ORIGINAL PAPERS

original papers
Adv Clin Exp Med 2010, 19, 3, 313–322
ISSN 1230-025X
© Copyright by Wroclaw Medical University
Roman Franiczek, Barbara Krzyżanowska, Izabela Dolna,
Grażyna Mokracka-Latajka
Conjugative Transfer of Plasmid-Mediated CTX-M-Type
β-Lactamases from Clinical Strains
of Enterobacteriaceae to Salmonella enterica Serovars
Transfer koniugacyjny kodowanych plazmidowo
β-laktamaz CTX-M ze szczepów klinicznych Enterobacteriaceae
do serowarów Salmonella enterica
Department of Microbiology, Wroclaw Medical University, Poland
Abstract
Objectives. The aim of the study was to evaluate the transfer frequency of plasmid-mediated extended-spectrum
β-lactamases (ESBLs) from clinical isolates of Enterobacteriaceae to Salmonella enterica and Escherichia coli K12
C600 recipient strains. Moreover, the susceptibility to selected antibiotics and chemotherapeutics of the donor
strains and transconjugants obtained in the mating experiments was estimated.
Material and Methods. Ten ESBL-positive clinical isolates, including Escherichia coli, Klebsiella pneumoniae,
Citrobacter freundii, Enterobacter cloacae, and Serratia marcescens (two strains of each species) were used as donor
strains. Salmonella enterica serovar Enteritidis (S. Enteritidis), S. Virchow, S. Hadar, and E. coli K12 C600 were
used as recipient strains. ESBL production in donor strains and transconjugants was detected by the double disk
synergy test (DDST). Transfer of ESBL-encoding plasmids was performed by a liquid conjugational method. The
minimal inhibitory concentrations (MICs) of antibacterial drugs were determined by an agar dilution technique
on Mueller-Hinton agar. The presence of the blaCTX-M gene in donor strains and transconjugants was determined
by PCR.
Results. A total of 40 conjugation crosses between donor and recipient strains were performed. Transconjugants
were obtained in twenty-seven (67.5%) of them. E. coli K12 C600 strain was found to be the best recipient. It
acquired plasmid-mediated ESBL from all of the donor strains tested. Among Salmonella enterica recipients, S.
Enteritidis and S. Infantis acquired ESBL-encoding genes from 9 and 7 donor strains respectively, whereas S. Hadar
acquired this gene from a single donor strain only. The effectiveness of conjugational transfer ranged from 10–6
to 10–1 per donor cell. The donor strains and their transconjugants displayed resistance patterns typical of ESBL
producers. They were uniformly resistant to cefotaxime and ceftriaxone but susceptible to carbapenems, tigecycline
and oxyimino-β-lactams in combination with clavulanic acid. In addition, resistance to gentamicin, amikacin and
co-trimoxazole was, in many cases, co-transferred with oxyimino-β-lactam resistance to recipients by means of
conjugation. The MIC values of cefotaxime and ceftriaxone were higher than those of ceftazidime. PCR results
revealed the presence of the blaCTX-M gene in all donor strains and their transconjugants.
Conclusions. The results of the study demonstrated the differences in conjugational acquisition of the blaCTX-M
gene among the Salmonella enterica serovars studied. Of the S. enterica strains, Salmonella enterica serovar
Enteritidis was found to be the best recipient of plasmid-mediated CTX-M-type β-lactamases (Adv Clin Exp Med
2010, 19, 3, 313–322).
Key words: Salmonella, ESBL, CTX-M.
Streszczenie
Cel pracy. Określenie częstości przekazywania plazmidowo kodowanych β-laktamaz o rozszerzonym spektrum
substratowym (ESBL) z klinicznych szczepów Enterobacteriaceae do szczepów biorców Salmonella enterica
i Escherichia coli K12 C600. Określono ponadto wrażliwość na wybrane antybiotyki i chemioterapeutyki szczepów
dawców i transkoniugantów uzyskanych w krzyżówkach.
314
R. Franiczek et al.
Materiał i metody. W badaniach zastosowano 10 izolatów klinicznych wytwarzających ESBL w charakterze
dawców: Escherichia coli, Klebsiella pneumoniae, Citrobacter freundii, Enterobacter cloacae i Serratia marcescens
(2 szczepy z każdego gatunku). Szczepy Salmonella enterica serowar Enteritidis (S. Enteritidis), S. Virchow, S. Hadar
i E. coli K12 C600 użyto w charakterze biorców. ESBL wykrywano testem synergizmu dwóch krążków (DDST).
Przekazywanie plazmidów kodujących ESBL przeprowadzono za pomocą metody koniugacji w podłożu płynnym.
Minimalne stężenia hamujące (MIC) leków przeciwbakteryjnych oznaczono metodą seryjnych rozcieńczeń
w podłożu agarowym Mueller-Hintona. Występowanie genu blaCTX-M w szczepach dawców i transkonjugantach
oznaczono metodą PCR.
Wyniki. Ogółem wykonano 40 krzyżówek koniugacyjnych między szczepami dawców i biorców. Transkoniuganty
otrzymano w 27 (67,5%) krzyżówkach. Najlepszym biorcą okazał się szczep E. coli K12, który nabył plazmidowo kodowane ESBL od wszystkich badanych szczepów dawców. Wśród biorców Salmonella enterica, serowary
S. Enteritidis and S. Infantis nabyły geny kodujące ESBL odpowiednio od 9 and 7 szczepów dawców, a serowar
S. Hadar nabył ten gen tylko od jednego szczepu donorowego. Skuteczność koniugacji wynosiła od 10–6 do 10–1
w przeliczeniu na komórkę dawcy. Szczepy dawców oraz ich transkoniuganty odznaczały się typowymi dla producentów ESBL wzorcami oporności. Były one oporne na cefotaksym i ceftriakson, wrażliwe natomiast na karbapenemy, tigecyklinę i oksyimino-β-laktamy skojarzone z kwasem klawulanowym. Ponadto, w wielu przypadkach
oporność na gentamycynę, amikacynę i kotrimoksazol była przekazywana na drodze koniugacji wraz z opornością
na oksyimino-β-laktamy. Wartości MIC dla cefotaksymu i ceftriaksonu były większe w porównaniu z wartościami
MIC dla ceftazydymu. Wyniki badań PCR wykazały obecność genu blaCTX-M u wszystkich szczepów dawców oraz
ich transkoniugantów.
Wnioski. Wyniki badań wykazały różnice w koniugacyjnym nabywaniu genu blaCTX-M wśród badanych serowarów
Salmonella enterica. Spośród badanych szczepów S. enterica najlepszym biorcą plazmidowo kodowanych β-laktamaz
CTX-M okazał się szczep Salmonella enterica serowar Enteritidis (Adv Clin Exp Med 2010, 19, 3, 313–322).
Słowa kluczowe: Salmonella, ESBL, CTX-M.
Nontyphoidal Salmonella enterica subsp.
enterica serovars are considered the leading cause
of food-borne gastroenteritis, but severe extraintestinal infections, such as bacteremia, meningitis
and osteomyelitis have also been reported [1].
Currently, the Salmonella genus includes more
then 2.500 different serovars, however the majority of human infections are caused by a very limited
number of them. In European countries, the most
common Salmonella serovar involved in human
infections is S. Enteritidis responsible for 79-84%
of salmonellosis, followed by S. Typhimurium, S.
Hadar, S. Virchow and S. Infantis [2]. Although
the antibiotic therapy is not recommended for
treatment of self-limiting Salmonella gastroenteritis, it is required for systemic, life-threatening
infections. In adults, fluoroquinolones are commonly used as the drugs of first choice. In pediatric patients, however, these antimicrobials are
contraindicated. For this reason, third-generation cephalosporins (3GC) such as ceftriaxone
and cefotaxime are preferentially used to treat
extraintestinal salmonellosis [3–5]. The extensive
clinical utilization of 3GC has been responsible
for the emergence of Salmonella strains exhibiting
oxyimino-β-lactam resistance due to the expression of plasmid-mediated extended-spectrum
β-lactamases (ESBLs) and/or β-lactamases derived
from the chromosome-encoded class C enzymes,
such as CMY-2 [6, 7]. The first ESBL-producing
Salmonella strains have been isolated in the late
1980s [8]. Since then, they have been identified in many countries worldwide. Although the
prevalence of ESBL-positive Salmonella isolates
is relatively rare compared to the other members
of the family Enterobacteriaceae, it has increased
considerably in recent years. Salmonellae have
been found to produce a vide variety of ESBLs
including: TEM-, SHV-, CTX-M- as well as PERtype enzymes [4, 7, 9–14]. ESBL-encoding genes
are usually carried by transferable plasmids and/
or mobile genetic elements, which contributes to
their rapid dissemination among Gram-negative
rods, particularly by means of conjugation [15, 16].
In addition, these conjugative plasmids often contain genes conferring resistance to non-β-lactam
antimicrobial agents, such as aminoglycosides, tetracycline, co-trimoxazole leading to the limitation
of therapeutical options [17, 18].
The data concerning the acquisition of ESBLencoding genes by different serovars of Salmonella
by mean of conjugation are very scarce. Thus,
the aim of the study was to evaluate the transfer frequency of oxyimino-β-lactam resistance
from ESBL-producing isolates to three serovars
of Salmonella enterica (S. Enteritidis, S. Virchow,
S. Hadar) and the E. coli K12 C600 reference strain.
In addition, the in vitro antimicrobial susceptibility of
donor strains and their transconjugants was studied.
Material and Methods
Bacterial Strains
Ten ESBL-producing clinical isolates of the
Enterobacteriaceae family including: Escherichia
coli, Klebsiella pneumoniae, Citrobacter freundii,
Enterobacter cloacae and Serratia marcescens (two
315
Conjugative Transfer of ESBLs
strains of each species) were used in the study as
donor strains. The isolates were collected from
patients hospitalized in the intensive care unit of
the University Hospital (Wrocław, Poland) during a 2-year period (2007–2008). Species identification of the strains was done by the ATB automated identification system (bioMérieux, France).
E coli K12 C600 reference strain and three serovars
of Salmonella enterica including: S. Enteritidis, S.
Virchow and S. Hadar were used as recipients in
mating experiments. The Salmonella strains were
isolated from 2003 to 2005 in the Country SanitaryEpidemiological Station in Wrocław (Poland), and
identified by standard method [19].
Antibiotic Susceptibility Testing
The MIC of antimicrobial agents was determined by an agar dilution technique on MuellerHinton agar (Oxoid) according to the CLSI recommendations [20]. The MIC values of oxyiminoβ-lactams (aztreonam, cefotaxime, ceftazidime
and ceftriaxone) were determined alone and in
a fixed concentration of clavulanic acid (2 mg/l).
The inoculum was 104 cfu per spot deposited on
the Mueller-Hinton agar. The MIC was defined as
the lowest concentration of the drug that inhibits visible growth after 16–18 hours of incubation
at 35oC. E. coli strains ATCC 25922 and ATCC
35218 were used as the quality reference strains.
Standard powders of antimicrobials tested were
obtained from the following suppliers: aztreonam (Bristol-Myers Squibb), ceftazidime (Glaxo
Wellcome), ceftriaxone (Hoffmann-La Roche
Inc.), amikacin, cefotaxime, gentamicin (Sigma
Chemical Co.), imipenem (Merck Sharp & Dohme
Research), meropenem (Zeneca), lithium clavulanate (GlaxoSmithKline Pharma), co-trimoxazole
(Polfa Tarchomin), tigecycline (Wyeth).
ESBL Production
ESBL production was determined by the double
disk synergy test (DDST) according to Jarlier et al.
[21]. This test was performed by placing disks of ceftazidime, cefotaxime and aztreonam (30 μg each) at
a distance of 20 mm (center-to-center) from a disk
containing amoxicillin with clavulanic acid (20 and
10 μg, respectively). The strains that showed synergy
between oxyimino-β-lactams and clavulanic acid
were considered to produce ESBL enzymes.
Transfer of Oxyimino-β-lactam
Resistance
Conjugational transfer of oxyimino-β-lactam
resistance was performed with all ESBL-positive
isolates (resistant to ceftazidime and/or cefotaxime
but susceptible to nalidixic acid) using the mixed
broth method. The recipient strains were resistant
to nalidixic acid but susceptible to all antimicrobials used in the susceptibility testing. Equal volumes
(1 ml) of cultures of the donor and the recipient
strains (109 cfu), grown in nutrient broth (Difco)
were mixed and incubated for 24 hours at 37oC.
Transconjugants were selected on MacConkey agar
(Biomed) supplemented with nalidixic acid (64 mg/l)
(Chinoin) to inhibit the growth of donor strains,
and ceftazidime or cefotaxime (4 mg/l) to inhibit
the growth of recipient strain. Transfer frequency
of oxyimino-β-lactam resistance was expressed as
the number of transconjugants cfu relative to the
number of recipient cfu after the mating period.
Plasmid DNA Preparation
Plasmid DNA was extracted from donor
strains and their transconjugants by the alkaline
method with the Qiagen Plasmid Mini Kit (Qiagen)
according to the manufacturer’s protocol.
PCR Amplification
of the blaCTX-M Determinant
Plasmid DNA preparations from donor strains
and transconjugants were used as templates for the
blaCTX-M genes amplification. The oligonucleotide
primers specific for the blaCTX-M determinants
were: P1C (5’ –TCGTCTCTTCCAG– 3’) and P2D
(5’ –CAGCGCTTTTGCCGTCTAAG– 3’).
PCR reactions were carried on in T3 thermocycler (Biometra GmbH, Gottingen, Germany).
PCR conditions were: 3 min at 95oC, 30 cycles of
30 s at 95oC, 30 s at 55oC, and 30 s at 72oC, and
finally 3 min at 72oC [22]. The size of the PCR
products was approximately 1 kb.
Results
Conjugation Experiments
In the present study, the authors compared the effectiveness of conjugational transfer of plasmid-borne genes coding for ESBLs
to Salmonella enterica recipients belonging to
three serovars: S. Enteritidis, S. Virchow, and
S. Hadar. Additionally, the E. coli K12 C600 strain
was used as the reference recipient. Ten ESBL-positive clinical isolates including: Escherichia
coli, Klebsiella pneumoniae, Enterobacter cloacae,
Citrobacter freundii and Serratia marcescens (two
isolates of each species) were used as donors in
the mating experiments.
316
R. Franiczek et al.
A total of 40 conjugation crossings were carried out. Transconjugants were obtained for
twenty seven (67.5%) of them (Table 1). Among
Salmonella recipients tested, serovars S. Enteritidis
and S. Virchow acquired plasmid-mediated ESBLs
from 9 and 7 donor strains respectively, with
a frequency ranged from 1.5 × 10-6 to 5.1 × 10-1
per donor cell. In contrast, S. Hadar was practically incapable of acquisition of plasmid-encoding
ESBLs. The only exception was the cross with
E. coli 26 donor strain, which produced transconjugants with a frequency of 3.1 × 10-5 per donor
cell. Using the reference strain E. coli K12 C600 as
the recipient, transconjugants were obtained in all
crosses with a frequency ranged from 1.5 × 10-6 to
5.8 × 10-1 per donor cell. Interestingly, the majority
of the donors studied (8/10) transferred plasmidmediated genes coding for ESBLs to this recipient
with a very high frequency of 10-2 to 10-1 per donor
cell. All transconjugants obtained in conjugational
crossings displayed ESBL phenotype, which was
confirmed by the conventional DDST.
Antimicrobial Susceptibility
of Donor Strains
The susceptibilities of the donor strains to
the antimicrobial agents tested are summarized
in Table 2. All these strains were fully resistant
to cefotaxime (MIC range: 256 to > 1024 mg/l),
ceftriaxone (MIC range: 256 to > 1024 mg/l) and
aztreonam (MIC range: 32 to 256 mg/l). Moreover,
all of them, with the exception two isolates, were
susceptible to ceftazidime (MIC range: 2 to 32
mg/l). In all cases susceptibility to oxyimino-βlactams was efficiently reversed (MIC: < 1 mg/l)
in the presence of clavulanic acid at concentration of 2 mg/l, confirming the expression of ESBL
phenotype. In addition, all the donor strains were
susceptible to imipenem and meropenem (MIC:
< 1 mg/l). With regard to non-β-lactam antimicrobials, the susceptibility testing gave the following
results: all the donor strains were uniformly resistant to gentamicin, amikacin and co-trimoxazole
(MIC: > 1024 mg/l) but susceptible tigecycline
(MIC: < 1 mg/l).
Antimicrobial Susceptibility
of Transconjugants
The transconjugants obtained in mating experiments exhibited antibiotic resistance profiles similar to those of their parental clinical isolates (Table
3). They were resistant to cefotaxime and ceftriaxone (MIC range: 128 to > 1024 mg/l) but susceptible to imipenem, meropenem and oxyiminoβ-lactams in combination with clavulanic acid
(MIC: < 1 mg/l). Resistance to ceftazidime (MIC:
32 mg/l) and aztreonam (MIC range: 32 to 256
mg/l) was detected in 6 and 22 transconjugants,
respectively. In all mating experiments resistance
to gentamicin and amikacin (MIC range: 64 to >
1024 mg/l) was simultaneously transferred with
oxyimino-β-lactam resistance, whereas resistance to co-trimoxazole (MIC 1024 – > 1024 mg/l)
was found in 25 out of the 27 transconjugants.
Similar to the donor strains, all transconjugants
were uniformly susceptible to tigecycline (MIC <
1 mg/l).
Table 1. Transfer frequency of ESBL-encoding plasmids from donor strains (n = 10) to the E. coli K12 C600 and three
Salmonella enterica serovars
Tabela 1. Częstość przekazywania plazmidów kodujących ESBL ze szczepów dawców (n = 10) do szczepu E. coli K12 C600
i trzech serowarów Salmonella enterica
Donor strainsa
(Szczepy dawcówa)
Ec 26
Ec 42
Kp 36
Kp 41
Cf 8
Cf 933
En 70
En 938
Ser 242
Ser 278
Transfer frequency to recipient strains
(Częstość transferu do szczepów biorców)
E. coli K12 C600
S. Enteritidis
S. Virchow
S. Hadar
1.5 × 10–1
1.5 × 10–1
5.8 × 10–1
3.8 × 10–1
2.9 × 10–1
5.4 × 10–2
1.6 × 10–1
2.8 × 10–1
2.4 × 10–6
1.5 × 10–6
4.9 × 10–4
3.1 × 10–5
1.2 × 10–4
1.5 × 10–3
5.7 × 10–5
1.1 × 10–2
1.5 × 10–6
2.5 × 10–1
6.9 × 10–2
–
1.8 × 10–3
1.6 × 10–3
2.0 × 10–5
1.6 × 10–6
–
8.5 × 10–6
–
1.5 × 10–2
5.1 × 10–1
–
3.1 × 10–5
–
–
–
–
–
–
–
–
–
Ec – Escherichia coli, Kp – Klebsiella pneumoniae, Cf – Citrobacter freundii, En – Enterobacter cloacae, Ser – Serratia marcescens.
a
317
Conjugative Transfer of ESBLs
Discussion
Fig. 1. Agarose gel electrophoresis of PCR products in
recipient, donor strains (A) and their transconjugants
(B).
A. Lane M – DNA molecular-size markers. Lanes: 1 to
4 – recipient strains: S. Enteritidis, S. Virchow S. Hadar
and E. coli K12 C600, respectively. Lanes: 5 to 14 –
donor strains: E. coli 26; E. coli 42; K. pneumoniae 36;
K. pneumoniae 41; C. freundii 8, C. freundii 933; Ent.
cloacae 70; Ent cloacae 938; S. marcescens 242 and
S. marcescens 278, respectively.
B. Lanes: 1 to 27 – transconjugants: T Ec 26/K12 C600; T Ec 26/
Enteritidis;T Ec 26/Virchow; T Ec 26/Hadar;T Ec 42/K12 C600; T Ec 42/Enteritidis;
T Ec 42/Virchow; T Kp 36/K12 C600; T Kp 36/Enteritidis; T Kp 36/Virchow; T Kp
41/K12 C600; T Kp 41/Enteritidis; T Kp 41/Virchow; T Cf 8/K12 C600; T Cf 8/
Enteritidis; T Cf 933/K12 C600; T Cf 933/Enteritidis; T Cf 933/Virchow; T En 70/
K12 C600; T En 70/Enteritidis; T En 938/K12 C600; T En 938/Enteritidis; T En 938/
Virchow, T 242/K12 C600; T Ser 242/Enteritidis; T Ser 242/Virchow and T Ser
278/K12 C600, respectively
Ryc. 1. Elektroforeza w żelu agarozowym produktów
PCR szczepów biorców, dawców (A) i ich transkoniugantów (B).
A. Ścieżka M – markery długości fragmentów DNA.
Ścieżki: od 1 do 4 – szczepy biorców w kolejności:
S. Enteritidis, S. Virchow S. Hadar and E. coli
K12 C600. Ścieżki: od 5 do 14 – szczepy dawców
w kolejności: E. coli 26; E. coli 42; K. pneumoniae 36; K.
pneumoniae 41; C. freundii 8, C. freundii 933; Ent. cloacae 70; Ent cloacae 938; S. marcescens 242 and
S. marcescens 278, respectively.
B. Ścieżki: od 1 do 27 – transkoniuganty w kolejności:
T Ec 26/K12 C600; T Ec 26/Enteritidis;T Ec 26/Virchow; T Ec 26/Hadar;T Ec 42/K12
C600; T Ec 42/Enteritidis; T Ec 42/Virchow; T Kp 36/K12 C600; T Kp 36/Enteritidis;
T Kp 36/Virchow; T Kp 41/K12 C600; T Kp 41/Enteritidis; T Kp 41/Virchow; T Cf
8/K12 C600; T Cf 8/Enteritidis; T Cf 933/K12 C600; T Cf 933/Enteritidis; T Cf 933/
Virchow; T En 70/K12 C600; T En 70/Enteritidis; T En 938/K12 C600; T En 938/
Enteritidis; T En 938/Virchow, T 242/K12 C600; T Ser 242/Enteritidis; T Ser 242/
Virchow and T Ser 278/K12 C600
Detection of the blaCTX-M Gene
On the basis of PCR amplification, all the
donor strains and their transconjugants, but not
recipients, were found to harbour the blaCTX-M
determinant (Fig. 1).
The emergence of Salmonella enterica serovars exhibiting oxyimino-β-lactam resistance due
to ESBLs poses an increasing clinical problem
throughout the world [7, 11–13]. The conjugational transfer of plasmid-mediated ESBLs occurs
efficiently in intestinal tract where enteric rods,
in particular Escherichia coli and Klebsiella spp.,
often act as the reservoir of self-transmissible plasmids conferring resistance to third-generation
cephalosporins. A good example supporting this
phenomenon has been reported by Su et al. [12].
The authors described the in vivo transmission of
plasmid-borne blaCTX-M-3 gene from E. coli to the
S. Anatum leading to the treatment failures and
fatal sepsis eventually.
It has been shown previously that Salmonella
strains may act as donors of plasmid-mediated
genes coding for ESBLs [9–12]. On the other
hand, the reports concerning the ability of these
microorganisms to acquire ESBL-encoding markers by means of conjugation are very scarce. The
results of the current study clearly showed a common and very effective mechanism of ESBLs dissemination among Gram-negative bacteria via
conjugation. Moreover, own findings revealed
significant differences in acquisition of oxyiminoβ-lactam resistance due to ESBLs synthesis
among the Salmonella enterica recipients studied.
S. Enteritidis was shown to be the best recipient. It
acquired ESBL-encoding plasmids from 9 of the 10
donor strains, followed by S. Infantis. On the other
hand, S. Hadar acquired ESBL-encoding determinants from a single donor strain only. These results
are in agreement with data previously reported by
Sarowska et al. [23].
The susceptibility test data showed that the
ESBL-positive isolates (donors) were multiresistant strains, displaying resistance to most β-lactams
and non-β-lactams. It should be emphasized that
these strains as well as their transconjugants demonstrated significantly higher MIC values of cefotaxime and ceftriaxone (MIC: 128 – > 1024 mg/l)
than those of ceftazidime (MIC: 2 – 32 mg/l). These
findings indicate that this resistance may result
from cefotaximase activity (e.g., CTX-M-type
β-lactamases). In order to check this suggestion,
PCR was performed with P1C and P2D primers
specific for CTX-M family of ESBLs. As expected,
the blaCTX-M determinant was detected in all donor
strains studied and their transconjugants.
CTX-M-type β-lactamases emerged in the
late 1980s, shortly after the introduction of cefotaxime in clinical practice. The global expansion
of the enzymes, however, was observed in the mid
1990s. CTX-M β-lactamases have been derived
2
32
8
8
8
2
4
32
4
Ec 42
Kp 36
Kp 41
Cf 8
Cf 933
En 70
En 938
Ser 242
Ser 278
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
CAZ+Cla
1024
1024
256
256
512
256
256
512
> 1024
512
CTX
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
CTX+Cla
1024
512
256
256
1024
512
512
1024
> 1024
1024
CRO
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
CRO+Cla
128
256
32
64
64
32
32
256
32
128
ATM
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
ATM+Cla
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
IPM
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
MEM
a
CAZ – ceftazydym, CTX – cefotaksym, CRO – ceftriakson, ATM – aztreonam, IPM – imipenem, MEM – meropenem, Gm – gentamycyna,
An – amikacyna, Sxt – kotrimoksazol, Tig – tigecyklina, Cla – kwas klawulanowy w stężeniu 2 mg/l.
b
Odnośnik a w tabeli 1.
a
CAZ – ceftazidime, CTX – cefotaxime, CRO – ceftriaxone, ATM – aztreonam, IPM – imipenem, MEM – meropenem, Gm – gentamicin,
An – amikacin, Sxt – co-trimoxazole, Tig – tigecycline, Cla – clavulanic acid at concentration of 2 mg/l.
b
See footnote a in Table 1.
4
CAZ
Antimicrobial agentsa
(Leki przeciwbakteryjnea)
Ec 26
Donor strainsb
(Szczepy dawcówb)
Tabela 2. Wartości MIC (mg/l) leków przeciwbakteryjnych dla ESBL-dodatnich szczepów dawców (n = 10)
Table 2. MIC values (mg/l) of antibacterial agents for ESBL-positive donors strains (n = 10)
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
Gm
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
An
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
Sxt
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
Tig
318
R. Franiczek et al.
CAZ+Cla
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
4
4
8
8
2
4
4
32
32
32
8
4
4
4
4
2
4
4
2
2
2
T Ec 26/K12 C600
T Ec 26/Enteritidis
T Ec 26/Virchow
T Ec 26/Hadar
T Ec 42/K12 C600
T Ec 42/Enteritidis
T Ec 42/Virchow
T Kp 36/K12 C600
T Kp 36/Enteritidis
T Kp 36/Virchow
T Kp 41/K12 C600
T Kp 41/Enteritidis
T Kp 41/Virchow
T Cf 8/K12 C600
T Cf 8/Enteritidis
T Cf 933/K12 C600
T Cf 933/Enteritidis
T Cf 933/Virchow
T En 70/K12 C600
T En 70/Enteritidis
T En 938/K12 C600
Antimicrobial agents
(Leki przeciwbakteryjne)
CAZ
Transconjugants (Ta)
(Transkoniuganty
(Ta)
128
1024
256
> 1024
256
512
512
256
1024
1024
128
1024
512
512
512
512
256
1024
1024
256
512
CTX
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
CTX+Cla
128
256
512
1024
256
1024
256
512
1024
> 1024
256
256
128
1024
512
256
1024
512
1024
512
1024
CRO
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
CRO+Cla
16
64
64
64
64
32
64
32
64
64
32
16
16
64
16
128
32
128
128
32
64
ATM
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
ATM+Cla
Tabela 3. Wartości MIC (mg/l) leków przeciwbakteryjnych dla transkoniugantów (n = 27) uzyskanych w krzyżówkach
Table 3. MIC values (mg/l) of antibacterial agents for transconjugants (n = 27) obtained in mating experiments
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
IPM
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
MEM
512
> 1024
> 1024
> 1024
> 1024
> 1024
512
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
64
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
Gm
64
1024
128
1024
> 1024
1024
1024
1024
1024
1024
1024
1024
1024
256
1024
1024
512
> 1024
1024
> 1024
1024
An
2
> 1024
<1
> 1024
> 1024
> 1024
> 1024
1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
> 1024
Sxt
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
<1
Tig
Conjugative Transfer of ESBLs
319
<1
<1
<1
<1
<1
8
32
32
32
4
T En 938/Virchow
T 242/K12 C600
T Ser 242/Enteritidis
T Ser 242/Virchow
T Ser 278/K12 C600
512
> 1024
1024
512
1024
CTX
<1
<1
<1
<1
<1
CTX+Cla
512
1024
256
512
256
CRO
<1
<1
<1
<1
<1
CRO+Cla
128
256
128
256
16
ATM
<1
<1
<1
<1
<1
ATM+Cla
<1
<1
<1
<1
<1
IPM
<1
<1
<1
<1
<1
MEM
> 1024
> 1024
> 1024
> 1024
> 1024
Gm
> 1024
1024
1024
> 1024
1024
An
> 1024
> 1024
> 1024
> 1024
> 1024
Sxt
<1
<1
<1
<1
<1
Tig
a
a
Uzyskane w krzyżówkach między szczepem dawcy i biorcy; na przykład T Ec 26/K12 C600, pierwszy skrót (Ec 26) określa szczep dawcy (E. coli 26), a drugi szczep biorcy (E. coli K12 C600).
Obtained in crosses between donor and recipient strains; for example T Ec 26/K12 C600, the first abbreviation (Ec 26) denotes the donor strain (E. coli 26), while the second the recipient strain (E. coli
K12 C600).
CAZ+Cla
Antimicrobial agents
(Leki przeciwbakteryjne)
CAZ
Transconjugants (Ta)
(Transkoniuganty
(Ta)
Tabela 3. Wartości MIC (mg/l) leków przeciwbakteryjnych dla transkoniugantów (n = 27) uzyskanych w krzyżówkach (continued)
Table 3. MIC values (mg/l) of antibacterial agents for transconjugants (n = 27) obtained in mating experiments (cd.)
320
R. Franiczek et al.
Conjugative Transfer of ESBLs
from the chromosomally encoded enzymes of
Kluyvera spp. [24]. In general, these enzymes
preferentially hydrolyze cefotaxime and ceftriaxone but their activity against ceftazidime is usually lower [25, 26]. Nowadays, plasmid-mediated
CTX-M-type β-lactamases are the most prevalent
ESBLs worldwide. These enzymes were identified
in various species of Enterobacteriaceae, including Salmonella enterica serovars [11, 12, 27–29].
In Poland, the first Salmonella serovar Mbandaka
exhibiting oxyimino-β-lactam resistance due to the
expression of CTX-M-3 enzyme has been reported
in 1999 [30]. Since then, this variant of ESBL was
found in other serovars of Salmonella, such as S.
Enteritidis, S. Typhimurium [11], S. Thompson, S.
Muenster and S. Oranienburg [31].
All the donor strains and their transconjugants
were uniformly susceptible to carbapenems and
tigecycline. These findings support previous observations that carbapenems remain the antibiotic in
choice for the treatment of infections caused by
ESBL-producing strains [15, 16, 32]. Additionally,
the results of the present study confirm the high
activity of tigecycline against ESBL-producing
enteric bacilli and are in accordance with those
previously reported by other authors [33–35].
This new semisynthetic antimicrobial, belonging
to the glycylcyclines, demonstrates excellent activity against a wide variety of Gram-positive and
321
Gram-negative bacteria, including enterobacteria
exhibiting ESBL phenotype. For this reason, tigecycline could be considered an encouraging antimicrobial for the treatment of infections involving
these microorganisms.
Resistance to aminoglycosides (gentamicin
and amikacin) and co-trimoxazole was in many
cases co-transferred with ESBL-encoding plasmids to the recipient strains. These findings seem
to confirm the previous observations that genes
coding for ESBLs and those conferring resistance
to non-β-lactam antimicrobial agents are often
localized within the same multi-drug resistance
plasmids that can be horizontally transferred from
one species to another by means of conjugation
[7, 13, 18]. Therefore, such multiresistant ESBLproducing organisms constitute a serious therapeutic problem and might be selected by various
non-β-lactam drugs.
In conclusion, own results suggest that the
extended-spectrum cephalosporins resistance
in Salmonella serovars due to ESBLs may have
been the consequence of an effective plasmid
exchange between Gram-negative strains coexisting in the same environment. Moreover, the
ability to acquire the blaCTX-M genes may depend
on Salmonella enterica serovars, however the further studies are needed to explain precisely these
findings.
References
[1] Parry CM: Antimicrobial drug resistance in Salmonella enterica. Curr Opin Infect Dis 2003, 16, 467–472.
[2] Galanis E, Lo Fo Wong DMA, Patrick ME, Binsztein N, Cieślik A, Chalermchaikit T, Aidra-Kane A, Ellis A,
Angulo FJ, Wegener HC: Web-based surveillance and global Salmonella distribution, 2000–2002. Emerg Infect
Dis 2004, 12, 381–388.
[3] Yen MH, Huang YC, Chiu CH, Lin TY: Duration of antimicrobial therapy for non-typhoid Salmonella bacteremia in healthy children. J Microb Immunol Infect 2002, 35, 94–98.
[4] Fey PD, Safranek TJ, Rupp ME, Dunne EF, Ribot ME, Iwen PC, Bradford PA, Angulo FJ, Hinrichs SH:
Ceftriaxone-resistant Salmonella infection acquired by a child from cattle. N Engl J Med 2000, 342, 1242–1249.
[5] Hohmann EL: Nontyphoidal salmonellosis. Clin Infect Dis 2001, 32, 263–269.
[6] Koeck JL, Arlet G, Philippon A, Basmaciogullari S, Vu Thien H, Buisson Y, Cavallo JD: A plasmid-mediated
CMY-2 β-lactamase from an Algerian clinical isolate of Salmonella senftenberg. FEMS Microbiol Lett 1997, 152,
255–260.
[7] Makanera A, Arlet G, Gautier V, Manai M: Molecular epidemiology and characterization of plasmid-encoded
β-lactamases produced by Tunisian clinical isolates of Salmonella enterica serotype Mbandaka resistant to broadspectrum cephalosporins. J Clin Microbiol 2003, 41, 2940–2945.
[8] Miriagou V, Tassios PT, Legakis NJ, Tzouvelekis LS: Expanded-spectrum cephalosporins resistance in nontyphoid Salmonella. Int J Antimicrob Agents 2004, 23, 547–555.
[9] Vahaboglu H, Dodanli S, Eroglu C, Öztürk R, Soyletir G, Yildirim I, Avkan V: Characterization of multipleantibiotic-resistant Salmonella Typhimurium strains: molecular epidemiology of PER-1-producing isolates and
evidence for nosocomial plasmid exchange by clone. J Clin Microbiol 1996, 34, 2942–2946.
[10] Tassios PT, Gazouli M, Tzelepi E, Milch H, Kozlova N, Sidorenko S, Legakis NJ, Tzouvelekis LS: Spread of
Salmonella Typhimurium clone resistant to expanded-spectrum cephalosporins in three European countries.
J Clin Microbiol 1999, 37, 3774–3777.
[11] Baraniak A, Sadowy E, Hryniewicz W, Gniadkowski M: Two different extended-spectrum beta-lactamases
(ESBLs) in one of the first ESBL-producing salmonella isolates in Poland. J Clin Microbiol 2002, 40, 1095–1097.
[12] Su LH, Chiu CH, Chu C, Wang MH, Chia JH, Wu TL: In vivo acquisition of ceftriaxone resistance in Salmonella
enterica serotype Anatum. Antimicrob Agents Chemother 2003, 47, 563–567.
322
R. Franiczek et al.
[13] Liebana E, Batchelor M, Torres C, Briñas L, Lagos LA, Abdalhamid B, Hanson ND, Martinez-Urtaza J:
Pediatric infection due to multiresistant Salmonella enterica serotype Infantis in Honduras. J Clin Microbiol 2004,
44, 4885–4888.
[14] Usha G, Chunderica M, Prashini M, Willem SA, Yusuf ES: Characterization of extended-spectrum β-lactamases
in Salmonella spp. at a tertiary hospital in Durban, South Africa. Diagn Microbiol Infect Dis 2008, 62, 86–91.
[15] Livermore DM: β-lactamases in laboratory and clinical resistance. Clin Microbiol Rev 1995, 8, 557–584.
[16] Paterson DL, Bonomo RA: Extended-spectrum β-lactamases: a clinical update. Clin Microb Rev 2005, 18, 657–686.
[17] Jacoby GA, Medeiros AA: More extended-spectrum β-lactamases. Antimicrob Agents Chemother 1991, 35,
1697–1704.
[18] Franiczek R, Krzyżanowska B, Dolna I, Mokracka G, Szufnarowski K: Extended-spectrum β-lactamaseconferring transferable resistance to different antimicrobial agents in Enterobacteriaceae isolated from bloodstream infections. Folia Microbiol 2005, 50, 119–1124.
[19] Gray LD: Escherichia, Salmonella, Shigella and Yersinia. In: Manual of clinical microbiology. Eds.: Murray PR,
Baron EJ, Pfaller MA, Tenover FC, Yolken RH, Washington 1995, ASM Press., 450–456.
[20] Clinical and Laboratory Standard Institute: Performance Standards for Antimicrobial Susceptibility Testing.
Wayne PA, USA 2006, 16th Informational Supplement, M100–S15.
[21] Jarlier V, Nicolas MH, Fournier G, Philippon A: Extended broad-spectrum β-lactamases conferring transferable
resistance to newer β-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev
Infect Dis 1988, 10, 867–878.
[22] Gniadkowski M, Schneider I, Pałucha A, Jungwirth R, Mikiewicz B, Bauernfeind A: Cefotaxime-resistant
Enterobacteriaceae isolates from a hospital in Warsaw, Poland: identification of a new CTX-M-3 cefotaximehydrolyzing β-lactamase that is closely related to the CTX-M-1/MEN-1 enzyme. Antimicrob Agents Chemother
1998, 42, 827–832.
[23] Sarowska J, Drulis-Kawa Z, Guz K, Jankowski S, Wojnicz D: Conjugative transfer of plasmid encoding extended-spectrum beta-lactamase to recipient Salmonella strains. Adv Clin Exp Med 2009, 18, 63–70.
[24] Humeniuk C, Arlet G, Gautier V, Grimont P, Labia R, Philippon A: β-lactamases of Kluyvera ascorbata, probable progenitors of some plasmid-encoded CTX-M types. Antimicrob Agents Chemother 2002, 46, 3045–3049.
[25] Alobwede I, M’Zali FH, Livermore DM, Heritage J, Todd N, Hawkey PM: CTX-M extended-spectrum
β-lactamase arrives in the UK. J Antimicrob Chemother 2003, 51, 470–471.
[26] Bonnet R: Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob Agents
Chemother 2004, 48, 1–14.
[27] Izumyia H, Mori K, Higashide M, Tamura K, Takai N, Hirose K, Terajima J, Watanabe H: Identification
of CTX-M-14 β-lactamase in Salmonella enterica serovar Enteritidis isolate from Japan. Antimicrob Agents
Chemother 2005, 49, 2568–2570.
[28] Bahar G, Mert A, Catania MR, Koncan R, Benvenuti C, Mazzariol A: A strain of Salmonella enterica serovar Virchow
isolated in Turkey and carrying a CTX-M-3 extended-spectrum β-lactamase. J Chemother 2006, 18, 307–310.
[29] Bertrand S, Weill FX, Cloeckeart A, Vrints M, Mairiaux E, Praud K, Dierick K, Wildemauve Ch, Godard C,
Butaye P, Imberechts H, Grimont AD, Collard JM: Clonal emergence of extended-spectrum β-lactamase (CTXM-2)-producing Salmonella enterica serovar Virchow isolates with reduced susceptibilities to ciprofloxacin among
poultry and humans in Belgium and France (2000–2003). J Clin Microbiol 2006, 44, 2897–2903.
[30] Gierczyński R, Szych J, Rastawicki W, Jagielski M: The molecular characterization of the extended-spectrum
beta-lactamase (ESBL) producing strain of Salmonella enterica serovar Mbandaka isolated in Poland. Acta
Microbiol Pol 2003, 52, 183–190.
[31] Szych J, Gierczyński R, Wardak S, Cieślik A: The occurrence and characterization of oxyimino-β-lactams resistant
strains among Salmonella enterica subsp. enterica isolated in Poland. Med Dosw Microbiol 2005, 57, 115–130.
[32] Medeiros AA: Evolution and dissemination of β-lactamases accelerated by generations of β-lactam antibiotics.
Clin Infect Dis 1997, 24, 19–45.
[33] Biedenbach DJ, Beach ML, Jones RN: In vitro antimicrobial activity of GAR-936 tested against antibiotic-resistant Gram-positive bloodstream infection isolates and strains producing expended-spectrum β-lactamases. Diagn
Microbiol Infect Dis 2001, 40, 173–177.
[34] Morosini MI, Garcia-Castillo M, Coque TM, Valverde A, Novais A, Loza E, Baquero F, Canton R: Antibiotic
coresistance in extended-spectrum-β-lactamase-producing Enterobacteriaceae and in vitro activity of tigecycline.
Antimicrob Agents Chemother 2006, 50, 2695–2699.
[35] Sorlozano A, Gutierrez J, Salmeron A, Luna JD, Martinez-Checa F, Roman J, Piedrola G: Activity of tigecycline
against clinical isolates of Staphylococcus aureus and extended-spectrum β-lactamase-producing Escherichia coli in
Granada, Spain. Int J Antimicrob Agents 2006, 28, 532–536.
Address for correspondence:
Roman Franiczek
Department of Microbiology
Wroclaw Medical University
Chałubińskiego 4
50-368 Wrocław
Poland
Phone: +48 71 784 13 02
E-mail: [email protected]
Conflict of interest: None declared
Received: 29.03.2010
Revised: 22.04.2010
Accepted: 7.06.2010