowiego
i koziego, wykorzystując zakwas uzyskany z ziaren kefirowych firmy
Biolacta-DANISCO (3 %) i kulturę kefirową typu DVS Biolacta-DANISCO (dodatek w ilości zalecanej przez producenta). Spasteryzowane
302
Wpływ dodatku β-glukanu na mikroflorę kefirów otrzymanych z różnych...
mleko podzielono na dwie części dodając do jednej β-glukan firmy
Futurum sp. z.o.o. (0,15 %). Każdą część również podzielono na dwie
części zaszczepiając jedną zakwasem z ziaren kefirowych a drugą
kulturą DVS. Fermentację prowadzono w temp. 20˚C do uzyskania
pH= 4,6. Kefiry schłodzono i przechowywano w temperaturze +4˚C
wykonując posiewy mikrobiologiczne następnego dnia po produkcji
oraz po 7 i 14 dniach przechowywania. Określenie jakości mikrobiologicznej i zmiany liczebności mikroflory kefirów w czasie przechowywania przeprowadzono określając liczbę paciorkowców mezofilnych i termofilnych, pałeczek mlekowych, drożdży oraz ziarniaków
z rodzaju Leuconostoc wyrażając otrzymane wyniki w log jtk/g. Uzyskane wyniki opracowano statystycznie wykorzystując program Statistica 9.0 wykonując wieloczynnikową analizę wariancji oraz szacując istotność różnic pomiędzy średnimi testem Duncana.
Wyniki i dyskusja
Mezofilne paciorkowce mlekowe należą do najliczniejszej grupy
drobnoustrojów występującej w kefirze wyprodukowanym zarówno
z mleka krowiego jak i koziego. Ich liczba była większa w mleku kozim zaszczepionym kulturą kefirową typu DVS i wynosiła 7,96±0,05
log jtk/g, w przypadku zastosowania zakwasu uzyskanego z ziaren
kefirowych, stwierdzono niższą wartość, mianowicie 7,39±0,11 log
jtk/g. Po 7 dniach przechowywania odnotowano zmniejszenie liczby kolonii w kefirach wyprodukowanych z użyciem kultury typu
DVS, natomiast w kefirach z udziałem zakwasu zaobserwowano
niewielki wzrost. Jednakże po 14 dniach chłodniczego przechowywania zauważono tendencję odwrotną w liczebności paciorkowców
mlekowych, przy zastosowaniu kultury typu DVS wzrosła, natomiast
przy zastosowaniu zakwasu zmniejszyła się (tab. 1). Badania przeprowadzone przez Wszołek [2006] wykazują, że na liczebność paciorkowców mezofilnych ma wpływ zarówno szczepionka (podczas
badania użyto szczepionek KC-1 i DL) jak i zakwas, we wszystkich
trzech przypadkach uzyskano większe wartości, mianowicie
9,08±0,06 log jtk/g, 7,86±0,14 log jtk/g oraz dla zakwasu 9,48±0,07
log jtk/g. Zaobserwowano również tendencję spadkową liczby pa303
Magda Filipczak-Fiutak, Monika Wszołek
ciorkowców mezofilnych, co wynika z ich mniejszej żywotności
w bardziej kwaśnym środowisku.
Paciorkowce termofilne S. thermophilus, jako niecharakterystyczne dla kultur kefirowych, występowały mniej licznie w badanych kefirach w stosunku do paciorkowców mezofilnych. Średnia ich liczba
w kefirach produkowanych z dodatkiem zakwasu macierzystego
wynosiła 5,42±0,43 log jtk/g, natomiast w kefirach z kulturą kefirową
typu DVS - 6,52±0,04 log jtk/g. Po 7 dniach przechowywania odnotowano zmniejszenie liczby kolonii w kozich kefirach produkowanych
zarówno z udziałem kultury DVS, jak i w przypadku zastosowania
zakwasu. Po 14 dniach odnotowano zmniejszenie liczby kolonii w kefirach produkowanych z zastosowania zakwasu, natomiast w przypadku produkcji z udziałem kultury DVS, zaobserwowano wzrost liczby kolonii (tab.1). Również w badaniach przeprowadzonych przez
Wszolek [2006], wykazano mniejszą liczebność paciorkowców termofilnych w kefirach z mleka koziego wyprodukowanych z udziałem
zakwasu (1,57±1,57 log jtk/g).
Podobnie jak w przypadku paciorkowców mezofilnych, pałeczki
mlekowe liczniej występowały w mleku zaszczepionym kulturą kefirową typu DVS, ich liczba wynosiła odpowiednio 7,36±0,42 dla
mleka krowiego i 6,84±0,35 log jtk/g w przypadku mleka koziego.
Następnie po 7 dniach przechowywania liczebność zwiększyła się we
wszystkich analizowanych kefirach, przy czym wyraźniejszy wzrost
charakteryzował produkty z mleka koziego. Jednakże po 14 dniach
nastąpiło zmniejszenie liczby kolonii (tab. 1).
304
Rodzaj Mikroflory [log
jtk/g]
7,62±0,22
7,68±0,12
6,32±0,13
6,07±0,12
5,94±0,27
7
14
1
Paciorkowce
mezofilne
7
14
6,33±0,08
6,14±0,12
6,40±0,13
7,83±0,21
7,46±0,28
8,19±0,21
bez dodatku
4,46±0,27
5,47±0,62
5,86±0,12
7,38±0,08
7,33±0,09
7,62±0,06
β-glukan
4,72±0,46
5,74±0,42
4,09±0,09
7,18±0,17
7,13±0,29
7,57±0,24
bez dodatku
ZAKWAS
6,04±0,12
5,58±0,24
6,42±0,13
7,78±0,36
7,55±0,28
8,10±0,16
β-glukan
Rodzaj kultury
6,28±0,03
5,94±0,13
6,52±0,04
7,48±0,40
7,03±0,24
7,96±0,05
bez dodatku
DVS
4,63±0,14
4,99±0,12
5,57±0,20
7,08±0,27
7,24±0,31
7,54±0,21
4,26±0,20
4,53±0,31
5,42±0,43
6,9±0,08
7,45±0,34
7,39±0,11
bez dodatku
ZAKWAS
β-glukan
KOZIE
Wpływ przechowywania
**
**
Wpływ β-glukanu
Nieistotne
Nieistotne
Wpływ rodzaju kultury
**
**
Wpływ rodzaju mleka
Nieistotne
Nieistotne
Paciorkowce
termofilne
Tab. 1. Wartości średnie i błąd standardowy średniej liczby mikroorganizmów w kefirach wyprodukowanych z mleka
krowiego i koziego, z dwoma rodzajami kultury startowej, z dodatkiem lub bez β-glukanu bezpośrednio po produkcji
i po 7 i 14 dniach chłodniczego przechowywania, * - Istotne różnice przy przedziale ufności p≤0,05 ** - Istotne różnice
przy przedziale ufności p≤0,01
7,89±0,20
Czas przechowywania [dni]
1
β-glukan
DVS
KROWIE
Rodzaj mleka
Wpływ dodatku β-glukanu na mikroflorę kefirów otrzymanych z różnych...
305
Magda Filipczak-Fiutak, Monika Wszołek
Zawartość drożdży w kefirze jest mniejsza niż bakterii kwasu mlekowego [Öner i in. 2010]. Drożdże najliczniej występowały
w kefirze wyprodukowanym z udziałem ziaren kefirowych i ich liczba
wynosiła 5,02±0,37 log jtk/g (krowie), 5,08±0,25 log jtk/g (kozie),
natomiast znacznie mniejsza wartość została odnotowana w kefirach ukwaszonych kulturą DVS (tab. 1). Po 7 dniach przechowywania
liczebność tych drobnoustrojów zwiększyła się, niezależnie od zastosowanego rodzaju kultury. Jednakże po 14 dniach nastąpiło zmniejszenie liczby kolonii (tab. 1). Uzyskane przez Wszołek [2006]
wyniki potwierdzają, że w świeżych kefirach wyprodukowanych przy
użyciu zakwasu, liczebność drożdży jest wyższa (3,60±0,66 log jtk/g),
niż w przypadku zastosowania kultury typu DVS. W tych badaniach,
jak również prowadzonych przez Guzel-Seydim [2005], wykazano
tendencję wzrostową liczebności drożdży podczas przechowywania. Inną tendencję zaobserwowali Kök-Taş i in. [2013], ponieważ
zauważyli oni zmniejszenie liczebności drożdży po 7 i 14 dniach
przechowywania. Wpływ na takie różnice mógł mieć rodzaj kultury
startowej stosowanej w poszczególnych doświadczeniach a także
rodzaj surowca użytego do produkcji.
Heterofermentatywne ziarniaki z rodzaju Leuconostoc występowały w znacznej ilości niezależnie od rodzaju kultury dodawanej
do mleka (tab.1). Wyższą ich liczebnością charakteryzowały się kefiry wyprodukowane z zastosowaniem kultury typu DVS i ich liczba
wynosiła 6,52±0,62 log jtk/g (mleko kozie), natomiast w kefirach
wykonanych z użyciem zakwasu wartość ta wynosiła 5,08±0,56 log
jtk/g. Ziarniaki te charakteryzowały się także tendencją do zwiększania liczby kolonii w czasie przechowywania. Wyniki uzyskane przez
Wszołek [2006] potwierdzają te spostrzeżenia.
Analizując dane z tab. 1 można wyciągnąć pewne wnioski
dotyczące wpływu rodzaju zastosowanej mikroflory oraz dodatku
β-glukanu na liczebność badanych kultur w kozich kefirach. Zastosowanie kultury typu DVS wraz z β-glukanem miało wpływ na
większą liczbę kolonii paciorkowców mezofilnych, leukonostoków
i drożdży, jednak w przypadku tych ostatnich, po 14 dniach
następował duży spadek liczebności. Niemniej jednak w pozostałych grupach drobnoustrojów, dodatek β-glukanu nie spowodował
306
Wpływ dodatku β-glukanu na mikroflorę kefirów otrzymanych z różnych...
statystycznych różnic w ich liczebność. Użycie zakwasu i β-glukanu
przy produkcji kefiru z mleka koziego, spowodowało zwiększenie
ilości jedynie paciorkowców termofilnych, pozostałe grupy mikroorganizmów były liczniejsze kefirach bez tego dodatku.
Dodatek β-glukanu w kefirach z mleka krowiego wpłynął także
na liczebność mikroflory. W przypadku użycia zakwasu z ziaren,
w kefirach z dodatkiem β-glukanu odnotowano zwiększenie się liczby
wszystkich grup mikroorganizmów, oprócz Str. thermophilus. Natomiast w przypadku użycia kultury typu DVS paciorkowce mezofilne
i termofilne oraz pałeczki mlekowe były liczniejsze w kefirach bez dodatku tego polisacharydu, natomiast obecność β-glukanu wpłynęła
pozytywnie na ilość ziarniaków z rodzaju Leuconostoc i drożdży.
Pomimo, że analiza wariancji nie wykazała wpływu dodatku β-glukanu na liczebność badanych kultur, wystąpiła jednak
statystyczna interakcja pomiędzy dodatkiem β-glukanu, rodzajem
kultury startowej i czasem przechowywania dla liczby paciorkowców
termofilnych co znalazło wyraz w większej ich liczbie w kefirach
z kulturą DVS, natomiast w kefirach na ziarnach paciorkowce lepiej
rosły w produktach bez tego dodatku. Podczas przechowywania w kefirach z DVS następowało stopniowe zmniejszenie ich liczebności a w
kefirach na ziarnach najpierw zmniejszenie a następnie zwiększenie
ich liczebności w ostatnim okresie przechowywania.
Zarówno w kefirach bezpośrednio po wyprodukowaniu, jak
i przechowywanych, nie stwierdzono wpływu rodzaju mleka na liczbę
poszczególnych rodzajów bakterii fermentacji mlekowej. Wynika
z tego, że mleko kozie jest dobrym podłożem do rozwoju kultur kefirowych, co potwierdzają wyniki badań Wszołek [2006].
Wnioski
Wysokoistotny wpływ (p≤0,01) na liczebność poszczególnych grup
drobnoustrojów miał rodzaj stosowanej kultury. W kefirach wyprodukowanych z użyciem ziaren kefirowych było więcej drożdży, natomiast w kefirach z kulturą DVS pozostałych mikroorganizmów.
Pomimo, że nie odnotowano statystycznie istotnych różnic
stwierdzono, że dodatek β – glukanu wpłynął na większą liczebność
drożdży w kefirach z mleka krowiego.
307
Magda Filipczak-Fiutak, Monika Wszołek
Zarówno w kefirach wyprodukowanych z mleka krowiego, jak
i koziego, zaobserwowano tendencję wzrostową liczebności ziarniaków z rodzaju Leuconostoc w trakcie przechowywania.
Bibliografia
Guzel-Seydim Z., Wyffels J. T., Seydim A. C., Greene A. K. 2005. Turkish
kefir and kefir grains: microbial enumeration and electron microscobic
observation. International Journal of Dairy Technology, 58, 25-29
Johansson L., Virkki L., Anttila H., Esselström H., Tuomainen P., SontagStrohm T. 2006. Hydrolysis of β-glucan. Food Chemistry, 97: 71-79.
Kök-Taş T., Seydim A. C., Özer B., Guzel-Seydim Z. B. 2013. Effects of different fermentation parameters on quality characteristics of kefir. Journal of Dairy Science, 96, 780-789
Novak M., Vetvicka V. 2008. β-Glucans, History, and the Present: Immunomodulatory Aspects and Mechanisms of Action. Journal of Immunotoxicology, 5: 47-57.
Öner Z., Karahan A. G., Çakmakçı M. L. 2010. Effects of different milk types
and starter cultures on kefir. GIDA, 35 (3), 177-182
Tsoni S. V., Brown G. D. 2008. β-Glucans and Dectin-1. Annals of the New
York Academy of Sciences, 1143: 45-60.
Tzianabos O. A. 2000. Polysaccharide Immunomodulators as Therapeutic
Agents: Structural Aspects and Biologic Function. Clinical Microbiology Reviews, 13(4): 523-533
Wszołek M. 2006. Mleczne napoje fermentowane z mleka koziego. Wydawnictwo Naukowe PTTŻ, Kraków
Wszołek M., Kupiec-Teahan B., Skov Guldager H., Tamime A.Y.: Production
of kefir, koumiss and other related products in Fermented Milks edited
by Tamime A. Blackwell Publishing, Oxford 2006, s. 174- 216.
Adres do korespondencji:
mgr inż. Magda Filipczak-Fiutak
dr hab. inż. Monika Wszołek, prof. UR
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Technologii Żywności
Katedra Przetwórstwa Produktów Zwierzęcych
e-mail: [email protected]
308
Grzegorz Fiutak, Ryszard Macura
Magda Filipczak - Fiutak, Joanna Brożyna
Opiekun naukowy: dr hab. inż. Ryszard Macura
EPISTEME
22/2014, t. I
s. 311-319
ISSN 1895-2241
PORÓWNANIE WARTOŚCI ODŻYWCZEJ DZIKO
ROSNĄCYCH ROŚLIN JADALNYCH
W ZALEŻNOŚCI OD OKRESU WEGETACJI
COMPARISON OF NUTRITION DECLARATION
OF EDIBLE WILD PLANTS GROWING
IN RELATION TO THE PERIOD OF GROWTH
Abstrakt. Dziko rosnące rośliny jadalne bogate są w cenne substancje
odżywcze. Dzięki temu mogą wpływać leczniczo na ludzki organizm
i przywracać jego prawidłowe funkcjonowanie. Materiałem badawczym były
nadziemne części młodych jadalnych dzikich roślin zebrane trzykrotnie
(8, 16 i 22 kwiecień 2009 r.): pokrzywy zwyczajnej (Urtica dioica L.) podagrycznika pospolitego (Aegopodium podagraria) oraz mniszka lekarskiego
(Taraxacum officinale). Zbadano zawartość: suchej masy, białka, witaminy
C, chlorofilu i karotenoidów. Analizując otrzymane wyniki stwierdzono, iż badane rośliny zawierają dużą ilość białka, witaminy C i karotenoidów. Pokrzywa była najlepszym źródłem białka (7 %) i karotenoidów
(31 mg/100g), natomiast najwięcej witaminy C zawierał podagrycznik
pospolity (183 mg/100g). Z upływem czasu zmniejszała się zawartość białka
i witaminy C w roślinach, a ilość karotenoidów nieznacznie wzrastała. Badania wykazały, że najbardziej wartościowe są rośliny ze zbioru pierwszego.
Słowa kluczowe: chlorofil, karotenoidy, witamina C, białko
Summary. Wild edible plants are rich in most valuable and healthiest nutritive compounds. Thanks to that they can influence the human organism
therapeutically and restore his correct functioning. Research material were
over-ground parts of the young edible wild plants (8th, 16th a 22th April
2009): nettle (Urtica dioica L.), ground elder (Aegopodium podagraria) and
dandelion (Taraxacum officinale). The contents of dry matter, protein, vitamin C, chlorophylls and carotenoids were analized. Analyzing the results, it
found that the tested plants contained a large amount of protein, vitamin
C and carotenoids. Nettle was the best source of protein ( 7%) and caroteno311
Grzegorz Fiutak, Macura Ryszard, Magda Filipczak-Fiutak...
ids (31 mg/100g), while the most of vitamin C contains a ground elder (183
mg/100g). With the passage of time the amount of protein and vitamin
C decreased, and the amount of carotenoids slightly increase. The results
revealed that the most valuable were young plants.
Key words: Chlorophyll, carotenoids, vitamin C, protein
Wstęp
Współcześnie przyzwyczailiśmy się, że większość produktów roślinnych pochodzi wyłącznie z upraw, zapominając o tym, że rośliny
dziko rosnące popularnie nazywane chwastami posiadają ogromną
siłę biologiczną.
Dziś coraz częściej powracamy do dobrych zwyczajów naszych
przodków i włączamy te polne „chwasty” do naszych jadłospisów.
Smacznie, zdrowo i ciekawie można urozmaicić nimi naszą dietę.
Z powodzeniem zastępują warzywa i służą jako aromatyczne
przyprawy. Najintensywniejszy smak i zapach mają rośliny zaraz
po zerwaniu. Wtedy też zawierają najwięcej witamin i substancji
odżywczych.
Celem pracy było oznaczenie zawartości wybranych wskaźników
wartości odżywczej w trzech dziko rosnących roślinach jadalnych
oraz porównanie ich w zależności od pory zbioru.
Materiał i metody
Materiał badawczy stanowiły trzy gatunki roślin: pokrzywa zwyczajna (Urtica dioica L.), podagrycznik pospolity (Aegopodium podagraria) oraz mniszek lekarski (Taraxacum officinale). Surowiec zebrano
w kwietniu 2009 roku trzy krotnie (8, 16 i 22 kwiecień). Miejscem
zbioru były tereny na obrzeżach Krakowa, nad rzeką Rudawą. Wybierano rośliny zdrowe i młode, w początkowym okresie wegetacji.
Zawartość suchej substancji oznaczono metodą suszenia surowców zielarskich susząc próbki w temp. 105°C do stałej masy.
Zawartość witaminy C oznaczono z wykorzystaniem 2,6-dichloroindofenolu [PN-90 A 75101/11], chlorofile oraz karotenoidy oznaczono metodą spektrofotometryczną. Ekstrakcję przeprowadzono acetonem w obecności tlenku magnezu, a następnie wykonano
pomiar absorbancji przy długościach fal: 662 nm (chlorofil a), 645
nm (chlorofil b) i 470 nm (karotenoidy i ksantofile) [Lichtenthaler
312
Porównanie wartości odżywczej dziko rosnących roślin jadalnych w zależności...
i Buschmann, 2001]. Białko oznaczono metodą Kjeldahla przy pomocy aparatu Büchi B-324. Analizy wykonano w trzech powtórzeniach. Statystyczną analizę danych przeprowadzono wykorzystując
program Statistica 9.0 wykonując dwuczynnikową analizę wariancji.
Istotność różnic oceniono testem Duncanana na poziomie istotności
p<0,05 oraz p<0,01 (tab. nr 2).
Wyniki i dyskusja
W zależności od terminu zbioru, rośliny wykazywały niewielkie różnice w zawartości suchej masy. Uzyskane wyniki zestawiono w tab. nr 1.
16.04.2009
17,53
±0,11
6,30
±0,53
17,38
±0,08
16,50
±0,07
16,18
±0,06
16,02
±0,01
11,74
±0,02
12,19
±0,11
12,95
±0,11
5,92
±0,01
5,93
±0,06
5,07
±0,21
4,23
±0,12
4,22
±0,15
3,60
±0,03
3,74
±0,21
22.04.2009
08.04.2009
16.04.2009
22.04.2009
08.04.2009
16.04.2009
22.04.2009
Suma karotenoidów
i ksantofili
[mg/100g]
6,94
±0,08
Chlorofil b
[mg/100g]
Zawartość białka [%]
18,25
±0,34
155,76 104,41 37,02
±2,64
±0,52 ±2,37
30,62
±0,37
97,5
±0,74
Chlorofil a
[mg/100g]
Sucha masa [%]
08.04.2009
Witamina C
[mg/100g]
Data zbioru
Mniszek lekarski
Podagrycznik
pospolity
Pokrzywa zwyczajna
Surowiec
Tab. 1. Zestawienie wyników analiz fizykochemicznych dla świeżego surowca
92,41
±0,26
30,58
±4,14
30,11
±2,5
89,14 117,16 33,93
±1,26
±2,39 ±1,84
182,83 93,10 27,22
±2,71
±2,29 ±0,23
103,41 87,03 27,86
±4,63
±1,16 ±0,05
103,93 83,82 26,37
0,97
±1,97 ±1,41
56,12 90,63 28,49
±8,37
±0,48 ±1,21
49,58 83,01 27,03
±1,49
±2,77 ±0,09
52,60 85,59 28,97
±1,09
±0,44 ±0,71
35,85
±1,31
25,82
±0,46
27,31
±0,71
27,49
±0,7
24,49
±0,6
22,07
±1,51
26,03
±0,94
313
Grzegorz Fiutak, Macura Ryszard, Magda Filipczak-Fiutak...
Tab. 2. Średnie najmniejszych kwadratów zawartości analizowanych
substancji w badanych roślinach
Podagrycznik
pospolity
Mniszek
lekarski
08.04.2009
16.04.2009
22.04.2009
Data
Pokrzywa
zwyczajna
Surowiec
Sucha masa [%]
17,72AB
16,23AC
12,31BC
15,51D
15,29D
15,46
Zawartość białka
[%]
6,2AB
5,11AC
3,87BC
5,72DE
5,01DF
4,65EF
Witamina C
[mg/100g]
113,9AB
129,88AC
52,64BC
131,25DE
83,76D
81,42E
Chlorofil a
[mg/100g]
104,52AB
87,72A
86,29B
95,85C
87,38D
95,31D
Chlorofil b
[mg/100g]
33,9AB
27,21A
28,07B
30,87C
28,56C
29,76
Suma karotenoidów
i ksantofili
[mg/100g]
32,33AB
26,93AC
24,24BC
26,89D
26,76E
29,85DE
a, b – wartości średnie oznaczone takimi samymi literami w wierszach
różnią się statystycznie istotnie na poziomie istotności p<0,05
A, B – wartości średnie oznaczone takimi samymi literami w wierszach
różnią się statystycznie wysoko istotnie na poziomie istotności p<0,01
W miarę wzrostu mniszka lekarskiego nieznacznie zwiększała
się ilość suchej masy (o niecałe 0,5 % w drugim zbiorze i o 1,2 %
w trzecim). Odwrotna zależność wystąpiła w przypadku pokrzywy
i podagrycznika. W obu roślinach zawartość suchej masy zmniejszała
się. Były to jednak bardzo małe różnice. Dla pokrzywy spadek
wynosił odpowiednio 0,7 % i 0,9 % dla drugiego i trzeciego zbioru
w porównaniu ze zbiorem pierwszym. W przypadku podagrycznika
spadek był jeszcze mniejszy (0,3 % w drugim i 0,5 % w trzecim zbiorze). Tak niewielkie zmiany ilości suchej masy roślin w zależności
od daty zbioru mogą wynikać z faktu, iż odstęp czasu pomiędzy kolejnymi badaniami był krótki i wynosił tylko 8 i 6 dni. Większe różnice w zawartości suchej masy w pokrzywie w różnych terminach zbi314
Porównanie wartości odżywczej dziko rosnących roślin jadalnych w zależności...
oru zaobserwowała Osińska i wsp. [2007]. Z badań autorki wynika,
że w pierwszej dekadzie lipca zawartość suchej masy wynosiła 27 %,
w drugiej dekadzie sierpnia była niższa o 3 %, a w trzeciej dekadzie
września była najwyższa i wynosiła 34 %. Zmiana nie jest liniowa,
najpierw nastąpił niewielki spadek ilości suchej masy, a następnie
wzrost jej zawartości. Podobną zależność zaobserwowali Zawiślak
i Dyduch [2005], badając zawartość suchej masy w liściu podagrycznika. W maju 2003 roku wynosiła ona ok. 14 %, w czerwcu i lipcu
spadała do ok. 12 % i znów nastąpił wzrost do 22 % we wrześniu. Natomiast według Janke [2004], wraz ze wzrostem mniszka następuje
zwiększenie ilości suchej substancji z 15,1 % (roślina jednoroczna) do
18,7 % (roślina dwuletnia). Na otrzymane różnice mogły mieć wpływ
warunki klimatyczne, zwłaszcza ilość opadów w poszczególnych
miesiącach oraz temperatura powietrza. Jak podaje Ching i Barber
[1979], niska temperatura gleby zwiększa lepkość roztworu glebowego oraz obniża tempo dyfuzji, co zmniejsza ilość składników pokarmowych docierających do korzeni i tym samym ogranicza ich pobieranie przez roślinę.
W pracy zbadano również zawartość białka w zależności od terminu zbioru roślin (tab. 1). Najwyższa była na początku kwietnia,
następnie malała w miarę upływu czasu i wzrostu roślin. Największy
spadek odnotowano w przypadku podagrycznika (o 0,85 % po 8 dniach i 1,7 % po 14 dniach).
W pokrzywie zawartość białka zmniejszyła się odpowiednio
o 0,64 % i 1 %, a w mniszku o 0,62 % i 0,48 %. Podczas trzyletnich badań Szewczuk i Mazur [2004] również zanotowali sukcesywny
spadek zawartości białka w pokrzywie. Ilość tego składnika w formie
wegetatywnej rośliny dwuletniej wynosiła 20,3 %, trzyletniej 20,0 %
a czteroletniej 12,8 %. Wyraźnie większe różnice w zawartości białka
stwierdzono w pokrzywach zebranych pomiędzy fazą pąkowania
i kwitnienia niż wegetatywną i pąkowania. W przypadku rośliny dwuletniej ilość białka w fazie pąkowania zmalała do 18,9 %, a w fazie
kwitnienia do 15,5 %. Do odmiennych wniosków doszli Kasperczyk
i Kacorzyk [1999] badając zawartość białka w mniszku. W miarę
wzrostu rośliny zwiększała się jego ilość z 10,9 % (pod koniec maja)
do 13,1 % (w sierpniu). Różnice pomiędzy wynikami badań własnych
i przeprowadzonymi przez innych autorów wskazują, iż zawartość
315
Grzegorz Fiutak, Macura Ryszard, Magda Filipczak-Fiutak...
białka w roślinach jest zmienna i zależy od wielu czynników m.in. od
zawartości azotu w glebie, ale także gatunku i części rośliny, jej wieku
oraz fazy rozwojowej.
Na zawartość witaminy C istotny wpływ ma stopień dojrzałości
rośliny. Każda z badanych roślin charakteryzowała się najwyższą
ilością witaminy w pierwszym terminie zbioru na początku kwietnia. W miarę wzrostu i dojrzewania roślin zawartość kwasu askorbinowego zmniejszała się, po czym osiągnęła wyrównany poziom.
Największy spadek odnotowano w przypadku podagrycznika. W stosunku do pierwszego zbioru wynosił on ok. 45 % zarówno dla drugiego jak i trzeciego zbioru. W przypadku pokrzywy spadek wynosił odpowiednio 38 % po 8 dniach i 43 % po 14 dniach. Natomiast
w mniszku zawartość witaminy C utrzymywała się niemal na stałym
poziomie, a różnice w jej ilości pomiędzy poszczególnymi terminami zbiorów były minimalne. W drugim zbiorze wynosiły ok. 12
%, a w trzecim nastąpił niewielki wzrost i straty w stosunku do zbioru pierwszego wynosiły zaledwie 6 %. Wyniki uzyskane w badaniach świadczą o tym, że młode rośliny we wczesnej fazie rozwoju
są najbogatszym źródłem witaminy C. Do innych wniosków doszli
Zawiślak i Dyduch [2005] analizując zawartość kwasu askorbinowego w podagryczniku. W trakcie wegetacji rośliny zawartość witaminy
C w blaszce liściowej wahała się od 22,8 mg/100g w czerwcu do 40,9
mg/100g we wrześniu. W tym wypadku ilość witaminy C zwiększała
się w miarę dojrzewania podagrycznika. Jednak autorzy nie badali
bardzo młodych roślin.
Analizując różnice w zawartości chlorofilu w zależności od terminu zbioru roślin zaobserwowano najbardziej widoczne zmiany
w przypadku pokrzywy. Najwięcej tego barwnika zawierała w trzecim zbiorze (o 7 % więcej niż w pierwszym zbiorze), natomiast najmniej w czasie drugiego zbioru w połowie kwietnia (14 % mniej niż
na początku miesiąca). W przypadku mniszka wystąpiła podobna
zależność, jednak różnice ilościowe nie były duże. W czasie drugiego zbioru nastąpił niewielki spadek zawartości chlorofilu o niecałe
8%, następnie ponowny wzrost ilości tego barwnika, który jednak
nie przekroczył ich początkowej zawartości. U podagrycznika zaobserwowano sukcesywny spadek ilości chlorofilu, najpierw o 4,5 %,
a następnie o 8,5 % w stosunku do pierwszego terminu zbioru. Jak
316
Porównanie wartości odżywczej dziko rosnących roślin jadalnych w zależności...
podają dane literaturowe, zawartość chlorofilu w roślinach jest cechą
genetyczną związaną z gatunkiem i odmianą. Ponadto występowanie barwnika w dużym stopniu zależy od warunków siedliskowych,
takich jak natężenie światła, temperatura powietrza, wilgotność
gleby oraz jej zasobność w składniki pokarmowe. Różnice w zawartości barwnika występują nawet w ciągu doby, w godzinach nocnych
stężenie chlorofilu jest większe [Falkowski i in. 2000]. Czynniki środowiskowe mogły mieć więc wpływ na różnice w zawartości barwników w poszczególnych terminach zbioru. Jak twierdzi Falkowski,
ilość chlorofilu może być również indykatorem dojrzewania roślin,
dlatego w stadium kwitnienia jego stężenie maleje do minimum.
Potwierdzają to badania Osińskiej i in. [2007]. Według autorów,
w pełni kwitnienia w sierpniu pokrzywa zawierała najmniejszą ilość
chlorofilu a, natomiast największą na początku kwitnienia w lipcu.
Oprócz terminu zbioru, także miejsce i płeć pokrzywy miały wpływ
na zawartość barwnika. Najwięcej chlorofilu a zawierały osobniki
męskie w lipcu – 357 mg/100g, a chlorofilu b osobniki żeńskie we
wrześniu – 143 mg/100g. Różnice pomiędzy wynikami Osińskiej
i własnymi wynikają najprawdopodobniej z odmiennych terminów
i miejsc zbioru oraz różnicy w fazie rozwojowej roślin.
Kolejnym analizowanym składnikiem była zawartość karotenoidów (tab. 1). Zmiany tych barwników są najbardziej widoczne
w przypadku pokrzywy, gdzie w trzecim zbiorze wzrósł w stosunku
do pierwszego o 15 %. Analogiczną zależność zaobserwowała
Jaworska [2005] w przypadku szpinaku. Zawartość barwników karotenoidowych w zbiorze wiosennym była niższa o 15 % niż podczas
zbioru jesiennego. Potwierdziły to także badania Guli-Guerrero i in.
[2003]. Według tych autorów różnica w zawartości karotenoidów
w pokrzywie młodej (51,4 mg/100g) i dojrzałej (74,8 mg/kg) wynosiła 31 %. W przypadku podagrycznika wzrost zawartości barwników
był niewielki i po 2 tygodniach wynosił 6 %. W mniszku natomiast
po 8 dniach nastąpił nieznaczny spadek w ilości karotenoidów (o 7,5
%) i po 2 tygodniach ponowny wzrost (o 6 % w stosunku do pierwszego zbioru). Zawartość barwników karotenoidowych w liściach zależy
od terminu zbioru, ale także od gatunku rośliny oraz od warunków,
w jakich się rozwijała. Według niektórych doniesień pora dnia również ma wpływ na ich zawartość. Najwyższe ilości odnotowano rano
317
Grzegorz Fiutak, Macura Ryszard, Magda Filipczak-Fiutak...
o wschodzie słońca, a najniższe w godzinach popołudniowych gdzie zawartość karotenu spada dwukrotnie [Falkowski i in. 2000].
Według Niewczas i in. [2005] dojrzewaniu roślin towarzyszy wzmożona biosynteza karotenoidów, wskutek czego następuje znaczny
wzrost ich zawartości. Zjawisko to, nazwane karotenogenezą, może
być kontynuowane także po zbiorze.
Wnioski
Wysoko istotny wpływ na zawartość substancji odżywczych miał
zarówno gatunek rośliny jak i termin zbioru.
1. Badane rośliny zawierają duże ilości substancji odżywczych,
szczególnie we wczesnej fazie rozwojowej.
2.Pokrzywa zwyczajna, podagrycznik pospolity i w nieco
mniejszym stopniu mniszek lekarski, są doskonałym źródłem białka
oraz witaminy C.
3. Wszystkie analizowane rośliny stanowią bogate źródło karotenoidów i chlorofili.
4. Rośliny we wczesnej fazie rozwoju są cenniejszym źródłem
analizowanych składników. Wyjątek stanowią karotenoidy, których
większą zawartością charakteryzowały się rośliny starsze.
Bibliografia
Ching P. C., Barber S. A., 1979. Evaluation of temperature effects on K uptake by corn. Agronomy J., 71: 1040-1044.
Falkowski M., Kukułka I., Kozłowski S., 2000. Właściwości chemiczne roślin
łąkowych. Wydawnictwo Akademii Rolniczej w Poznaniu. Wyd. 2
Guil-Guerrero J. L., Rebolloso-Fuentes M.M., Torija I., 2003. Fatty acids and
carotenoids from Stinging Nettle. Journal of food composition and
analysis, 16: 111-119
Janke R., 2004. Farming a Few Acres of Herbs: Dandelion. Kansas State
University.
Jaworska G., 2005. Wartość gospodarcza i zawartość składników
odżywczych w szpinaku nowozelandzkim oraz jego przydatność do
produkcji mrożonek i konserw sterylizowanych. Zeszyty Naukowe
Akademii Rolniczej w Krakowie. 301: 52
Kaspreczyk M., Kacorzyk P., 1999. Zawartość białka i makroelementów
w trzech ziołach łąkowych. Zeszyty Naukowe Akademii Rolniczej
w Krakowie. Rolnictwo, 36: 41-47
318
Porównanie wartości odżywczej dziko rosnących roślin jadalnych w zależności...
Niewczas J., Szweda D., Mitek M., 2005. Zawartość wybranych składników
prozdrowotnych w owocach dyni olbrzymiej. Żywność. Nauka. Technologia. Jakość 2 (43): 147 – 155
Osińska E., Rosłon W., Łyszkowska M., 2007. Ocena plonowania i jakości
ziela pięciu dziko rosnących populacji pokrzywy zwyczajnej. Herba Polonica, 3: 104-109
Szewczuk Cz., Mazur M., 2004. Wpływ zróżnicowanych dawek nawozów
azotowych na skład chemiczny pokrzywy zwyczajnej (Urtica dioica)
zbieranej w trzech fazach rozwojowych. Cz. I. Zawartość składników
organicznych. Acta Sci. Pol., Agricultura 3(1): 229-237
Zawiślak G., Dyduch J., 2005. Zawartość niektórych składników chemicznych w liściu podagrycznika pospolitego. Zeszyty Naukowe
Akademii Rolniczej we Wrocławiu. Rolnictwo, 86(515): 585-590.
Adres do korespondencji:
mgr inż. Grzegorz Fiutak
dr hab. inż. Ryszard Macura
mgr inż. Joanna Brożyna
Katedra Chłodnictwa i Koncentratów Spożywczych
Wydział Technologii Żywności
Uniwersytet Rolniczy w Krakowie
ul. Balicka 122, 30-149 Kraków
e-mail: [email protected]
mgr inż. Magda Filipczak-Fiutak
Katedra Przetwórstwa Produktów Zwierzęcych
Wydział Technologii Żywności
Uniwersytet Rolniczy w Krakowie
ul. Balicka 122, 30-149 Kraków
Opiekun naukowy: dr hab. inż. Ryszard Macura
319
Ewelina Gwóźdź, Piotr Gębczyński
Aleksandra Skrzypczak
Opiekun naukowy:
Dr hab. inż. Piotr Gębczyński, prof. UR
EPISTEME
22/2014, t. I
s. 321-331
ISSN 1895-2241
KSZTAŁTOWANIE SIĘ CECH SENSORYCZNYCH
PRZECIERÓW POMIDOROWYCH
W TRAKCIE PRZECHOWYWANIA
Development of the sensory
characteristics of tomato
puree during storage
Abstrakt. Celem pracy była analiza wpływu czasu przechowywania
na kształtowanie się cech sensorycznych przecierów pomidorowych
otrzymanych z dwóch odmian pomidorów: Polset F1 o owocach kulistych
i Crosby F1 o owocach podłużnych. Materiał badawczy stanowiły dwa
typy produktów: typ PI o charakterze klasycznego przecieru, oraz typ PII
z całych rozdrobnionych owoców pomidora, analizowanych bezpośrednio
po produkcji oraz po 8 miesiącach przechowywania. W pracy oceniono
smakowitość i barwę produktów metodą profilową oraz dokonano oceny
organoleptycznej metodą 5 punktową. W profilowej ocenie smakowitości
obydwu typu przecierów dominował smak i zapach pomidorowy, ponadto w
przecierze typu PI otrzymanym z odmiany Polset F1 silnie wyczuwalny był
smak warzywny. Deskryptorami dominującymi w ocenie barwy była barwa
czerwona i pomarańczowa. Wyższa średnia ocena punktowa barwy została
przypisana produktom typu PII, natomiast analizując wyniki ogólnej oceny
organoleptycznej lepszymi cechami sensorycznymi charakteryzowały się
produkty typu PI. W wyniku ośmiomiesięcznego przechowywania w warunkach chłodniczych jakość przecierów oceniana za pomocą cech sensorycznych uległa niewielkiemu obniżeniu we wszystkich produktach.
Słowa kluczowe: przecier pomidorowy, przechowywanie, smakowitość, barwa,
ocena organoleptyczna
Summary. The aim of the work was to analyze the effect of storage time on
the development of the sensory characteristics of tomato purees. Products
were obtained from two varieties of tomatoes: Polset F1 with round shape fruit and Crosby F1 with elongated fruits. Research material consisted
of two types of products: PI type classical puree and PII type from whole
crushed tomato fruit. Samples were evaluated immediately after production
321
Ewelina Gwóźdź, Piotr Gębczyński, Aleksandra Skrzypczak
and after eight-month storage. The tastiness and color was evaluated using
sensory profiling method, and the color, presence of delamination, consistency, flavor and taste were evaluated using a 5-point scale rating method.
In the profiling tastiness evaluation, tomato taste and aroma dominated in
both type of products and in the PI type of puree obtained from Polset F1
the taste described as vegetable taste was strongly palpable. The dominant
descriptors of products color were red and orange. Higher average grading
of color was assigned the PII type products. Better overall sensory characteristic with 5-point scale rating had the PI products. Following an eightmonth storage under refrigeration, quality of purees assessed by sensory
attributes has slightly decreased in all products.
Key words: tomato puree, storage, tastiness, color, sensory assessment.
Wstęp
Pomidory to źródło witamin, substancji odżywczych, a przede
wszystkim likopenu, cennego antyutleniacza, który nadaje im intensywny czerwony kolor. Dla konsumenta ważną cechą pomidora jest nie tylko jego wartość odżywcza, ale barwa i zapach. Barwa
związana jest z obecnością barwników karotenoidowych, między
innymi likopenu i β-karotenu. Natomiast aromat tworzy mieszanina ponad 400 różnych związków [Świetlikowska 2006]. Pomidory są
ważnym surowcem w przemyśle spożywczym, czego dowodem jest
wzrost spożycia nie tylko pomidorów świeżych, ale i ich przetworów.
Dużym zainteresowaniem konsumentów cieszą się takie produkty
jak pomidory suszone, keczupy, zupa pomidorowa oraz soki pomidorowe [Bogacz 2011, Stasiuk 2009]. Owoce pomidora, świeże
i przetworzone, a szczególnie zawarte w nich substancje aktywne
odgrywają istotną rolę profilaktyce chorób nowotworowych [Horbowicz i Saniewski 2000]. Istotne znaczenie ma tu likopen, związek
o właściwościach prozdrowotnych, który jest lepiej przyswajalny
z produktów przetworzonych niż z surowca świeżego [Nowak
i Żmudzińska-Żurek 2009]. Wpływa on na równowagę hormonalną,
odporność organizmu i ma wysoką aktywność przeciwutleniającą
[Bramley 2000].
Celem pracy była ocena wpływu czasu przechowywania na
kształtowanie się cech sensorycznych dwóch różnych typów przecierów pomidorowych otrzymanych z pomidorów odmiany Polset F1
i Crosby F1.
322
Kształtowanie się cech sensorycznych przecierów pomidorowych w trakcie...
Materiał i metodyki
Materiał badawczy stanowiły dwa typy przecierów pomidorowych,
do otrzymania których wykorzystano pomidory odmiany Polset F1
o owocach kulistych i Crosby F1 o owocach podłużnych. Pomidory
pochodziły z plantacji położonej w województwie świętokrzyskim.
Pomidory po umyciu i sortowaniu poddano rozdrobnieniu i rozparzeniu w temp. 70oC±2oC przez 30 minut i następnie przetarciu.
W ten sposób otrzymano produkt typu PI o charakterze klasycznego przecieru pomidorowego. Typ PII otrzymano w analogiczny
sposób pomijając etap przetarcia rozdrobnionych owoców pomidora.
Otrzymane przeciery rozlano do butelek o poj. 300 cm3 z zamknięciem typu twist-off i poddano pasteryzacji w temp. 95oC przez 12 minut, a następnie schłodzeniu i magazynowaniu w temp. 5oC±1oC bez
dostępu światła.
Przeciery bezpośrednio po wytworzeniu oraz po 8 miesięcznym
okresie składowania oceniono pod kątem zachodzących zmian cech
sensorycznych. Ocenę barwy i smakowitości wykonano w oparciu o metodę analizy sensorycznej zamieszczoną w normie PN-ISO
11035 [1998]. Przeprowadzono również ocenę sensoryczną metodą
5 punktową zgodnie z normą PN-ISO 6658 [1999]. W celu oceny
wpływu czasu magazynowania na cechy sensoryczne przecierów
pomidorowych przeprowadzono jednoczynnikową analizę wariancji
oraz test NIR. Za istotne przyjęto prawdopodobieństwo testowe na
poziomie p<0,05.
Wyniki
Analiza barwy czerwonej bezpośrednio po produkcji oraz po upływie
8 miesięcy przechowywania wykazała spadek wartości ocenianego parametru w produktach PII obydwu odmian w stosunku do
produktów PI. Wyższymi ocenami charakteryzowały się przeciery
otrzymane z odmiany Crosby F1. W produktach po przechowywaniu
zauważono barwę pomarańczową, żółtą i brunatną, a barwy szarej
nie zidentyfikowano (tab. 1).
323
Ewelina Gwóźdź, Piotr Gębczyński, Aleksandra Skrzypczak
Crosby F1
Polset F1
Odmiana i typ
przecieru
Tab. 1. Średnie oceny barwy przecieru pomidorowego oznaczone metodą
profilową (0M - przecier bezpośrednio po produkcji, 8M - przecier po 8
miesiącach przechowywania)
PI
PII
PI
PII
Pomarańczowa
Czerwona
Żółta
Brunatna
Szara
0M
8M
0M
8M
0M
8M
0M
8M
0M 8M
3,8±
3,2±
3,0±
3,2±
0,6±
0,8±
0,0±
0,6±
0,0±
0,0±
0,20ac
0,20c
0,63a
0,37a
0,24ab
0,20ab
0,0a
0,24b
0,0a
0,0a
4,6±
4,2±
2,4±
2,8±
1,2±
1,4±
0,0±
0,6±
0,0±
0,0±
0,24b
0,20ab
0,40a
0,20a
0,37ab
0,40b
0,0a
0,24b
0,0a
0,0a
4,2±
3,8±
2,6±
2,8±
0,4±
0,4±
0,0±
0,2±
0,0±
0,0±
a
0,40
a
0,37
a
0,24
a
0,24
a
0,0
a
0,0
0,0a
0,20
ab
0,20
ac
0,20
ab
4,6±
4,2±
2,4±
2,8±
1,0±
1,4±
0,0±
0,4±
0,0±
0,0±
0,20b
0,20ab
0,40a
0,20a
0,45ab
0,24b
0,0a
0,24ab
0,0a
0,0a
a, b, c – różne litery oznaczają statystycznie istotne różnice między średnimi
(p < 0,05)
W ramach oceny smakowitości produktów oceniono zapach (tab.
2) i smak (tab. 3). Nie zidentyfikowano w badanych przecierach zapachu przypalonego, a ponadto w produktach PI odmiany Polset F1
zapachu surowego, a w produkcie PII warzywnego po produkcji jak
i po przechowywaniu. W produktach PI otrzymanych z odmiany Crosby F1 nie stwierdzono zapachu warzywnego, surowego i obcego.
W przecierach obydwu typu odmian dominował zapach pomidorowy,
któremu przypisano oceny punktowe w przedziale 3,0-3,40 dla odmiany Polset F1 i 2,80-3,40 dla Crosby F1. Dokonując analizy oceny
smaku przecierów pomidorowych w produkcie typu I odmiany Polset
F1 nie stwierdzono smaku gorzkiego i obcego. W tym samym typie
produktu otrzymanym z odmiany Crosby F1 nie wychwycono smaku surowego oraz obcego. Dominujący smak w obu typach to smak
pomidorowy (2,80-4,20), swoisty (3,10-3,80) oraz słodki (2,0-2,80).
324
Kształtowanie się cech sensorycznych przecierów pomidorowych w trakcie...
Tab. 2. Średnie oceny zapachu przecieru pomidorowego oznaczone metodą
profilową (0M - przecier bezpośrednio po produkcji, 8M - przecier po 8
miesiącach przechowywania)
2,8±0,20a
0,4±0,24a
2,4±0,24d
0,6±0,24a
1,2±0,20b
0,0±0,0a
0,0±0,0a
1,4±0,24c
3,0±0,32a
2,2±0,37abc 0,4±0,24a
0,0±0,0c
0,0±0,0a
1,6±0,24c
3,0±0,32a
0,0±0,0a
4,2±0,20d
0,0±0,0a
0,0±0,0a
0,0±0,0a
3,4±0,51a
0,0±0,0a
4,8±0,20c
0,8±0,20bc
0,0±0,0a
0,0±0,0a
3,4±0,24a
0,0±0,0a
3,4±0,40a
0,4±0,24ab
0,0±0,0a
0,8±0,20b
3,4±0,24a
0,0±0,0a
3,4±0,40a
0,4±0,24ab
0,0±0,0a
0,8±0,37b
3,0±0,32a
3,6±0,24ab 0,4±0,24a
0,4±0,24ab
0,0±0,0a
0,0±0,0a
3,2±0,37a
0,0±0,0a
4,4±0,24bc
Obcy
0,0±0,0a
PII(8M)
Przypalony
Surowy
Swoisty
Warzywny
Pomidorowy
Rodzaj
Polset F1
Crosby F1
zapaPI(0M) PII(0M) PI(8M) PII(8M) PI(0M) PII(0M) PI(8M)
chu
a,b,c – różne litery oznaczają statystycznie istotne różnice miedzy średnimi
( p <0,05)
W sensorycznej ocenie organoleptycznej pod uwagę brano rozwarstwienie, barwę, konsystencję zapach i smak (tab. 4). Z porównania średnich ocen wynika, iż lepszymi cechami charakteryzowały się
produkty nieprzechowywane. Po 8 miesiącach przechowywania niezależnie od typu produktu i odmiany, z której zostały wyprodukowane
przeciery przypisano im niższe oceny i tak dla rozwarstwienia uzyskano wyniki niższe o 4-8% w stosunku do produktu nieprzechowywanego, dla barwy o 4-5%, konsystencji 1-3%, zapachu 4-10% oraz
smaku o 3-5%
325
Obcy
0,0±0,0a
0,0±0,0ab
0,2±0,20a
0,6±0,24bc
0,0±0,0a
0,0±0,0bc
0,6±0,24a
1,0±0,0c
Swoisty
3,8±0,37ab
326
3,8±0,37a
3,3±0,20ab
3,1±0,10a
4,6±0,24b
3,6±0,24ab
3,8±0,37a
3,4±0,24a
0,4±0,24a
1,4±0,24ab
1,4±0,24a
2,0±0,0a
2,0±0,0a
0,8±0,37a
1,2±0,20a
0,6±0,24ab
3,0±0,45ac
3,4±0,24ab
3,8±0,20abc
4,2±0,37b
PI(8M)
1,4±0,24c
0,4±0,24a
2,6±0,51a
0,6±0,24a
2,8±0,20c
PII(0M)
0,6±0,24ab
2,4±0,51b
2,6±0,51a
0,6±0,40b
3,4±0,24abc
PI(0M)
0,0±0,0a
2,4±0,51a
2,2±0,37a
0,6±0,40b
3,6±0,51abc
3,8±0,37ab
Rodzaj
smaku
Polset F1
0,2±0,20b
0,0±0,0a
1,0±0,55b
2,2±0,37a
2,0±0,55a
2,0±0,55b
Warzywny Pomidorowy
PII(8M)
0,2±0,20ab
0,4±0,24a
2,6±0,24a
2,8±0,37a
2,8±0,37a
Słodki
PI(8M)
1,4±0,24c
0,6±0,24a
2,4±0,51a
2,6±0,40a
Kwaśny
PII(0M)
0,4±0,24a
0,4±0,24a
0,4±0,24a
Surowy
PI(0M)
0,0±0,0ab
0,0±0,0a
Gorzki
Ewelina Gwóźdź, Piotr Gębczyński, Aleksandra Skrzypczak
Tab. 3. Średnie oceny smaku przecieru pomidorowego oznaczone metodą
profilową (0M - przecier bezpośrednio po produkcji, 8M- przecier po 8
miesiącach przechowywania)
Crosby F1
PII(8M)
a,b,c – różne litery oznaczają statystycznie istotne różnice miedzy średnimi
( p <0,05)
Kształtowanie się cech sensorycznych przecierów pomidorowych w trakcie...
Dyskusja
Przetwory pomidorowe cieszą się dużą popularnością pośród całej
gamy produktów przetwórstwa owocowo-warzywnego. Wytwórcy
wciąż urozmaicają ofertę produktów pomidorowych. Celem przetwarzania i utrwalania owoców i warzyw jest głównie przedłużenie ich trwałości oraz zahamowanie procesów biologicznych poprzez ograniczenie aktywności enzymów i wzrostu drobnoustrojów
[Kędzior 2004]. Dlatego potrzebne są badania nad wpływem
różnych warunków i czasów przechowywania na jakość produktów
spożywczych. Ocena cech sensorycznych jest oceną subiektywną i zależy od wielu czynników – czułości wzroku, oświetlenia, powierzchni
produktu [Sokół-Łętowska i Kucharska 2006]. Barwa odgrywa istotną rolę w ocenie konsumenckiej, ponieważ stanowi najważniejszy
wyróżnik oceny wizualnej, a także sugeruje jakich doznań zapachowych i smakowych może oczekiwać konsument [Czapski i WalkowiakTomczak 2008].
Rozwarstwienie
4,32±0,04a
4,72±0,10cd
4,38±0,09ab
4,50±0,11bc
4,32±0,06ab
4,62±0,06cd
4,40±0,04ab
4,30±0,07ab
4,12±0,05a
4,14±0,07a
4,04±0,04a
4,41±0,04ab
4,26±0,03a
Polset F1
4,22±0,05a
8M
4,42±0,10a
0M
4,26±0,12a
8M
4,60±0,03b
0M
4,50±0,04bc
8M
4,84±0,04cd
0M
4,68±0,06bc
8M
4,28±0,06bc
0M
Ocena
końcowa
4,54±0,05a
8M
Smak
4,52±0,04a
0M
Zapach
4,90±0,03d
8M
Konsystencja
PI
0M
Barwa
PII
Odmiana i
typ przecieru
Tab. 4. Wyniki oceny organoleptycznej (0M - przecier bezpośrednio po
produkcji, 8M - przecier po 8 miesiącach przechowywania)
327
4,80±0,05c
4,88±0,05c
4,82±0,04bc
4,98±0,02d
4,80±0,04cd
4,90±0,03d
4,78±0,02cd
4,32±0,04b
4,48±0,11ab
4,40±0,06a
4,58±0,10bc
4,16±0,05a
4,50±0,09bc
4,30±0,04ab
4.76±0,01de
5,00±0,0d
4,50±0,05ab
4,29±0,02a
4,42±0,04abc
4,26±0,05b
4,91±0,02e
4,58±0,04a
4,48±0,07a
4,51±0,03bc
PI
Crosby F1
PII
Ewelina Gwóźdź, Piotr Gębczyński, Aleksandra Skrzypczak
a,b,c,d,e – różne litery oznaczają statystycznie istotne różnice miedzy średnimi ( p <0,05)
Przedstawione wyniki stanowią ocenę wpływu zastosowanego
procesu technologicznego, czasu przechowywania oraz odmiany na
kształtowanie się cech sensorycznych dwóch typów przecierów pomidorowych. Po 8 miesięcznym okresie przechowywania doszło do
zmian, które objawiały się spadkiem bądź wzrostem intensywności
ocenianych deskryptorów barwy. W przypadku oceny barwy czerwonej doszło do istotnego spadku jej natężenia, które mieści się w przedziale 9-16% w stosunku do przecierów nieprzechowywanych.
W przypadku oceny pozostałych parametrów barwy zanotowano
wzrost intensywności poszczególnych barw i tak dla barwy pomarańczowej wynosił on 10-16% i był nieistotny, natomiast dla barwy
żółtej oraz brunatnej różnice po 8 miesięcznym przechowywaniu były
istotne i mieściły się w przedziale 16-60%. Dla przecieru PI otrzymanego z odmiany Crosby F1 zanotowano spadek natężenia barwy pomarańczowej o 7%, natomiast nie odnotowano zmian barwy żółtej
tego przecieru.
Analizując wyniki dotyczące smakowitości otrzymanych przecierów pomidorowych nie stwierdzono istotnych różnic zależnych
od typu produkt, odmiany z jakiej był wykonany przecier oraz czasu przechowywania dla zapachu pomidorowego. Istotne różnice
stwierdzono dla odczucia zapachu warzywnego, swoistego i surowego. W przypadku przecieru PI otrzymanego z owoców pomidora
Polset F1 zanotowano wzrost natężenia zapachu swoistego, a dla
surowego i obcego nie stwierdzono różnic. W produkcie PII odnotowano zmianę zapachu obcego i wynosiła ona 100%. Dla odmiany
Crosby F1 nie zanotowano zmian zapachu warzywnego, dla obu typu
328
Kształtowanie się cech sensorycznych przecierów pomidorowych w trakcie...
produktów. W przecierze PII Crosby F1 doszło do wzrostu natężenia zapachu o 9% i 100% odpowiednio dla zapachu swoistego i obcego. Natomiast zanotowano obniżenie natężenia zapachu surowego
o 13%. Dokonując oceny smakowitości analizowano również zmiany
smaku. W produktach PI i PII z obu odmian pomidorów stwierdzono
istotne różnice w zależności od typu produktu, czasu przechowywania i odmiany. W przypadku oceny smaku pomidorowego stwierdzono istotne różnice w zależności od typu produktu. Wyniki otrzymane
dla produktu PI są wyższe niż dla PII, odmiana nie miała istotnego wpływu na wyniki, a obserwowany pewien spadek na poziomie
od 6 do 18% nie był istotny. W przypadku oceny smaku słodkiego
nie zanotowano żadnych zmian po 8 miesięcznym przechowywaniu w obydwu typach przecieru, a dla smaku kwaśnego na poziomie
8 do 62% dla produktu PI i PII otrzymanego z odmiany Polset F1.
W przypadku smaku warzywnego doszło do obniżenia jego natężenia
o 34% w produkcie PII Crosby F1. Analizując wyniki po przechowywaniu nie zanotowano żadnych zmian dla produktów PI Polset F1
dla smaku surowego, gorzkiego, obcego i swoistego. Zanotowano
natomiast wzrost ocenianych parametrów smaku dla produktu PII
o 200-250% dla smaku obcego i gorzkiego, a spadek o 6-34% dla swoistego i surowego. Dla przecieru otrzymanego z odmiany Crosby F1
dla obydwu typów przecieru nie zanotowano żadnych zmian dla smaku kwaśnego i surowego, a dla PI dla gorzkiego i obcego. Doszło natomiast do wzrostu natężenia smaku obcego i gorzkiego odpowiednio
o 66-133% dla produktu PII. Stwierdzono zmiany dla obydwu typów
przecieru odmiany Crosby F1 w obrębie natężenia smaku swoistego
o 11-22% w kierunku spadku natężenia.
W ogólnej ocenie organoleptycznej dokonano analizy rozwarstwienia barwy, konsystencji, zapachu i smaku. Niezależnie od
typu produktu i odmiany wyniki po 8 miesiącach przechowywania
uległy obniżeniu, a spadek ten był istotny.
Wnioski
1. Produkty otrzymane z odmiany Crosby F1 w ogólnej ocenie organoleptycznej uzyskały wyższe wyniki niż produkty z odmiany Polset F1.
2. Produkty typu PI uzyskały w ogólnej ocenie organoleptycznej wyższe
wyniki niż produkty typu PII.
329
Ewelina Gwóźdź, Piotr Gębczyński, Aleksandra Skrzypczak
3. Stwierdzono istotny wpływ typu produktu na ocenę smaku, a dodatkowo odmiany i czasu składowania na zapach.
Bibliografia
Bogacz K. 2011. Pomidor – idealne źródło witamin i substancji odżywczych
i prozdrowotnych. Przemysł Fermentacyjny i Owocowo-Warzywny, 7,
34-35.
Bramley P.M. 2000. Is lycopene beneficial to human health? Phytochemistry, 54, 233-236.
Czapski J. Walkowiak-Tomczak D. 2008. Kinetyka zmiany barwy antocyjanów w czasie ogrzewania roztworów barwników z aronii,
czerwonych winogron i czarnego bzu. Acta Agrophysica, 12(3), 635636.
Horbowicz M. Saniewski M. 2000. Biosynteza, występowanie i właściwości
biologiczne likopenu. Postępy Nauk Rolniczych, 1, 29-45.
PN-ISO 6658:1998 Analiza sensoryczna. Metodologia. Wytyczne ogólne.
Polski Komitet Normalizacji, Warszawa.
PN-ISO 11035:1999. Analiza sensoryczna – Identyfikacja i wybór deskryptorów do ustalania profilu sensorycznego z użyciem metod wielowymiarowych. Polski Komitet Normalizacji, Warszawa.
Kędzior W. 2003. Badanie i ocena jakości produktów spożywczych. Wydawnictwo Akademii Ekonomicznej w Krakowie. Kraków.
Nowak K. i Żmudzińska-Żurek B. 2009. Pomidory – najlepsze źródło likopenu. Przemysł Spożywczy, 6, 26-28.
Sokół-Łętowska A. Kucharska A.Z. 2006. Zmiany barwy, zawartości polifenoli i właściwości przeciwrodnikowych. Przemysł Fermentacyjny i
Owocowo-Warzywny, 1, 24-26.
Stasiuk E. 2009. Zawartość potasu wybranych sokach pomidorowych.
Zeszyty Naukowe Akademii Morskiej w Gdyni, 64, 15-18.
Świetlikowska K. 2006. Surowce spożywcze pochodzenia roślinnego.
Wydawnictwo Państwowych Zakładów Wydawnictw Lekarskich.
Warszawa
330
Kształtowanie się cech sensorycznych przecierów pomidorowych w trakcie...
Adres do korespondencji:
mgr inż. Ewelina Gwoźdź, Katedra Technologii Owoców
Warzyw i Grzybów, Wydział Technologii Żywności
Uniwersytet Rolniczy im. H. Kołłątaja w Krakowie
e-mail: [email protected]
dr hab. inż. Piotr Gębczyński, prof. UR, Katedra Technologii Owoców
Warzyw i Grzybów, Wydział Technologii Żywności
Uniwersytet Rolniczy im. H. Kołłątaja w Krakowie
e-mail: [email protected],
mgr inż. Aleksandra Skrzypczak, Katedra Technologii Owoców
Warzyw i Grzybów, Wydział Technologii Żywności
Uniwersytet Rolniczy im. H. Kołłątaja w Krakowie
e-mail: [email protected]
331
Monika Kosowska,
Joanna Rychlicka-Rybska
Teresa Fortuna
Opiekun naukowy: prof. dr hab. Teresa Fortuna
EPISTEME
22/2014, t. I
s. 333-342
ISSN 1895-2241
Zastosowanie skrobi jako zamiennika
fosforanów w produkcji
polędwicy wędzonej, parzonej
Use of starch as a substitute of phosphates
in the production of smoked cooked loin
Abstrakt. Celem przeprowadzonych badań było sprawdzenie możliwości
zastąpienia fosforanów skrobiami modyfikowanymi fizycznie, w produkcji
polędwicy wędzonej, parzonej. Jako zamienniki fosforanów zastosowano
3 handlowe preparaty skrobi modyfikowanych fizycznie. W gotowych produktach przeprowadzono badania tekstury metodą profilowej analizy tekstury (TPA), pomiar barwy w systemie CIELab oraz analizę sensoryczną metodą profilowania smakowitości. Wyniki badań wskazują na możliwość zastosowania skrobi modyfikowanych, wymiennie z fosforanami w nastrzyku
polędwic, jednak uzyskane wydajności produktów finalnych są niższe.
Zanotowano istotne zróżnicowanie parametrów tekstury, składowych
barwy oraz wybranych wyróżników smakowo-zapachowych.
Słowa kluczowe: polędwica wędzona parzona, fosforany, skrobia, jakość
Summary. The aim of presented research was verification the possibility
to replace phosphates by physically modified starch in the production of
smoked cooked loin. As substitutes of phosphates 3 kinds of commercial,
physically modified starch were used. The texture and the colour of readymade products was measured using texture profile analysis method (TPA)
and CIELab system respectively. The sensory analysis has been performed
by means of the flavour profile method. The results of the research show the
possibility to use physically modified starch as a substitute of phosphates in
loin injections. However, the yield of the final products is lower. There has
been noticed a significant differences of texture parametres , colour components and selected descriptors in the examined products.
Key words: smoked cooked loin, phosphates, starch, quality
333
Monika Kosowska, Joanna Rychlicka-Rybska, Teresa Fortuna
Summary
The aim of presented research was verification the possibility to replace phosphates by physically modified starch in the production of
smoked cooked loin. As substitutes of phosphates 3 kinds of commercial, physically modified starch were used. The texture and the colour
of ready-made products was measured using texture profile analysis
method (TPA) and CIELab system respectively. The sensory analysis
has been performed by means of the flavour profile method.
The results of the research show the possibility to use physically
modified starch as a substitute of phosphates in loin injections. However, the yield of the final products is lower. There has been noticed
a significant differences of texture parametres , colour components
and selected descriptors in the examined products.
Wstęp
Prowadzone w ostatnich latach badania wskazują, że współcześni
konsumenci coraz częściej czytają etykiety dostępnych na rynku produktów i na tej podstawie dokonują świadomych wyborów spożywanej żywności. Szacuje się, że ponad 70 % konsumentów jest zainteresowana żywnością o „naturalnych” cechach, zwłaszcza pozbawioną
składników pochodzenia syntetycznego. Żywność wysoko przetworzona staje się mniej lubiana, lub traktowana nieufnie, ze względu na
dużą zawartość w niej substancji dodatkowych. Chcąc sprostać oczekiwaniom konsumentów, producenci żywności dokonują zmian
w składach swoich produktów, poprzez usunięcie, często dozwolonych substancji dodatkowych na rzecz składników naturalnych
lub nie posiadających oznaczenia E. Efektem tego procesu jest
powstawanie tzw. „clean label” czyli etykiet podkreślających bardziej
„naturalny” skład produktu [Olszak 2012].
Jakość polędwic wędzonych, parzonych uzależniona jest od szeregu czynników, m.in.: jakości surowca mięsnego, wielkości nastrzyku
solanką peklującą, przebiegu procesów masowania oraz obróbki
termicznej, jak również rodzaju i ilości zastosowanych substancji
dodatkowych, w tym głównie fosforanów [Prycz i in. 2012]. Fosforany od wielu lat stosowane są w przemyśle mięsnym ze względu
na wszechstronne właściwości: wiążą wodę, zapobiegają wyciekom
334
Zastosowanie skrobi jako zamiennika fosforanów w produkcji polędwicy...
soku mięśniowego, nadają kruchą konsystencję i dużą soczystość,
przyczyniają się do utrwalenia różowej barwy mięsa peklowanego
[Jankiewicz i Słowiński 2008]. Pojawiają się doniesienia naukowe
o niekorzystnym oddziaływaniu fosforu na zdrowie człowieka, w tym
szczególnie na gospodarkę mineralną [Prycz i in. 2012]. Jednak przetwory mięsne zawierające dodatek fosforanów w niewielkim stopniu przyczyniają się do nadmiernego spożycia fosforu [Jankiewicz
i Słowiński 2008].
Substancjami, które mogłyby częściowo zastąpić fosforany
w produkcji wędzonek są skrobie modyfikowane fizycznie, czyli substancje, które mogą być deklarowane na etykiecie jako skrobie, nie
będące źródłem fosforanów.
Celem badania była próba zastąpienia fosforanów preparatami
skrobi modyfikowanych fizycznie oraz określenie wpływu tej wymiany na jakość polędwic wędzonych, parzonych.
Materiał i metody
W doświadczeniu technologicznym wyprodukowano polędwice
wędzone parzone. Surowcem do produkcji był mięsień najdłuższy
grzbietu (m. longissimus dorsi). Materiał doświadczalny nastrzyknięto
solankami peklującymi, w ilości 20 % w stosunku do masy surowca,
o składach przedstawionych w tab. 1. Jako zamienniki fosforanów
zastosowano 3 handlowe preparaty skrobi modyfikowanych fizycznie, oznaczone jako ST (skrobia tapiokowa), SZ1 (skrobia ziemniaczana 1) oraz SZ2 (skrobia ziemniaczana 2).
Nastrzyknięte polędwice masowano w 3 godzinnym cyklu 20
min. pracy/10 min. przerwy. Po masowaniu badane próby poddano
obróbce termicznej (suszenie w temperaturze 65°C przez 90 minut,
wędzenie w temperaturze 60°C przez 20 minut oraz parzenie w temperaturze 78°C do osiągnięcia temperatury 70°C w geometrycznym
centrum batonu). Po obróbce termicznej polędwice studzono przez
nadmuch powietrza, a następnie umieszczono w chłodni do osiągnięcia temperatury ok. 10°C w centrum geometrycznym.
335
Monika Kosowska, Joanna Rychlicka-Rybska, Teresa Fortuna
Tab. 1. Składy solanek nastrzykowych
Produkt
Skład solanki:
PF
0,12 % askorbinian sodu, 1,26 % cukry, 1,02 % trójfosforan pentasodowy (STPP), 9 % peklosól, 88,6 % woda
PST
0,12 % askorbinian sodu, 1,08 % cukry, 1,8 % ST, 9 % peklosól,
88 % woda
PSZ1
0,12 % askorbinian sodu, 1,08 % cukry, 1,8 % SZ1, 9 % peklosól,
88 % woda
PSZ2
0,12 % askorbinian sodu, 1,08 % cukry, 1,8 % SZ2, 9 % peklosól,
88 % woda
Otrzymane produkty oznaczono następująco: polędwica z fosforanami – PF,
polędwica ze skrobią tapiokową – PST, polędwica ze skrobią ziemniaczaną
1 – PSZ1 oraz polędwica ze skrobią ziemniaczaną 2 – PSZ2.
W otrzymanych próbkach badano teksturę, barwę oraz profil
smakowo-zapachowy. Badania tekstury przeprowadzono metodą
profilowej analizy tekstury (TPA). Z produktów wycinano wzdłuż
włókien mięśniowych próbki w postaci walców o wysokości 15 mm
i średnicy 14 mm. Analizę profilową tekstury (TPA) przeprowadzono przy użyciu teksturometru TA-XT2 Plus firmy Stable Micro
Systems (Godalming, Wielka Brytania), z przystawką w postaci walca o średnicy 50 mm. Wykonano test 2-krotnego ściskania próbek
do 50 % ich wysokości. Prędkość przesuwu walca wynosiła 2 mm/s.
Określano następujące parametry tekstury: twardość, sprężystość,
kohezję oraz żujność. Pomiary barwy wykonano metodą odbiciową
przy użyciu chromometru Minolta CR-3500d (Tokio, Japonia). Jako
źródło światła wykorzystano standardowy iluminat D65, z typem
obserwatora 10°. Wyniki wyrażono w jednostkach systemu CIELab,
gdzie L* - oznacza jasność barwy, natomiast a*i b* - oznaczają kolor
(a* - odniesienie do czerwieni, b* - wysycenie w kierunku żółtym).
Ocenę sensoryczną przeprowadzono w Laboratorium Analiz Sensorycznych spełniającym wymagania normy PN-ISO 8589:1998,
metodą profilowania smakowitości, zgodnie z wytycznymi normy
PN-ISO 6564:1999. Ocenę prowadził 9-osobowy zespół wybranych
oceniających, posiadający odpowiednie przygotowanie metodyczne
i doświadczenie w badaniach produktów mięsnych. Z analizy senso336
Zastosowanie skrobi jako zamiennika fosforanów w produkcji polędwicy...
rycznej została wykluczona polędwica PSZ1, ze względu na nieakceptowalny zapach zwierzęcy, dyskwalifikujący produkt. W wyniku
analiz wybrano 7 wyróżników smakowo-zapachowych, a następnie
oceniano ich intensywność na skali graficznej od 0 do 5 punktów,
z osobnymi dla każdego z wyróżników określeniami brzegowymi.
Dodatkowo oceniono smakowitość ogólną każdego z produktów.
Analizę statystyczną wyników badań przeprowadzono w programie Statistica 10.0 za pomocą jednoczynnikowej analizy wariancji, a istotność różnic weryfikowano testem Tukey’a przy poziomie
istotności α=0,05.
Wyniki i dyskusja
W otrzymanych produktach największą wydajnością końcową charakteryzowała się polędwica PF uzyskana z udziałem STPP (tab.
2). Spośród polędwic z dodatkiem skrobi, najmniejsze straty i zarazem największą wydajność uzyskała polędwica PST, mimo to jej
wydajność końcowa była niższa o 4,5 % w porównaniu z polędwicą
zawierającą STPP. Polędwice PSZ1 i PSZ2 uzyskały porównywalne miedzy sobą wydajności, ale niższe o ok. 9 % w porównaniu
z polędwicą PF. Otrzymane wyniki wydajności końcowych badanych produktów pozwalają stwierdzić, że możliwa jest zamiana
STPP preparatami skrobi modyfikowanymi fizycznie w recepturach
polędwic wędzonych parzonych. Należy liczyć się jednak z obniżeniem wydajności końcowej produktu finalnego. Uzyskane wyniki świadczą, iż najlepsza do tego typu zastosowań jest skrobia tapiokowa ST.
Tab. 2. Straty po masowaniu i obróbce termicznej
oraz wydajności końcowe polędwic.
Produkt
Strata po
masowaniu
[%]
Strata termiczna
[%]
Wydajność
końcowa
[%]
PF
0,73a
9,62a
109,12b
PST
1,01a
11,85a
104,62a,b
PSZ1
1,54b
14,87a
100,64a
PSZ2
1,69b
15,03a
100,29a
337
Monika Kosowska, Joanna Rychlicka-Rybska, Teresa Fortuna
a, b – różne litery w tej samej kolumnie oznaczają statystycznie istotne
różnice pomiędzy wartościami średnimi przy p≤0,05 (istotność różnic
weryfikowano testem Tukey’a)
Zmodyfikowanie składu solanki nastrzykowej w technologii
produkcji polędwic wędzonych, parzonych spowodowało znaczne
zróżnicowanie parametrów ich tekstury (tab. 3). Najmniejszą twardością charakteryzowała się polędwica zawierające dodatek STPP, za
co prawdopodobnie odpowiadają jony fosforowe, powodujące wzrost
pęczliwości białek oraz rozluźnienie struktury białek mięśniowych
[Olkiewicz i Ostrowska 2001]. Niemniej wartości twardości uzyskane w przypadku polędwic PST i PSZ2 nie różniły się istotnie od
twardości polędwicy PF. Istotna różnica w twardości wystąpiła tylko
w przypadku polędwicy PSZ1, która okazała się twardsza. W przypadku sprężystości największą wartością charakteryzowała
Tab. 3. Wyniki TPA dla badanych polędwic
Badany parametr
PF
PST
PSZ1
PSZ2
Twardość [kg]
5,00±0,18a
5,28±0,20a,b
6,62±0,53b
5,44±0,21a,b
Sprężystość
[-]
0,65±0,01b
0,49±0,01a
0,42±0,04a
0,50±0,01a
Kohezja [-]
0,41±0,01a
0,45±0,01b
0,50±0,02c
0,50±0,01c
Żujność [kg]
1,31±0,05b
1,15±0,05a
1,38±0,14b
1,35±0,05b
a, b, c – różne litery w tym samym wierszu oznaczają statystycznie istotne różnice pomiędzy wartościami średnimi przy p≤0,05 (istotność różnic
weryfikowano testem Tukey’a)
się polędwica zawierająca dodatek STPP, natomiast wszystkie
polędwice z dodatkiem skrobi uzyskały wartości istotnie niższe.
Analizując kohezję badanych próbek, grupę jednorodną stanowiły
produkty PSZ1 i PSZ2, natomiast polędwice PF i PST istotnie się
od nich różniły. Najmniejszą kohezję stwierdzono w przypadku
polędwicy PF i najbardziej zbliżoną do niej wartość miała polędwica
PST. W przypadku żujności jedynie polędwica PST charakteryzowała
się istotnie niższą wartością tego parametru, pozostałe wyniki były
338
Zastosowanie skrobi jako zamiennika fosforanów w produkcji polędwicy...
porównywalne. Otrzymane wyniki pomiaru tekstury badanych
polędwic świadczą o możliwości wykorzystania przede wszystkim
skrobi tapiokowej jako substytutu STPP, w celu uzyskania zbliżonych
parametrów tekstury do polędwicy PF.
Dodatek skrobi modyfikowanych fizycznie spowodował istotne
rozjaśnienie barwy w przypadku wszystkich polędwic. W porównaniu do polędwicy PF wartość parametru L* najbardziej zbliżona była
w przypadku polędwicy PSZ1, ale równocześnie polędwica ta charakteryzowała się największą wartością nasycenia barwą żółtą (b*),
istotnie odbiegając tym samym od polędwicy PF. Polędwice PST
i PSZ2 charakteryzowały się mniejszym nasyceniem barwy czerwonej (a*) w porównaniu do polędwic PF i PSZ1.
Tab. 4. Wyniki pomiaru barwy polędwic wędzonych, parzonych
Badany parametr
L*
a*
b*
PF
PST
PSZ1
PSZ2
67,93±0,55a
75,59±0,26c
71,51±0,38b
77,50±0,27d
7,49±0,21a
5,90±0,13b
7,11±,15a
5,58±0,09b
8,30±0,19a
8,78±0,13a
9,22±0,14b
8,28±0,12a,b
a, b,c,d – różne litery w tym samym wierszu oznaczają statystycznie istotne różnice pomiędzy wartościami średnimi przy p≤0,05 (istotność różnic
weryfikowano testem Tukey’a)
Wyniki przeprowadzonego pomiaru barwy polędwic potwierdzają
wpływ fosforanów na proces utrwalenia barwy mięsa świeżego
i peklowanego. Przy wymianie fosforanów na preparaty skrobi, należy liczyć się z istotnymi zmianami w wybarwieniu polędwic, szczególnie z rozjaśnieniem i mniejszą stabilnością barwy czerwonej.
339
Monika Kosowska, Joanna Rychlicka-Rybska, Teresa Fortuna
Rys. 1. Wykres profilowania smakowitości polędwic wędzonych parzonych
Po wykluczeniu z oceny sensorycznej polędwicy PSZ1 ze względu
na nieakceptowalny zapach, przedstawione graficznie (rys. 1) wyniki
analizy sensorycznej pozostałych polędwic pozwalają stwierdzić,
iż zastąpienie fosforanów skrobiami nie różnicuje znacząco profilu smakowo-zapachowego produktów. Różnicę stwierdzono tylko
w przypadku produktu PST. Polędwica ta charakteryzowała się istotnie wyższą wartością natężenia smaku wędzonego w porównania do
pozostałych produktów. Smakowitość ogólna wszystkich wyrobów
została oceniona wysoko i nie różnicowała produktów.
Wnioski
1. Zastosowane preparaty skrobi modyfikowanych fizycznie wpływają na
kształtowanie jakości polędwic wędzonych, parzonych.
2. Stwierdzono, istotne zróżnicowanie w wydajnościach produktów finalnych. Najbardziej zbliżone wydajności do polędwicy zawierającej
STPP uzyskano po zastosowaniu skrobi tapiokowej, natomiast skrobie
ziemniaczane uzyskały wartości niższe.
3. Preparaty skrobiowe ST, SZ1 i SZ2 istotnie różnicują cechy tekstury
polędwic wędzonych, parzonych. Najbardziej zbliżone wartości do próby
z dodatkiem fosforanów uzyskano w przypadku skrobi tapiokowej ST.
4. Zastosowane preparaty skrobiowe wpływają na barwę produktów finalnych. Stwierdzono istotne rozjaśnienie barwy polędwic i niższe
wartości barwy czerwonej.
340
Zastosowanie skrobi jako zamiennika fosforanów w produkcji polędwicy...
5. Wykazano, że dodatek skrobi nie wpływa na zróżnicowanie smakowitości ogólnej, stwierdzono nieznaczne różnice w intensywności smaku
wędzonego w profilu smakowo-zapachowym wytworzonych wędzonek.
Bibliografia
Fortuna T., Gałkowska D. 2006. Skrobie modyfikowane jako dodatki do
żywności. Laboratorium, 8-9, 38-41.
Walkowski A., Lewandowicz G. 2004. Skrobie modyfikowane właściwości
technologiczne i zakres stosowania. Przemysł Spożywczy, 5, 49–51.
Jankiewicz L., Słowiński M. 2008. Technologia produkcji wędlin. Wędzonki
parzone. Polskie Wydawnictwo Fachowe, Warszawa, 42-48.
Olkiewicz M., Ostrowska A. 2001. Effect of addition of microbial transglutaminase preparation on sensory and texture quality of model ham, produced from normal and PSE meat.W: Proceedings 47th international
congress of meat science and technology. Kraków, 26.08.-31.08.2001.
Sesja 6.3. Kraków: 26-27
Olszak J. 2012. Clean label – nowy kierunek w znakowaniu żywności. Przemysł Spożywczy, 66: 7-9.
Prycz J., Kowalski R., Danyluk B., Bilska A. 2012. Technologiczna przydatność preparatów transglutaminazy w produkcji szynki parzonej. Nauka
Przyroda Technologie, 6, 4, #81.
Adres do korespondencji:
mgr inż. Monika Kosowska - Uniwersytet Rolniczy w Krakowie
Wydział Technologii Żywności
Katedra Analizy i Oceny Jakości Żywności
Regis Sp. z o.o. ul. Łany 6, 32-700 Bochnia
e-mail: [email protected]
dr Joanna Rychlicka-Rybska - Regis Sp. z o.o.
ul. Łany 6, 32-700 Bochnia
e-mail: [email protected]
prof. dr hab. Teresa Fortuna - Uniwersytet Rolniczy w Krakowie
Wydział Technologii Żywności
Katedra Analizy i Oceny Jakości Żywności
e-mail: [email protected]
341
Kinga Kraska, Grzegorz Formicki
Edyta Kapusta, Magdalena Semla
Marta Batoryna, Martyna Błaszczyk
Opiekun naukowy:
dr hab. Grzegorz Formicki prof. UP
EPISTEME
22/2014, t. I
s. 343-351
ISSN 1895-2241
WPŁYW ALKOHOLU ETYLOWEGO NA
POZIOM GLUTATIONU ZREDUKOWANEGO
W WĄTROBIE I NERKACH U MYSZY
THE CONTENT OF REDUCED GLUTATHIONE
IN LIVER AND KIDNEYS AFTER ETHYL
ALCOHOL ADMINISTRATION
Abstrakt. Alkohol etylowy dostaje się do organizmu wraz ze spożywanymi
napojami. Łatwo i szybko przenika przez błony komórkowe do tkanek
i krwi. Miejscem największej absorpcji są żołądek i jelita. W organizmie utlenia się do aldehydu octowego, który zwiększa jego negatywny wpływ. Celem
przeprowadzonego eksperymentu było zbadanie poziomu glutationu zredukowanego w wątrobie, która odgrywa szczególną rolę w detoksykacji alkoholu i nerkach, gdzie w kanalikach proksymalnych zwiększoną aktywność
wykazuje b-liaza. Przeprowadzony eksperyment wykazał, iż alkohol etylowy
wpływa na obniżenie poziomu glutationu zredukowanego w wątrobie i nieznaczne podwyższenie w nerkach. Zmiany poziomu glutationu zredukowanego mogą być związane z tworzeniem reaktywnych form tlenu w wyniku
reakcji glutationu zredukowanego z ksenobiotykiem jakim jest alkohol.
Słowa kluczowe: alkohol etylowy, glutation zredukowany, myszy, nerki, wątroba
Summary. Ethyl alcohol easily and readily passes through cell membranes
to the blood and next to different tissues and organs. The highest absorption occurs in stomach and intestine. Ethyl alcohol is oxidized to acetaldehyde, which shows high toxicity, especially to neural tissue. The aim of
the experiment was to examine the level of reduced glutathione in the liver,
which plays a special role in the detoxification of alcohol and kidneys, where
the proximal tubules has an increased activity of b-lyase. The experiment
showed that application of ethyl alcohol leads to the decrease of reduced
glutathione concentration in the liver and slight increase of its concentration in the kidneys. Changes in the concentrations of reduced glutathione
after administration of ethyl alcohol lead to the suggestion that imbalance
in redox reactions is one of the mechanisms of toxic action of ethanol.
Key words: ethyl alcohol, reduced glutathione, mice, kidney, liver
343
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta, Magdalena Semla...
Introduction
Ethyl alcohol can be an effect of the glucose metabolism during alcohol fermentation conducted by microorganisms, such as fungi and
bacteria. Ethanol enters the body usually via ingestion of consumed
liquids. It is metabolized by the organism. One of the ways of alcohol
alteration occurs via alcohol oxidation to acetaldehyde by means of
alcohol dehydrogenase, using NAD and producing NADH. The ethyl
alcohol itself is not as harmful for our organism as its oxidation product, i.e. acetaldehyde. Negative consequences of alcohol consumption may be heightened by the fact that ethanol easily penetrates cell
membranes and further goes to tissues and blood, i.e. in the mouth.
The greatest absorption of alcohol takes place in our stomach and
intestines. There are four pathways of biochemical alcohol alterations. The first pathway of alcohol alteration consists in ethanol oxidation to acetaldehyde by means of alcohol dehydrogenase and subsequently to acetate by means of aldehyde dehydrogenase and takes
place in liver. The first stage of the alteration cycle is formation of
the complex of alcohol dehydrogenase/NAD+. The second pathway
of microsomal ethanol-oxidizing system (MEOS) proceeds in the
endoplasmic reticulum of liver cells and is crucial for the process of
catabolism of larger, more frequently consumed amounts of alcohol.
The microvilli pathway is active, when the system of both dehydrogenases of the first pathway, i.e. alcohol dehydrogenase and aldehyde dehydrogenase, is insufficient. In this pathway there is an active
system supporting cytochrome P-450, mostly isoenzyme II E1 [Bartosz 2003], which utilizes about 6 percent of the dose of alcohol consumed [Małkowska & Szutowski 2009]. The microvilli system takes
part in the metabolism of methyl alcohol, which is particularly toxic,
as well as other alcohols with their particles longer than ethanol and
methanol. Some kind of jeopardy connected with the existence of
this pathway constitutes the formation of free hydroxyl radicals. The
third metabolic pathway is a biochemical system including catalase
that occurs as a result of addition by means of hydrogen peroxide
H202. Catalase shows two properties – catalase and peroxide, depending on the availability of hydrogen peroxide. With higher concentration of H202 dominant is catalase activity that causes the hydrogen
peroxide to decompose into water and oxygen. With lower concentra344
Wpływ alkoholu etylowego na poziom glutationu zredukowanego w wątrobie...
tion dominant is however peroxide activity, with i.e. hydrogen, ethanol and methanol being the substrates [Ścibor & Czeczot 2006]. The
alcohol alteration is probably much more intensive in stomach than
in liver because of the lower availability of hydrogen peroxide. Interesting for people who like drinking greater amounts of alcohol may
be the fact that catalase can show good performance in elimination
of alcohol in the central nervous system, i.e. in red blood cells. According to the above suggestion people showing higher catalase activity
in blood cells can consume more alcohol than on average. The fourth
pathway consists in the non-oxidative reactions – coupling with glucuronic acid, sulfuric acid or free fatty acids through esterification.
Although this pathway is not that important it can lead to damage of
parenchymatous organs, such as liver [Kumański & Kamińska 2012].
The fastest and most effective are the two first pathways, in case of
which the first metabolite constitutes acetaldehyde.
Glutathione is a tripeptide composed of three amino acids
cysteine​​, glutamic acid and glycine. It is a very powerful antioxidant [Bukowska 2004], while alcohol affects the redox state of cells,
changing the ratio of GSH/GSSG and impairs their function. Particularly vulnerable to the adverse effects of ethanol are liver, skeletal muscles, lung, the heart muscle. The effects of alcohol can also
affect the immune mechanisms and apoptosis in cells [Kamińska and
Kumański 2012].The high concentration of glutathione is in the kidneys and liver. The concentration of intracellular glutathione is 3-4
times higher than extracellular concentration. According to Łukaszewicz-Hussain [2003] the highest concentration of glutathione was
recorded in liver and is associated with the ability of the hepatocyte
to convert cysteine-methionine by transsulfuration. Glutathione is
formed in the hepatocyte cytosol and is transported into the mitochondria as they have no possibility of synthesizing GSH. High reactivity is related to the presence of the thiol group in GSH molecule.
The main role of glutathione is related to leveling damage caused by
reactive oxygen species (ROS).
345
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta, Magdalena Semla...
Material and methods
The study was performed in twenty 12 weeks old males of Swiss
mice. Animals were fed with standard diet and grown in 12/12 light/
dark photoperiod. Animals were segregated into three experimental
groups and one control group. The animals from control group were
given natrium saline orally. Animals of the first experimental group
were treated orally with ethanol (5% solution). The daily dose of
ethyl alcohol was of 0.24 mg / day for a period of two weeks. Animals
of the second experimental group were treated with ethanol (10%
solution). The daily dose of ethyl alcohol was of 0.42 mg / day for
a period of 14 days. Animals of the third experimental group were
poisoned with ethanol (15% solution). The daily dose of ethyl alcohol
was of 0.585 mg / day by two weeks. 24h after the last oral administration the animals were introduced into a state of deep anesthesia
and decapitated. The level of reduced glutathione was determined in
liver and kidneys. Dissected organs were weighed and placed in refrigerated saline. Then homogenized in 0.1 M phosphate buffer, pH
7.4 containing EDTA. The homogenate was centrifuged for 15 min
in a centrifuge MPW-365 at 4°C and 15 000 rpm. The resulting supernatant was deproteinized by adding 500 μl of the supernatant
and 500 μl of 10% TCA and 500 ml EDTA. The mixture was put into
the refrigerator for 10 min, next centrifuged for 5 min at 6300 rpm.
GSH was determined by the colorimetric method of Ellman (1970).
The concentrations of GSH were measured with microplate reader
Sunrise TECAN. To determine the differences between the groups
one way ANOVA test was used followed by post hoc analysis using
Tukey’s test. The significant level was established at p<0.05. The used
procedures were accepted by the Local Ethical Committee, Resolution No. 132/2013.
Results
The studies showed a decrease in the concentration of reduced glutathione in all experimental groups. The largest decrease was observed in the first experimental group after alcohol administration at
a dose of 0.24 mg / day for a period of 14 days. Differences between
the groups were not statistically significant (F = 0.34, p = 0.80) (Fig.1.).
346
Wpływ alkoholu etylowego na poziom glutationu zredukowanego w wątrobie...
Fig. 1. The content of reduced glutathione (µM/g) in liver of mice after fourteen days of ethanol administration; a – no significant differences detected
GSH concentrations in experimental groups I and II were somewhat higher than in control animals. Whereas kidneys of animals
from the III experimental group contained lower concentration of
GSH than kidneys of control animals. On the other hand ANOVA
showed insignificant differences between animals from the consecutive groups (F=0.35, p=0.79) – Figure 2.
Fig. 2. The content of reduced glutathione (µM/g) in kidneys of mice after
fourteen days of ethanol administration; a – no significant differences detected
Discussion
Animal study indicated that alcohol reduces the level of reduced glutathione which may cause an oxidative stress. GSH strongly acts on
347
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta, Magdalena Semla...
tissues being in the state of oxidative stress caused by the action of
alcohol [Kamińska and Kumański 2012]. In physiological conditions
the changes are removed by enzymatic and non-enzymatic antioxidant system. The oxidative stress and impaired GSH level arise from
the imbalance between the formation and removal of free radicals
[Świderska et al. 2012]. According to Bailey et al [2001] alcohol can
decrease in the concentration of GSH in liver cells by the induction of
oxidative stress, changes in the GSH / GSH-Px ration and the oxidative modification of liver proteins. Reduced level of GSH occurs in alcoholism, diabetes [Yu and in.2001] and AIDS [Clarke and in.2002].
Pro-oxidative effect of ethanol according to Bilska [2007] depends on
the induction of cytochrome P450 isoform CYP 2 E1, which can accelerate the production of reactive forms of oxygen and have negative
impact on nucleic acids and other energetic substrates.
The processes of biosynthesis and biodegradation of glutathione belong to the most interesting metabolic processes, known as
g-glutamyl cycle. The basic substrates in biosynthesis are three amino acids: L-a glutamate, L-a cysteine and glycine. The availability of
cysteine is a factor that can influence the speed of glutathione formation. Liver and kidneys, in which the enzymes connected with
the amino acid biodegradation are located, can take advantage of
methionine as a cysteine precursor. In other tissues plasma is the
only source of cysteine.
The decline in reduced glutathione level can be caused by the reactions of formation of
S-conjugates with electrophile, toxic, exo- and endogenous substances (GSX). The detoxification process leads to the increase of the
substance hydrophilicity and their better excretion through kidneys.
Most of S-conjugates of cysteine undergo a reaction of N-acetylation
and turn into non-toxic mercapturic acids excreted in urine. However, some of the S-conjugates are decomposed by b-lyase and release
pyruvate, ammonia and other toxic thiols. The toxicity is intensified
in kidneys due to high activity of b-lyase in proximal tubules that
leads to the release of toxic RTF and thiols. In kidneys there is also
higher activity of N-deacetylase that enables the transformation of
mercapturates into S-conjugates. The formation of such connection
of xenobiotic with GSH not only has negative impact, but also can
348
Wpływ alkoholu etylowego na poziom glutationu zredukowanego w wątrobie...
damage the cell or even lead to carcinogenesis [Bilska 2007]. This
process results in a loss of the rest of cysteine and thus depletes the
cellular GSH pool, what could explain the depletion of the reduced
glutathione concentration in the examined organs.
Conclusions
Ethyl alcohol insignificantly influences the concentration of reduced
glutathione in the liver and kidneys of mice. The largest decrease in
GSH concentration was observed in the liver. Lowering the level of
reduced glutathione may cause oxidative stress and disturbances in
the functioning of cells and organs.
References
Bailey S.M. Patel V.B. Young T.A. Asayama K. 2001. Cunningham C.C. Chronic ethanol consumption alters the glutathione/glutathione peroxidase-1 system and protein oxidation status in rat liver. Alcohol Clin. Exp.
Res., 25, 726-733.
Bartosz G. 2003. Druga twarz tlenu. Wolne rodniki w przyrodzie. PWN,
Warszawa.
Bilska A. Kryczyk A. Włodek L. 2007. Różne oblicza biologicznej roli glutationu. Postepy High Med. Dos. (online), 61:438-453.
Bukowska B. 2004. Glutation: Biosynteza, czynniki indukujące oraz stężenie w wybranych jednostkach chorobowych. Medycyna Pracy, 55(6):
501-509.
Clarke S.F. Guy P.L. Burritt D.J. Jameson P.E. 2002. Changes in the activities
of antioxidant enzymes in response to virus infection and hormone
treatment. Pysiol. Plant.,114, 157-164.
Ellman G.L. 1970. SH groups determination in biological fluids. Analytical
Biochemistry, 46, 237.
Kamińska A. Kumański K. 2012. Alkohol a glutation. Kosmos problemy
nauk biologicznych, Polskie Towarzystwo Przyrodników im. Kopernika, 61, 1 (294), 105–120.
Kumański K. Kamińska A. 2012. Różne drogi metaboliczne alkoholu etylowego w tkankach. Kosmos problemy nauk biologicznych, Polskie
Towarzystwo Przyrodników im. Kopernika, 61, 1 (294) : 29-35.
Łukaszewicz - Hussain A. 2003. Rola glutationu i enzymów z nim związanych
w procesach antyoksydacyjnych organizmu. Medycyna Pracy, 54 (5):
473-479.
349
Kinga Kraska, Grzegorz Formicki, Edyta Kapusta, Magdalena Semla...
Małkowska A. Szutowski M. 2009. Wartość diagnostyczna etyloglukuronianu (EtG) jako wskaźnika konsumpcji alkoholu. Alkoholizm Narkomania 22, 189-201.
Ścibor D. Czeczot A. 2006. Katalaza – budowa, właściwości, funkcje. Postępy
Higieny Medycyny Doświadczalnej (online), 60: 170-180.
Świderska-Kołacz G. Kumański K. Parka B. 2012. Alkohol a stres oksydacyjny.
Kosmos problemy nauk biologicznych, Polskie Towarzystwo Przyrodników im. Kopernika, 61, 1 (294), 93-103.
Yu B.P. Chung H.Y. 2001. Oxidative stress and vascular aging. Diabetes Res.
Clin. Pract., 54: S73-S80.
Adres do korespondencji:
mgr Kinga Kraska
Pedagogical University of Cracow
Faculty of Geography and Biology
Institute of Biology
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland
+48 126626720
e-mail: [email protected]
dr hab. Grzegorz Formicki prof. UP
Pedagogical University of Cracow
Faculty of Geography and Biology
Institute of Biology
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland
+48 126626720
e-mail: [email protected]
mgr Edyta Kapusta
Pedagogical University of Cracow
Faculty of Geography and Biology
Institute of Biology
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland
+48 126626720
e-mail: [email protected]
350
Wpływ alkoholu etylowego na poziom glutationu zredukowanego w wątrobie...
mgr Magdalena Semla
Pedagogical University of Cracow
Faculty of Geography and Biology
Institute of Biology
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland
+48 126626720
e-mail: [email protected]
mgr inż. Marta Batoryna
Pedagogical University of Cracow
Faculty of Geography and Biology
Institute of Biology
Department of Animal Physiology and Toxicology
Podbrzezie 3, 31-054 Cracow, Poland
+48 126626720
e-mail: [email protected]
mgr Martyna Błaszczyk
Pedagogical University of Cracow
Faculty of Geography and Biology
Institute of Biology
Department of Vertebrates Zoology and Human Biology
Podbrzezie 3, 31-054 Cracow, Poland
+48 126626720
e-mail: [email protected]
351
Katarzyna Liszka, Tadeusz Grega
Dorota Najgebauer-Lejko
Opiekun naukowy: prof. dr hab. inż. Tadeusz Grega
EPISTEME
22/2014, t. I
s. 353-360
ISSN 1895-2241
CHARAKTERYSTYKA JOGURTÓW Z DODATKIEM
OWOCÓW ROKITNIKA I CZARNEGO BZU
CHARACTERISTICS OF YOGUT WITH THE ADDITION
OF ELDERBERRY AND SEA BUCKTHORN FRUITS
Abstrakt. Praca miała na celu określenie wpływu dodatku przecierów
z owoców rokitnika oraz czarnego bzu na kwasowość, właściwości antyoksydacyjne i mikroflorę jogurtów. Mleko przerobowe zaszczepiono szczepionką liofilizowaną typu DVS i inkubowano w temp. 43°C do osiągnięcia
pH 4,7, a następnie dodano przeciery owocowe słodzone (30% cukru) lub
niesłodzone w ilości 10%. W otrzymanych jogurtach określono kwasowość
czynną, miareczkową, aktywność przeciwutleniającą metodą FRAP i z rodnikiem DPPH oraz liczbę mikroflory starterowej w 1, 15 i 29 dniu przechowywania chłodniczego. Analizując otrzymane wyniki stwierdzono, że dodatek owoców spowodował istotny wzrost właściwości przeciwutleniających
jogurtów, przy czym znacznie większe wartości stwierdzono dla jogurtów
z czarnym bzem. Dodatek przecieru z rokitnika spowodował również istotny wzrost kwasowości jogurtów. Nie odnotowano natomiast negatywnego wpływu suplementacji na poziom mikroflory jogurtowej.
Słowa kluczowe: jogurt, rokitnik, czarny bez, bakterie jogurtowe, kwasowość,
FRAP, DPPH.
Summary. The aim of the study was to determine the effect of elderberries
(Sambucus nigra) and sea buckthorn (Hippophae rhamnoides) purees on acidity, antioxidant properties and microflora of yoghurt. Butch milk was inoculated with freeze-dried DVS starter and incubated at 43 °C until pH 4.7,
and then sweetened (30%) or unsweetened fruit preparations were added
in the amount of 10%. The obtained yoghurts were analysed for titratable
and active acidity, antioxidant activity by the FRAP and DPPH methods and
the number of starter microflora at the 1st, 15th and 29th day of cold storage
at 4°C. The results revealed that fruit addition affected significant increase
of the antioxidant properties of yoghurts with elderberries being the most
effective. The addition of sea buckthorn caused a significant increase in acidity. Moreover, no detrimental effect of the fruit supplementation on the
level of yoghurt bacteria was noticed.
Key words: yogurt, sea buckthorn, elderberry, yogurt bacteria, acidity, FRAP,
DPPH.
353
Katarzyna Liszka, Tadeusz Grega, Dorota Najgebauer-Lejko
Wstęp
Mleczne napoje fermentowane charakteryzują się zawartością wielu
składników pokarmowych, a ich wszechstronność i działanie prozdrowotne jest powszechnie znane. Wśród wielu należy wyróżnić jogurt, który cieszy się ogromną popularnością pod względem spożycia,
zajmując pierwsze miejsce spośród wszystkich mlecznych napojów
fermentowanych. Produkty te mają korzystne właściwości z racji
swojej wysokiej wartości odżywczej i fizjologicznej, a w porównaniu
z mlekiem cechuje je wyższa przyswajalność białek i tłuszczu oraz
wyższa zawartość znacznej ilości witamin [Kudełka 2005].
Żywność pochodzenia roślinnego charakteryzuje się łatwym
przyswajaniem węglowodanów, błonnika oraz witamin. Ponadto jest
bogatym źródłem związków biologicznie aktywnych, a znakomitą ich
część stanowią polifenole - substancje o działaniu antyoksydacyjnym,
które mają duże znaczenie w zapobieganiu przewlekłym chorobom niezakaźnym [Stankiewicz 2009]. Owoce czarnego bzu oprócz
flawonoidów zawierają duże ilości antocyjanów, dlatego mają również właściwości przeciwwirusowe, odtruwające oraz wzmacniające.
Natomiast owoce rokitnika cechuje wysoka zawartość witaminy C,
E, karotenoidów, flawonoidów, kwasów tłuszczowych, fitosteroli,
kwasów organicznych oraz proantocyjanidynów. Jednocześnie odznaczają się stosunkowo wysokimi zdolnościami antyoksydacyjnymi,
przy niewielkiej zawartości fenoli [Lee i Finn 2007, Michel i in.
2011, Zeb i Malook 2009]. Obecnie obserwuje się wysokie zainteresowanie żywnością pochodzenia naturalnego, mającą właściwości
prozdrowotne [Mirończuk-Chodakowska i in. 2011, Ochmian i in.
2009, Szajdek i Borowska 2004], dlatego celem pracy było określenie wpływu dodatku przecierów z tych owoców na kwasowość,
właściwości antyoksydacyjne oraz mikroflorę jogurtów.
Materiały i metody
Przedmiotem badań były jogurty wzbogacane owocami dziko
rosnących krzewów rokitnika i czarnego bzu. Za nadające się do produkcji przecierów uznano owoce zdrowe, mające odpowiedni kształt
i zabarwienie. Tuż po zbiorze owoce zostały umyte, a następnie
354
Charakterystyka jogurtów z dodatkiem owoców rokitnika i czarnego bzu
przechowywane w temperaturze -18°C. Podczas produkcji przecierów owoce zostały całkowicie rozmrożone, a następnie rozparzone
w łaźni wodnej przez okres 15 min. Po tym czasie zostały one przetarte przez sito, a następnie część przecierów wzbogacano cukrem
(30%) i poddano pasteryzacji (85ºC, 15 min). Po ochłodzeniu przeciery owocowe przechowywano w warunkach chłodniczych w temp. 4ºC.
Surowcem do produkcji jogurtów było mleko pochodzące od krów
z zakładu KHNO „Polan sp. z o.o.” w Dziekanowicach. Bezpośrednio
po przywiezieniu przystąpiono do produkcji mlecznych napojów fermentowanych metodą zbiornikową, po czym dokonano normalizacji
do 13% s.m.b poprzez dodatek odtłuszczonego mleka w proszku.
Następnie poddano je homogenizacji – 65 °C, ok. 6 MPa oraz pasteryzacji w temp. 85 ºC przez okres 15 min. Mleko zaszczepiono liofilizowaną szczepionką typu DVS YC-180 (Chr. Hansen), zawierającą
bakterie Streptococcus thermophilus i Lactobacillus delbrueckii ssp.
bulgaricus. Następnie inkubowano w temp. 43°C do osiągnięcia pH
4,7, po czym dodano przeciery owocowe słodzone (30% cukru) lub
niesłodzone w ilości 10%. Otrzymane jogurty przechowywano w warunkach chłodniczych w temp. 4°C.
Rodzaje wyprodukowanych jogurtów:
• naturalny, bez dodatku przecierów owocowych – JN
• z 10% dodatkiem przecieru z rokitnika – JR
• z 10% dodatkiem przecieru z rokitnika z cukrem – JRC
• z 10% dodatkiem przecieru z czarnego bzu – JB
• z 10% dodatkiem przecieru z czarnego bzu z cukrem – JBC.
Zakres badań obejmował ocenę właściwości przeciwutleniających w teście oceny siły redukcyjnej FRAP (Anti Radical Power)
oraz w teście z rodnikiem DPPH (1,1-difenylo-2-pikrylohydrazyl).
Pojemność przeciwutleniającą (metoda DPPH) wyliczano i podano jako ARP, odwrotność EC50 i wyrażono względem ARP troloksu
[Najgebauer-Lejko i in. 2011]. Ponadto dokonano analizy poziomu
mikroflory starterowej tj.: Lactobacillus delbrueckii ssp. bulgaricus
oraz Streptococcus thermophilus – posiew wgłębny wg (PN-ISO 7889:
2007). Oznaczono również kwasowość miareczkową i czynną (pH)
wyprodukowanych jogurtów. Analizy wykonano w 2 niezależnych
seriach oraz w dwóch powtórzeniach w 1, 15 i 29 dniu przechow355
Katarzyna Liszka, Tadeusz Grega, Dorota Najgebauer-Lejko
ywania chłodniczego. W celu oznaczenia wpływu czynników doświadczalnych (rodzaj przecierów owocowych oraz czas przechowywania)
na poziom wybranych cech, przeprowadzono dwuczynnikową analizę wariancji a istotność różnic pomiędzy średnimi oszacowano na
podstawie testu Duncana (P ≤0,05) za pomocą programu komputerowego Statistica 8 (StatSoft).
Wyniki i dyskusja
Rezultaty wykonanych analiz pokazują, że dodatek przecierów
owocowych miał istotny wpływ na poziom kwasowości jogurtów.
W przypadku zastosowania przecierów z owoców rokitnika zaobserwowano istotnie niższy poziom pH oraz wyższe wartości
kwasowości potencjalnej w porównaniu do jogurtów z dodatkiem
czarnego bzu (Tab. 1). Jest to najprawdopodobniej związane ze stosunkowo wysoką kwasowością owoców zastosowanych do wzbogacania jogurtów [Leja i in. 2007, Ochmian i in. 2009, Michel i in. 2011].
Tym samym wpływa na zwiększenie tego parametru w badanych jogurtach. Przy czym większą kwasowością odznaczają się owoce rokitnika niż czarnego bzu [Zeb i Malook 2009]. Ponadto wraz z upływem
czasu przechowywania zaobserwowano większe tempo obniżania się
kwasowości potencjalnej jogurtów owocowych z dodatkiem cukru.
Natomiast wartość kwasowości czynnej w jogurtach z przecierami
owocowymi zmniejszała się, niezależnie od dodatku cukru. Dodatek
owoców nie wpłynął istotnie na poziom mikroflory starterowej jogurtów.
W przypadku oceny aktywności przeciwutleniającej wykonanej
metodą FRAP (Wyk. 1) i z rodnikiem DPPH (Wyk. 2) dwuczynnikowa
analiza wariancji wykazała, że dodatek przecierów z owoców czarnego bzu spowodował istotny wzrost poziomu wybranych parametrów w stosunku do jogurtu naturalnego, przy czym wyższe wartości
osiągnął jogurt bez dodatku cukru. Ma to związek z wyższą zawartością samych owoców w tym jogurcie. Podobną zależność można
zaobserwować w obniesieniu do jogurtów z dodatkiem rokitnika,
ale jogurty te osiągnęły dużo niższe wartości niż te, które zostały
wzbogacone czarnym bzem. Jest to związane z wysoką zawartością
rozpuszczalnych fenoli oraz flawonoli występujących w tych owo356
Charakterystyka jogurtów z dodatkiem owoców rokitnika i czarnego bzu
cach i tym samym wysoką zdolnością neutralizacji wolnych rodników
[Lee i Finn 2007, Leja i in. 2007, Ochmian i in. 2009]. Natomiast
owoce rokitnika przy stosunkowo niewielkiej zawartości fenoli również wykazują zdolności przeciwutleniające [Michel i in. 2011, Zeb
i Malook 2009]. Tym samym wzbogacanie jogurtów tymi owocami
powoduje znaczny wzrost tego parametru w odniesieniu do jogurtu naturalnego. Można również stwierdzić, że czas przechowywania
powoduje zmniejszenie właściwości antyoksydacyjnych w badanych
jogurtach owocowych, przy czym większy spadek notują jogurty
z dodatkiem przecierów z czarnego bzu.
Tab. 1. Poziom kwasowości oraz liczba mikroflory starterowej jogurtów
w zależności od rodzaju przecierów owocowych oraz czasu przechowywania
Rodzaj jogurtu
Cecha
Kwasowość miareczkowa
(% kw. mlekowego)
pH
JN
JR
JRC
JB
JBC
Dzień
przechowywania
1,30bc
1,35c
1,34ac
1,11b
1,14ab
1
1,18ab
1,36a
1,31ab
1,18ab
1,12b
15
1,35ac
1,38a
1,28ab
1,16bc 1,12bc
29
4,79a
4,48b
4,56ab
4,71ab 4,75ab
1
4,55a
4,44a
4,45a
4,55a
4,60a
15
4,59ab
4,39a
4,55ab
4,65ab
4,69b
29
Liczba L. delbrueckii ssp.
bulgaricus
(log jtk/ml)
8,26a
8,66a
8,87a
8,91a
8,92a
1
8,26a
8,25a
8,20a
8,26a
8,26a
15
8,30a
8,12a
8,16a
8,33a
8,21a
29
Liczba Str.
thermophilus
(log jtk/ml)
9,12a
9,94a
9,88a
9,65a
9,31a
1
9,27a
9,41a
9,16a
9,34a
9,07a
15
9,23a
9,16a
9,28a
9,25a
9,23a
29
a, b – wartości oznaczone różnymi literami w rzędach różnią się między sobą
statystycznie istotnie (P<0,05).
357
Katarzyna Liszka, Tadeusz Grega, Dorota Najgebauer-Lejko
Wyk. 1. Aktywność antyoksydacyjna - FRAP
a, b – wartości oznaczone różnymi literami różnią się między sobą
statystycznie istotnie (P<0,05).
Wyk. 2. Aktywność antyoksydacyjna - ARP
a, b – wartości oznaczone różnymi literami różnią się między sobą
statystycznie istotnie (P<0,05).
Wnioski
1.
358
Dodatek owoców czarnego bzu spowodował istotny wzrost właściwości
przeciwutleniających jogurtów.
Charakterystyka jogurtów z dodatkiem owoców rokitnika i czarnego bzu
2. Jogurty z dodatkiem rokitnika charakteryzowały się niższymi wartościami pH oraz wyższym poziomem kwasowości miareczkowej w stosunku do jogurtów wzbogacanych owocami czarnego bzu.
3. Nie odnotowano negatywnego wpływu dodatku przecierów owocowych na poziom mikroflory jogurtowej.
Bibliografia
Kudełka W. 2005. Charakterystyka mlecznych napojów fermentowanych
w Unii Europejskiej oraz w Polsce. Zaszyty Naukowe Akademii Ekonomicznej, Kraków, 678, 149-152.
Lee J., Finn C. E. 2007. Anthocyanins and other polyphenolics in American
elderberry (Sambucus canadensis) and European elderberry (S. nigra)
cultivars. J. Sci. Food Agr., 87, 2665–2675.
Leja M., Mareczek A., Nanaszko B. 2007. Antyoksydacyjne właściwości
owoców wybranych gatunków dziko rosnących drzew i krzewów. Roczniki Akademii Rolniczej, CCCLXXXIII, Kraków, 41, 327-331.
Michel T., Destandau E., Elfakir C. 2011. Evaluation of a simple and promising method for extraction of antioxidants from sea buckthorn
(Hippophaë rhamnoides L.) berries: Pressurised solvent-free microwave assisted extraction. Food Chem., 126, 1380–1386.
Mirończuk-Chodakowska I., Zujko M., E., Witkowska A. 2011. Zawartość
polifenoli oraz aktywność antyoksydacyjna niektórych przetworów
owocowych o znacznym stopniu przetworzenia. Bromat. Chem.
Toksykol. XLIV, 3, 905-910.
Najgebauer-Lejko D., Sady M., Grega T., Walczycka M. 2011. The impact of
tea supplementation on microflora, pH and antioxidant capacity of yoghurt. Int. Dairy J., 21(8), 568-574.
Ochmian I., Oszmiński J., Skupień K. 2009. Chemical composition phenolics and firmness of small black fruits. J. Appl. Bot. Food Qual., 83,
64-69.
PN-ISO 7889: 2007. Jogurt – Oznaczanie liczby charakterystycznych drobnoustrojów –Metoda liczenia kolonii w temperaturze 37°C.
Stankiewicz J. 2009. Jakość mlecznych napojów fermentowanych suplementowanych dodatkami pochodzenia roślinnego. Zeszyty Naukowe
Akademii Morskiej, 61, 39-42.
Szajdek A., Borowska J. 2004. Właściwości przeciwutleniające żywności pochodzenia roślinnego. Żywność. Nauka. Technologia. Jakość, 4 (41) S,
5-28.
359
Katarzyna Liszka, Tadeusz Grega, Dorota Najgebauer-Lejko
Zeb A., Malook I. 2009. Biochemical characterization of sea buckthorn
(Hippophae rhamnoides L. spp. turkestanica) seed. Afr. J. Biotechnol.,
8 (8), 1625-1629.
Adres do korespondencji:
mgr inż. Katarzyna Liszka
prof. dr hab. inż. Tadeusz Grega
dr inż. Dorota Najgebauer-Lejko
Katedra Przetwórstwa Produktów Zwierzęcych
Wydział Technologii Żywności
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
360
Anna Ogrodowczyk
Joanna Fotschki
Barbara Wróblewska
Opiekun naukowy:
dr hab. Barbara Wróblewska, prof. nadzw.
EPISTEME
22/2014, t. I
s. 361-368
ISSN 1895-2241
The effect of L. delbruecki ssp. bulgaricus 151 fermented buttermilk beverage
on the course of allergic reaction
Wpływ maślanki fermentowanej szczepem
L. delbruecki ssp. bulgaricus-151 na
przebieg reakcji alergicznej
Summary. Buttermilk in the properly balanced diet of healthy people provides a rich source of essential proteins, phospholipids as well as bio-available minerals and vitamins. Existing knowledge on its health-promoting
activity, particularly in the diet of patients with food allergy, is insufficient. The main aim of this study was to verify whether proteins and peptides obtained during fermentation and hydrolysis of buttermilk modulate
the allergic response of murine cow’s milk protein allergy model. The level
of immunoglobulins and cytokine secretion as well as metabolic activity of
gut-associated lymphoid tissue was determined. The change of short-chain
fatty acid composition in mouse caecum was also estimated. The obtained
results provide the information on the buttermilk as an appropriate substitute of diets for patients with food allergies.
Key words: buttermilk, allergy, innate and secondary response
Abstrakt. Maślanka w odpowiednio zbilansowanej diecie zdrowych ludzi
stanowi bogate źródło niezbędnych białek, fosfolipidów oraz bio-dostępnych
witamin i minerałów. Dotychczasowa wiedza dotycząca jej aktywności prozdrowotnej, w szczególności w diecie osób cierpiących na alergię pokarmową, jest niewystarczająca. Głównym celem pracy było stwierdzenie czy
maślanka poddana fermentacji i hydrolizie może modulować odpowiedź
układu immunologicznego związanego ze śluzówką jelita w mysim modelu alergii. Przeanalizowano poziom immunoglobulin, cytokin oraz ekspresję czynników odpowiedzi pierwotnej myszy. Ponadto określono zmiany
składu krótkołańcuchowych kwasów tłuszczowych obecnych w jelicie
361
Anna Ogrodowczyk, Joanna Fotschki, Barbara Wróblewska
ślepym zwierząt i ich wpływ na ekosystem jelit. Wyniki badań dostarczają
informacji na temat wpływu maślanki jako elementu diety osób cierpiących
na alergię pokarmową.
Słowa kluczowe: maślanka, alergia, odpowiedź pierwotna i wtórna
Introduction
Cows’ milk allergy (CMA) is recognized as a frequent disorder in progression of allergic diseases in men’s life. Due to the growing problem of CMA that affects, regardless of age, an increasing part of the
world population, the more effective and less strict form of therapy
than elimination diet is being looked for. Therefore, the mainstream
of CMA treatment is self-oral immunotherapy focused on the intake
of increasing amount of milk or milk-based products, like fermented beverages, until the immune tolerance toward milk allergens has
been achieved [Fisher et al., 2011]. The beneficial role of diet supplementation with fermented dairy products is known for many years
and also provides the new therapeutic approach for people suffering
from allergic diseases [Kawase et al., 2009].
The favourable composition and health-promoting effect of buttermilk as well as its refreshing taste have been extensively studied
[Conway et al., 2014]. Sweet as well as fermented buttermilk provides many nutrients such as: proteins and peptides rich in essential
amino acids, lactose, bioavailable minerals and vitamins, omega-3
fatty acids, antioxidants and beneficial contents of phospho- and
sphingolipids that can reach up to seven times that of the whole
cows’ milk [Sodini et al., 2006]. Lactic acid fermentation process can
have a double beneficial effect, both through probiotic activity of living microorganisms - lactic acid bacteria (LAB) strains, as well as
the modulating effect of their biogenic metabolites. All these components improve gut barrier integrity, stimulate the development of tolerance to antigens and act suppressively on intestinal inflammatory
response [Tang 2009].
Recent studies particularly emphasize the role of intestinal barrier and the intestinal mucosal immune system and its role in the
development of the innate and secondary immune response to food
antigens as well as in creating the state of tolerance [Vickery et al.,
362
The effect of l. Delbruecki ssp. Bulgaricus - 151 fermented buttermilk beverage...
2011]. The site of antigen contact may also determine the nature of
the immune response to the antigen. The main structures of the intestinal immune system entering into contact with the antigen present in the intestinal lumen include dendritic cells, Peyer’s patches,
macrophages, antigen-presenting cells or lymphocyte T cells having
receptors on their surface called Major Histocompatibility Complex
(MHC) class I and II [Chehade et al., 2005]. Also, many valuable information about the condition of the body is provided directly by
analysis of gut microbiota content and indirectly by analysis of the
composition of short chain fatty acids (SCFA) in mouse caecal digesta, which are claimed to improve mucosal integrity, reduce intestinal
permeability and act as anti-inflammatory agents for the mucosa
[Fereira et al., 2012].
The main aim of this study was to determine the effect of diet
supplementation with the fermented buttermilk beverage on the
suppression of allergic reaction induced in mice organism.
Material and methods
Material
Sweet buttermilk (BM) (4.5% of carbohydrates; 2.75% of proteins;
0.44% of fat content) was obtained from Regional Dairy Cooperative
in Błonie (Poland). Subsequently, it was split in several batches that
were fermented with selected strain of lactic acid bacteria (Lactobacillus delbruecki ssp. bulgaricus–151) obtained from the microorganisms collection of the Microbiology Laboratory at the Institute of
Animal Reproduction and Food Research of the Polish Academy of
Sciences (Olsztyn, Poland). The fermentation process was carried out
on aliquots of BM at 37°C, to pH 4.6 for 8 hours.
Methods
The laboratory-bred strain of BALB/c mice was divided into four
groups. Two of them were sensitized peritoneally with the most
allergenic fraction of cows’ milk protein (β-lactoglobulin, α-casein
mixed with aluminum adjuvant). One group of animals after sensitization procedure and one of non-sensitized groups were fed with
363
Anna Ogrodowczyk, Joanna Fotschki, Barbara Wróblewska
fermented buttermilk derived product. The remaining two groups
of animals (control-sensitized and control non-sensitized) were fed
with standard, non-dairy diet. After three-week feeding period the
mice were sacrificed and selected organs were collected for further
analysis. Blood was collected for determination of IgE, IgG secretion
by ELISA assay using commercial reagents (respectively: OptEIA™/
555248 BD Biosciences; A9044-SIGMA). Small intestine was collected for determination of expression (mRNA) of inflammatory biomarkers (cytokines: TNFα, IL-4, MCP-1) with Reverse Transcription
Polymerase Chain Reaction (RT-PCR) method [Olivares et.al., 2012].
Caecal digesta were collected to determine the concentration of short
chain fatty acids by reverse phase-HPLC-UV method [De Baere et
al., 2013]. The experiment was approved by the Local Ethical Committee in Olsztyn (75/2011/N). All groups of animals consisted of
eight mice. Each experiment was conducted in triplicate. One-way
analysis of variance (ANOVA) and the Tukey post hoc test were applied. Statistical significance was established at *P <0.05, ** P <0.01,
*** P <0.001 for all comparisons. Statistical software (STATISTICA,
version 10 StatSoft, Poland) was used for the statistical analysis.
Results and discussion
This study reports the effect of the oral administration of fermented
buttermilk beverages on a significant decrease of total IgE (fig. 1a)
and antigen specific IgG (fig. 1b) in blood serum of the sensitized
group of animals. At the same time, a slight increase of total IgE level
relatively to the control group was observed in group of non-sensitized animals treated with fermented product. Such a situation was
not observed according to the specific IgG serum level. Increased
levels of an allergen-specific antibodies of class E and G are known
mediators of inflammation in the course of IgE-mediated allergic reactions [Bowman & Selgrade, 2008].
364
The effect of l. Delbruecki ssp. Bulgaricus - 151 fermented buttermilk beverage...
Fig. 1. IgE, IgG secretion. 151/S and 151/NS- respectively group of animals
sensitized or non-sensitized fed with product fermented with L. delbruecki
ssp. bulgaricus- 151; CTRL/S CTRL/NS- control groups of animals on standard dairy-free diet.
In this study, it was also observed that the stimulation of animal
cells with the fermented buttermilk beverages decreased the expression of pro-inflammatory biomarkers. It was observed that IL-4,
MCP-1 and TNF-α decreased in the mice group fed with 151- formula
(fig.2).
Fig. 2. Expression of pro-inflammatory biomarkers (TNFα, MCP-1, IL-4).
IL-4 produced by Th2 cells, mast cells and basophils is responsible for stimulating antibody class switching toward IgE, which
partially reveals the IgE level decrease. TNF-α is also the cytokine
associated with inflammation due to its ability of attracting neutrophils and stimulating phagocytosis and is produced by activated
monocytes and macrophages. MCP-1 is also a cytokine that belongs
to the chemokine family. It provokes infiltration of monocyte, memory T cells, and dendritic cells to the sites of inflammatory process and it constitutes the connection between innate immunity and
secondary immune response. The analysis of expression of biomarkers informs about the promotion of Th2-controlled and phagocytic
immune responses (IgE-mediated allergy) in the sensitized control
365
Anna Ogrodowczyk, Joanna Fotschki, Barbara Wróblewska
group and relieving this process in the group of buttermilk-based
formula treated animals. The reduction of the inflammatory response after the application of the formula may be associated with modification of the structure of milk protein allergens by L. delbruecki
ssp. bulgaricus-151, that also reveals strong proteolytic properties
[Jędrychowski & Wróblewska 1999; Kleber et al., 2006], increased
immune response and enhanced non-immunological defense barrier
of the gastrointestinal tract [Vickery et.al., 2011] as well as increases
the production of SCFA and changes their profile, which enhances
their protective effect. The qualitative and quantitative determination of SCFA, as the primary metabolites of the intestinal microbiota,
indicates a significant increase in the total level of SCFA in groups
treated with fermented buttermilk formula (fig. 3), however the differences in individual acid groups were not always significant. The
prior analysis of SCFA in buttermilk- based formula reveals the increased amount of propionic, lactic and butyric acids, which explains
their increased level in caecal digesta of the treated group of animals.
Oral administration of these products also allows beneficial effects
of SCFA, especially butyric acid on the seal of tight junctions and
amelioration of intestinal mucosa after antigen administration [Peng
et al., 2009].
SCFA content
mmol/g
1000
I-BUTYRIC
BUTYRIC
LACTIC-D
LACTIC-L
PROPIONIC
I-VALERIC
LACTIC
ACETIC
800
600
400
200
0
151/S
151/NS
CTRL/S
CTRL/NS
Fig. 3. The content of short chain fatty acids in the caecal digesta
of studied mice group.
Conclusions
This study demonstrated the potential immunomodulatory effects of
buttermilk-based fermented formula. Buttermilk with L.delbruecki
ssp. bulgaricus -151 strain used in this study has the ability to down366
The effect of l. Delbruecki ssp. Bulgaricus - 151 fermented buttermilk beverage...
regulate expression of pro-inflammatory biomarkers and to secrete specific antibodies directed to a mixture of antigens. Moreover,
a significant difference was found in the content and profile of SCFA
in groups of animals fed with different types of diet. It makes the
designed formula desirable for both allergic and healthy groups of
consumers.
References
Bowman Ch. C. Selgrade M. K. 2008. Differences in allergenic potential
of food extracts following oral exposure in mice reflect differences in
digestibility: potential approaches to safety assessment. Toxicol. Sci.
102: 100–109.
Chehade, M., and L. Mayer. 2005. Oral tolerance and its relation to food
hypersensitivities. J Allergy Clin Immunol 115:3-12;
Conway V. Couture P. Gauthier S. Pouliot Y. Lamarche B. 2014. Effect of
buttermilk consumption on blood pressure in moderately hypercholesterolemic men and women. Nutrition, 30(1), 116-119.
De Baere S. Eeckhaut V. Steppe M. De Maesschalck C. De Backer P. Van
Immerseel F. Croubels S. 2013. Development of a HPLC-UV method
for the quantitative determination of four short-chain fatty acids and
lactic acid produced by intestinal bacteria during in vitro fermentation.
J Pharm Biomed Anal. 80:107-115.
Ferreira T. M. Leonel A. J. Melo M. A. Santos RR. Cara D. C. Cardoso V. N.
Correia M. I. Alvarez-Leite J. I. 2012. Oral supplementation of butyrate
reduces mucositis and intestinal permeability associated with 5-Fluorouracil administration. Lipids. 47(7): 669-678.
Fisher H. R. du Toit G. Lack, G. 2011. Specific oral tolerance induction in
food allergic children: is oral desensitisation more effective than allergen avoidance? Archives of Disease in Childhood, 96: 259-264.
Jedrychowski L. Wroblewska B. 1999. Reduction of the antigenicity of whey
proteins by lactic acid fermentation. Food Agric Immunol. 11: 91–99.
Kawase M. He F. Kubota A. Hiramatsu M. Saito H. Ishii T. Yasueda H. Akiyama K. 2009. Effect of fermented milk prepared with two probiotic
strains on Japanese cedar pollinosis in a double-blind placebo-controlled clinical study. Int J Food Microbiol. 15;128: 429-434.
Kleber N. Weyrich U. Hinrichs J. 2006. Screening for lactic acid bacteria with
potential to reduce antigenic response of β-lactoglobulin in bovine
skim milk and sweet whey. Innov Food Sci Emerg Technol. 7: 233–238.
367
Anna Ogrodowczyk, Joanna Fotschki, Barbara Wróblewska
Olivares M. Laparra M. Sanz Y. 2012. Oral administration of Bifidobacterium longum CECT 7347 modulates jejunal proteome in an in vivo gliadin-induced enteropathy animal model. J Proteomics. 21; 77: 310-320.
Peng L. Li ZR. Green R. S. Holzman IR. Lin J. 2009. Butyrate enhances
the intestinal barrier by facilitating tight junction assembly via activation of AMP-activated protein kinase in Caco-2 cell monolayers.
J Nutr.139(9): 1619-1625.
Sodini I. Morin P. Olabi A. Jiménez-Flores R. 2006. Compositional and functional properties of buttermilk: a comparison between sweet, sour, and
whey buttermilk. J Dairy Sci. 89(2): 525-536.
Tang, M.L.K. 2009. Probiotics and Prebiotics: Immunological and Clinical
effects in Allergic Disease. In Microbial-Host Interaction: Tolerance
versus Allergy. Nestlé Nutr Inst Workshop Ser Pediatr Program, 64:
219-238.
Vickery B.P. Scurlock A.M. Jones S.M. Burks A.W. 2011. Mechanisms of
immune tolerance relevant to food allergy. J Allergy Clin Immunol.
127(3): 576-584.
Adres do korespondencji:
mgr Anna Ogrodowczyk, mgr Joanna Fotschki
dr hab. Barbara Wróblewska prof. nadzw
Instytut Rozrodu Zwierząt i Badań Żywności
Polskiej Akademii Nauk w Olsztynie
Zakład Immunologii i Mikrobiologii Żywności
e-mail: [email protected]
368
Paulina Anna RutkowskA
Michał Jankowski
Opiekun naukowy: prof. dr hab. Renata Bednarek
EPISTEME
22/2014, t. I
s. 369-377
ISSN 1895-2241
ROZWÓJ ROŚLINNOŚCI RUNA I POZIOMÓW ORGANICZNYCH GLEB W 150-LETNIM CYKLU UPRAWY
SOSNY NA WYDMACH KOTLINY TORUŃSKIEJ
THE DEVELOPMENT OF UNDERGROWTH VEGETATION AND SOILS ORGANIC HORIZONS IN THE 150
YEARS CYCLE OF THE PINE TIMBER FOREST PLANTATION ON DUNES IN THE TORUŃ BASIN
Abstrakt. Badania przeprowadzono w sosnowych lasach gospodarczych
w 100-150 letnim cyklu produkcyjnym, na terenie Kotliny Toruńskiej.
Analizowano zmiany flory oraz rozwój poziomów organicznych gleb usytuowanych na północnych stokach wydm śródlądowych, w różnowiekowych
drzewostanach sosnowych (27, 52, 70, 105 oraz 150 lat). Zbiorowiskiem
roślinnym dominującym na danym obszarze jest subkontynentalny bór
świeży Peucedano-Pinetum. Liczba zdiagnozowanych gatunków stopniowo
zwiększa się wraz z wiekiem drzewostanów sosnowych. W najmłodszym
drzewostanie (27 lat) w runie występują tylko takie gatunki jak Ptilium crista castrensis i Vaccinium vitis-idaea. Z rosnącym wiekiem sosny pojawiają się
kolejne gatunki: Deschampsia flexuosa, Vaccinium myrtillus oraz Convallaria
majalis. Rozwój poziomów organicznych gleb także jest związany z rosnącym
wiekiem sosny i prowadzi do wykształcenia próchnicy typu mor. Po około
100 latach od nasadzenia drzewostanu w poziomach tych wykształca się
pełna sekwencja podpoziomów (Ol-Of-Oh).
Słowa kluczowe: roślinność runa leśnego, drzewostany sosnowe, poziom organiczny, próchnica typu mor, uprawa sosny
Summary. The research was conducted in a pine timber forest in 100-150
years production cycle in the Toruń Basin. Changes in vegetation and development of organic horiozon of soils situated on northen slopes of inlanddunes in various-age pine timber forests (27, 52, 70, 105 and 150 years)
have been studied. Continental fresh coniferous forest Peucedano Pinetum
is a plant community dominant in the area . Number of species progressively increases with age of pine tree stands. In the youngest tree stand
369
Paulina Anna Rutkowska, Michał Jankowski
(27 years) only species such as Ptilium crista castrensis and Vaccinium vitisidaea were observed in undergrowth vegetation.With increasing age of pine
stands Deschampsia flexuosa, Vaccinium myrtillus and Convallaria majalis appear.
The development of soil organic horizons is also associated with growth of
pine trees and leads to mor type of humus formation. After ca. 100 years
since planting pines the full sequence of subhorizons (Ol-Of-Oh) is developed in these horizons.
Key words: undergrowth vegetation, pine tree stands, organic horizon, mor
type of humus, pine timber forest
Wstęp
Gleby obszarów wydmowych w Kotlinie Toruńskiej są wykorzystywane głównie pod uprawy lasów sosnowych w 100- 150-letnim cyklu
produkcyjnym [Jankowski i Bednarek 2002, Jankowski 2003]. Na obszarze tym gospodarka leśna jest prowadzona co najmniej od połowy
XIX wieku, wcześniej zaś stanowił on naturalna puszczę leśną. Mimo,
iż obecnie w Kotlinie Toruńskiej dominują nasadzone monokultury
sosnowe, ma tu miejsce pełna zgodność fitocenozy z siedliskiem
[Matuszkiewicz 1996, Matuszkiewicz i Matuszkiewicz 2005]. Dominującym zbiorowiskiem roślinnym jest subkontynentalny bór świeży
Peucedano-Pinetum w odmianie sarmackiej, należący do klasy Vaccinio-Piceatea [Matuszkiewicz i Matuszkiewicz 1996; Trampler i in.
1990; Matuszkiewicz 2005; Matuszkiewicz i in. 2012].
Przed nasadzeniem każdego nowego pokolenia sosny następuje
przygotowanie gleby przez przeoranie, które powoduje zmiany morfologii w górnych częściach profilu glebowego. Powtarzające się procesy
niszczenia i regeneracji, czynią rozwój gleb i roślinności zjawiskiem
cyklicznym [Jankowski i Bednarek 2002]. W wyniku wcześniejszych
badań chronosekwencji gleb przeprowadzonych przez Jankowskiego
i Bednarek [2002] oraz Jankowskiego [2003] w jednym z obszarów
wydmowych Kotliny Toruńskiej, zostały wyodrębnione trzy stadia
rozwojowe gleb związane z odpowiednimi etapami sukcesji roślinnej.
Antropogeniczne nasadzenia sosny są czynnikiem, który sprawia, iż
rozwój gleby przebiega z pominięciem pierwszego stadium, związanego z pionierską roślinnością murawową i rozpoczyna go stadium
wpółdojrzałe, bądź nawet dojrzałe, związane z roślinnością leśną.
370
Rozwój roslinności runa i poziomów organicznych...
Celem niniejszej pracy było prześledzenie zmian zachodzących
w odradzającym się runie leśnym oraz w poziomach organicznych
gleb powstałych w cyklu uprawy sosny na wydmach Kotliny Toruńskiej.
Materiały i metody
Badania przeprowadzono w Północnej Polsce, w południowo-wschodniej części Kotliny Toruńskiej, w pobliżu miejscowości Otłoczyn,
w lasach gospodarczych, gdzie bezwzględnie dominują monokultury sosnowe. Obszar badań stanowi teren wybitnie piaszczysty,
a wydmy w Kotlinie Toruńskiej tworzą jeden z największych obszarów wydmowych w Polsce i w Europie [Galon 1958]. W związku
z uprawą sosny cały teren lasów podzielony jest na oddziały, których
powierzchnia wynosi około 25 ha. W obrębie każdego z oddziałów
dodatkowo wydzielone zostały pododdziały, z których każdy porasta jednowiekowy drzewostan sosnowy. Na obszarze badań dominującym typem siedliskowym lasu jest bór świeży [Operat glebowosiedliskowy 2000], a dominującym typem gleb są gleby bielicowe
[Jankowski 2003].
Obiekty badawcze zlokalizowano na małej powierzchni (1 km2),
na stokach wydm o ekspozycji północnej, tak aby warunki środowiskowe były jak najbardziej jednorodne. Jedynym elementem
różnicującym badane powierzchnie był wiek drzewostanów, który ustalono na podstawie mapy przeglądowej Nadleśnictwa Gniewkowo,
obrębu Otłoczyn (stan na 1.01.2008).
Próbki pobrano z poziomów organicznych 5 profili glebowych
umiejscowionych w drzewostanach sosnowych w wieku: profil 1-27
lat, profil 2-52 lata, profil 3-70 lat, profil 4-105 lat, oraz profil 5-150
lat. Zostały one pobrane i opisane według standardowych procedur wykorzystywanych w gleboznawstwie [FAO 2006, PTG 2011].
W poszczególnych drzewostanach wykonano spis gatunków roślin,
występujących w otoczeniu profili glebowych na powierzchni około
100 m2, z uwzględnieniem nazewnictwa Rutkowskiego [1998].
Zawartość węgla organicznego i azotu ogółem oznaczono na autoanalizatorze Vario Max firmy Elementar. Wartości pH oznaczono
metodą potencjometryczną w H2O i w roztworze KCl o stężeniu 1
mol×
371
Paulina Anna Rutkowska, Michał Jankowski
Roślinność
Wiek drzewostanu w latach
27
52
70
105
150
Pinus sylvestris
+
+
+
+
+
Ptilium crista castrensis
+
+
+
+
+
Vaccinium vitis-idaea
+
+
+
+
+
+
+
+
Vaccinium myrtillus
Deschampsia flexuosa
+
+
+
+
Convallaria majalis
+
+
+
+
+
+
Betula pendula
+
Sorbus aucuparia
Quercus petraea
Calamagrostis epigeios
Juniperus communis
Prunus serotina
+
+
+
+
+
+
+
+
+
+
+
Ponadto, w drzewostanie 54-letnim zaobserwowano występowanie gatunku inwazyjnego Calamagrostis epigeios i światłożądnego Juniperus communis, a w drzewostanach powyżej 70 lat obecność pojedynczych krzewów Prunus serotina. Sporadyczne występowanie podrostu gatunków drzew, takich jak Betula pendula, Sorbus aucuparia,
Quercus petraea było obserwowane niezależnie od wieku dominującej
sosny (tab. 1).
Pomimo najbardziej zaawansowanego stopnia rozwoju, nawet
150-letni drzewostan, charakteryzował się ubogim pod względem
różnorodności gatunków słabo rozwiniętym runem w porównaniu z naturalnie wykształconym zespołem Peucedano-Pinetum [Matuszkiewicz i Matuszkiewicz 1996, Matuszkiewicz i in. 2012], co jak
zauważył Wojterski [1964 ] jest charakterystyczne dla drzewostanów
gospodarczych.
Rozwój poziomów organicznych gleb
Morfologia
Próchnica typu mor wykształca się pod wpływem roślinności borowej
i związana jest głównie z piaszczystymi glebami oligotroficznymi i
372
Rozwój roslinności runa i poziomów organicznych...
zniekształconymi przez gospodarkę leśną glebami mezotroficznymi
[Prusinkiewicz 1964, Plichta 1981, Klasyfikacji gleb leśnych Polski
2000, Dziadowiec 2004].
Już w glebie rozwijającej się pod najmłodszym, 27-letnim
drzewostanem wykształcony jest poziom organiczny o cechach
typowych dla próchnicy mor, charakteryzujący się niewielką
miąższością (4 cm). Pomimo tego można już zauważyć jego podział
na dwa podpoziomy: surowinowy Ol oraz butwinowy Of. Podobną
strukturę morfologiczną poziomu organicznego stwierdzono w glebie pod 52-letnim drzewostanem sosnowym. Cechą różnicującą jest
jego większa miąższość wynosząca 8,5 cm. Poziomy organiczne rozwijające się pod drzewostanem 27- jak i 52-letnim pod względem
morfologicznym nie odpowiadają w pełni wykształconemu typowi
próchnicy mor [Plichta 1981, Dziadowiec 2004]. Według Klasyfikacji
gleb leśnych Polski [2000] poziomy te reprezentują stadium rozwojowe semimor tego typu próchnicy.
W porównaniu z młodszymi glebami, w drzewostanie 70-letnim wzrasta miąższość poziomu organicznego, dochodząca do 14
cm. Wciąż widoczne są jednak zaburzenia przejawiające się w przewarstwieniach piasku w obrębie danego poziomu, najprawdopodobniej będące wynikiem dawnego przygotowania gleby pod uprawę
sosny. Sumaryczna miąższość przewarstwień wynosi 5cm. Pod
70-letnią sosną, na razie tylko w formie soczewek, pojawia się podpoziom epihumusowy Oh.
W dwóch najstarszych drzewostanach występuje już pełne
zróżnicowanie poziomu organicznego na podpoziomy (Ol - surowinowy, Of - butwinowy, Oh - epihumusowy). Jedynym morfologicznym elementem różnicującym była ich miąższość, która wynosiła odpowiednio 11 oraz 14 cm.
Uzyskane wyniki są zasadniczo zgodne z rezultatami
otrzymanymi przez innych autorów. Przykładowo Plichta [1981]
na obszarze Borów Tucholskich w gospodarczych drzewostanach
sosnowych w wieku 65-70 oraz 105 lat zaobserwował trójdzielne poziomy organiczne o miąższości 9 i 12 cm. Stützer [1997] stwierdził,
że w glebach zachodniej Jutlandii, w miarę wzrostu wieku drzewostanów miąższość poziomu organicznego zwiększała się około 1-1,5
cm w każdej dekadzie. Odmienne wyniki zaprezentował Fiedler i in.
373
Paulina Anna Rutkowska, Michał Jankowski
[1962] stwierdzając na powierzchni doświadczalnej powstanie po
upływie 50 lat poziomu organicznego o miąższości 6 cm. Rahmonow [1999] w naturalnym borze świeżym porastającym Pustynię
Błędowską, zaobserwował trójdzielny poziom organiczny (Ol-Of-Oh)
w drzewostanie 130-140 letnim, jednakże, do pełnego wykształcenia
podpoziomu epihumusowego potrzeba było około 200 lat.
Podstawowe właściwości chemiczne
Pod drzewostanami sosnowymi Kotliny Toruńskiej zawartość węgla
w poziomie organicznym waha się od 23% w podpoziomach epihumusowych (Oh) do 50% w podpoziomach surowinowych (Ol; tab.
2). Zawartość azotu mieści się w przedziale od 0,7 do 1,6%, a jego
największą zawartość stwierdzono w podpoziomie butwinowym (Of;
tab. 2). W podpoziomie surowinowym nie zaobserwowano zmian
zawartości materii organicznej wynikających z jego wieku. Zmiany
zawartości materii organicznej widoczne są natomiast w podpoziomie butwinowym oraz w pojawiającym się po około 100 latach
podpoziomie epihumusowym. Wraz ze wzrostem wieku drzewostanów zaobserwowano wzrost udziału węgla organicznego w podpoziomie butwinowym, z 30 do około 40 % (27-150 lat) oraz w podpoziomie epihumusowym, z 7 do 34 % (70-150 lat).
Tab. 2. Podstawowe właściwości chemiczne poziomów organicznych
Podpoziom
Ol
Of
Głębokość [cm]
4-3
3-0
Ol
8-7,5
Of
7,5-0
Profil 3- 70 lat
Ol
14-13
Of
13-6
Of/Oh
6-5
E/Oh
5-0
Ol
374
11-10,5
C [%]
N [%]
Profil 1- 27 lat
49,1
0,81
30,1
0,87
Profil 2- 52 lata
48,3
0,69
35,7
1,21
48,3
0,90
42,2
1,29
37,4
1,29
7,05
0,29
Profil 4- 105 lat
48,7
0,83
C/N
61
34
pH w
H2O
1 M KCl
4,2
3,9
3,5
3,2
70
30
4,2
4,1
3,5
2,9
54
33
29
25
4,3
3,4
3,3
3,7
3,7
2,6
2,6
2,8
59
4,3
3,6
Rozwój roslinności runa i poziomów organicznych...
Of
Oh
10,5-2
2-0
Ol
Of
Oh
14-13
13-3
3-0
39,7
23,4
1,53
1,03
Profil 5- 150 lat
49,3
1,21
39,4
1,58
34,1
1,32
26
23
3,8
3,7
3,0
2,9
41
25
26
4,3
3,7
3,5
3,5
2,9
2,6
Wszystkie badane gleby charakteryzują się szerokimi wartościami stosunku C/N, co świadczy o ich małej aktywności biologicznej. Najszerszy stosunek C/N stwierdzono w podpoziomach surowinowych (od 41 do 70). W całym poziomie organicznym wartości te
wahają się od 23 do 70. Wraz z rozwojem poziomu organicznego
w poszczególnych podpoziomach następuje nieznaczne zawężenie
wartości tego stosunku (tab. 2).
Odczyn poziomu organicznego zależy od stopnia humifikacji
próchnicy i ilości kwasów humusowych. Taka korelacja jest cechą
charakterystyczną dla próchnicy typu mor [Plichta 1981]. W analizowanych glebach odczyn jest kwaśny i silnie kwaśny w obrębie całego profilu glebowego. Wartości pH w badanych glebach wahają się od
3,3 do 4,3 w H2O i od 2,6 do 3,7 w roztworze KCl (tab. 2). Wartości
pH nie zależą od wieku drzewostanu ani od stopnia rozwoju poziomu
organicznego.
Wnioski
Odtwarzające się w 100-, 150-letniej uprawie sosnowej runo leśne
charakteryzuje się znacznie mniejszą liczbą gatunków w porównaniu
z lasem naturalnym. W efekcie cyklicznej uprawy sosny ekosystem
leśny nie osiąga pełnego i właściwego dla siebie stopnia rozwoju, co
jest wynikiem przerwania jego ewolucji w momencie zrębu, w wieku
100-150 lat.
Wyniki przeprowadzonych badań pozwalają na stwierdzenie,
iż poziom organiczny po około 100 latach od momentu nasadzenia
sosny ma już budowę charakterystyczną dla próchnicy typu mor.
Mimo morfologicznego wykształcenia wszystkich trzech podpoziomów (Ol-Of-Oh) jego miąższość wciąż zwiększa się, a w podpoziomach butwinowym (Of) i epihumusowym (Oh) cały czas ma miejsce
wzrost zawartości materii organicznej. Porównanie otrzymanych
375
Paulina Anna Rutkowska, Michał Jankowski
wyników z wynikami badań innych autorów pozwala na stwierdzenie,
że rozwój poziomu organicznego w drzewostanach gospodarczych
może przebiegać szybciej aniżeli w wyniku naturalnej sukcesji.
Bibliografia
Bednarz Z. Koczwańska J. 1976. Atlas roślin runa leśnego. Państwowe
Wydawnictwo Rolnicze i Leśne. Warszawa.
Dziadowiec H. 2004. Zasoby materii organicznej gleb i morfogenetyczne typy próchnic leśnych. [w:] Bednarek R. Dziadowiec H. Pokojska
U. Prusinkiewicz Z. Badania ekologiczno-gleboznawcze. Wyd. Nauk.
PWN. Warszawa, s. 154-163.
Fiedler H. J. Fiedler E. Hoffman F. Höhne H. Sauer G. Thomasius H. 1962.
Auswertung eines Streuntzungversuches von H. Vater aus dem Jahre
1912. Archiv f. Forstwesen. 11, 1. s. 70-28.
Galon R. 1958. Wydmy śródlądowe Polski, część II. Wyd. Nauk. PWN.
Warszawa, s. 7-59.
Guidelines for Soil Description. 2006. Fourth egition. FAO. Rome, Italy
Jankowski M. 2003. Historia rozwoju pokrywy glebowej obszarów wydmowych Kotliny Toruńskiej. Praca doktorska wykonana pod kierunkiem prof. dr hab. R. Bednarek, maszynopis w Katedrze Gleboznawstwa i Kształtowania Krajobrazu UMK. Toruń.
Jankowski M. Bednarek R. 2002. Secondary developmental stages of soils
formed on inland dunes under pine woodlands. Symposium no. 39. 17
WCSS, Bangkok, 2002.
Klasyfikacja gleb leśnych Polski. 2000. Centrum Informacji Lasów
Państwowych. Warszawa, s. 99-100.
Matuszkiewicz J. M. 2005. Zespoły leśne Polski. Wyd. Nauk. PWN.
Warszawa.
Matuszkiewicz W. Matuszkiewicz J. M. 1996. Przegląd fitosocjologiczny
zbiorowisk leśnych Polski. Phytocoenosis. vol. 8. (N.S.). WarszawaBiałowieża.
Matuszkiewicz W. Sikorski P. Szwed P. Wierzba M. 2012. Zbiorowiska
roślinne Polski. Lasy i zarośla. Ilustrowany przewodnik. Wyd. Nauk.
PWN. Warszawa.
Operat glebowo-siedliskowy. Nadleśnictwo Gniewkowo, Obręb Otłoczyn
2000, Regionalna Dyrekcja Lasów Państwowych w Toruniu.
Plichta W. 1981. Zagadnienie genezy, właściwości i klasyfikacji próchnicy
mor. UMK, Toruń.
Prusinkiewicz Z. 1964. Próchnica gleb leśnych. PTPN. 18, 3. s. 361-381.
376
Rozwój roslinności runa i poziomów organicznych...
Rahmonow O. 1999. Procesy zarastania Pustyni Błędowskiej. Uniwersytet
Śląski. Sosnowiec.
Rutkowski L. 1998. Klucz do oznaczania roślin naczyniowych Polski niżowej.
Wyd. Nauk. PWN. Warszawa.
Stützer A. 1998. Early stages of podzolization in young aeolian sediments,
western Jutland. Catena 32, s. 115-129.
Systematyka gleb Polski. 2011. Rocz. Glebozn. 63, 3. s. 47-104.
Trampler T. Kliczkowska A. Dmyterko E. Sierpińska A. 1990. Regionalizacja
przyrodniczo- leśna na podstawach ekologiczno- fizjograficznych. PWRiL. Warszawa.
Wojterski T. 1964. Bory sosnowe na wydmach nadmorskich na polskim
wybrzeżu. Poznańskie Towarzystwo Przyjaciół Nauk. Prace Komisji Biologicznej, 28, 2, Poznań.
Adres do korespondencji:
mgr Paulina Anna Rutkowska
Katedra Gleboznawstwa i Kształtowania Krajobrazu
Uniwersytet Mikołaja Kopernika w Toruniu
e-mail: [email protected]
dr hab. Michał Jankowski
Katedra Gleboznawstwa i Kształtowania Krajobrazu
Uniwersytet Mikołaja Kopernika w Toruniu
e-mail: [email protected]
Katedra Gleboznawstwa i Kształtowania Krajobrazu
WNoZi, UMK
ul. Lwowska 1, 87-100 Toruń
377
Elżbieta Kornalska
Izabella Majewska
Witold Trela
EPISTEME
22/2014, t. I
s. 379-387
ISSN 1895-2241
Structural diversification
of Polish agriculture
after accession to the European Union
Strukturalna deversyfikacja
gospodarki rolnej w polsce
po wstąpieniu do Unii Europejskiej
Abstrakt. Poland faces a crucial problem posed by the specificity of its
agriculture and rural areas, which require high investment outlays to make
them attractive for potential non-agricultural investors and to create decent
living conditions for farmers and their families. Agrarian overpopulation
and perceptible high degree of land fragmentation are characteristic features of Polish agriculture. An average farm area in 2004 was 8.4 ha, while
in 2010 - 10.38 ha. The paper aims to present the role of the EU assistance
programmes and their influence on transformation of agricultural farms
and rural areas.
Key words: rural areas, agricultural farms
Abstrakt. Polska stanęła w obliczu poważnego problemu wynikającego
z samej cpecyfiki jej rolnictwa i obszarów wiejskich, które wymagają wysokich nakładów inwestycyjnych, aby były atrakcyjne dla potencjalnych
inwestorów oraz gwarantowały godne warunki życia dla rolników i ich
rodzin. Agrarne przeludnienie i odczuwalny wysoki stopień rozdrobnienia gruntów są charakterystycznymi cechami polskiego rolnictwa. Średnia
powierzchnia gospodarstwa rolnego w 2004 r stanowiła 8,4 ha, natomiast
w roku 2010 - 10,38 ha. Celem artykułu jest przedstawienie roli programów
pomocowych UE i ich wpływ na przekształcenia gospodarstw rolnych i obszarów wiejskich.
Słowa kluczowe: obszary wiejskie, farmy
379
Elżbieta Kornalska, Izabella Majewska, Witold Trela
Introduction
Agriculture in Poland matters far more socially and economically than
in the other EU member states. Agriculture is an essential element of
the economy growth. It influences socio-economic processes, at the
same time being the area of impact for the whole economy. However, it does not mean that the condition of agricultural sector is on a
high level. Six of Polish voivodships with a considerable proportion
of agriculture in comparison to other sectors of economy are among
the poorest regions of the European Union1.
After starting the official endeavours for Poland’s acceptance by
the structures of the European Union (18 April 1994) agriculture became the object of the adjustment activities meant to help to fulfil
the integration requirements. Farmers gained the possibility to use
pre-accession funds, facilitating their farms adjustment to the European standards.
The interest in assistance programmes was very high, however
not free from fears of something “new or innovative”. A feeling of
confusion dominated among farmers, potential beneficiaries, who
were feeling lost in a multitude of measures offered by individual
programmes, which was mainly due to the procedures of the funds
acquisition.
Polish farmers gained access to the benefits of assistance programme offered in the framework of Common Agricultural Policy
(CAP) including: direct payments and accompanying measures under
the Rural Development Programme and Structural Funds, or Sector
Operational Programme (SOP).
Implementation of the SAPARD and other pre-accession programmes proved positive for the preparation of Poland’s membership in the EU.
Poland’s accession to the communities denoted allocating considerable funding not only to the agriculture itself, but also to rural
areas. In Poland these areas make up over 93% of the country territory.
1
FAMU, Policy of Development of Rural Areas, Current information and analyses, 2010
380
Structural diversification of Polish agriculture after...
The purpose of research, methods
The main objective of the study is to present the changes in agriculture that took place after the Polish accession to the EU. To present these changes were used SWOT analysis for Polish agriculture in terms
of the agri-food aspect, environmental aspects and socio-economic
aspects.
General characteristics of rural areas in Poland
In the Republic of Poland rural areas are defined as those situated
outside the administrative boundaries of towns and cities, which
means that these are rural gminas (communes) or rural parts of urban-rural gminas. Separating parts of urban-rural gminas, i.e. town
and rural area, which have different territorial identifiers allows for
accumulation and presentation of statistical data for the city and the
country. In justified cases, definition of rural areas may be extended
to comprise small urban units, strictly functionally connected with
rural areas2.
Poland is inhabited by over 38 million people, which constitutes 7.9% of the total European Union population. 38.6% of the total
population of Poland live rural areas3. It should be emphasized that
Poland has a considerable human potential, it occupies sixth position
in the EU considering the population number.
Rural localities differ greatly as to their population number:
15% have less than 100 inhabitants;
66% have between 100 and 500 inhabitants;
13% have between 500 and 1000 people
only 6% has a population exceeding 1000 people.
Proportion of rural population is diversified depending on regions: from 21.4% in the śląskie voivodship to 59.6% in the podkarpackie voivodship. A traditional rural family usually is an extended
family. Households composed of 5 or more persons account for
24.5% of all rural households, whereas in the cities they constitute
only 9.0%.
GUS, Studia i Analizy statystyczne, Obszary wiejskie w Polsce. Rural Areas in
Poland. Warszawa, Olsztyn 2011
3
EUROSTAT, http://epp.eurostat.ec.europa.eu/
2
381
Elżbieta Kornalska, Izabella Majewska, Witold Trela
From the economic, social and environmental perspective rural
areas are of significant importance. However, they need considerable
additional investment to make them attractive for potential nonagricultural investors and create decent living conditions for farmers
and their families. Rural Development Programme for 2004-2006
and Sectoral Operational Programme “Restructuring and modernization of food sector and rural development, 2004 -2006” together
with arable land payments, played a crucial role in transformation of
these areas in the first years after Poland’s accession to the EU. New
financial projections of RDP for the subsequent years 2007-2013
comprised many programmes targeting rural areas4.
From the beginning of its membership until November 2011 Poland received from the EU over 19 billion euro for supporting agriculture, rural development and fisheries policy5.
SWOT analysis of Polish agriculture
Strengths
Agri-food aspects
considerable land resources and resulting production potential;
multi branch character of agricultural production in the scale of
the country;
growing average agricultural farm area (diversified by regions);
advantageous conditions for the development of organic farming and other niche product farming.
Environmental aspects
slight pollution of soils and relatively good state of the environment, determining substantial possibilities of production of high
quality food;
high biodiversity of rural areas providing a basis for realization
of agri-environmental projects;
high tourism and environmental amenities of agricultural landscape.
Socio-economic aspects
Poczta W. Fabisiak A. Level and structure of allocation of European Agricultural
Found for Rural Development founds for Agricultural Sector in the Central and
Eastern European countries. Warszawa 2007.
5
ARiMR 2012, www. arimr.gov.pl
4
382
Structural diversification of Polish agriculture after...
dense settlement network
large human resources allowing for the development of nonagricultural activities.
Weaknesses
Agri-food aspects
low profitability of agricultural sector;
low level of capital and underinvestment of agricultural farms;
slow changes of farm area structure;
high proportion of poor and acidified soils;
discontinuing of production on large area of arable lands.
Environmental aspects
low water resources;
insufficient level of identification of biodiversity resources in
rural areas (lack of national inventory of fauna and flora resources
and habitats; the data available focus on selected groups of fauna and
flora);
strong soil acidification.
Socio-economic aspects
poorly developed technical and social infrastructure in rural areas (different in various regions);
an excess of labour force and high unemployment;
poor occupational mobility of rural dwellers;
low level of education of rural inhabitants, including farmers;
poorly developed network of services for rural communities.
ket;
Opportunities
Agri-food aspects
open access of agricultural products to European Common Mar-
possibility of trading with the third countries;
increasing purchasing power of consumers resulting from economic growth, generating demand for processed and niche foodstuffs;
forming of a group of economically viable farms;
young labour force on the labour market.
Environmental aspects
maintaining a high biodiversity of rural areas, determining their
383
Elżbieta Kornalska, Izabella Majewska, Witold Trela
great tourism amenities and natural values of the agricultural landscape.
Socio-economic aspects
heightened interest in rural areas as a dwelling place and place
for spending spare time among the inhabitants of Poland and other
European Union countries;
young labour force on the labour market;
increase in the number of bottom-up initiatives;
development of small towns which are the centres and place of
employment for rural area inhabitants.
Threats
Agri-food aspects
barriers to trading with the third countries;
competitive pressure;
Environmental aspects
irrational farming policy leading to increased pollution of the
environment.
Socio-economic aspects
growing poverty and social exclusion in rural areas;
limited possibilities of diversification of employment of persons
who quit farming because of a slow economic growth rate;
slowing down of development due to deficiencies in the infrastructure.
Transformations of farm area structure
In Poland, like in the other southern countries and unlike the
northern or western EU countries, small farms (below 10 ha AL) prevail.
In 2004 average agricultural farm area in Poland was 9.4 ha. Average farm area in individual voivodships deviated of the average area
by 4.24ha. On the other hand, in 2010 mean farm area was 10.38ha6.
Assessment of the transformation requires the correct relations
between labour, land and capital on the farm level, since it constitutes the basic symptom of potential competitiveness. Perceptible
Użytkowanie gruntów, powierzchnia zasiewów i pogłowie zwierząt gospodarskich
w 2011 roku, GUS, Warszawa 2011.
6
384
Structural diversification of Polish agriculture after...
changes in agricultural farm area structure have occurred since 2004;
total number of farms decreased from 2933 thousand to 2278
thousand, i.e. by 655 thousand (22.3%) and the loss concerned both
agricultural parcels (farms below 1 ha AL) and the farms over 1 ha
AL,
structural changes were significantly diversified in respective
farm area groups;
the number of agricultural farms in the 1-2 ha AL area group
changed the most, i.e. by over 1/3, and a dynamic decline in their
number resulted from the fact that some parts of lands belonging to
these farms were not covered by direct payment system because of
difficulties in documenting agricultural activities pursued on at least
1 ha AL on farms from the 1-2 ha AL area group;
in 2-15ha AL area group the number of farms diminished in the
17 to 18% range;
only slightly slower , i.e. by 14.3% the number of farms was
dwindling in the 15-20ha AL area group;
a significantly lower decrease in the number of farms was registered in the 20-30ha AL area group (4.3%);
increase in the number of farms occurred only in the area groups
of over 30ha AL, however in case of 30-50 ha farms it reached 12.5%,
whereas the number of farms bigger than 50ha increased in 20042010 by over 40%.
Summary
The decrease concerns agricultural farms from the area groups facing
difficulties in reaching income parity and opportunities for development, whereas an increase occurs in these area groups where proper
income guarantees the proper fulfilment of the consumption (income parity level) and productive function (development of farms – realization of net investments)7.
From the perspective of structural changes, particularly their influence on competitive potential, land use structure by farms from
Sikorska A. Wrzochalska A. Chmieliński P., Common Agricultural Policy and
regional diversification of Polish farming, [w:] The structural changes in the Rural
Areas and Agriculture in the selected European Countries, no. 128.1, Institute of
Agricultural and Food Economics, National Research Institute,Warsaw 2009
7
385
Elżbieta Kornalska, Izabella Majewska, Witold Trela
respective area groups is of greater importance than the structure of
agricultural farms. Changes which occurred at that period are coincidental with changes in agricultural farms area structure. A substantial depletion of arable lands occurred on the smallest farms (1-2ha),
whereas the largest increase was observed for larger farms, of more
than 30ha AL.
The analysis of agricultural farm area structure transformations
and land use structure according to area group, points to a positive
direction of changes, since the importance of large area farms increases and they accumulate a higher percentage of AL.
Moreover, changes in the area structure usually positively affect
processes of concentration and specialization of agricultural farms.
In Poland, like in highly developed countries, the share of agriculture in production resources and goods manufacturing diminishes according to a general and social approach.
However, it does not mean that the social importance of this
sector lessens, on the contrary.
Ensuring food safety and supply of public goods which are not
directly connected with food manufacturing is commonly accepted
by economic policies of highly developed countries and constitutes
one of the basic premises justifying supporting agriculture from public funds. Ensuring food safety by agriculture in future and providing
public goods require development of agriculture which will not be
possible without its structural changes8.
Encompassing Polish agriculture with CAP mechanisms led to
a moderate increase in production and definite increase in the incomes of this sector. During the pre-accession period (1999-2003)
mean annual income level was about 10.2 billion zlotys, whereas
during the post-accession period (2004-2010) it grew to the mean
annual level of 21.9 billion zlotys (real incomes of agriculture were
by 114.4% higher). The cause of the dynamic increase in farmers’
incomes were the subsidies made possible by their participation in
CAP at the simultaneous lack of any significant growth of burdens
to agriculture. Until 2004 subsidies constituted about 9% of farmers’
The 2009 European Growth and Jobs Monitor: Indicators of Success in the
Knowledge Economy, Allianz Economic Research & Development, Frankfurt/Main
2009.
8
386
Structural diversification of Polish agriculture after...
incomes, whereas during the post-accession period the share was on
the level between 50.2 and 60%.
In the opinion of economists specializing in agricultural economics, farmers using CAP assistance funds and Structural Funds
contribute to faster modernisation and restructuring of the agricultural sector, which will further translate into dynamic development
and equalizing development opportunities of Polish agriculture, like
the agriculture of the Western and Southern Europe.
References:
FAMU, Policy of Development of Rural Areas, Current information and
analyses, 2010.
GUS, Studia i Analizy statystyczne, Obszary wiejskie w Polsce. Rural Areas
in Poland. Warszawa, Olsztyn 2011
Poczta W. Fabisiak A. Level and structure of allocation of European Agricultural Found for Rural Development founds for Agricultural Sector in
the Central and Eastern European countries. Warszawa 2007.
Sikorska A. Wrzochalska A. Chmieliński P., Common Agricultural Policy and
regional diversification of Polish farming, [w:] The structural changes
in the Rural Areas and Agriculture in the selected European Countries,
no. 128.1, Institute of Agricultural and Food Economics, National Research Institute,Warsaw 2009.
The 2009 European Growth and Jobs Monitor: Indicators of Success in
the Knowledge Economy, Allianz Economic Research & Development,
Frankfurt/Main 2009.
Użytkowanie gruntów, powierzchnia zasiewów i pogłowie zwierząt gospodarskich w 2011 roku, GUS, Warszawa 2011
EUROSTAT, http://epp.eurostat.ec.europa.eu/
ARiMR 2012, www. arimr.gov.pl
Adres do korespondencji:
Mgr inż. Elżbieta Kornalska
Mgr inż. Izabella Majewska
Mgr inż. Witold Trela
Uniwersytet Rolniczy w Krakowie
387
Izabella Majewska
Witold Trela
Elżbieta Kornalska
Opiekun naukowy: dr hab. inż. Jerzy Cieślik
EPISTEME
22/2014, t. I
s. 389-395
ISSN 1895-2241
WSPÓŁPRACA Z MEDIAMI A TWORZENIE
WIZERUNKU UCZELNI NA PRZYKŁADZIE
UNIWERSYTETU ROLNICZEGO W KRAKOWIE
COOPERATION WITH THE MEDIA AND CREATING
THE IMAGE OF UNIVERSITIES ON THE EXAMPLE
OF UNIVERSITY OF AGRICULTURE IN KRAKOW
Abstrakt. Środki masowego przekazu odgrywają ważną rolę w kreowaniu
wizerunku uczelni wyższych. Stanowią też istotny składnik skutecznych
kampanii marketingowych. Zapewnienie szerokiej obecności w mediach wpływa na budowę świadomości marki i jej wizerunku w otoczeniu.
Głównym zadaniem działań public relations jest promocja osiągnięć
i sukcesów jednostki naukowo-badawczej jaką jest szkoła wyższa i kreowanie jej pozytywnego wizerunku w otoczeniu. Celem opracowania jest przedstawienie wpływu działań media relations na wizerunek Uniwersytetu Rolniczego w Krakowie. W opracowaniu analizie poddano ilość doniesień medialnych z podziałem na ich rodzaj, profil oraz zasięg w latach 2012 i 2013.
Słowa kluczowe: media, public relations, wizerunek uczelni
Summary. The mass media play an important role in the creation of the
image of universities. They are also an important component of an effective marketing campaign. Assurance a wide presence in the media affects
the construction of brand awareness and its image. The main task of public
relations activities is to promote the successes of the scientific research unit
which is a school of higher education and creating a positive image of it. The
objective is to present the impact of media relations for the image of the
University of Agriculture in Krakow. In the development of the number of
media reports were analysed according to their type, profile and reach in the
years 2012 and 2013.
Key words: media, public relations, the image of the University
389
Izabella Majewska, Witold Trela, Elżbieta Kornalska
Wstęp
Działania media relations stanowią istotne wsparcie w procesie komunikacji uczelni z otoczeniem oraz dotarciu do określonych grup
docelowych. Działalność w zakresie relacji z mediami ma za zadanie
pozytywnie wpływać na wizerunek, prestiż, a także proces budowania zaufania do marki jaką stanowi Uniwersytet Rolniczy w Krakowie.
Odbiorcami wewnętrznymi działań w zakresie public relations są
pracownicy uczeni, studenci, natomiast odbiorcami zewnętrznymikandydaci na studia, ich rodziny, cała społeczność lokalna, władze
samorządowe czy instytucje współpracujące. Media stanowią jeden
z kanałów dotarcia do wymienionych grup docelowych.
W obliczu niżu demograficznego, wizerunek uczelni ma znaczenie strategiczne dla przyszłości uczelni. Według prognoz raportu Demograficzne Tsunami opracowanego przez Instytut Sokratesa liczba
osób w wieku 19-24 lat zmniejszy się z 3,37 mln w 2010 roku do
2,32 mln w roku 2020 (Sokratesa, 2011). Spadek wyniesie więc aż
31%, to z kolei oznacza, że o blisko jedną trzecią spadnie liczba potencjalnych studentów. To spowoduje wzrost konkurencji ze strony
uczelni wyższych i zwiększenie zakresu działań promocyjnych.
Media w dzisiejszych czasach stanowią niezbędny składnik skutecznych kampanii marketingowych. Pojawienie się w mediach jest
możliwe nie tylko poprzez wykupywanie powierzchni reklamowej,
lecz również poprzez inspirowanie nieodpłatnych publikacji redakcyjnych na temat oferowanych produktów czy usług. Nieodpłatne doniesienia medialne mają największą wartość, ponieważ nie są
obarczone elementem nieufności, jak to jest w przypadku płatnych
kreacji reklamowych - np. artykułów sponsorowanych.
Materiał i metody
W niniejszym opracowaniu posłużono sie danymi zaczerpniętymi
z Instytutu Monitorowania Mediów (IMM) na temat obecności
Uniwersytetu Rolniczego w Krakowie w prasie, mediach społecznościowych i Internecie w latach 2012 i 2013. Dodatkowym źródłem
informacji były publikacje i literatura z zakresu komunikowania się
i zarządzania wizerunkiem firmy.
W niniejszym opracowaniu zastosowano metodę badawczą opisową, porównawczą oraz analizę przyczynowo skutkową.
390
Wpółpraca z mediami a tworzenie wizerunku uczelni na przykładzie...
Wyniki i dyskusja
Komunikacja marketingowa odgrywa istotną rolę w budowaniu wizerunku uczelni. Wynika to ze specyficznego i niematerialnego charakteru usług edukacyjnych, a także trudności z pozyskaniem jej
odbiorców i dużego uzależnienia od otoczenia. Wizerunek stanowi subiektywne wyobrażenie na temat uczelni, jej oferty, badań naukowych
i in. powstały na podstawie konfrontacji komunikatów wysyłanych z
uczelni z informacjami pochodzącymi z innych źródeł - krajowych i lokalnych środków masowego przekazu, rodziny, znajomych i in.
Na wizerunek uczelni ma wpływ szereg czynników mieszczących
się w wielu obszarach (E. Stachura, 2006). Obok jakości kształcenia
(kwalifikacji kadry, osiągnięć naukowych, uzyskanych akredytacji
i certyfikatów), ważna jest też siedziba uczelni (budynki, wyposażenie lokalizacja), pozycja w rankingach, kontakty i współpraca zagraniczna, relacje z otoczeniem gospodarczym, przyjazna atmosfera studiowania, koszty studiów czy pomoc materialna. Tworzenie
pozytywnego wizerunku uczelni w dużej mierze uzależnione jest
od właściwie skonstruowanych przekazów medialnych, będących
kanałem komunikacji między uczelnią a otoczeniem zewnętrznym.
W rankingu najbardziej opiniotwórczych mediów w 2012 roku,
opublikowanym przez Instytut Monitorowania Mediów (Instytut,
2013) pierwsze miejsce zajęła Gazeta Wyborcza, kolejne miejsce
zajęła Rzeczpospolita, a trzecie miejsce zajął Dziennik Gazeta Prawna. Wśród piętnastu najczęściej cytowanych mediów znalazło się aż
10 tytułów prasowych (oprócz wymienionych wysokie pozycje zajęły
- Wprost, Newsweek, Polityka, Super Express, Fakt, Gazeta Polska
Codziennie i Puls Biznesu), dwie stacje telewizyjne - TVN 24 i TVN
oraz trzy stacje radiowe - RMF FM, Tok FM, Radio Zet.
Instytut Monitorowania Mediów (IMM) monitoruje ponad
1000 tytułów prasowych, ponad 200 tys. domen (Internet i social
media). W okresie poddanym badaniu pojawiło się łącznie 8712 doniesień medialnych (4617 w roku 2012 i 4095 w roku 2013) na temat
Uniwersytetu Rolniczego im. Hugona Kołłątaja w Krakowie. W roku
2012 - 79,4 % publikacji znalazło się w Internecie, a 20,6 % w prasie.
W roku 2013 w Internecie znalazło się 77,4 % publikacji, a 22,6%
w prasie. Jest to wynikiem konsolidacji wydawnictw prasowych
i wzrastającej popularności internetowych witryn informacyjnych.
391
Izabella Majewska, Witold Trela, Elżbieta Kornalska
Ryc. 1. Liczba publikacji na temat Uniwersytetu Rolniczego w Krakowie
z podziałem na media
Źródło: Opracowanie własne na podstawie danych uzyskanych z Instytutu
Monitorowania Mediów dla Uniwersytetu Rolniczego w Krakowie
Najwięcej artykułów medialnych zaobserwowano w okresie od
marca do czerwca. Ma to związek między innymi ze wzmożonymi
działaniami promocyjnymi w zakresie rekrutacji na studia oraz organizowanymi wydarzeniami ogólnouczelnianymi. W roku 2012
najwięcej doniesień medialnych zaobserwowano w listopadzie
ze względu na zaistniałą sytuację kryzysową, związaną z jednym
z pracowników naukowych uczelni. W tym miesiącu wydźwięk materiałów w przeważającej części miał charakter neutralny (49,15%),
w dalszej kolejności negatywny (39,55%) i pozytywny (11,3%) (Instytut, 2012).
Ryc. 2. Liczba publikacji na temat Uniwersytetu Rolniczego w Krakowie
z podziałem na profil
Źródło: Opracowanie własne na podstawie danych uzyskanych z Instytutu
Monitorowania Mediów dla Uniwersytetu Rolniczego w Krakowie
392
Wpółpraca z mediami a tworzenie wizerunku uczelni na przykładzie...
W analizowanym okresie, publikacje na temat Uniwersytetu Rolniczego występowały aż w 15 profilach tematycznych. Zaobserwowano, iż najwięcej doniesień medialnych, w których pojawiło się hasłoUniwersytet Rolniczy w Krakowie znalazło się w przekazach o profilu ogólnoinformacyjnym (2915 w 2012 r. i 2622 w 2013 r.), dalsze miejsce zajmowały inne pozycje (609 w 2012 r. i 479 w 2013 r.),
z zakresu finansów, prawa i ubezpieczeń (419 w 2012 r. i 311 w 2013
r.), rolnictwa i ekologii (240 w 2012 r. i 305 w 2013 r.) oraz edukacji
(321 w 2012 r. i 200 w 2013 r.).
Analizując obecność Uniwersytetu Rolniczego w mediach,
bardzo istotny czynnik stanowi zakres dotarcia do potencjalnych
czytelników. Z tego powodu niezwykle istotny jest kontakt z Polską
Agencją Prasową (PAP) i Informacyjną Agencją Radiową (IAR). Są to
największe agencje informacyjne w Polsce, przekazujące obiektywne
informacje z kraju i ze świata. Z ich serwisów informacyjnych
korzystają zarówno media, jak też urzędy państwowe, instytucje oraz
przedsiębiorcy.
Ryc. 3. Liczba publikacji na temat Uniwersytetu Rolniczego w Krakowie
z podziałem na zasięg
Źródło: Opracowanie własne na podstawie danych uzyskanych z Instytutu
Monitorowania Mediów dla Uniwersytetu Rolniczego w Krakowie
W analizowanym okresie najwięcej publikacji miało zasięg
ogólnokrajowy (4010 w 2012 r. i 3521 w 2013 r.) oraz regionalny
(531 w 2012 r. i 457 w 2013 r.). Najmniej publikacji było w zasięgu
lokalnym (74 w 2012 r. i 115 w 2013 r.). Dane te świadczą o szerokim
zakresie informacji medialnej i dotarciu do grup odbiorców zlokalizowanych nie tylko w regionie, ale też na terenie całej Polski.
393
Izabella Majewska, Witold Trela, Elżbieta Kornalska
Wnioski
W okresie od stycznia 2012 roku do grudnia 2013 roku ukazało
się łącznie 8712 artykułów i doniesień prasowych i internetowych.
Wynika z tego, że w badanym okresie dziennie ukazywało się średnio prawie 12 wzmianek na temat Uczelni (z uwzględnieniem dni
wolnych od pracy).
Zakres tematyczny artykułów i wywiadów medialnych, w których
wzmiankowany był Uniwersytet Rolniczy w Krakowie dotyczył
głównie działań rekrutacyjno-promocyjnych, ale również nowości
w systemie szkolnictwa wyższego, spraw socjalnych, domów studenckich, współpracy Uczelni z biznesem, niżu demograficznego, inicjatyw związanych ze szkolnictwem wyższym. Duży udział
artykułów stanowiły również wypowiedzi eksperckie i artykuły
o charakterze naukowym z realizacji przeprowadzanych przez pracowników badań naukowych.
W relacjach z mediami bardzo ważne jest budowanie długotrwałych więzi z dziennikarzami poprzez stałe dostarczanie informacji prasowych i przekazywanie rzetelnych informacji. Należy pamiętać o tym, że dziennikarze codziennie otrzymują szereg informacji z różnych źródeł. Zadaniem rzecznika prasowego jest więc umiejętne przekazanie informacji w atrakcyjnej formie, która wzbudziłaby zainteresowanie dziennikarzy. W działaniach public relations nie
powinno się tworzyć bariery między mediami a instytucją, a starać
się być pomostem, po którym informacje mogą się poruszać w obie
strony (S. Black, 1998).
Nie można zapominać, że media nie reklamują, lecz informują na
temat bieżących wydarzeń z kraju i ze świata. Dlatego w ich przekazach znajdują się zarówno informacje pozytywne, jak i negatywne.
Bardzo cenne dla dziennikarzy są informacje na temat wynalazków
i ich społecznej użyteczności oraz innowacyjnych badań naukowych
i kierunków studiów.
Sprawne działania z zakresu media relations mogą zapewnić
Uczelni prestiż, pozytywny rozgłos, a także wpływać na budowę
trwałego i długofalowego zaufania docelowych odbiorców oraz
eksperckiego wizerunku przedstawicieli uczelni w kraju i na świecie.
394
Wpółpraca z mediami a tworzenie wizerunku uczelni na przykładzie...
BIBLIOGRAFIA
E. Stachura, Elementy wizerunku szkoły wyższej. Marketingowe zarządzanie
szkołą wyższą pod red G. Nowaczyk, P. Lisiecki, Poznań 2006, s. 361
Instytut Monitorowania Mediów, Najbardziej opiniotwórcze polskie media
w 2012 roku. Warszawa 2013
Instytut Monitorowania Mediów, Miesięczne analizy ilościowo-jakościowe
na podstawie publikacji z okresu od 01.01.2012 do 31.12.2012
i 01.01.2013 do 31.12.2013, 2012
Instytut Sokratesa, Instytut Rozwoju Kapitału Intelektualnego im. Sokratesa, Demograficzne Tsunami. Warszawa (2011).
S. Black, Public Relations. Dom Wydawniczy ABC, Warszawa 1998
Adres do korespondencji:
mgr inż. Izabella Majewska
e-mail: [email protected]
mgr inż. Witold Trela
e-mail: [email protected]
mgr inż. Elżbieta Kornalska
e-mail: [email protected]
Katedra Zarządzania i Marketingu w Agrobiznesie
Uniwersytet rolniczy im. Hugona Kołłątaja w Krakowie
395
Witold Trela
Izabella Majewska
Elżbieta Kornalska
EPISTEME
22/2014, t. I
s. 397-407
ISSN 1895-2241
Działania innowacyjne
w polskich przedsiębiorstwach
przemysłowych i usługowych
innovative actions
in Polish industrial and service companies
Abstrakt. W XXI wieku podstawowymi źródłami wzrostu gospodarczego kraju i organizacji w nim funkcjonujących stają się wiedza i innowacje.
Innowacyjność jest niezbędna, by prosperować w dzisiejszej bardzo konkurencyjnej gospodarce światowej. Zakres, w jakim wiedza i innowacje są
zmaterializowane w wytwarzanych produktach jest wyznacznikiem procesu
kształtowania nowej globalnej gospodarki opartej na wiedzy. Artykuł przedstawia różne definicje innowacji, charakteryzuje działalność innowacyjną
polskich przedsiębiorstw przemysłowych i usługowych.
Słowa kluczowe: innowacje, wiedza, gospodarka globalna, przedsiębiorstwa
przemysłowe, przedsiębiorstwa usługowe
Summary. In the XXI century, the basic sources of economic growth of
the country and its organizations are functioning knowledge and innovation. Innovation is necessary to thrive in today’s highly competitive global
economy. The extent to which knowledge and innovation are materialized
in the products it is an indicator of the process of shaping the new global
knowledge-based economy. The article presents the different definitions of
innovation, innovation has Polish industrial and service enterprises.
Key words: innovation, knowledge, global economy, industrial companies, service companies
397
Witold Trela, Izabella Majewska, Elżbieta Kornalska
Wprowadzenie
W teorii ekonomii istnieje wiele definicji innowacji. Definiowana jest
ona m.in. jako proces „uczenia się”. Oznacza to, że innowacja jest
wynikiem akumulacji „specyficznej wiedzy i informacji użytecznej
dla przedsiębiorstwa1”.
Zainteresowanie nauki innowacjami rozpoczęło się w latach
czterdziestych – pięćdziesiątych XX wieku, chociaż pojęcie innowacji
do literatury ekonomicznej wprowadził już w 1911 roku J.A. Schumpeter. Zainteresowanie to spowodowane było zmianą myślenia
o rozwoju społecznym i gospodarczym. Nastąpiła stopniowa dewaloryzacja tradycyjnego podejścia do przedsiębiorstwa jako instytucji
przynoszącej zysk jej właścicielom. Nowe podejście wskazywało na
podstawową rolę przedsiębiorstw w generowaniu rozwoju2.
Pierwszy raz pojęcie innowacji do nauk ekonomicznych
wprowadził J.A. Schumpeter. Pod względem przedmiotowym określał
pojęcie innowacji bardzo szeroko. Według niego obejmuje ona:
wprowadzenie nowego towaru, (z jakim konsumenci nie mieli jeszcze
do czynienia, lub nowej odmiany towaru),
wprowadzenie nowej metody produkcji (nie wypróbowanej w danej
dziedzinie przemysłu),
otwarcie nowego rynku, (na którym dany rodzaj krajowego przemysłu
uprzednio nie działał i to bez względu),
zdobycie nowego źródła surowców lub półfabrykatów (niezależnie od
tego, czy źródło już istniało, czy też musiało być stworzone w przyszłości),
wprowadzenie nowej organizacji 3.
Wiele definicji innowacji powstało również w Polsce. Badania
nad tym zagadnieniem intensywniej zaczęły rozwijać się pod koniec
lat sześćdziesiątych XX wieku, jednak w gospodarce centralnie planowanej problematyka ta z powodu braku autentycznych mechanizmów rynkowych była rozpatrywana przede wszystkim w aspekcie
technicznym. Do polskich badaczy zajmujących się tą problematyką
w tym okresie możemy zaliczyć: K. Wandelta, J. Czupiała, L. PiaseczMatusiak K.B. (red) Innowacje i transfer technologii. Słownik pojęć, red. K.B. Matusiak, Warszawa 2005.
2
Bielski I., Przebieg i uwarunkowania procesów innowacyjnych, OPO, Bydgoszcz
2000.
3
Schumpeter J.A., Teoria rozwoju gospodarczego, PWN, Warszawa 1960.
1
398
Działania innowacyjne w polskich przedsiębiorstwach przemysłowych i usługowych
nego, J. Więckowskiego, B. Fiedora, S. Kasprzyka, L. Białonia, Z. Pietrusińskiego, W. Sprucha oraz Z. Madeja4.
Zdaniem P.F. Druckera: „Nie potrafimy jeszcze opracować teorii
innowacji. Wiemy już dostatecznie wiele, by móc stwierdzić, kiedy,
gdzie i jak szuka się w systematyczny sposób okazji do innowacji oraz
w jaki sposób ocenia się szanse ich powodzenia oraz ryzyko w przypadku niepowodzenia. Wiemy wystarczająco dużo by opracować, choć
w zarysie praktykę innowacji”5.
Według terminologii OECD działalność innowacyjna to szereg
działań o charakterze naukowym (badawczym), technicznym, organizacyjnym, finansowym i handlowym, których celem jest opracowanie i wdrożenie nowych lub istotnie ulepszonych produktów i procesów6.
Przy czym nie każde nowe rozwiązanie jest innowacją, dopóki nie
ma ono praktycznego zastosowania. Innowacja może mieć charakter
techniczny, marketingowy, organizacyjny lub procesowy7. Innowację
będziemy rozpatrywać jako jest to wdrożenie w praktyce gospodarczej nowego albo znacząco udoskonalonego produktu, usługi lub procesu, w tym także wdrożenie nowej metody marketingowej lub organizacyjnej redefiniującej sposób pracy lub relacje firmy z otoczeniem.
Powszechnie w praktyce gospodarczej wyróżnia się cztery typy
innowacji:
Innowacje technologiczne/techniczne. Często uważane za najważniejsze, ponieważ przynoszą największą wartość dodaną oraz
najwyższe dochody dla przedsiębiorstw. Są one jednak najbardziej
kosztowne. Bezpośrednio przyczyniają się do rozwoju produktów
i usług. Innowacje technologiczne w pełni bazują na wynikach prac
naukowych i działalności badawczej. Ten typ innowacji jest podstawą
dla innowacji organizacyjnych oraz procesowych.
Swiadek A., Wiśniewska J. (red.) Innowacje przyszłością rozwoju gospodarki, Szczecin 2013.
5
Drucker P. F., Innowacje i przedsiębiorczość. Praktyka i zasady, PWE, Warszawa
1992.
6
Stawasz E., Przegląd podstawowych pojęć: innowacje, transfer technologii, krajowy
i regionalny system innowacji, polityka innowacyjna, [w:] Instrumenty transferu
technologii i pobudzania innowacji.
7
www.oecd.org/science/inno/2101733.pdf.
4
399
Witold Trela, Izabella Majewska, Elżbieta Kornalska
Innowacje marketingowe. Dotyczą w głównej mierze sfery sprzedaży i dystrybucji dóbr. Mogą to być na przykład nowe opakowania,
nowe formy reklamy, jak również nowe strategie cenowe.
Innowacje organizacyjne. Polegają one na zmianie w sposobie funkcjonowania przedsiębiorstwa, zmianie organizacji pracy,
jak również organizacji zarządzania. Mogą one mieć charakter bez
kosztowy. Związane są z racjonalizacją organizacji lub dostosowaniem jej do zmieniających się przepisów prawa, czy wymogów rynku
lub klientów.
Innowacje procesowe. Są one powiązane z wprowadzeniem
innowacji technicznych. Dotyczą wprowadzenia zmian w procesie
produkcji, lub też procesie świadczenia usług.
Często wszystkie typy innowacji występują łącznie, najczęściej
w przedsiębiorstwach przemysłowych (wytwarzanie nowych produktów). W przedsiębiorstwach usługowych zastosowanie mają przede głównie innowacje organizacyjne oraz marketingowe.
Przedsiębiorstwo innowacyjne
Za przedsiębiorstwo innowacyjne stosując definicje E. Stawasza
uważa się, przedsiębiorstwo, które w badanym okresie (najczęściej
trzyletnim) wprowadziło przynajmniej jedną innowację techniczną
(technologiczną). Może to być nowy lub ulepszony produkt, proces,
będący nowością przynajmniej z punktu widzenia tegoż przedsiębiorstwa8.
W realiach współczesnego świata, w którym przepływ informacji
jest praktycznie nieograniczony firmy chcące podnieść swoją konkurencyjność, muszą stale dokonywać zmian technologicznych i technicznych. W takiej sytuacji wyodrębnianie z ogółu przedsiębiorstw
grona firm innowacyjnych nie zawsze jest uzasadnione, ponieważ
działalność innowacyjna wpisana jest w działalność gospodarczą.
Zapewnia ona firmom przetrwanie i skuteczną odpowiedź na zmiany
zachodzące na konkurencyjnym rynku. Parafrazując słowa Druckera „innowacja jest szczególnym narzędziem przedsiębiorców, za pomocą którego ze zmiany czynią okazję do podjęcia nowej działalności
Stawasz E., Przedsiębiorstwo innowacyjne w: Innowacje i transfer technologii –
Słownik pojęć, K.B. Matusiak (red.),PARP, Warszawa 2005.
8
400
Działania innowacyjne w polskich przedsiębiorstwach przemysłowych i usługowych
gospodarczej lub do świadczenia nowych usług”9. Pojecie to pojawia
się jednak coraz częściej w literaturze przedmiotu, tym samym przedstawienie jego składowych prezentowanych przez różnych autorów
wydaje się niezbędne.
Zdaniem A. Jasińskiego przedsiębiorstwo innowacyjne to takie,
które10:
prowadzi w szerokim zakresie prace badawczo – rozwojowe (lub
dokonuje zakupów nowych produktów czy technologii),
przeznacza na działalność innowacyjną wysokie nakłady finansowe,
wdraża nowe rozwiązania naukowo – techniczne,
reprezentuje duży udział nowości (wyrobów i technologii) w wolumenie produkcji i usług,
wprowadza innowacje na rynek.
Chcąc stosować się do definicji zaproponowanej przez A. Jasińskiego musimy wykluczyć z grona firm innowacyjnych przedsiębiorstwa, w których proces wprowadzania innowacji nie jest ciągły,
a jest tylko odpowiedzią na zmiany pojawiające się na rynku (pojawienie się nowej konkurencji, spadek popytu na oferowane produkty,
kryzys gospodarczy). Można również stwierdzić, iż zdarzenia te są
głównym procesów innowacyjnych w sektorze MŚP.
Definicja stworzone przez A. Sosnowska, S. Łobejko i A. Kłopotek uważają za firmę innowacyjną jako inteligentną organizację,
permanentnie generującą i realizującą innowacje, znajdującą uznanie
u odbiorców ze względu na wysoki poziom nowoczesności i konkurencyjności, a sposób i struktura zarządzania są dostosowane do
podstawowego zadania11. Autorzy wyróżniają za najważniejsze cechy
innowacyjnej firmy jako zdolność do permanentnego generowania
innowacji, umiejętności wykorzystania innowacyjnego potencjału
firmy, zdolności przewidywania przyszłości i utrzymania wysokiej
przewagi konkurencyjnej12.
Drucker P. F., Innowacja i przedsiębiorczość, praktyka i zasady, PWE, Warszawa
1992, s. 29.
10
Jasiński A.H., Przedsiębiorstwo innowacyjne na rynku, KiW, Warszawa 1992, s. 25.
11
Sosnowska A., Łobejko S., Kłopotek A., Zarządzanie firma innowacyjną, Diffin,
Warszawa 2000.
12
Ibidem.
9
401
Witold Trela, Izabella Majewska, Elżbieta Kornalska
Materiały i metody
Do przedstawienia innowacyjności polskich przedsiębiorstw
posłużono się danymi pochodzącymi z polskiego Głównego Urzędu Statystycznego za okres 2010-2012. Badanem pełnym objęte
były przedsiębiorstwa przemysłowe o liczbie pracujących 50 osób
i więcej. Jako próba reprezentacyjna posłużyła grupa przedsiębiorstw
przemysłowych, w których pracowało od 10-49 osób, jak również jednostki z sektora usług o liczbie pracujących 10 i więcej. W opracowaniu wykorzystano metodę porównawczą i syntezy.
Działalność innowacyjna przedsiębiorstw
Zakres, w jakim innowacje i wiedza są zmaterializowane w wytwarzanych produktach jest wyznacznikiem procesu kształtowania globalnej gospodarki opartej na wiedzy. Nowa innowacyjna gospodarka
jest efektem nie tylko wzrostu komputeryzacji działalności ludzkiej
i jej internetyzacji, umożliwiających gromadzenie, przetwarzanie
i wykorzystanie informacji na niespotykaną wcześniej skalę, ale również
zwiększenia intensywności konkurencji w skali krajowej i międzynarodowej oraz wzrostu znaczenia szeroko rozumianych innowacji.
Innowacyjne przedsiębiorstwa charakteryzują się dużym udziałem przeznaczanych środków na badania i rozwój.
Przedsiębiorstwa poddane badaniom rozpatrzono w dwóch ujęciach jako13:
Przedsiębiorstwo aktywne innowacyjnie to takie, które w badanym okresie wprowadziło przynajmniej jedną innowację produktową lub procesową lub realizowało w tym okresie przynajmniej
jeden projekt innowacyjny, który został przerwany lub zaniechany
w trakcie badanego okresu (niezakończony sukcesem) lub nie został
do końca tego okresu ukończony (tzn. jest kontynuowany).
Przedsiębiorstwo innowacyjne w zakresie innowacji produktowych i procesowych — jest to przedsiębiorstwo, które w badanym okresie wprowadziło na rynek przynajmniej jedną innowację
produktową lub procesową (nowy lub istotnie ulepszony produkt
bądź nowy lub istotnie ulepszony proces.
13
Rozkrut D. (red.) Działalność innowacyjna przedsiębiorstw w latach 2010-2012
GUS Warszawa, 2013.
402
Działania innowacyjne w polskich przedsiębiorstwach przemysłowych i usługowych
Tab. 1. Przedsiębiorstwa aktywne innowacyjnie (innowacyjne) w latach
2010-2012 według sektorów własności
Wyszczególnienie
Przedsiębiorstwa
przemysłowe %
Przedsiębiorstwa
usługowe %
Sektor przywatny
17,3 (16,2)
13,1 (11,8)
Sektor publiczny
25,4 (23,5)
39,6 (39,6)
Ogółem
17,7 (16,5)
13,9 (12,4)
Źródło: Główny Urząd Statystyczny
Biorąc pod uwagę przedsiębiorstwa aktywnie innowacyjnie
(innowacyjne) najwyższy odsetek aktywnych znalazł się w przedsiębiorstwach sektora publicznego w sektorze usług sięgając prawie 40%,
w porównaniu z 13,1% w sektorze prywatnym. Taki stan miał również miejsce w przedsiębiorstwach przemysłowych sektora publicznego (25.,4%) i prywatnego (17,3%). Bezpośrednim czynnikiem
wpływającym na prezentowany rozkład była wielkość przedsiębiorstw i indywidualna polityka rozwoju firm. Analiza pod kątem
bardziej restrykcyjnej definicji wskazuje, że udział innowacyjnych
przedsiębiorstw przemysłowych i z sektora usług w latach 2010-2012
wynosił odpowiednio 16,5 % i 12,4 %. Zarówno w przypadku odsetka
przedsiębiorstw przemysłowych aktywnych innowacyjnie, jak i innowacyjnych przodują duże firmy będące własnością publiczną.
Tab. 2. Przedsiębiorstwa aktywne innowacyjnie (innowacyjne) w latach
2010-2012 według liczby zatrudnionych.
Liczba zatrudnionych
Przedsiębiorstwa
przemysłowe (%)
Przedsiebiorstwa
usługowe (%)
10-49
10,4 (9,6)
10,9 (9,5)
50-249
31,4 (29,4)
22,9 (20,9)
250 <
59,3 (56,2)
48,4 (44,7)
Źródło: Główny Urząd Statystyczny
Uwzględniając wielkość przedsiębiorstw (wg liczby zatrudnionych) największy odsetek podmiotów aktywnych innowacyjnie
występował wśród jednostek o liczbie pracujących 250 osób i więcej
(59,3% dla przedsiębiorstw przemysłowych i 48,4% dla przedsię403
Witold Trela, Izabella Majewska, Elżbieta Kornalska
biorstw z sektora usług). Tab. 2 jednoznacznie przedstawia iż im
przedsiębiorstwo zatrudnia więcej osób tym podejmowane działania
innowacyjne są częstsze. Przedsiębiorstwa z sektora średnich (50249) i dużych (249 i więcej) inwestują w innowacyjne przedsięwzięcia,
które w przyszłości przyniosą ekonomicznie uzasadnione korzyści.
Firmy z sektora małych przedsiębiorstw niechętnie wprowadzają
działania innowacyjne. Udział innowacyjnych przedsiębiorstw jest
nieznacznie niższy od aktywnych innowacyjnie.
Tab. 3. Przedsiębiorstwa innowacyjne w latach według rodzajów innowacji
Innowacja
Przedsiębiorstwa
przemysłowe (%)
Przedsiebiorstwa
usługowe (%)
Produktowa
11,2
7
Procesowa
12,4
9,1
Produktowa i procesowa
7,1
3,8
Źródło: Główny Urząd Statystyczny
Najwyższy odsetek podmiotów, które wprowadziły innowacje
produktowe oraz procesowe, zarówno wśród przedsiębiorstw przemysłowych, jak i z sektora usług, wystąpił w sektorze publicznym.
Najczęściej innowacje procesowe wprowadzone przez przedsiębiorstwa przemysłowe w latach 2010-2012 dotyczyły nowych lub istotnie ulepszonych metod wytwarzania (produkcji) wyrobów i usług
(wdrożyło je, 12,4 % przedsiębiorstw), a w sektorze usług, nowych
lub istotnie ulepszonych metod i systemów wspierających procesy
w przedsiębiorstwie, takich jak systemy utrzymania (konserwacji),
systemy operacyjne związane z zakupami, rachunkowością, systemy
obliczeniowe 9%. Innowacje produktów wdrażało odpowiednio
11,2% i 7%.
Innowacja organizacyjna to wdrożenie nowej metody organizacyjnej w przyjętych przez przedsiębiorstwo zasadach działania
(w tym w zakresie zarządzania wiedzą – knowledge management),
w organizacji miejsca pracy lub stosunkach z otoczeniem, która nie
była dotychczas stosowana w danym przedsiębiorstwie.
404
Działania innowacyjne w polskich przedsiębiorstwach przemysłowych i usługowych
Tab. 4. Przedsiębiorstwa wprowadzające innowacje organizacyjne
i marketingowe wg liczby zatrudnionych
Liczba
zatrudnionych
Przedsiebiorstwa
przemysłowe (%)
Przedsiębiorstwa usługowe(%)
Innowacje
Innowacje
Innowacje
Innowacje
organizacyjne marketingowe organizacyjne marketingowe
10-49
6,5
7,6
8,3
9,5
50-249
15,4
13,7
17,8
15,9
250<
40,7
30,4
33,6
29,0
Źródło: Główny Urząd Statystyczny
Za innowacje marketingowe uznano wdrożenie nowej koncepcji
lub strategii marketingowej różniącej się znacząco od metod marketingowych dotychczas stosowanych w danym przedsiębiorstwie.
Innowacje marketingowe obejmują znaczące zmiany w projekcie/
konstrukcji produktów, dystrybucji produktów, opakowaniu, promocji produktów i kształtowaniu cen. Nie zalicza się do nich zmian
sezonowych, regularnych i innych rutynowych zmian w zakresie metod marketingowych. Głównym celem innowacji marketingowych
jest zaspokojenie potrzeb klientów, otwarcie nowych rynków zbytu,
uznaje się też nowe pozycjonowanie produktu przedsiębiorstwa na
rynku w celu zwiększenia sprzedaży14.
Ogółem w latach 2010-2012 w Polsce innowacje organizacyjne
wdrożyło 10,3% przedsiębiorstw przemysłowych oraz 10,5 % przedsiębiorstw z sektora usług. Najwyższy odsetek przedsiębiorstw, które wprowadziły innowacje organizacyjne odnotowano
w największych firmach w sektorze przedsiębiorstw (40,7%) i usług
(33.6%). Możemy zauważyć, iż firmy z MSP (10-249 pracowników)
nie wprowadzają organizacyjnych innowacji często zostając przy
niezmienionym systemie zarządzania. Innowacje marketingowe
wprowadzane były najczęściej w przedsiębiorstwach zatrudniających
ponad 250 pracowników jak również w średnich przedsiębiorstwach.
14
Rozkrut D. (red.) Działalność innowacyjna przedsiębiorstw w latach 2010-2012
GUS Warszawa, 2013.
405
Witold Trela, Izabella Majewska, Elżbieta Kornalska
Innowacje organizacyjne
stanowią czynnik wspierający
innowacje w obrębie produktów i procesów, ale same wywierają istotny wpływ na efektywność funkcjonowania przedsiębiorstw.
Przyczyniają się do podniesienia jakości i wydajności pracy. Często
intensyfikują wymianę informacji jak również zdolność firmy do uczenia się oraz wykorzystywania nowej wiedzy i nowych technologii.
Zakończenie
Jednym z najważniejszych czynników poprawy konkurencyjności
naszej gospodarki i tym samym pozycji naszego kraju w Europie
i świecie jest poprawa poziomu innowacyjności. Innowacyjność stała
się koniecznością, której nie można odkładać działań na później.
We współczesnej gospodarce przedsiębiorstwa nie mogą realizować
zysków tylko przy wykorzystaniu samych «tradycyjnych» czynników:
ziemi, kapitału i pracy.
Innowacje w gospodarce prowadzą do tworzenia nowych produktów, procesów, ulepszania technologii, nowych strategii marketingowych jak również zwiększania efektywności i konkurencyjności
poszczególnych przedsiębiorstw.
W celu poprawy innowacyjności polskich przedsiębiorstw należy
podjąć określone działania w skali przedsiębiorstw jak również całej
gospodarki poprzez; zwiększanie nakładów na sferę B+R wykorzystując środki pochodzące z funduszy własnych i zewnętrznych,
zwiększeniu zaangażowania sektora prywatnego w badania naukowe i prace rozwojowe. Nie uda się to bez zaangażowania rządu,
który powinien stwarzać optymalne warunki w zakresie polityki
innowacyjnej, które obejmować powinny tworzenie dobrego klimatu
dla innowacji, stymulacji popytu przedsiębiorstw na działania B+R
oraz podaż efektów wdrażanych przez naukę.
Bibliografia:
Bielski I., Przebieg i uwarunkowania procesów innowacyjnych, OPO, Bydgoszcz 2000
Drucker P. F., Innowacje i przedsiębiorczość. Praktyka i zasady, PWE,
Warszawa 1992
406
Działania innowacyjne w polskich przedsiębiorstwach przemysłowych i usługowych
Jasiński A. H., Przedsiębiorstwo innowacyjne na rynku, KiW, Warszawa
1992
Matusiak K. B. (red) Innowacje i transfer technologii. Słownik pojęć,
Warszawa 2005
Markowski, E. Stawasz, R. Zembaczyński, Warszawa 1997
Rozkrut D. (red.) Działalność innowacyjna przedsiębiorstw w latach 20102012 GUS Warszawa, 2013.
Schumpeter J. A., Teoria rozwoju gospodarczego, PWN, Warszawa 1960
Stawasz E., Przegląd podstawowych pojęć: innowacje, transfer technologii,
krajowy i regionalny system innowacji, polityka innowacyjna, [w:] Instrumenty transferu technologii i pobudzania innowacji
Swiadek A., Wiśniewska J. (red.) Innowacje przyszłością rozwoju gospodarki, Szczecin 2013
Sosnowska A. Łobejko S., Kłopotek A., Zarządzanie firma innowacyjną, Diffin, Warszawa 2000
http://www.oecd.org/science/inno/2101733.pdf
Adres do korespondencji:
Mgr inż. Witold Trela
Mgr inż. Izabella Majewska
Mgr inż. Elżbieta Kornalska
Uniwersytet Rolniczy w Krakowie
407
Witold Trela
Elżbieta Kornalska
Izabella Majewska
EPISTEME
22/2014, t. I
s. 409-418
ISSN 1895-2241
Development of organic farming
in Poland
Rozwój gospodarstw ekologicznych
w Polsce
Summary. In Poland, we note increasingly higher environmental awareness of consumers. Since 2003, the steadily growing number of certified organic farms in Poland. From year to year increases area of organic
​​
farming,
which is not associated with the growth-availability of organic products.
This article presents the status and development of organic farming in Poland in the years 2003-2012.
Key words: organic farming, farming system, development of organic farming
Abstrakt. W Polsce wzrasta wiadomość ekologiczna konsumentów. Od
2003 roku systematycznie rośnie liczba certyfikowanych gospodarstw ekologicznych w Polsce. Z roku na rok zwiększa się powierzchnia upraw ekologicznych, które nie jest związane ze wzrostem dostępności produktów
ekologicznych. W artykule przedstawiono stan i rozwój rolnictwa ekologicznego w Polsce w latach 2003-2012.
Słowa kluczowe: rolnictwo ekologiczne, rolnictwo, rozwój rolnictwa ekologicznego
409
Witold Trela, Elżbieta Kornalska, Izabella Majewska
1. Introduction
The ecological crisis in the world today is widely known, therefore,
in many countries sought ways to prevent environmental contamination and food. The threat to the environment is not only industry
but also agriculture, which uses chemical fertilizers and toxic pesticides. They are an integral part of modern agriculture conventional
(intensive), which is geared for maximum production and maximum
profit, often ignored environmental costs, which include the depletion of landscape, the destruction of groundwater and surface water, and soil degradation and erosion. Intensification of conventional
agriculture leads to the loss of biodiversity at the genetic, species and
landscape1.
This situation is not acceptable, especially in light of adopted by
many countries, including Poland, the principles of sustainable development. No wonder that for several decades continues the search
for different ways of farming. This search resulted in the introduction and development of the so-called. organic farming, the operation of which is close to the ideal of a modern economy cyclic, that
is, one in which there is no waste, and more waste is any material in
another process.
Currently in Poland, we can distinguish three farming systems2:
conventional, integrated and organic. In the conventional system
used fertilizers and pesticides3.
Organic farming is a system of agricultural production management system based on the use of natural processes taking place within the farm. It is a management system based on possible sustainable
crop and livestock production within the household, based on the
application of biological, mineral and raw-tech4. As synonyms in the
naming of this system is used, in addition to the names of organic
Hansen B., Alroe H.F., Kristensen E. S., Wier M., 2002. Assessment of food safety
in organic farming. DARCOF Working Papers no. 52.
2
Krasowicz S., Kukuła S. 1998. Porównanie trzech systemów rolniczych w gospodarstwach rodzinnych północno-wschodniej Polski. Zesz. Nauk. AR w Krakowie
331, ser. Sesja Nauk. 55.
3
Kuś J. 1995. Systemy gospodarowania w rolnictwie – rolnictwo ekologiczne.
Materiały szkoleniowe 45/96 Puławy.
4
www.fao.org/organicag/oa-faq/oa-faq1/en.
1
410
Development of organic farming in Poland
farming and biological agriculture. These names are treated equally,
and in the EU countries is assumed that each Member State chooses
one of them is used in the instruments, scientific work and everyday
language. In Poland, the name is used organic farming5.
According to the above-mentioned definition of fertilizing crops
are used organic fertilizers produced on the farm. Plant protection is
carried out through specific preventive measures, and farm animals
are kept on feed produced on the farm. Also in accordance with the
definition of an organic farm is forbidden to use chemical fertilizers,
chemical pesticides, any substance synthesis chemical feed, and genetically modified organisms6.The purpose of organic agriculture is
to produce food ecological quality. To achieve its goal of organic production is controlled by external certification bodies, which together
with the manufacturer are responsible for the ecological quality of
food offered7.
Aim of the study
The main objective of the work is to present the development of organic farming in Poland and the changes taking place in it, through
the explanation of basic definitions. The analysis covers the period
for the years 2003-2012, shows his condition over the years and explains the interest in this specific type of farming. The results are
presented graphically.
2. The state of organic farming in Poland
Organic farming is becoming more popular in Europe and in Poland.
With the constant growth of the market, an average period of 25%
per year over the last 10 years, organic farming is clearly one of the
fastest growing agricultural sectors.
In most Western European countries, organic agriculture began
to develop intensively in the late 80s and 90s of the twentieth cen5
Neuerburg W., Padel S. (red. Nauk. Sołtysiak U. 1994 Rolnictwo ekologiczne
w praktyce, Wyd. Stowarzyszenie Wydawnicze Ekoland, Warszawa.
6
www.ifoam.org/en/organic-landmarks/definition-organic-agriculture.
7
Tomalak M., Lipa J., Krawczyk R., Korbas M. 2004. Uwarunkowania stosowania
środków ochrony roślin w rolnictwie ekologicznym, Krajowe centrum doradztwa
ekologicznego w Radomiu.
411
Witold Trela, Elżbieta Kornalska, Izabella Majewska
tury Related it was the introduction of an active agricultural policy
and relevant legislation and high subsidies for households changing
their production from conventional to organic farming8.
Organic farming in Poland is still under development. Condition
as well as the concentration of rural households shows that we are
a country especially predestined to organic production. Low degree
of intensification of Polish agriculture in the last decade helped to
the fact that agricultural areas are characterized by good conditions
for farming. Also agrarian fragmented structure, excess labor force
in rural areas encourage the development of more labor-intensive organic production9. It can be concluded that the factors that inhibit
the development of conventional agriculture can contribute to the
development of organic farming. Organic farming in Poland is not
pushed through as the main direction of development of Polish agriculture, but it is promoted as an alternative to individual farms10.
The data from the years 2003-2012 indicate that organic farming in Poland is constantly developing, which may be evidenced ever
increasing number of organic farms.
As of December 31, 2012, in Poland the control of the certifying
bodies covered was almost 26 thousand. organic producers, farming
nearly 662 thousand. ha11. In 2012, the largest total area of organic
farmland was in the following Voivodeships, Zachodniopomorskie
(135 366.8 ha), Warmińsko-Mazurskie (112 945.3 ha) and Podlaskie
(56 367.3 ha). In the three Voivodeships were 46.0% of the total
area of organic farmland in Poland. The smallest was the area of organic farmland in the Voivodeships of Opolskie (2 930.3 ha), Śląskie
(7 125,0 ha) and Kujawsko-Pomorskie (8 812.4 ha).
In 2012, activities in the field of organic farming resulted in
25 944 organic producers. Most of them were operating in the
Warmińsko - Mazurskie Voivodeship (3 803), Pomorskie Voivodeship (3 600), and Podlaskie Voivodeship (2 932).
www.jard.edu.pl/pub/21_2_2013_pl.pdf.
Wójcik G., Znaczenie rolnictwa ekologicznego w Polsce w kontekście przemian
planowanych na lata 2001-2014, Wiadomości Zootechniczne, R.L(2012), 4.
10
Grykień S., 2005. Bariery rozwoju rolnictwa ekologicznego w Polsce. W: Funkcje
obszarów wiejskich. Akademia Świętokrzyska, Kielce: 63–71.
11
www.minrol.gov.pl/pol/Jakosc-zywnosci/Rolnictwo-ekologiczne/Rolnictwo-ekologiczne-w-Polsce.
8
9
412
Development of organic farming in Poland
Fig. 1. The area of agricultural crops, the number of organic farms and processing plants in the system of organic farming by provinces in 2012
Voivodeship
Cultivation
area (ha)
dolnośląskie
44304,12
1312
13
kujawsko-pomorskie
8812,35
390
15
lubelskie
37466,45
2174
36
lubuskie
52580,52
1356
6
łódzkie
9908,72
518
15
Organic farms Procesing plants
małopolskie
21049,73
2103
24
mazowieckie
55804,15
2373
59
opolskie
2930,26
90
2
podkarpackie
30381,46
1940
18
podlaskie
56367,3
2924
5
pomorskie
30615,7
894
17
śląskie
7124,97
236
16
świętokrzyskie
14550,84
1288
10
warmińsko112945,3
3793
10
mazurskie
wielkopolskie
41478,58
974
42
zachodniopomorskie
135366,8
3579
24
Total:
661687,3
25944
312
Source: Ministry of Agriculture and Rural Development
Including organic producers of these Voivodeships accounted
for 39.2% of all organic producers in Poland. In The total number
of processing of these Voivodeships accounted for 43.9% of the total organic processing plants in Poland. In 2012, at least it was organic producers in the regions of Opolskie Voivodeship (95), Śląskie
Voivodeship (257) and Kujawsko-Pomorskie Voivodeship (406). In
these same regions were also the least organic producers in Opolskie
Vovideship 90, in Śląskie Voivodeship (236) and Kujawsko-Pomorskie (390) organic processing was least in the regions of Opolskie Vovideship (2), Podlaskie Vovideship (5), Lubuskie Voivdeship (6) and
Warmińsko-Mazurskie Voivodeship (10).
413
Witold Trela, Elżbieta Kornalska, Izabella Majewska
Fig. 2. Number of farms in the system of organic farming in Poland in the
years 2003-2012 (data for 2012).
Source: Ministry of Agriculture and Rural Development
Organic farming systematically and is constantly developing. In
the analyzed period, the number of registered organic farms has increased 11 fold.
Fig. 3. Area of crops
​​
used in accordance with the rules of organic farming
in Poland in the years 2003-2012 (data for 2012).
Source: Ministry of Agriculture and Rural Development
414
Development of organic farming in Poland
In the period 2003 - 2012 organic arable land area has increased
11 times and now represents approximately 3.4% of the total area
used for agriculture in Poland. The average size of organic farms in
Poland now exceeds 26 hectares (The national average of approximately 10 hectares for conventional farms).
Fig. 4. The structure of organic farming in Poland.
Category crops
The share of land area (%)
meadows and pastures
35,3
plants for feed
33,7
cereals
18,6
fruit and berry
8,9
vegetables
1,4
leguminous plants for dry seeds
0,9
industrial plants
0,5
potatoes
0,4
other crops
0,3
Total
100
Source: IJHAR (Main Inspectorate of Commercial Quality of Agri-Food
Products)
In 2012, the largest share of agricultural crops in the area were
grasslands and pastures, the share was 35.3%. In second place were
the crops for animal feed, which occupied 33.7% of agricultural land.
Cereals accounted for 18.6% of organic farmland. Other crop group
occupied 12.3% of total agricultural land. In 2012, 76.5% of all agricultural producers led farm dedicated exclusively to production
plant, and 23.5% - households engaged in both crop production and
livestock.
415
Witold Trela, Elżbieta Kornalska, Izabella Majewska
Fig. 5. Number of processing plants (organic farming system) in Poland
in the years 2003-2012 (data for 2012).
Source: Source: Ministry of Agriculture and Rural Development
In 2012 year, among 312 organic processing took most active
in the processing of fruits and vegetables (31.6%), manufacture of
other food and agriculture (24.8%), processing of grain mill products
(23.6%) as well as meat processing (7%), coffee and tea (5%), milk
and cheese product (4.7%), production of animal feed (0.6%), sugar
production (0.3%)12.
3. Summary
In recent years, not only in Poland, but also worldwide organic farming is gaining wider social approval. Ecological as a system of farming is at an early stage of development in Poland, and for a decade,
observed a very dynamic development. In the period 2003-2012 in
Poland rapidly develop organic farms in both the number and surface
area.
With the growing demand for eco-products, support system for
organic farms, organic surface of agricultural land in recent years
steadily increasing. This is a proposal for small and medium-sized
farms to increase their profitability. This increase is also global trends.
12
data from IJHAR, 2013
416
Development of organic farming in Poland
It is observed that an increasing number of farmers decides to
transform his farm into an organic farm. This is a chance for farmers
to obtain income by: sale of healthy and organic food as well as the
opportunity to apply for a grant to the hectare organic production
under the government’s support.
The area of organic farms in Poland are an average of 26 hectares, which demonstrates the interest of agriculture by “larger” farmers whose main source of income is organic production. Significant
impact on the interest in organic farming crisis, food security, and
health care for every consumer. These factors affect consumers seeking foods with guaranteed high quality. Organic farming to produce
food with higher nutritional values ​​and health meets these criteria.
The system of organic farming guarantee the quality of the environment in which it operates as well as high quality food produced.
To meet these requirements requires a lot of work, good organization
and applied knowledge or the field of agricultural technology and
ecology. These are the reasons due to which organic farming will play
an important role in agricultural production as well as alternative
direction for a group of farms in Poland.
Bibliography
Grykień S., 2005. Bariery rozwoju rolnictwa ekologicznego w Polsce.
W: Funkcje obszarów wiejskich. Akademia Świętokrzyska, Kielce
Hansen B., Alroe H.F., Kristensen E. S., Wier M., 2002. Assessment of food
safety in organic farming. DARCOF Working Papers no. 52’
Neuerburg W., Padel S. (red. Nauk. Sołtysiak U. 1994 Rolnictwo ekologiczne
w praktyce, Wyd. Stowarzyszenie Wydawnicze Ekoland, Warszawa.
Krasowicz S., Kukuła S. 1998. Porównanie trzech systemów rolniczych
w gospodarstwach rodzinnych północno-wschodniej Polski. Zesz.
Nauk. AR w Krakowie 331, ser. Sesja Nauk. 55
Kuś J. 1995. Systemy gospodarowania w rolnictwie – rolnictwo ekologiczne.
Materiały szkoleniowe 45/96 Puławy
Tomalak M., Lipa J., Krawczyk R., Korbas M. 2004. Uwarunkowania stosowania środków ochrony roślin w rolnictwie ekologicznym, Krajowe
centrum doradztwa ekologicznego w Radomiu.
Wójcik G., Znaczenie rolnictwa ekologicznego w Polsce w kontekście przemian planowanych na lata 2001-2014, Wiadomości Zootechniczne,
R. L(2012)
417
Witold Trela, Elżbieta Kornalska, Izabella Majewska
Internet sources:
www.fao.org/organicag/oa-faq/oa-faq1/en/
www.ifoam.org/en/organic-landmarks/definition-organic-agriculture
www.jard.edu.pl/pub/21_2_2013_pl.pdf
www.minrol.gov.pl/pol/Jakosc-zywnosci/Rolnictwo-ekologiczne/Rolnictwo-ekologiczne-w-Polsce
Postal address:
MSc Ing. Witold Trela
MSc. Ing. Elżbieta Kornalska
MSc. Ing. Izabella Majewska
University of Agriculture in Krakow
418
Łukasz Borek
Krzysztof Ostrowski
EPISTEME
22/2014, t. I
s. 419-431
ISSN 1895-2241
ROLA I ZNACZENIE INFRASTRUKTURY
WODNO-MELIORACYJNEJ W KSZTAŁTOWANIU
WALORÓW KRAJOBRAZOWYCH PARKU
DWORSKIEGO W BRNIU
THE ROLE OF IRRIGATION SYSTEM IN SHAPING
A PARK LANDSCAPE IN BREŃ
Abstrakt. Istotną rolę i znaczenie, jako element kompozycyjny założenia
parkowego w miejscowości Breń, kształtującego jego walory krajobrazowe,
ma infrastruktura wodno-melioracyjna. Kanały wodne i stawy wchodzące
w skład kompleksu parkowo-ogrodowego w Brniu (województwo
małopolskie, powiat Dąbrowa Tarnowska) zajmują powierzchnię około
7,5 ha. Ich zasilanie odbywa się za pomocą urządzeń i budowli melioracji
szczegółowych, do których woda kierowana jest po uprzednim spiętrzeniu
jazem, zlokalizowanym na rzece Breń. Inwentaryzacja i ocena stanu
technicznego budowli i urządzeń wodnych przeprowadzona w latach 2010–
2013, po wykonaniu prac melioracyjnych, stanowiących pierwszy etap
programu rewitalizacji założenia parkowego w miejscowości Breń, pozwala
stwierdzić, że kanały oraz stawy parkowe pełnią funkcję krajobrazową
i retencyjną, stwarzając odpowiednie warunki wzrostu i rozwoju zieleni
parkowej. Przywrócenie sprawności działania infrastruktury wodnomelioracyjnej sprawia, że całość założenia spełnia funkcje rekreacyjnowypoczynkowe.
Słowa kluczowe: założenie parkowe, walory krajobrazowe, infrastruktura
wodno-melioracyjna, retencja
Summary. Irrigation system is an important compositional element of the
park in Breń and shapes the landscape. Water channels and ponds in the
park in Breń (Małopolska voivodeship, district Dąbrowa Tarnowska) cover
approximately 7.5 hectares. The water supply is carried out by means of field
drainage system to which the water flows via a weir located on the Breń
River. Inventory and assessment of the technical condition of buildings
and water facilities carried out in 2010-2013, after the irrigation works
constituting the first phase of the revitalization of the park in Breń, show
419
Łukasz Borek, Krzysztof Ostrowski
that the canals and ponds have both landscape and retention function and
create appropriate conditions for growth and development of park greenery.
Working irrigation system is an asset to recreational and leisure functions
of the park.
Key words: park, landscape, drainage and irrigation system, retention
Wstęp
W świadomości społecznej rola i znaczenie urządzeń wodno-melioracyjnych w kształtowaniu i zagospodarowaniu przestrzeni sprowadza się głównie do zabiegów technicznych, służących regulowaniu
stosunków powietrzno-wodnych terenów użytkowanych rolniczo
(odwodnienia i nawodnienia). Tymczasem słowo melioracje, pochodzące od łacińskiego meliorare oznaczającego: poprawiać, ulepszać,
posiada znacznie szerszy kontekst i wymowę. Melioracje są świadomą ingerencją człowieka w środowisko naturalne poprzez ciągłe
jego udoskonalanie, służące poprawie jakości i warunków życia.
Urządzenia i budowle melioracyjne wykonane przez człowieka
tworzą w przestrzeni złożony system, kształtujący krajobraz kulturowy danego terenu.
Zadaniem melioracji wodnych, oprócz ułatwienia wykonywania
prac agrotechnicznych i optymalizacji czynników plonotwórczych,
jest ochrona środowiska przyrodniczego, poprzez racjonalne gospodarowanie wodą w warunkach występowania jej niedoboru lub
nadmiaru (susze, powodzie) z wykorzystaniem różnych form małej
retencji [Nyc i Pokładek 2004; Liberacki i Olejniczak 2013].
Ustawa Prawo Wodne [Dz. U. z 2012 r., poz. 145] dzieli melioracje na podstawowe i szczegółowe w zależności od funkcji i parametrów stosowanych urządzeń (budowli). Ważną rolą infrastruktury
wodno-melioracyjnej, choć często niedocenianą, było i nadal jest jej
wykorzystanie w urządzaniu terenów rekreacyjnych i sportowych
oraz do poprawy walorów krajobrazowych – w tym parków i ogrodów
podworskich.
Zapis Ustawy o ochronie przyrody [Dz. U. z 2013 r., poz. 627
z póź. zm.] mówi, że „walory krajobrazowe – to wartości ekologiczne, estetyczne lub kulturowe obszaru oraz związane z nim rzeźba terenu, towary i składniki przyrody, ukształtowane przez siły przyrody lub
działalność człowieka”. Zarówno parki jak i znajdujące się w nich
420
Rola i znaczenie infrastruktury wodno-melioracyjnej w kształtowaniu...
urządzenia wodno-melioracyjne w postaci rowów, kanałów i stawów,
powstałe w wyniku świadomej działalności człowieka, odpowiadają
temu zapisowi, ponieważ spełniają funkcje krajobrazowe, estetyczne
i kulturowe.
Celem artykułu jest określenie roli infrastruktury wodno-melioracyjnej w kształtowaniu walorów krajobrazowych w przestrzeni
pozarolniczej na przykładzie parku dworskiego w Brniu, po jej renowacji i modernizacji.
Miejsce i metody badań
Założenie dworsko-parkowe położone jest w małej miejscowości Breń
(N: 50o13’; E: 20o57’), pod względem administracyjnym należącej do
jednego z sołectw gminy Olesno, w powiecie dąbrowskim, w północno-wschodniej części województwa małopolskiego (ryc. 1).
Powierzchnia założenia i zabudowań podworskich wynosi około 15
ha. Obiekt leży w zlewni rzeki Breń na stosunkowo płaskim terenie
o średniej wysokości bezwzględnej 175,00 m n.p.m.
Ryc. 1. Położenie obiektu na tle województwa małopolskiego
Źródło: na podstawie www.odkryjmalopolske.pl/podzial-administracyjny.html
421
Łukasz Borek, Krzysztof Ostrowski
Materiałem wyjściowym do wykonania niniejszego opracowania
były:
• wyniki inwentaryzacji budowli i urządzeń wodnych, wykorzystywanych do nawadniania założenia parkowego w Brniu, przeprowadzonej po pracach melioracyjnych wykonanych w latach
2010–2013, stanowiących pierwszy etap programu rewaloryzacji,
• analiza dokumentacji przetargowej: Opracowanie koncepcji rewaloryzacji założenia ogrodowego w Brniu (…), udostępnionej
przez Starostwo Powiatowe w Dąbrowie Tarnowskiej [Dokumentacja przetargowa], uzupełnionej przeglądem literatury, artykułów oraz materiałów promocyjnych gminy Olesno i powiatu
dąbrowskiego,
• własna obserwacja i dokumentacja fotograficzna prowadzona od
2010 roku,
• podkład mapowy (geoportal.gov.pl, geomalopolska.pl) służący
zobrazowaniu lokalizacji budowli i urządzeń wodnych [Strony
internetowe].
Wyniki i dyskusja
Powstanie parku w stylu francuskiego baroku, którego fundatorem
był ród Czartoryskich, datuje się na II połowę XVIII wieku. Projekt
dwuosiowej kompozycji zlecono wiedeńskiemu projektantowi
ogrodów rezydencjonalnych Pfaffingerowi, który według przekazów
historycznych sam miał kierować pracami przy jego wykonaniu
[Babiarz 2001; powiatdabrowski.pl]. Motorem napędzającym rozwój
zieleni parkowej, oprócz podłoża, była woda. Cały kompleks parkowo
ogrodowy od strony północnej, wschodniej i zachodniej otoczono
kanałami wodnymi, których zadaniem było odgrodzenie parku od
dworu i terenów użytkowanych rolniczo. Kanały i stawy pełniły
wówczas istotną rolę kompozycyjną walorów estetycznych całego
założenia parkowego [Furmanik 2010; Przesmycka i Boguszewska
2012]. Walory te docenił w roku 1786 hrabia Kuropatnicki, geograf
i heraldyk, który w sowim dziele [1858] przy opisie cyrkułu
tarnowskiego: miasta i wsie znakomitsze sporządził zapis: „Bryń.
Wieś Xsiążąt Czartoryskich, najpiękniejszy ogród w całej Galicyi ma
w sobie”. W wieku XIX czytamy: „Breń, inaczej Bryń, wieś w powiecie
422
Rola i znaczenie infrastruktury wodno-melioracyjnej w kształtowaniu...
dąbrowskim, leży w równinie w glebie piaszczystej. Obszar dworski z
pięknym pałacem i parkiem jest własnością powierniczą (fideikomis)
Jana Konopki” [Sulimierski i in. 1880].
Na terenach posiadłości ziemskich oprócz parków, wykonywano
stawy rybne, gdzie powadzono głównie hodowlę ryb karpiowatych.
Stawy breńskie spełniały ważną rolę gospodarczą polegającą na
wykorzystaniu energii spadu wody do napędzania koła młyńskiego oraz ważny element krajobrazu kulturowego wsi polskiej [Dobrowolski i in. 1995].
Ryc. 2. Lokalizacja urządzeń i budowli wodno-melioracyjnych nawadniających założenie parkowe w Brniu.
Legenda: 1 – ujęcie wody za pomocą jazu piętrzącego na rzece Breń; 2 – rów
doprowadzający; 3 – zastawka piętrząca; 4 – staw przydrożny; 5 – mnich
spustowo-przelewowy; 6 – staw parkowy; 7 – kanały parkowe; 8 – zastawki
kanałowe; 9 – rów odprowadzający.
Po II wojnie światowej obszar ten przeszedł w posiadanie starostwa powiatowego w Dąbrowie Tarnowskiej. W 2003 roku zani423
Łukasz Borek, Krzysztof Ostrowski
echano piętrzenia wody na jazie i zaprzestano prowadzenia chowu
ryb. Z powodu braku konserwacji urządzeń i budowli wodno-melioracyjnych przepływ wody do stawów i kanałów parkowych był
niemożliwy. W wyniku sukcesji roślinnej obszar obrósł w samosiejki. Brak wody w stawach i kanałach parkowych przyczynił się
do zachwiania stosunków gruntowo-wodnych ternu przyległego,
przejawiających się niszczeniem nawierzchni drogowej i pękaniem
budynków, obumieraniem starodrzewu oraz zanikaniem niektórych
gatunków roślin i zwierząt.
Prace melioracyjne, które wykonano w parku i jego otoczeniu
w latach 2010– 2013 były pierwszym etapem programu rewitalizacyjnego zespołu dworsko-parkowego w Brniu, których priorytetowym celem było odtworzenie sprawności działania systemu melioracyjnego (ryc. 2). W zakres tych prac (robót) wchodziło wykonanie
melioracji podstawowych i szczegółowych. Melioracje podstawowe
obejmowały modernizację i renowację ujęcia wody powierzchniowej w postaci trzyprzęsłowego jazu ruchomego na rzece Breń (Fot.
1), zlokalizowanego w km 33+000 w miejscowości Swarzów oraz
kanałów wodnych o parametrach przedstawionych w tab. 1. Jaz
powstał przed II wojną światową jako konstrukcja faszynowo-ziemna, której głównym celem była regulacja i stabilizacja koryta rzeki.
W 1959 roku dokonano przebudowy i dotychczasową budowlę zastąpiono stabilniejszą konstrukcją żelbetową. Inwestycja ta wynikała z konieczności podwyższenia rzędnej piętrzenia wody w celu
doprowadzenia jej do stawów rybnych i kanałów parkowych oraz
nawadniania pobliskich pól. W kwietniu 2013 roku za pomocą wyremontowanych urządzeń melioracyjnych do parku znowu popłynęła
woda, która wypełniła kanały parkowe oraz pobliskie stawy rybne
o łącznej powierzchni około 7,5 ha [powiatdabrowski.pl].
W zakres modernizacji i renowacji kanałów wodnych wchodziło
pogłębienie istniejących lecz zaniedbanych rowów doprowadzających
i odprowadzających wodę z terenu parku, umocnienie dna i skarp,
usunięcie namułów i samosiewek oraz zrekonstruowanie grobli
stawowych i budowli związanych z nimi funkcjonalnie. Wymiana
wody w kanałach i stawach następuje przez przepływ regulowany
zastawkami (Fot. 2) i mnichami oraz odpowiednio wyprofilowanym
dnem misy stawu parkowego i kanałów otaczających park.
424
Rola i znaczenie infrastruktury wodno-melioracyjnej w kształtowaniu...
Znaczną część prac melioracyjnych stanowiły umocnienia misy
stawowej oraz dna, skarp rowów i kanałów melioracyjnych, wykonane z kiszki faszynowej lub płotków faszynowych (Fot. 3). Na terenie od krawędzi skarpy wokół stawu parkowego, w celach stabilizacyjnych ułożono płaty darniny. W punktach narażonych na erozję,
osuwanie się gruntu, umocnienie wykonano z narzutu kamiennego.
Tab. 1. Wykaz elementów infrastruktury wodno-melioracyjnej, w założeniu
parkowym w Brniu
Urządzenia i budowle
melioracyjne
Parametry i wielkości
1
Jaz piętrzący
– Max PP = NNP = 177,22 m n.p.m.
– wysokość przy normalnym poziomie piętrzenia
Hp = 3,7 m
– Poboru wód powierzchniowych z rzeki Breń
przy pomocy rurociągu betonowego Φ 60 cm o
długości 240 m., którego dno jest posadowione
na rzędnej 176,56 m n.p.m.
– Q max. godz. = 191,30 m3∙h-1
– Q śr.dob. do napełnienia stawów = 4 591,30 m3∙d-1= 53,14
dm3∙s-1
– Q śr.dob. do podtrzymania zalewu = 51,42 dm3∙s-1
– przepływ nienaruszalny Qn = 0,270 m3∙s-1
2
Rów doprowadzający
długość L = 270 m
3
Staw przydrożny
Powierzchnia: F = 1,14 ha
4
Staw parkowy
Powierzchnia: F = 0,99 ha
5
Kanały parkowe
Długość: L = 930 m
6
Rów odprowadzający
długość L = 550 m
7
Urządzenia piętrzącoprzelewowe
zastawka piętrząca na doprowadzalniku
Mnich
zastawki kanałowe ręczne typu naściennego
ZKN/R 450–1500–HC2900
8
Inne
przepusty
Lp.
425
Łukasz Borek, Krzysztof Ostrowski
Podstawą do prawidłowego gospodarowania wodą na terenie założenia parkowo-ogrodowego było ustalenie wielkości charakterystycznych, określających między innymi ilość wody będącej
w dyspozycji do nawadniania, wysokości piętrzenia wody na ujęciu
oraz zachowaniu przepływu nienaruszalnego (biologicznego) w cieku
poniżej poboru wody (tab. 1).
Z szacunkowych wyliczeń, dysponując danymi zamieszczonymi
w tabel 1 oraz mapy i narzędzi strony geoportal.pl, ustalono, że staw
i kanały parkowe otaczające całe założenie mają powierzchnię około
7,5 ha co przy ich zalewie wodą do głębokości 1,0 m daje możliwość
zgromadzenia na tym terenie około 75 000 m3 wody.
Kanały i staw parkowy pełnią rolę sanitarną i estetyczną oraz są
rezerwuarem, retencjonującym wodę nie tylko w samym parku lecz
również w jego bezpośrednim sąsiedztwie (Fot. 4 i 5). Ponadto powietrze na tym obszarze jest nasycone parą wodną, przez co wpływa
na zmniejszenie amplitudy temperatur dobowych, co prowadzi do
wytworzenia się specyficznego mikroklimatu [Małecka i Staszewski
2011]. Samo lustro wody uspokaja i wprowadza element dekoracyjny
w postaci odbijających się w nim drzew i błękitu nieba.
Fot. 1. Ujęcie wody do nawodnień za pomocą jazu na rzece Breń,
fot. Ł. Borek
426
Rola i znaczenie infrastruktury wodno-melioracyjnej w kształtowaniu...
Fot. 2. Zastawka piętrząca na rowie doprowadzającym, fot. Ł. Borek
Fot. 3. Umocnienia faszynowe dna i skarp kanałów wodnych, fot. Ł. Borek
427
Łukasz Borek, Krzysztof Ostrowski
Fot. 4. Kanał parkowy z białym mostkiem, fot. Ł. Borek
Podsumowanie i wnioski
W wyniku przeprowadzonej analizy można stwierdzić, że urządzenia
wodno-melioracyjne spełniają ważną rolę w kształtowaniu walorów
krajobrazowych w tym założeń ogrodowych i parkowych. Obecnie,
kiedy coraz częściej mówi się o gromadzeniu wody w zbiornikach
małej retencji, stawach, oczkach śródpolnych, czy też odtwarzaniu
starorzeczy i młynówek, program odnowy melioracji związany z przywróceniem pierwotnej funkcji krajobrazowej parkowi w Brniu
jest dowodem na to, jak ważną funkcję pełni infrastruktura melioracyjna w ochronie i kształtowaniu środowiska. Krajobraz kulturowy pozostawiony sam sobie podlega degradacji, tracąc pierwotną
funkcję i kształt. W celu nie dopuszczenia do zniszczenia (degradacji)
założenia parkowego w Brniu powinno się dbać o odpowiednią eksploatację systemu melioracyjnego, który pozwala na utrzymanie
optymalnego uwilgotnienia gleby, niezbędnego do prawidłowego rozwoju roślinności parkowej (Fot. 6). Należy nadmienić, że park jest
428
Rola i znaczenie infrastruktury wodno-melioracyjnej w kształtowaniu...
przestrzenią życiową roślin i zwierząt oraz miejscem do rekreacji
i wypoczynku. Troska o jego zachowanie dla przyszłych pokoleń leży
przede wszystkim w gestii władz samorządu terytorialnego, a w szczególności administratora tego cennego dla społeczności powiatu
dąbrowskiego i małopolski, obiektu.
Na podstawie przeprowadzonych badań studialnych, obserwacji
i analiz stwierdzono, że urządzenia wodno-melioracyjne na terenie
założenia parkowo-ogrodowego w miejscowości Breń, przy należytej
ich eksploatacji i konserwacji:
• poprawiają walory estetyczne, krajobrazowe i
mikroklimatyczne,
• umożliwiają prawidłowy rozwój fauny i flory parkowej,
• zwiększają zasoby wodne,
• wpływają na podniesienie atrakcyjności rekreacyjnej i
turystycznej,
• pozwalają na utrzymanie obiektów o dużej wartości
przyrodniczej i historycznej.
Fot. 5. Staw przydrożny po modernizacji, fot. Ł. Borek
429
Łukasz Borek, Krzysztof Ostrowski
Fot. 6. Optymalne nawodnienie sprzyja rozwojowi bujnej roślinności,
fot. Ł. Borek
Bibliografia
Babiarz St. 2001. Gmina Olesno. Szkice z przeszłości i teraźniejszości. Materiały opracował Stanisław Babiarz wraz z absolwentami 2000 roku Technikum Inżynierii Środowiska i Melioracji w Brniu.
Dobrowolski A., Bukacińska M., Bukaciński D., Kaczmarek W. 1995. Przyrodniczo-ekonomiczna waloryzacja stawów rybnych w Polsce. Fundacja
IUCN Poland, Warszawa.
Dokumentacja przetargowa: Opracowanie koncepcji rewaloryzacji założenia
ogrodowego w Brniu wraz z projektem wykonawczym, szczegółowych
specyfikacji technicznych wykonania i odbioru robót oraz kosztorysów
dla założenia ogrodowego, stawu parkowego i kanałów parkowych wraz z wymaganymi pozwoleniami i uzgodnieniami w ramach zadania pn. Rewaloryzacja i konserwacja zabytkowego Zespołu Dworsko
- Parkowego w Brniu.
Furmanik B. 2010. Dobory materiałowe w ogrodach zabytkowych. Instrukcje.
Kurier Konserwatorski nr 7, 23–31.
430
Rola i znaczenie infrastruktury wodno-melioracyjnej w kształtowaniu...
Kuropatnicki A. E. 1858. Geografia albo dokładne opisanie królestw Galicyi i Lodomeryi. Wydanie powtórne nakładem Wojciecha Manieckiego w drukarni zakładu narodowego im. Ossolińskich, Lwów.
Liberacki D., Olejniczak M., 2013. Ocena potrzeb renowacji i modernizacji
urządzeń wodno-melioracyjnych zlokalizowanych na wybranych ciekach
Puszczy Zielonka. Annual Set The Environment Protection. Rocznik
Ochrona Środowiska, t. 15, 930–943.
Małecka I., Staszewski Z. 2011. Wpływ stawów i cieków w kaliskim parku
miejskim na środowisko. Zeszyty Naukowe. Inżynieria Lądowa i Wodna w Kształtowaniu Środowiska, Nr 3. Instytut Badawczo-Rozwojowy
Inżynierii Lądowej i Wodnej „Euroexbud”. Polskie Towarzystwo Inżynierii Ekologicznej Zarząd Oddziału Ziemi Kaliskiej
Nyc K., Pokładek R. 2004. Współczesne problemy eksploatacji w melioracjach.
Woda-Środowisko-Obszary Wiejskie, IMUZ, t. 4 z. 1(10), s. 31–46
Przesmycka B., Boguszewska K. 2012. Wybrane elementy wodne w założeniach pałacowych i dworskich województwa lubelskiego. Stan zachowania.
Teka. Kom. Arch. Urb. Stud. Krajobr. – OL PAN, VIII/2, 80 – 88.
Strony internetowe: wwwpowiatdabrowski.pl; www.gminaolesno.pl; geoportal.
gov.pl, geomalopolska.pl
Sulimierski F., Chlebowski B., Walewski W. 1880. Słownik geograficzny Królestwa Polskiego i innych krajów słowiańskich. T. I, Warszawa.
Dz. U. z 2013 poz. 627 z póz. zm. [Ustawa z dnia 16 kwietnia 2004 r.
o ochronie przyrody tekst jednolity]
Dz. U. z 2012 r., poz. 145. Prawo wodne [Ustawa z dnia 18 lipca 2001 r. tekst
jednolity]
Adres do korespondencji:
mgr inż. Łukasz Borek
prof. dr hab. inż. Krzysztof Ostrowski
Katedra Melioracji i Kształtowania Środowiska
Wydział Inżynierii Środowiska i Geodezji
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
431

Podobne dokumenty