from microbiology.pl - Polish Journal of Microbiology

Transkrypt

P O L S K I E T O WA R Z Y S T W O M I K R O B I O L O G Ó W
POLISH SOCIETY OF MICROBIOLOGISTS
Polish Journal of Microbiology
2014
formely Acta Microbiologica Polonica
2014, Vol. 63, No 1
CONTENTS
MINIREWIEV
Use of plant extracts to control and treat AB5 enterotoxin-related diarrhea
KOMIAZYK M., PALCZEWSKA M., SITKIEWICZ I., GROVES P. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
ORIGINAL PAPERS
Quantitative expression of Candida albicans aspartyl proteinase genes SAP7, SAP8, SAP9, SAP10 in human serum in vitro
STANISZEWSKA M., BONDARYK M., MALEWSKI T., KURZĄTKOWSKI W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
The effect of oleanolic and ursolic acids on the hemolytic properties and biofilm formation of Listeria monocytogenes
KUREK A., MARKOWSKA K., GRUDNIAK A.M., JANISZOWSKA W., WOLSKA K.I. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
Iron shortage and bile salts play a major role in the expression of ompK gene in Vibrio anguillarum
HAMOD M.A., BHOWMICK P.P., SHUKUR Y.N., KARUNASAGAR I., KARUNASAGAR I. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Development of synbiotics with inulin, palatinose, α-cyclodextrin and probiotic bacteria
PRANCKUTĖ R., KAUNIETIS A., KUISIENĖ N., ČITAVIČIUS D. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
Uropathogenic Escherichia coli isolates with different virulence genes content exhibit similar pathologic influence on vero cells
OBAID J.M.A.S., MANSOUR S.R., ELSHAHEDY M.S., RABIE T.E., AZAB A.M.H. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
Novobiocin sensitivity of Salmonella typhimurium dam and/or seqA mutants
CHATTI A., ALOUI M., TAGOURTI J., MIHOUB M., LANDOULSI A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
The antimicrobial susceptibility of Helicobacter pylori strains isolated from children and adults with primary infection
in the lower silesia region, Poland
GOŚCINIAK G., BIERNAT M., GRABIŃSKA J., BIŃKOWSKA A., PONIEWIERKA E., IWAŃCZAK B. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
Helicobacter pylori infection in type 1 diabetes children and adolescents using 13C urea breath test
CHOBOT A., BĄK-DRABIK K., SKAŁA-ZAMOROWSKA E., KRZYWICKA A., KWIECIEŃ J., POLAŃSKA J. . . . . . . . . . . . . . . . . . . . . 63
The utility of Caco-2 cells in isolation of enteroviruses from environmental and clinical material
WIECZOREK M., CIĄĆKA A., WITEK A., LITWIŃSKA B. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
Psychrotrophic lipase producers from arctic soil and sediment samples
R. RASOL R., RASHIDAH A.R., NAZUHA R.S.N., SMYKLA J., WAN MAZNAH W.O., ALIAS S.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
Plant growth promotion rhizobacteria in onion production
ČOLO J., HAJNAL-JAFARI T.I., ĐURIĆ S., STAMENOV D., HAMIDOVIĆ S. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
The prevalence of Anaplasma phagocytophilum in questing Ixodes ricinus ticks in SW Poland
KIEWRA D., ZALEŚNY G., CZUŁOWSKA A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
Biocontrol efficacy of different isolates of Trichoderma against soil borne pathogen Rhizoctonia solani
ASAD S.A., ALI N., HAMEED A., KHAN S.A., AHMAD R., BILAL M., SHAHZAD M., TABASSUM A. . . . . . . . . . . . . . . . . . . . . . . . . . . . 95
Prevalence of EBV genotypes in Polish, Taiwanese and Arabic healthy students and association between genotypes
and 30-bp deletion in the LMP-1 gene phylogenetic analysis
POLZ D., PODSIADŁO Ł., STEC A., POLZ-DACEWICZ M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
SHORT COMMUNICATIONS
Microbial transformations of 3-methoxyflavone by strains of Aspergillus niger
KOSTRZEWA-SUSŁOW E., DYMARSKA M., JANECZKO T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
Zeaxanthin biosynthesis by members of the genus Muricauda
SUDHARSHAN PRABHU, REKHA P.D. ARUN A.B. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115
INSTRUCTION FOR AUTHORS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121
INSTRUCTION FOR AUTHORS
Submission of manuscripts: http://pjm.indexcopernicus.com/
Instructions for authors: http://www.pjm.microbiology.pl/
2014, Vol. 63, No 1, 3–14
MINIREVIEW
Use of Plant Extracts to Control
and Treat AB5 Enterotoxin-Related Diarrhea
MAGDALENA KOMIAZYK1, 2, MAŁGORZATA PALCZEWSKA1, IZABELA SITKIEWICZ3
and PATRICK GROVES1*
Laboratory of Molecular Interactions and NMR, Instituto de Tecnologia Química e Biológica (ITQB-UNL),
Oeiras, Portugal
2
Laboratory of Biochemistry of Lipids, Nencki Institute of Experimental Biology, Warsaw, Poland
3
Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Warsaw, Poland
1
Submitted 27 December 2013, accepted 30 December 2013
Abstract
Plants contain a broad spectrum of small molecules with potential antimicrobial properties. Here, we review the antimicrobial activities of
plant extracts against enterotoxic bacteria encoding AB5 toxins, including Vibrio cholerae, Shigella dysenteriae and enterotoxic Escherichia
coli strains. Several plant extracts have strong antimicrobial effects and the potential to boost Oral Rehydration Therapy, which is the first
line of treatment for acute diarrhea.
K e y w o r d s: Escherichia coli, Shigella dysenteriae, Vibrio cholerae, AB5 enterotoxin, plant extracts
1. Introduction
The World Health Organization (WHO) prepares
yearly reports on the global status of diarrheal diseases
(http://www.who.int/topics/diarrhoea/en/). In addition
to reporting statistics for the number of cases and fatalities, the WHO identifies actions to reduce the spread
of disease and improve treatments. In developed, rich
countries, diarrhea is usually associated with poor
hygiene standards in the food industry but in poor countries the majority of cases are related to a lack of clean
water supplies and underdeveloped medical networks.
Diarrheal symptoms can be caused by multiple
inflammatory bowel diseases such as ulcerative colitis,
Crohn’s disease or irritable bowel syndrome. However,
symptoms can also be caused by a wide range of bacteria (Campylobacter sp., Clostridium sp., Staphylococcus
aureus, Vibrio cholerae, Shigella dysenteriae, enterotoxic strains of Escherichia coli), viruses (rotaviruses,
noroviruses) and parasites (Giardia lamblia, Entamoeba
histolytica and Cryptosporidium sp.). Because of the
difficulties in diagnosis and the need of rapid therapy to
prevent water and ion loss, rehydration therapy is used
as a first line of action.
Oral Rehydration Therapy (ORT) provides a simple
and rapid treatment that can be given by any adult to
a suffering individual, either adult or a child, to improve
recovery from diarrhea. ORT solutions are usually composed of water, sodium chloride, glucose, potassium
ions and citrate and the formulation currently recommended by the WHO has an osmolarity of 245 mmol/L
(Anonymous, 2002). In contrast, intravenous rehydration requires a nurse while drugs require a doctor and
a significant period of time to start working. It must
be stressed that ORT alleviates the symptoms and aids
recovery but does not cure the source of the diarrheal
episode. The treatment of diarrhea depends on the initial source, which often is not known. It has been suggested that the use of antibiotics for the treatment of
diarrhea worsens the problem in cases related to infections with bacteria carrying phages encoding endotoxins (Prins, 1994). Therefore, ORT is of particular
importance where the infectious agent has already been
removed by the diarrheal episode.
Edible plants are traditionally used by many societies to alleviate and cure diarrhea. The properties of
traditional plant extracts are worth exploring as they
can stop or kill bacterial growth, neutralize or deactivate enterotoxins, are cheap and readily available, can
give a better flavor to ORT, provide useful microelements and vitamins, and last, but not least, edible plants
do not require the same level of extensive testing or
* Corresponding author: P. Groves, Molecular Interactions and NMR, Instituto de Tecnologia Química e Biológica (ITQB-UNL),
Av. da República (Estação Agronómica Nacional), 2780-157 Oeiras Oeiras, Portugal; phone: (+351) 214 469 300; fax: (+351) 214 411 277;
e-mail: [email protected]
4
Komiazyk M. et al.
regulatory approval as new drugs. This review covers the scientific literature relevant to the use of plant
extracts to treat enterotoxic bacterial disease, particularly diarrhea caused by the AB5 family of enterotoxins
(V. cholera, S. dysenteriae and enterotoxin producing
strains of E. coli). Together, the organisms that produce
AB5 enterotoxins result in more than 200 million episodes of diarrhea per year and around 2 million deaths.
The plants reviewed here provide potential leads for
improving ORT formulations and properties.
2. Mode of action of enterotoxic bacteria
AB5 enterotoxins are originally encoded by pro
phages STX1 or STX2 of Shigella sp. (Herold, 2005), or
by phage CTXφ of Vibrio sp. (McCloud, 2004). Strains
of the bacteria that do not express enterotoxins, which
are a majority, are usually benign. Phages can undergo
horizontal transfer and infect/transfer the toxin to other
bacterial species and this is the case for the STX1 and
STX2 prophages with E. coli. The primary role of AB5
molecules is not known. Recently it’s been suggested
1
that AB5 enterotoxin is a weapon against protozoa and
immune system cells such as nucleophiles and their
production is activated by reactive oxygen species.
Enterotoxic bacterial infection proceeds from the
ingestion of contaminated water or food. Sufficient
numbers of bacteria must survive passage through the
stomach and into the intestine, where they anchor to
the intestinal wall. Here, they colonize the intestinal
wall and grow without any great ill-effects to the host.
Once the bacterial colony reaches a certain number of
cells, enterotoxin production is switched on. The assembled enterotoxin is secreted via the type II secretion
system. Recent developments in research on strategies
of V. cholerae to maintain fitness in different ecological
niches and protein production are described in a recent
review by Sikora (Sikora, 2013).
Cholera is a model bacterial disease caused by
microorganisms producing AB5-type enterotoxins
(Beddoe et al., 2010). The molecular structure of the
toxin is formed from a proper toxin – A subunit and
donut-like ring of five B-subunits, Figure 1. The B-subunits, which recognize GM1 gangliosides in human cells,
act as a chaperone/delivery vehicle for the A-subunit
Fig. 1. Primary and 3D structural data for cholera toxin (PDB accession code 1XTC).
A) Protein sequence of cholera toxin subunit A. The first 18 residues (italics) constitute a signal sequence that is removed during secretion. The
A1 domain is separated from the A2 domain by ‘nicking’ – an exogenous human protease breaks the backbone chain between residue Ser212 and
Met213. The A2 domain is denoted in italics and bold text. The A1 and A2 remain joined through a Cys-Cys linkage denoted by a line. B) Protein
sequence of the cholera toxin subunit B. The signal peptide (italics) is removed during secretion from V. cholerae. C) Structure of cholera toxin (PDB:
1XTC) as a cartoon representation of the secondary structure elements of cholera toxin. The five B-subunits are colored in green-blue shades. The
A2 subunit (magenta) forms a long helical element that is embed in the center of the donut-shaped B-subunit pentamer. The A2 subunit is linked to
the A1 subunit (yellow) through disulfide bonds. B) schematic representation of the enterotoxin structure. The GM1-binding sites are situated in the
B-subunits and on the opposite face of the A1 subunit.
1
Plant extracts against enterotoxic bacteria
that sits on the opposite face of the donut. The B-subunits of different enterotoxic bacteria have similar secondary and tertiary structures, as well as similar modes
of binding to GM1, although their primary amino acid
sequences are quite distinct. The A-subunit is formed
from two polypeptide chains: a long alpha-helical A2
domain that anchors the A1 domain into the hole of
the B5 structure. The A1 domain, crosslinked to the
A2 domain through disulfide bonds, is processed in the
endoplasmic reticulum and released to the cytoplasm.
The introduction of the toxin to human cells follows a specific path involving initial endocytosis of the
GM1-toxin complex followed by transport to the Golgi
and endoplasmic reticulum. The toxin is processed
in the endoplasmic reticulum and the A1 subunit is
released into the cytoplasm where subunit A1 binds
to, and activates, ADP-ribosylation factor 6 (Arf6).
This unwanted stimulation interferes with a range of
cellular processes involving cAMP. In particular, the
disregulation of cAMP levels results in the opening of
ion channels and rapid loss of ions and water from the
human cell which forms the diarrheal episode (Kopic
and Geibel, 2010).
The multi-step process of the bacterial life cycle,
involvement of a bacteriophage, toxin production,
transport and action provides several potential targets where the disease process can be mediated/modified. Plant extracts can inhibit the initial anchoring
of bacteria to the digestive system (Birdi et al., 2010),
down-regulate toxin production in bacteria (Birdi
et al., 2010; Brijesh et al., 2009), inhibit the binding of
toxin to GM1 (Birdi et al., 2010; J.-C. Chen et al., 2006;
2007; 2009;), close toxin-activated ion channels (Fischer
et al., 2004) etc.
Despite this, the majority of the reported research
focuses almost exclusively on the antimicrobial properties of plants (Table I). However, it needs to be noted
that concentration of studied antimicrobial plant
extracts is usually much higher and expressed as minimal inhibitory concentration (MIC) in mg/ml range
than those observed for antibiotics – usually in µg/ml
(http://www.eucast.org/mic_distributions/).
Plants have been used as a treatment and source of
active substances for millennia with Ayurvedic practice and the roots of Chinese medicine providing the
best established, documented and known examples.
Ethnopharmacists collect the remaining local folk
knowledge in various worldwide regions such as India
(Dey and De, 2012; Tetali et al., 2009), Indonesia (Grosvenor, Supriono and Gray, 1995) or Nigeria (Tekwu,
Pieme and Beng, 2012). In the majority of cases, little
or no scientific validation has been provided for the
efficacy of plant extracts against disease. Experienced
practitioners of plant medicine take careful note on the
method of collection and storage of the plant material,
5
as well as the preparation and use of the plant extract.
Still, there is often a lack of validated identification of
the bacterial species, treatment process, plant used,
or use of placebo controls. This is best exemplified by
making a simple internet search that often results in
general list of diseases that can be cured by a particular
plant, very often without any useful details on how to
prepare or use the plant material.
Scientists have validated the beneficial effects of
many plant extracts, including those against enterotoxic
bacteria, particularly the more common and readily
available plants. The antimicrobial active ingredients
are often hydrophobic in nature and are most efficiently
obtained by organic solvent extraction such as ethanol,
methanol or acetone requiring a chemical laboratory
(e.g. Rajan, Thirunalasundari and Jeeva, 2011). Data are
also collected for simple aqueous extracts or decoctions
– basically equivalent to a cup of herbal tea or broth.
While ethanol extracts might support the effects of
alcoholic beverages popularly used as digestives, they
are clearly unsuitable for children less than five years
old who represent one of the most sensitive groups
of diarrhea patients. The use of methanol or acetone
as a solvent raises safety issues. While the production
of essential oils through steam distillation is an energy
and time consuming process, unwanted solvents can
be avoided and a safer product can be produced. They
also potentially work in much lower concentrations
then aqueous extracts and so they make an interesting
alternative. Still, in our opinion, the ideal, active plant
extracts should be available from a simple cold or hot
water extract. Considering this point, the reviewed literature is focused towards the use of aqueous extracts.
3. Examples of active plants, plant parts
and mode of preparation
Folk medicine provides the starting point for many
investigations and the selection of plants and part of
the plants to study. However, we must recognize that
the properties of plants that have been cultivated and
selected over the millennia may change. For example
1000 year old Anglo-Saxon recipes were used to test
the antibacterial properties of plants such as Potentilla
reptans (European cinquefoil) against wound infections
and modern experiments found that plant extracts have
stronger antimicrobial properties against gram negative
intestinal bacteria such as E. coli than wound-infecting
bacteria (S. aureus) (Watkins et al., 2012). This makes
the extracts useful for a possible treatment of diarrhea,
and maybe less suitable in their original use to treat
skin lesions.
Indian Ayurvedic medicine is based on phytomedicinal properties practiced over several millennia.
Studies on Ayurvedic recipes revealed that an aqueous
plant name
Plant
common name
(plant’s part)
Method of preparation
Tested enteropathogens
Assay
MIC MeOH = 32.4 mg/ml
MIC EO = 25.8 mg/ml
MIC EO =24.1 mg/ml
MBC: crude preparation
– 1.25mg/ml and methanol
extract – 0.85 mg/ml
Vernonia polyanthes –
Asia
Psidium guajava
Guava
Methanol extract and
V. cholerae O1
(Bangladesh) (leaves and bark) crude aqueous mixture 1. Agar diffusion method
2. Microdilution method
(MIC and MBC)
MIC EO = 27.6 mg/ml
South
Eugenia uniflora
Brazilian Cherry Essential oil and methanol Sixteen E. coli strains isolated Agar dilution method
America
extract from human specimens in the
Clinical Hospital of Botucatu
Baccharis
Medical School
dracunculifolia –
(stem bark)
Rahim et al.,
2010
Silva et al.,
2012
Delaquis
et al., 2002
Mathabe et al.,
2006
The MIC is dependent
on plant extract preparation
and bacte rial strain.
All of the plants have
antimicrobial activities
0.039–0.312 mg/ml. against
V. cholerae, S. dysenteriae and
S. flexneri. E.coli is resistant
to E. burkei, E. elephantina,
S. brachypetala
and S. cordatum
EO from eucalyptus has very
similar activity to coriander
seeds (0.2% vol/vol).
Ximenia caffra
Tekwu et al.,
2012
Reference
The MIC is dependent on the
solvents and is between 0.032
(MeOH N. latifoli bark extr.)
and 0.512 mg/ml.
Result
Eucalyptus dives
Eucalyptus
Essential oil (EO)
E.coli O157:H7,
Broth microdilution
Lactobacillus sp.
with 0.15% agar
Africa
Albizia
(leaves)
Hexane, ethyl acetate and E. coli LMP0101U,
1. Agar disc diffusion (Cameroon)gummifera
methanol (MeOH) extracts S. dysenteriae LMP0208U, 2. Broth microdilution method
S. flexneri LMP0313U
(MIC) with 0,5% phenol red
Ficus exasperata (leaves and bark)
Nauclea latifoli (leaves and bark)
South Africa Elephantorrhiza
(stem rhizome) methanol, acetone, ethanol V. cholerae, E. coli ATCC 35218, 1. Agar-well diffusion
burkei and boiling water extracts Shigella dysenteriae,
2. Broth microdilution (MIC)
Shigella
flexneri,
Shigella
sonnei,
Elephantorrhiza
(stem rhizome)
Shihella boydii
elephantina
Gymnosporia(roots)
senegalensis
Indigofera (whole plant)
daleoides
Ozoroa insignis
(stem bark)
Spirostachys africana (stem bark)
Schotia brachypetala Huilboerboon
(stem bark)
Syzygium cordatum Water berry
(stem bark)
Region
Table I
Summary of antimicrobial properties of various plant extracts
6
Komiazyk M. et al.
1
plant name
Plant
common name
(plant’s part)
1. Disc diffusion
2. Broth microdilution
(MIC and MBC) Assay
Reference
EO has antibacterial activity Burt and
against E. coli
Reinders,
(max. MBC – 0.08–2.5 µl/ml) 2003
Result
Allium sativum
Garlic
Water extract
E. coli O157
1. Growth of E. coli on agar plates containing 1–2% of garlic extract 2. E. coli O/N culture was
added to garlic extract and
the number of living cells was
counted on agar plates
Garlic has antimicrobial
activity against E. coli O157.
Fresh garlic killed E. coli
much faster than 1 year old
garlic powder.
Sasaki et al.,
1999
MIC: aq extr. – 0.38 mg/ml,
Rajan et al.,
EtOH extr. – 0.19mg/ml 2011
1. Disc diffusion method
2. Agar dilution method
Mangifera indica Mango (kernel)
Ethanol (EtOH) and
S. dysenteriae
aqueous extract MBC fruit and bark =
Nwodo, et al.,
= 125 mg/ml. Only one E. coli 2011
strain was resistant to
250 mg/ml tamarind extract.
Leaves have the lowest
antimicrobial activity.
Asia
Tamarindus indica Tamarind
Ethanol, hot and cold
E. coli from diarrheal stools
1. Agar diffusion method
(leaves, stemp
water extracts
(7 strains) E. coli ATCC 11775 2. Macrodilution method
bark, fruit pulp)
(MIC and MBC)
North
Caesalpinia
Poinciana
Methanol and aqueous
E. coli ATCC 25922 (control), Agar dilulution
These plant extracts were
Alanís, et al.,
America
pulcherrima
extracts
clinical isolates
(1, 2, 4 and 8 mg/ml)
tested at concentration
2005
(Mexico)
of E. coli 0157:H7, S. ssonnei
of 8 mg/ml and found
Chiranthodendron Mexican
and S. flexneri
to inhibit the growth
pentadactylon
hand tree
of tested strains.
Chrysactinia –
Methanol extracts have better
mexicana
antimicrobial activities than
aqueous solutions
Geranium
(roots and
mexicanum
aerial part)
Punica granatum
pomegranate
Asia
Cinnamomum
cinnamon (bark) water, ethanol and
E. coli O157:H7,
1. E. coli was cultured with
Cinnamon bark has
Muthuswamy,
(Sri Lanka) zeylanicum
petroleum ether-based
E. coli ATCC 25921,
three different concentrations antibacterial activity against
et al., 2007
extracts, essential oil
E. coli ATCC25922
of cinnamon extract.
E. coli. The antibacterial
Senhaji,
and E. coli ATCC11105
2. Identification of the anti-
compound is cinnamic
et al., 2007
microbial compound
aldehyde.
3. Broth microdilution(MIC)
4. Disc diffusion
North
Origanum vulgare
oregano
Essential oil
E.coli O157:H7
America
(Caribbean) Thymus vulgaris
thyme
Region
Table I continued
1
7
MBC: E. coli – 0.625 mg/ml
and Vibrio spp.
– 0.31–1.25 mg/ml
Hajlaoui et al.,
2010
Illicium verum
Star anise
ethanol and petroleum
E. coli
extracts
Standard agar cup plate
Antimicrobial activity of star
method – active coumpounds anise is mainly due
were studied
to anethole
De et al.,
2002
Asia (India) Azadirachta indica neem (leaves)
methanol extract
V. cholerae (NB2 and SG24)
1. Disc diffusion
MBC = 10 mg/ml
Thakurta P.
– belonged to O1 and O139, 2. Broth microdilution
MIC > 5 mg/ml
et al.
PC4, PC9, PC11, PC14
(MIC and MBC)
serotypes
1. Disc diffusion
2. Brothmicro dilution
(MIC and MBC)
Mathabe
et al., 2006
Mazumder R.,
et al.
Reference
Cuminum cyminum Cumin (seeds) Essential oil
E. coli ATCC 35218 and
11 Vibrio spp. strains
Result
Tea has antimicrobial activity Bandyoagainst studied bacteria.
padhyay
Growth of most E. coli strains et al., 2005
was inhibited between
10–20 µg/ml; Shigella spp.:
20–30 µg/ml and V.cholerae:
10–30 µg/ml.
Assay
Camellia sinensis
tea (leaves)
Alcohol extract – dried and 111 baterial strains were tested Agar dilution method
brown powder was used including: 15 E. coli,
24 Shigella spp.
and 23 V. cholerae
The lowest activity against
tested bacteria with water
extract
(MIC: 0.156–0.3 mg/ml).
With other solvents
– MIC: 0.078 mg/ml
Punica granatum
(rind and roots) methanol, acetone, ethanol E. coli UP 2566, S. dysenteriae 1. Agar well diffusion method
and boiling water extracts IOA-108, V. cholerae, (150 mg/ml)
E. coli ATCC 35218
2. Broth microdilution (MIC)
common name
(plant’s part)
MIC: E. coil AM 8/98
– 2–5 µg/ml; S. dysenteriae,
E. coli VC sonawave 3:37C
and E. coli CD/99/1
– 150 µg/ml; V. cholerae
– 100–150 µg/ml;
L.arabinosus
–150–200 µg/ml
plant name
Plant
Asia
Curcuma longa
Tumeric leaves Methanol extract
E. coil AM 8/98, S. dysenteriae 1, 1. Agar dilution method
2 and 6, E. coli VC sonawave
2. Disc diffusion
3:37C, E. coli CD/99/1,
V. cholerae 865, Lactobacillus
arabinosus CD /99/1
Region
Table I continued
8
Komiazyk M. et al.
1
plant name
common name
(plant’s part)
Assay
Eucalyptus sp.
Eucalyptus
leaves)
Casuarina
She-oak
equisetifolia
(bark and leaves)
Zizyphus jujuba
Jujube (leaves)
Syzgium cumini
Jamun
(bark and leaves)
Syzygium
Clove
aromaticum
(bud and oil)
Saussurea lappa
(roots)
Acorus calamus
Sweet flag
(rhizome)
Allium cepa
Onion (leaves)
Camelia sinensis
Tea (leaves)
Europe
Vaccinium myrtillus Blueberry
Lyophilized berry extract E. coli ATTC 11775, 1. Agar diffusion method
(berries)
and phenolic compounds E. coli CM871
2. Bacteria growth curve
Lactobacillus sp. (7 strains)
Rubus idaeusRaspberry
measurement – bacteria grew
(berries)
with 0.5, 1 or 5 mg/ml berry
Vaccinium vitisidaca Lingonberry
extracts
(berries)
Ribes nigrum
Blackcurrant
(berries)
Rubus chamaemorus Cloudberry
(berries)
Vaccinium oxycoccus Cranberry
(berries)
Hippophae
Sea buckthorn
rhamnoides
berry (berries)
Fragaria ananassa
Strawberry
(berries)
Holy Basil
70% alcohol extract
E. coli UP 2566,
Agar well diffusion method
(whole plant)
S. dysenteriae IOA-108
(150 mg/ml) – 45 Indian
plants were tested
White mulberry
(leaves)
Indian sarsaparilla (roots)
Plant
Asia (India Ocimum sanctum
Morus alba
Hemidesmus
indicus
Region
Table I continued
Finnish berry extracts
(1 mg/ml) have animicrobial
activity against E. coli
(except Blackcurrant
to ATTC 11775).
All studied probiotic bacteria
are resistant to these extracts
150 mg/ml of plants
extracts can inhibit growth
of S.dysenteriae and E. coli.
But ork better against E. coli.
150 mg/ml of plants extracts
with similar efficacy can
inhibit growth of E. coli and
S. dysenteriae
150 mg/ml of plants
extracts can inhibit growth
of S. dysenteriae and E. coli.
Extracts work better against
Shigella.
Result
Puupponen-Pimiä et al.,
2001
Ahmad and
Beg 2001
Reference
1
9
plant name
common name
(plant’s part)
Result
1. Disc diffusion
MBC: E. coli – 4 µl/ml and
and V. cholerae – 1 µl/m
(MIC and MBC)
Assay
Creeping
cinquefoil (aerial
parts and roots)
MIC EtOH = 43.4 mg/ml
MIC EO = 28.2 mg/ml
Matricaria Chamomile
Essential oil and methanol
chamomilla
extract Burt and
Reinders,
2003
Origanum vulgare
Oregano
Essential oil
E. coli O157:H7
1. Disc diffusion
EO has antibacterial activity
against E. coli
(MIC and MBC) Adiguzel
et al., 2009
Zomorodian
et al., 2012
Silva et al.,
2012
Delaquis et al.,
2002
Nepeta cataria
Catnip (plants at Methanol extract and
E. coli A1, Shigella spp.,
1. Disc diffusion
MIC MeOH: 31.25 µg/ml
flowering stage) essential oil
E. coli ATCC 43894
MIC EO: 125µg/ml
(MIC and MBC)
Sixteen E. coli strains isolated Agar dilution method
from human specimens in the
Clinical Hospital of Botucatu
Medical School
Watkins et al.,
2012
Mahboubi
and Haghi,
2008
Reference
Methanol extract has better
Burt and
antimicrobial activity than
Reinders,
aqueous. Methanol extract
2003
of thyme inhibits 100% growth
of all tested strains.
EO from coriander leaves
have almost two times less
antimicrobial activity than
seeds (0.4%vol/vol) and is
similar to dill. (0.2%vol/vol).
1. Disc diffusion
(MIC and MBC)
3. Agar dilulution
(1, 2, 4 and 8 mg/ml)
Europe/Asia Anethum graveolens Dill
Essential oil
E. coli O157:H7,
Broth microdilution
Lactobacillus sp. with 0.15% agar
Coriandrum sativum Coriander
(leaves and
seeds)
Thymus vulgaris
Thyme
Essential oil, methanol
E. coli O157:H7,
and aqueous extracts
E. coli ATTC 25922 (control),
S. sonnei–1,2 and S. flexneri–1,2
Potentilla reptans
Agrimonia eupatoria Agrimony (aerial Red wine, ethanol
E. coli (UEL 57)
Microdilution method (MIC) 0.2 mg/ml of root aq
parts and roots) (25% or 75%) and boiling and EtOH. extract inhibit
water extracts (aq)
> 60% E. coli growth
Squaw Mint
Essential oil
E. coli ATCC 8739, V. cholerae
(flowering aerial
Inaba
parts)
Plant
Europe
Mentha pulegium
Region
Table I continued
10
Komiazyk M. et al.
1
1
decoction of guava leaves (Psidium guajava) and unripe
bael fruit (Aegle marmelos) was found to have weak bacteriostatic/bacteriocidal properties (Birdi et al., 2010;
Brijesh et al., 2009). The study also included tests of
adherence/invasion potential of different bacterial species producing enterotoxins to human cells in the presence of plant extract. Because extracts of both plants
inhibited the adherence and invasion of bacteria, they
could play a positive role in the treatment of bacterial
infection by inhibiting the initial colonization of the
digestive system by the bacteria. This is a very important but rarely studied phenomena despite the fact that
disruption of attachment – the first stage of bacterial
infection – is a key property to prevent disease onset.
Finding and using plants with this properties could be
crucial in case of infections caused by hemolytic strains
causing bloody diarrhea that are the most damaging
and difficult forms of diarrhea to treat, requiring hospitalization, antibiotic treatment and which cannot currently be alleviated by ORT alone.
The method in which plant extracts are prepared
contributes greatly to its efficacy. Prolonged heat treatment might degrade active ingredients present in the
initial plant extract or lead to chemical modifications
and an increase in the concentration of active ingredients. Examples of different treatment outcomes depending on the extract preparation were described by Rahim
et al. and Birdi (Rahim et al., 2010; Birdi et al., 2010).
Birdi et al. found that extract of guava (P. guajava)
leaves were more effective against antibiotic-resistant
V. cholerae strains than Birdi, however, Rahim prepared
a cold water extract of the guava leaves whereas Birdi
heated and reduced the plant extracts (Rahim et al.,
2010; Birdi et al., 2010). This suggests that heating may
destroy part of the antibacterial properties of the guava
leaves although Rahim et al. did not find that heating
of their samples reduced their efficacy (Rahim et al.,
2010). Variable antimicrobial properties of particular
plant extracts can be commonly found in the literature,
which stresses the fact that careful attention must be
paid to sample collection, storage and preparation, as
well as the bacteria strains used in subsequent studies.
The specificity of antimicrobial activities of plant
extracts towards pathogenic bacterial strains as compared with benign strains are rarely tested. An example
of a study addressing this issue is the test of 26 Mexican
plant extracts against non-pathogenic E. coli and the
enterotoxic E. coli O157:H7, amongst others (Alanís
et al., 2005). The aqueous extracts used in these studies
showed a much better specificity for the pathogenic
E. coli O157:H7 strain over a non-pathogenic E. coli
strain when compared to methanolic extracts. Carica
papaya (papaya), Ocimum basilicum (basil), Matricaria
chamomilla (chamomile) and Thymus vulgaris (thyme)
are commonly known plants reported with such anti-
11
microbial specificity. Patient recovery rates and reestablishing gut flora, which can take several weeks following hospitalization, are an important consideration
with respect to diarrhea. The retention of any beneficial
bacteria in the digestive system by the selective action
of plant extracts has much to be recommended.
Organic solvents, chiefly ethanol and methanol,
are often used to obtain active ingredients from plant
extracts but using them in the treatment of patients
with acute diarrhea is highly questionable. A refluxed
ethanolic extract of cinnamon (Cinnamomum zey
lanicum) inhibited the growth of Listeria inocua and
E. coli O157:H7 but an aqueous extract was ineffective
(Muthuswamy, Rupasinghe and Stratton, 2007). The
50-fold dilution of the ethanolic extracts means that
the final solution still contains 2% ethanol, which is
unsuitable for the treatment of dehydrated patients,
particularly children. Senhaji found that the essential
oil of the same plant, obtained without organic solvents,
was effective against E. coli O157:H7 (Senhaji, Faid and
Kalalou, 2007). In this case pure essential oil could be
a second choice for studies, after simple water extracts.
Plant metabolite concentrations often vary during the growth cycle and in different parts of the plant
so a consistent level of therapeutic molecules is an
important consideration. For Nepeta cataria (catnip),
the antibacterial properties of essential oils distilled
at three different stages of plant growth were tested
(Zomorodian et al., 2012). In this case, consistent
results were obtained across the growth stages which
uphold specificity for S. aureus and Shigella sp. over
E. coli. It is worth noting that the essential oil content
of catnip tea will be much lower than the levels of essential oils reported to have an antibacterial effect and also
that catnip tea is not recommended for women during
pregnancy or lactation (Ernst, 2002).
A range of European berries (blueberry, raspberry,
lingonberry, blackcurrant, strawberry, cloud berry,
sea buckthorn berry and cranberry) were found to be
more active against E. coli and other pathogenic bacteria compared to Lactobacillus sp. (Puupponen-Pimiä
et al., 2001). However, the samples were first extracted
with 70% acetone and processed to remove sugars. It
is not possible to estimate the amount of fruit required
providing equivalent levels of active material and if
a low concentration of fruit extract could replace part
of the sugar component in ORT. Positive data for raspberry fruit and cordial at 10% dilution has also been
reported (Ryan, Wilkinson and Cavanagh, 2001). While
neat fruit juices are generally not recommended for
the treatment of diarrhea, these studies support the
potential inclusion of natural, rather than artificial, fruit
flavors in ORT formulas.
Publications naturally report positive antimicrobial
properties of plant extracts but it is not always easy to
12
1
Komiazyk M. et al.
gauge their effectiveness. Plant extract yields and other
essential data are often unreported and this adds to
difficulties in comparing the different experimental
methods used between publications. Mathabe surveyed
the effect of plant extracts on several bacterial species,
including V. cholerae and Shigella sp. (Mathabe et al.,
2006). They used extracts from different parts of 21,
locally used plants. Punnica granatum (pomegranate),
as clearly stated in the abstract, was the best known
plant to give positive data. However, it is only on reading the full paper that it is pomegranate root that provided the positive data and not the juice or fruit. The
reported MIC for the hot water extract of pomegranate
root (0.156 µg/ml) is a lower concentration than would
be expected from a teabag (1–2 g of plant material) in
a mug of hot water (about a third of a liter) although
exact extract yields were not reported. The cold water
extract of tamarind (Tamarindus indica) fruit was very
effective against a range of bacteria, including clinical
isolates of E. coli that caused infantile diarrhea (Nwodo
et al., 2011). A cold water extract from 1 g plant material (1 teabag) per liter of water (about 3 mugs) was
sufficient to achieve a bacteriocidal effect against
E. coli (Nwodo et al., 2011). Extracts of mango kernel (Mangifera indica), including a cold water extract,
were effective against S. dysenteriae (Rajan, Thirunalasundari and Jeeva, 2011). The abstract of this paper
is unambiguous as it states clearly that the data were
obtained with mango kernel. The cold water extract
was effective at a concentration of 1.5 g dry plant material per liter of water (Rajan, Thirunalasundari and
Jeeva, 2011). Hajlaoui found that essential oil from
cumin (Cuminum cyminum) was active against Vibrio
sp. and E. coli (Hajlaoui et al., 2010). However, the
extraction yields and MICs suggest a high concentration of plant material is required to obtain an effective
extraction (> 15 g/liter means at least three teabags in
a mug of water).
Pairs of aqueous plant extracts can have a greater
efficacy than their single counterparts (Han and Guo,
2012). The common traditional Chinese medicine pair
of Angelica sinensis and Sophora flavescens was tested
against four different bacteria. Neither plant had significant antibacterial properties when used alone but
did so when used together. Specific interactions and
effects of foods on pharmaceutical action are known.
The adverse effect of grapefruit juice on a wide range of
drugs is well documented (Hanley et al., 2011).
Essential oils of thyme and oregano were effective
against E. coli O157:H7 in disk diffusion and microplate
(MIC) assays although this was the only bacterium
tested (Burt and Reinders, 2003). This means that we
cannot rule out a general antimicrobial effect that will
also kill beneficial bacteria in the digestive tract. The
principal ingredient of thyme oil, thymol, is used in
mouthwashes as an antibacterial and antifungal agent
but there are no safe recommendations about its use
in food. Oregano oil is generally recognized as safe by
the FDA at a consumption level of 200 mg a day (Food.
Listing of Food Additive Status Part II. US Food and
Drug Administration Web Site. http://www.fda.gov/
Food/FoodIngredientsPackaging/FoodAdditives/
ucm191033.htm#ftnO). The bacteriostatic and bacteriocidal properties of oregano varied with the presence
of other added ingredients (agar and soy lecithin).
Garlic is considered beneficial for a wide range of
medical problems. Included as a 1% additive to media,
garlic was active against several bacteria, including
E. coli O157:H7 (Sasaki et al., 1999). Fresh garlic extract
and allicin, the principal compound in garlic suspected
of carrying antimicrobial properties, had equal or better
activity than five tested antibiotics against a range of
antibiotic resistant strains of Shigella sp., eneterotoxic
E. coli and V. cholerae. (Ahsan et al., 1996). Allicin is
an unstable molecule and the effectiveness of garlic is
highly dependent on the source of the plant material,
method of preparation, as well as the ages of the plant
material and extract. Allicin is not the only active component of garlic, Politi et al. identified a polysaccharide component isolated from garlic that binds to the
B-subunit of cholera toxin to confer antitoxin properties (Politi et al. 2006).
4. Avenues for future research
The majority of published works in the field focus
on the antimicrobial properties of plant extracts. Few
studies test the specificity of plant extracts for infectious over benign bacterial strains. The toxicity of plant
extracts to humans should also be considered, particularly when highly concentrated fractions are used, or
parts of the plant that are not normally ingested. Pharmaceutical practice focuses on developing one drug
or treatment to target a specific and weak point in the
disease mechanism. In principal, a mixture of plant
extracts may present a synergistic effect against several
stages of the infection cycle, specificities against a wide
range of bacteria and overall lead to obtaining a more
effective remedy for diarrhea.
The search for beneficial plant extracts would benefit from multi-disciplinary, collaborative, large-scale
screening approaches. The first task is to select plant
materials that are generally considered safe for human
consumption (including children and pregnant/lactating women) as based on literature searches. Plant
material should be collected at different growth stages
and from different varieties of plant. Screening of fresh,
stored and dried plant materials should be performed.
Plant extracts should be prepared with cold water, hot
1
13
water and boiling/refluxing extractions – toxic solvents should be avoided. The long-term stability of the
extracts in solution and/or as freeze-dried powders
should be compared.
Antimicrobial screens should be based around wellestablished protocols to measure bacteriostatic and bacteriocidal properties of the plant extracts. However, it
is important to test a range of enterotoxic and benign
strains of bacteria in order to obtain ideas on the specificity of plant extracts. Advanced protocols based on
mammalian cell cultures to test the anti-adhesion and
anti-invasion properties of plant extracts on bacterial cell cultures are critical to the discovery of plant
extracts that can counter hemolytic strains of enterotoxic bacteria. Protocols to measure the downregulation of toxin production (rtPCR) and toxin secretion
by plant extracts are worth carrying out to ascertain if
plant extracts are capable of slowing diarrheal episodes.
Returning to sample selection, combinations of
optimal plant extracts should be tested in combination to ensure that their full activity is maintained or
synergy obtained. The final aim is to have ready-to use
ORT in solution and sachets of dried ORT to be dissolved in clean water. These products fulfill the aim of
treating diarrhea but prevention and control of the disease might be aided with sachets of dried plant extract
(without added salt and sugar) or teabags filled with
mixed plant materials.
The strategy outlined above means a change from
the current approach of validating plant extracts on an
individual or regional basis towards a more multidisciplinary, collaborative effort. We have recently instigated
a projected targeted towards AB5-producing bacteria,
establishing a range of protocols in three different labs.
Our antimicrobial data corroborate existing published
data for a number of hot water plant extracts and reveal
new, include toxicity studies on human cell lines and
a number of anti-toxin properties. However, we still do
not employ a full range of protocols or have instigated
animal or human trials to test our suggested mixes of
plant extracts. Furthermore, the AB5 family of enterotoxins represents just one group of enterotoxic pathogens that can be studied using the same set of protocols.
5. Conclusion
It is not possible to compare datasets for a particular
plant due to different plant sources, extract preparations
and microbial screens. However, the wide variability
indicates that these points are very important being
very important in determining if a particular plant
extract will be effective or not. A plant extract, or more
likely a mixture of plant extracts, that provide a wide
spectrum of antimicrobial and anti-toxin properties
would provide a powerful boost to ORT formulations. It
is important in such a case that a suitable antimicrobial
screen is used to assay the plants before distribution or
sale. A second point is that several screens are required
to test plant effects against different aspects of microbial colonization, toxin release and toxicity. It is this
point that is largely overlooked in favor of traditional,
plate-based antimicrobial screens. Future studies would
benefit from large-scale collaborative screening with an
aim of improving ORT.
Acknowledgement
M.P. thanks the Fundaçao para a Ciência e a Tecnologia (FCT)
for the postdoctoral grant (SFRH/BPD/65762/2009). P.G. thanks
FCT for a Ciencia Fellowship. We acknowledge FCT and POCI,
with co-participation of the European Regional Development Fund
(FEDER), for financial support under project PTDC/QUI-BIQ/
115298/2009. I.S. and M.P. were supported by the Polish-Portugal
Executive Program for years 2011–2012 sponsored by the Polish
Ministry of Science and Higher Education and by FCT. This work
was also supported by FCT through grant no. PEst-OE/EQB/
LA0004/2011.
Literature
Adiguzel A., H. Ozer, M. Sokmen, M. Gulluce, A. Sokmen,
H. Kilic and F. Sahin. 2009. Antimicrobial activity and chemical
composition of Mentha pulegium L. essential oil. Pol. J. Microbiol.
58: 69–76.
Baris Ozlem Ahmad I and A.Z. Beg. 2001. Antimicrobial and
phytochemical studies on 45 Indian medicinal plants against multidrug resistant human pathogens. J. Ethnopharmacol. 74: 113–123.
Ahsan M. and A.K.A. Chowdhury. 1996. Garlic Extract and Allicin: Broad Spectrum Antibacterial Agents Effective Against Multiple
Drug Resistant Strains of Shigella dysenteriae type Escherichia coli
and Vibrio cholerae. Phytother. Res. 10: 329–331.
Alanís A.D., F. Calzada, J.A.Cervantes, J. Torres and G.M. Ceballos. 2005. Antibacterial Properties of Some Plants Used in Mexican
Traditional Medicine for the Treatment of Gastrointestinal Disorders. J. Ethnopharmacol. 100: 153–157.
Anonymous. 2002. WHO Drug Information. 16: 121–122. http://
apps.who.int/medicinedocs/pdf/s4950e/s4950e.pdf
Bandyopadhyay D., T.P. Chatterjee, A. Dasgupta, J. Lourduraja and S.G. Dastidar. 2005. In vitro and in vivo antimicrobial
action of tea: the commonest beverage of Asia. Biol. Pharm. Bull.
28: 2125–2127.
Beddoe T., A.W. Paton, J. Le Nours, J. Rossjohn and J.C. Paton.
2010. Structure, Biological Functions and Applications of the AB5
Toxins. Trends Biochem. Sci. 35: 411–418.
Birdi T., P. Daswani, S. Brijesh, P. Tetali, A. Natu and N. Antia.
2010. Newer Insights into the Mechanism of Action of Psidium gua
java L. Leaves in Infectious Diarrhoea. BMC Complement Altern.
Med. 10: 33.
Brijesh S., P. Daswani, P. Tetali, N. Antia and T. Birdi. 2009. Studies
on the Antidiarrhoeal Activity of Aegle marmelos Unripe Fruit: Validating Its Traditional Usage. BMC Complement. Altern. Med. 9: 47.
Burt S.A. and R.D. Reinders. 2003. Antibacterial Activity of
Selected Plant Essential Oils Against Escherichia coli O157:H7. Lett.
Appl. Microbiol. 36:162–167.
Chen J.-C., T.-Y. Ho, Y.-S. Chang, S.-L. Wu and C.-Y. Hsiang.
2006. Anti-diarrheal Effect of Galla chinensis on the Escherichia coli
14
Komiazyk M. et al.
Heat-labile Enterotoxin and Ganglioside Interaction. J. Ethnophar
macol. 103: 385–391.
Chen J.-C., T.-Y. Ho, Y.-S. Chang, S.-L. Wu, C.-C. Li and
C.-Y. Hsiang. 2009. Identification of Escherichia coli Enterotoxin
Inhibitors from Traditional Medicinal Herbs by in silico, in vitro,
and in vivo Analyses. J. Ethnopharmacol. 121: 372–378.
Chen J.-C., L.-J. Huang, S.-L. Wu, S.-C. Kuo, T.-Y. Ho and
C.-Y. Hsiang. 2007. Ginger and Its Bioactive Component Inhibit
Enterotoxigenic Escherichia coli Heat-labile Enterotoxin-induced
Diarrhea in Mice. J. Agric. Food Chem. 55: 8390–8397.
De M., A.K. De, P. Sen and A.B. Banerjee. Antimicrobial Properties of Star Anise (Illicium verum Hook f). Phytother. Res. 16:
94–95.
Delaquis P.J., K. Stanich, B. Girard and G. Mazza. 2002. Antimicrobial activity of individual and mixed fractions of dill, cilantro,
coriander and eucalyptus essential oils. Int. J. Food Microbiol. 74:
101–109.
Dey A. and J.N. De. 2012. Ethnobotanical Survey of Purulia District, West Bengal, India for Medicinal Plants Used Against Gastrointestinal Disorders. J. Ethnopharmacol. 143: 68–80.
Ernst E. 2002. Herbal Medicinal Products During Pregnancy: are
they safe? BJOG 109: 227–235.
Fischer H., T.E. Machen, J.H. Widdicombe, T.J.S. Carlson,
S.R. King, J.W.S. Chow and B. Illek. 2004. A Novel Extract SB-300
from the Stem Bark Latex of Croton lechleri Inhibits CFTR-mediated
Chloride Secretion in Human Colonic Epithelial Cells. J. Ethnophar
macol. 93: 351–357.
Grosvenor P.W., A. Supriono and D. Gray. 1995. Medicinal Plants
from Riau Province , Sumatra, Indonesia . Part 2: Antibacterial and
Antifungal Activity. J. Ethnopharmacol. 45: 97–111.
Hajlaoui H., H. Mighri, E. Noumi, M. Snoussi, N. Trabelsi,
R. Ksouri and A. Bakhrouf. 2010. Chemical Composition and
Biological Activities of Tunisian Cuminum cyminum L. Essential
Oil: a High Effectiveness Against Vibrio spp. Strains. Food Chem.
Toxicol. 48: 2186–2192.
Han C. and J. Guo. 2012. Antibacterial and anti-inflammatory
Activity of Traditional Chinese Herb Pairs, Angelica sinensis and
Sophora flavescens. Inflammation 35: 913–919.
Hanley M.J., P. Cancalon, W.W. Widmer and D.J. Greenblatt.
2011. The Effect of Grapefruit juice on Drug Disposition. Expert
Opin. Drug. Metab. Toxicol. 7:267–286.
Herold S., H. Karch and H. Schmidt. 2004. Shiga toxin-encoding
bacteriophages-genomes in motion. Int. J. Med. Microbiol. 294:
115–121.
S. Kopic and J.P. Geibel. 2010. Toxin mediated diarrhea in the
21 century: the pathophysiology of intestinal ion transport in
the course of ETEC, V. cholerae and rotavirus infection. Toxins. 2:
2132–2157.
Lainhart W., G. Stolfa and G. Koudelka. 2009. Shiga toxin as a bacterial defense against a eukaryotic predator, Tetrahymena thermo
phila. J. Bacteriol. 191: 5116–5122.
Mahboubi M. and G. Haghi. 2008. Antimicrobial activity and
chemical composition of Mentha pulegium L. essential oil. J. Ethno
pharmacol. 119:325–327.
Mathabe M.C., R.V. Nikolova, N. Lall and N.Z. Nyazema. 2006.
Antibacterial Activities of Medicinal Plants Used for the Treatment
of Diarrhoea in Limpopo Province, South Africa. J. Ethnopharmacol.
105: 286–293.
Mazumder R., T. Mendiratta, S.C. Mondal and A. Mazumder.
2000. Antimicrobial Potency of the Leaf – Stalk Extract of Curcuma
longa (LINN). Anc. Sci. Life. 20: 92–96.
McLeod S.M., H.H. Kimsey, B.M. Davis and M.K. Waldor. 2005.
CTXphi and Vibrio cholerae: exploring a newly recognized type of
phage-host cell relationship. Mol. Microbiol. 57: 347–356.
1
Muthuswamy S., H.P.V. Rupasinghe and G.W. Stratton. 2007.
Antimicrobial effect of Cinnamon Bark Extract on Fresh-Cut
Apples. J. Food Saf. 28: 534–549.
Nwodo U.U., G.E. Obiiyeke, V.N. Chigor and A.I. Okoh. 2011.
Assessment of Tamarindus indica Extracts for Antibacterial Activity.
Int. J. Mol. Sci. 12: 6385–6396.
Politi M., J. Alvaro-Blanco, P. Groves, A. Prieto, J.A. Leal,
F.J. Cañada, J. Jiménez-Barbero. 2006. Screening of Garlic Water
Extract for Binding Activity with Cholera Toxin B Pentamer by
NMR Spectroscopy – An Old Remedy Giving a New Surprise. Eur.
J. Org. Chem. 9: 2067–2073.
Prins J. M., S.J.H. van Deventer, E.J. Kuijper, P. Speelman. 1994.
Clinical Relevance of Antibiotic-Induced Endotoxin Release. Anti
microb. Agents Chemother. 38: 1211–1218.
Puupponen-Pimiä R., L. Nohynek, C. Meier, M. Kähkönen,
M. Heinonen, A. Hopia and K.M. Oksman-Caldentey. 2001. Antimicrobial Properties of Phenolic Compounds from Berries. J. Appl.
Microbiol. 90: 494–507.
Rahim N., D.J. Gomes, H. Watanabe, S.R. Rahman, C. Chomvarin,
H.P. Endtz and M. Alam. 2010. Antibacterial Activity of Psidium
Guajava Leaf and Bark Against Multidrug-resistant Vibrio cholerae:
Implication for Cholera Control. Jpn. J. Infect. Dis. 63:271–274.
Rajan S., T. Thirunalasundari and S. Jeeva. 2011. Anti-enteric
Bacterial Activity and Phytochemical Analysis of the Seed Kernel
Extract of Mangifera indica Linnaeus Against Shigella dysenteriae
(Shiga, Corrig.) Castellani and Chalmers. Asian Pac. J. Trop. Med.
4: 294–300.
Ryan T., J.M. Wilkinson and H.M. Cavanagh. 2001. Antibacterial
Activity of Raspberry Cordial in vitro. Res. Vet. Sci. 71: 155–159.
Sasaki J.-I., K. Takeshi, I. Kunio, U. Hidemitsu and M. Hajime.
1999. Antibacterial Activity of Garlic Powder Against Escherichia
coli O-157: H7. J. Nutr. Sci. Vitaminol. 45: 785–790.
Senhaji O., M. Faid and I. Kalalou. 2007. Inactivation of Esche
richia coli O157:H7 by Essential Oil from Cinnamomum Zeylani
cum. Braz. J. Infect. Dis. 11: 234–236.
Sikora A.E. 2013. Proteins Secreted via the Type II Secretion System: Smart Strategies of Vibrio Cholerae to Maintain Fitness in Different Ecological Niches. PLoS Pathog. 9: e1003126.
Silva N.C.C., L. Barbosa, L.N. Seito and A. Fernandes Jun.
2012. Antimicrobial activity and phytochemical analysis of crude
extracts and essential oils from medicinal plants. Nat. Prod. Res.
26: 1510–1514.
Stolfa G. and G. Koudelka. 2013. Entry and Killing of Tetrahymena
thermophila by Bacterially Produced Shiga Toxin. mBio. 4: 1–10
Tekwu E.M., A.C. Pieme and V.P. Beng. 2012. Investigations of
Antimicrobial Activity of Some Cameroonian Medicinal Plant
Extracts Against Bacteria and Yeast with Gastrointestinal Relevance.
J. Ethnopharmacol. 142: 265–723.
Tetali P., C. Waghchaure, P.G. Daswani, N.H. Antia and T.J. Birdi.
2009. Ethnobotanical Survey of Antidiarrhoeal Plants of Parinche
Valley, Pune District, Maharashtra, India. J. Ethnopharmacol. 123:
29–236.
Thakurta P., P. Bhowmik, S. Mukherjee, T.K. Hajra, A. Patra and
P.K. Bag. 2007. Antibacterial, antisecretory and antihemorrhagic
activity of Azadirachta indica used to treat cholera and diarrhea in
India. J. Ethnopharmacol. 111: 607–612.
Watkins F., B. Pendry, A. Sanchez-Medina and O. Corcoran. 2012.
Antimicrobial Assays of Three Native British Plants Used in AngloSaxon Medicine for Wound Healing Formulations in 10th Century
England. J. Ethnopharmacol. 144: 408–415.
Zomorodian K., M.J. Saharkhiz, S. Shariati, K. Pakshir, M.J. Rahimi
and R. Khashei. 2012. Chemical Composition and Antimicrobial Activities of Essential Oils from Nepeta cataria L. Against Common Causes of Food-Borne Infections. ISRN Pharm. 2012: 591953.
2014, Vol. 63, No 1, 15–20
ORIGINAL PAPER
Quantitative Expression of Candida albicans Aspartyl Proteinase Genes SAP7,
SAP8, SAP9, SAP10 in Human Serum in vitro
MONIKA STANISZEWSKA1*, MAŁGORZATA BONDARYK1, TADEUSZ MALEWSKI2
and WIESŁAW KURZĄTKOWSKI1
National Institute of Public Health – National Institute of Hygiene, Warsaw, Poland
2
Museum and Institute of Zoology Polish Academy of Science, Warsaw, Poland
1 Submitted 28 March 2013, revised 24 July 2013, accepted 16 November 2013
Abstract
The different members of the secreted aspartyl proteinase (Sap) family of the human pathogenic yeast Candida albicans are proposed to play
different roles during infection and are differentially expressed at various body sites. In recent reports, expression analysis has focused on the
genes SAP1-6, while the expression pattern of SAP7-10 was less well studied. We analyzed the SAP7-SAP10 expression profile of C. albicans
under human serum influence that may be elucidated in the course of blood infection in humans and how this in vitro expression profile
is associated with hyphal formation. The phenotypes of strains were examined under scanning electron microscopy. Quantitative RT-PCR
(2–∆∆CT) was used to monitor SAP expression of C. albicans wild type cells and mutants lacking SAP9 and/or SAP10. Of the four analyzed
SAP genes, only SAP7 was detectably induced in the double mutant and in the wild type strains in the model that mimics bloodstream
infections. On the other hand, in the wild types (isolate 83 and CAF2-1), SAP7 was expressed 0.8- or 0.4-fold less than SAP10, respectively.
Our findings suggest that Sap7 may respond to the challenge of the human blood environment. Furthermore, the results support the
notion that compensatory upregulation of SAP7 and SAP8 in the Δsap9/Δsap10 mutant occurs in these conditions. SAP7-10 expression
was strain-specific. Our findings point to a link between morphogenesis and expression of SAP9 in serum, where these conditions induce
both hyphae and SAP9, but temporal gene expression patterns might be controlled by other factors.
K e y w o r d s: Candida albicans, aspartic proteinases expression, morphogenesis, blood human serum
Introduction
Candida albicans possesses a number of virulence
attributes and among them widely studied are aspartyl
proteinases (Saps) that can digest epithelial cell surface
components and thereby provide an entrance into or
between host cells (Dalle et al., 2010). Although plenty
of data dealing with the Saps involved in the infection
process have been extensively studied (Naglik et al.,
2008; Rehaume et al., 2008; Schelenz, 2008) the comparative analysis of Saps expression in morphologies
induced under human serum influence at human body
temperature has not been described in depth. Given
the role of SAP7, SAP8 and SAP9-10 in the growth
of C. albicans in serum (Lermann and Morschhäuser, 2008), we asked whether those isoenzymes are
expressed in C. albicans hyphal forms induced under
human serum influence in vitro. In addition, we analyzed whether any differences exist in the expression
level between these subfamilies. In contrast to all other
members of the Sap family, the Sap9-10 proteases monitored under in vitro and in vivo conditions are independent of pH and morphotype (Hornbach et al., 2009;
Schild et al., 2011). Furthermore, according to Schild
et al. (2011) it seems apparent that the host associated
lifestyle of C. albicans requires regulatory proteolytic
digestion at different niches with different pH values.
Moreover, the latter authors demonstrated that Sap9
and Sap10 influence on cell wall functions by proteolytic cleavage of cell wall proteins which are significant
for morphogenesis (Schild et al., 2011). Thus, in the
current study SAP9 and SAP10 expression analysis
was undertaken in hyphal forms under serum influence at pH 7.1–7.4. An earlier study (Naglik et al., 2003)
showed that SAP7 was found to be induced in response
to infection of reconstituted human vaginal epithelium
model as well as in isolates from patients. Furthermore,
Taylor et al. (2005) observed that induction of SAP7
correlates with virulence in an intravenous infection
model of candidiasis in mice. Many differences in the
* Corresponding author: M. Staniszewska, Independent Laboratory of Streptomyces and Fungi Imperfecti, National Institute of Public
Health – National Institute of Hygiene, 24 Chocimska, 00-791 Warszawa, Poland; phone: +48 22 54 21 228; fax: + 48 22 849 74 84; e-mail:
[email protected]
16
1
Staniszewska M. et al.
SAP gene expression profiles observed in various studies remain to be explained and more thoroughly characterized. Therefore, the aim of the study was to determine the relative levels of SAP7, SAP8, SAP9 and SAP10
transcripts in C. albicans strains in vitro at neutral pH
at 18 h-growth in human blood serum (an artificial
model of bloodstream infections). That may provide
evidence for a role of these proteinases in C. albicans
survive and escape of disseminated infection. Moreover, we determined whether any correlation might exist
between overexpression of the SAP7-10 genes and true
hyphae formation.
Experimental
Materials and Methods
Strains and growth conditions. The Candida
strains used in this study are listed in Table I. The stock
culture of examined strains was stored on ceramic
beads (MicrobankTM, Pro-Lab Diagnostics, Canada)
at –70°C. Routine culturing of strains for growth in
YEPD medium as well as for morphogenesis development in human serum was conducted as described
previously (Staniszewska et al., 2012). The usefulness
of fresh human serum in order to mimic blood serum
infections and to investigate the gene expression pattern
of C. albicans during such infections incubated under
semi-aerobic conditions at 37°C was described by
Fradin et al. (2003; 2005).
Quantitative RT-PCR. Total RNA was isolated
from cells according to the protocol by Amberg et al.
(2005). RNA concentrations were determined by measuring absorbance at 260 nm (Nano Drop 2000, Thermo
SCIENTIFIC, USA). First-strand cDNAs were synthesized from total RNA, using two-step qRT-PCR analysis (Sigma, USA) and following the recommendations
of the manufacturer. Real-time RT-PCR was used to
determine the quantitative levels of SAP7-10 mRNA
transcripts in RNA samples using Rotor Gene 6000
(RCorbett, Qiagen, Germany). Quantitative reverse
transcription-PCR assay was performed following the
protocol described previously by Naglik et al. (2008)
using QuantiTect Probe PCR Kit (Qiagen, Germany)
according to the manufacturer’s instructions. TaqMan
primer and probe (5’ FAM, 3’ TAMRA) sets were used
as described previously Naglik et al. (2008). The 2–∆∆CT
method was used to analyze the relative changes in
gene expression from quantitative RT-PCR experiment (Livak and Schmittgen, 2001). The CT values
were provided from RT-PCR instrumentation and were
imported into a spreadsheet Microsoft Excel 2010. The
data were analyzed using Eq. (Livak and Schmittgen,
2001), where ∆CT = Avg. sap CT – Avg. β-actin CT and
∆∆CT = ∆CT – ∆CT parental strain.
Scanning electron microscopy study. To examine
cell morphology, samples were prepared as described
previously by Oliviera et al. (2010). Briefly, morphotypes of each strain were fixed with 2.5% glutaraldehyde
in 0.1 M phosphate buffer (pH 7.2) for 18 h at a low
temperature (5–6°C). Then, the samples were carefully
washed with 0.1 M phosphate buffer (pH 7.2). Postfixation was carried out for 2 h at room temperature
with 2% osmium tetroxide. Initial dehydration was
accomplished by placing specimens in the following
series of ethanol gradients: 50% and 70% (two times
for 10 min), 95% (two times for 5 min) and 100% (two
times for 1 min), respectively. Then, samples were
dehydrated with acetone (two times for 30 sec.) until
dried by the critical point method in liquid CO2. Subsequently, the specimens of the wild type strain were
coated with gold in a vacuum evaporator and examined
with a scanning electron microscope (SEM Quanta-200,
FEI, Czech Republic). In the case of the mutant strains,
after post-fixation morphotypes were dehydrated
two times for 10 min with graded ethanol (50% and
75%) followed by dehydration with acetone (two times
for 30 sec). The dried specimens were coated with
osmium tetroxide and observation was done under
scanning electron microscope Hitachi S-5500 (Japan).
Images were assembled with Photoshop (Adobe Photoshop CS3 Extended). Cell dimensions were determined
by using bars.
Table I
Strains used in the study
Strain
Parent
Genotype
Reference
SC5314
Wild strain
Gillum et al. (1984)
83
Clinical isolate
Staniszewska (2009)
CAI4[pCIp10]SC5314
Δura3::imm434/Δura3::imm434 + pCIp10 (Integration)
Fonzi and Irwin (1993)
CAF2-1SC5314 Δura3::imm434/URA3
Fonzi and Irwin (1993)
Δsap9
CAI4[pCIp10] Δsap9::hisG/Δsap9::hisG + pCIp10 (Integration)
Schild et al. (2011)
Δsap9/10
CAI4[pCIp10] Δsap10::hisG/Δsap10::hisG Δsap9::hisG/Δsap9::hisG + pCIp10 (Integration) Schild et al. (2011)
Δsap10
CAI4[pCIp10] Δsap10::hisG/Δsap10::hisG + pCIp10 (Integration)
Schild et al. (2011)
1
17
Expression of C. albicans aspartyl proteinase in human serum
Fig. 1. Expression of the SAP genes.
The expression of SAP7, SAP8, SAP9 and SAP10 was quantified by qRT-PCR from cells in stationary growth phase in human serum at 37°C.
ACT1 transcript was used as internal control and the multifold increase over the value of the wild type at 37°C is shown for each strain
Results
Quality control and quantitative expression of
SAP7-SAP10 genes in human blood serum. SAP7,
SAP8, SAP9-10 and ACT1 TaqMan primer/probe sets
were calibrated and they demonstrated similar efficiency in titration experiments using C. albicans SC5314
genomic DNA (9.7–52.3 ng) in serial log10 dilutions (data
not shown). The expression levels of SAP7-SAP10 genes
were monitored after a 18 h period after inoculation of
human serum with the C. albicans strains (Fig. 1). All
SAP genes tested were detected in human serum, albeit
at very low levels, except SAP7, which was expressed at
relatively high levels compared to the remaining genes
tested (Table II). Contrariwise, the wild type strain 83
and CAF2-1 showed slightly enhanced SAP10 expression (at least 1.2- and 2.3-fold) compared to SAP7
respectively. We therefore examined the expression of
SAP7-10 genes under serum influence by comparing
the expression profile among particular mutants. Considering SAP7, in the double mutant ∆sap9/Δsap10
the expression level of SAP7 was significantly higher
(20-fold compared to ∆sap9 or 8.4-fold compared to
∆sap10) and so was that of SAP8 (5.0- or 3.3-fold for
∆sap9 and ∆sap10 respectively). As a result of the com-
parison of the expression pattern of wild type strains
it was shown that in the reference strain SC5314 SAP7
was expressed 1.5-fold compared to CAI4. Contrariwise, the wild type CAI4 displayed around 1.6-fold
higher expression of SAP9 than strain 83. We demonstrated that CAF2-1 has a 2.3-fold change of SAP10
gene expression compared with either CAI4 or strain 83.
Contrariwise, the wild type SC5314 showed 5-fold lower
expression (compared to strain 83 and CAI4) and
11.5-fold lower expression than CAF2-1. Comparison
of the expression patterns of the protease mutants and
the wild types demonstrated high diversity. The expression levels of SAP7, SAP8 and SAP10 in the wild type
CAF2-1 were around 3.3- and 5.0- and 46-fold higher
than in mutant the ∆sap9 respectively. Moreover, in the
mutant ∆sap9 SAP10 was underexpressed 20-fold vs
the parental strain CAI4. In view of SAP10, the mutant
∆sap9 displayed expression from 4.0- to 21-fold lower
than the wild types. Similarly, deletion of SAP9 or SAP10
appeared to have a minor influence on expression of
either SAP8 or SAP9 (comparable to the wild types).
Thus, ∆sap10 as well as SC5314 displayed comparable expression of SAP9 (2∆∆CT = 0.3 or 0.2 respectively).
When comparing the three genes (SAP7 vs SAP8 vs
SAP9) in the mutant ∆sap10 at 18 h-growth in human
Table II
Fold mRNA expression of SAP7 to SAP10 relative to ACT1 and normalized over the value
of the wild type strains’ expression
Gene
a
Fold mRNA expressiona in C. albicans strains
CAI4
SC5314
∆sap9
∆sap10
∆sap9/∆sap10
83
CAF2-1
SAP7
1.42.1 0.3 0.7 5.9 0.8 1.0 b
SAP8
0.20.3 0.2 0.3 1.0 0.4 1.0 b
SAP9
1.0b
0.2ND 0.2ND 0.6ND
SAP10
1.0b
0.20.05 NDND 1.0 2.3
– Values are average of triplicate readings; b – Parental strain; ND – not determined
18
serum, one can see a clear trend in underexpression of
these genes compared to the wild types, with the exception of SAP8 upregulation (1.5-fold) compared to CAI4.
Furthermore, SAP7 and SAP8 were expressed 1.4-fold
and 3.3-fold higher in the wild type CAF2-1 compared to ∆sap10 respectively. Likewise, in the parental
strain CAI4 SAP9 displayed 5.0-fold overexpression vs
∆sap10. The double mutant ∆sap9/Δsap10 showed an
increased expression of SAP7 (2.8-fold compared to the
wild type SC5314). Furthermore, Fig. 1. and Table II
showed that SAP7 was clearly the most highly expressed
gene at around 5.9-fold (with reference to CAF2-1) in
the ∆sap9/Δsap10 mutant. Consequently, SAP8 displayed a significant overexpression in the ∆sap9/Δsap10
mutant compared to the wild types SC5314 and CAI4
(in the range 3.3 and 5.0-fold, respectively). While in
the double mutant ∆sap9/Δsap10 the expression level
of SAP8 was comparable to CAF2-1.
Hypha-forming capability in Candida albicans
strains. In order to characterize the phenotype of ∆sap,
we examined the ability to undergo the dimorphic
transition. For this purpose, cells were grown in liquid
undiluted human serum and incubated at 37°C, cell
morphology was then observed microscopically after
18-h incubation. To test this possibility, we examined
which genes could prevent from the morphogenesis
defect of Δsap9/rsap10 in human serum. As shown in
Fig. 2. the mutants Δsap9 and Δsap9/Δsap10 exhibited
decreased ability to filament compared to the wild type
cells. Although, the latter mutants are able to form
filaments, they fail to filament abundantly in these
preferable conditions probably because the absence of
SAP9 represses the dimorphic transition in C. albicans.
Contrariwise, the ∆sap10 mutant formed true hyphae
when grown under these conditions as revealed by
microscopic examination. The deletion of genes SAP8
(data not shown) and SAP10 had no effect on morphogenesis process.
Discussion
Our results demonstrated that from the tested SAP7
to SAP10, only SAP7 mRNA level is significantly altered
at the later stage of bloodstream infections in different genetic backgrounds (the wild types and the ∆sap
mutants). Comparing the expression of SAP9 and
SAP10, our assay suggested that the single mutants
lacking either of these proteins do not show a significant expression increase of the other. We found that the
expression levels of SAP7-10 were downregulated in all
the single mutants compared with the wild types. One
possible explanation for this observation may be that
the single mutants have a reduced ability to survive in
blood serum. Contrariwise, the double mutant Δsap9/
Δsap10 displayed overexpression of SAP7 and SAP8
1
compared to the wild types. These results support the
notion that compensatory upregulation of SAP7 and
SAP8 in the Δsap9/Δsap10 mutant occurred. However, the mechanism underlying how and when SAP9
and SAP10 regulate other genes as well as each other
remains to be elucidated. Interestingly, lack of Sap10
had only a minor influence on SAP9 expression (4-fold
higher) compared to the expression level of SAP10
in Δsap9. Recently, Schild et al. (2011) showed that
although Sap9 and Sap10 exhibit near neutral pH optimum of proteolytic activity they only partially substitute each other in these conditions. In our study a lower
expression of SAP10 may be related to a more limited
number of potential substrates (Schild et al., 2011).
In the study, the mutants lacking these proteins
showed dissimilar phenotypes of Δsap9 or Δsap10, such
as altered morphogenesis under human serum influence. Moreover, our data supported the results by Naglik et al. (2004) that Sap9 is probably a key proteinase
that does not only promote cell wall integrity, general
cell growth and fitness at mucosal surface, but as our
data implied is dependent on the morphology under
human serum influence. Thus, our study supports the
findings of Schild et al., (2011) and in view of our data
it is highly probable that Sap9 is involved in polarized
growth and morphogenesis in C. albicans under human
serum influence at pH 7.1–7.4. Previously, quantification of cellular forms of the wild type strain (Staniszewska et al., 2011 and 2012) showed that incubation in
human serum at 37°C for 18 h resulted in transformation of almost 100% of all the observed cells to pure
true hyphal forms. However, our present data demonstrated that deletion of SAP9 substantially reduces true
hyphae formation compared with the wild type strains
i.e., strain 83, SC5314 as well as Δsap10 under these conditions (Fig. 2). Thus, SAP9 expression may be linked
to hyphal morphology even if the pleomorphism is
regulated by other factors. Moreover, it was shown that
incubation in undiluted serum at human body temperature did not prevent the defective hyphal growth of the
mutants Δsap9 and Δsap9/Δsap10 (Fig. 2), indicating
that Sap9 may be involved in the loss of cell polarity in
these mutants under hyphae-forming conditions. Moreover, we showed that SAP7 and SAP8 expression could
not prevent the morphogenesis defect of either Δsap9 or
Δsap9/Δsap10 in undiluted human serum and expression of these genes does not induce hyphae formation.
Finally, our data imply that Sap7, Sap8 and Sap10 play
a minor role in morphogenesis and these genes do not
compensate the SAP9 disruption in hyphae formation.
Studies investigating the production of SAP mRNA
(Hube et al., 1994; Taylor et al., 2005) and the virulence
of SAP knockout strains (Lermann and Morschhäuser,
2008) showed that induction of SAP expression is
a niche-specific phenomenon. Therefore it was necessary in our study to discover which of the tested protein-
1
Expression of C. albicans aspartyl proteinase in human serum
19
Fig. 2. Characteristics of Candida albicans strains’ phenotypes grown in undiluted human serum at 37°C
for 18 h under static conditions in plastic Eppendorf vials.
(A) Micrograph showing true hyphal phenotype of the C. albicans clinical strain 83. Note the dominant filament morphotypes (arrows).
(B) Clumps of morphological forms of strain SC5314 can be seen. Note the germinating blastoconidial cell, indicated by an arrow and
true hyphal morphologies (open arrows). (C, D) The ∆sap9 mutant exhibits budding phenotype and failure of hyphal development.
Fine details of blastoconidia are discernible. (C) Oval blastoconidial mother cell (arrow) with a bud (open arrow) can be seen. Scars
(arrowheads) localized polarly are observed. (D) Blastoconidial cells morphology and cellular budding (arrow) typical of strain the
∆sap9 are visible. Mutant causes filamentous growth only in a small percentage of yeast cells. Note singular hyphal morphology (open
arrow). (E) The ∆sap10 mutant. Clumps of germinating blastoconidia can be seen (arrow). Hyphal induction has occurred, note long
true hyphal cells indicated by arrow heads. (F) The ∆sap9/∆sap10 mutant phenotype. Yeast cells defective in cellular filamentation process are observed. Fine details of blastoconidia are discernible. Oval blastoconidial cell (arrow) and a new bud (open arrow) can be seen.
Scars (s) localized polarly are observed.
ases are expressed at higher level during artificial blood
infection. We observed that human serum favours SAP7
expression. One reason for this unexpected result may
be found in the fact that SAP7 plays a role in blood
dissemination followed by interaction with human
endothelial cells. These results demonstrated that SAP7
is required for the growth of C. albicans clinical isolates
in human serum as the sole nitrogen source and Sap7
is normally expressed in the wild type strains and overexpressed when the remaining genes are expressed at
a very low level. It was likely in our study that when
C. albicans cells have to adapt and survive within the
blood environment they upregulate SAP7 expression,
while other genes important for growth and viability
in serum are downregulated (Fradin et al., 2003; Hube
et al., 1994). We therefore concluded that there is little
20
correlation between the expression of the remaining
SAP genes tested and the role of Sap proteins during
blood infection. Furthermore, our findings were in
agreement with the view that protein production is
reduced in the later stage of blood infections (Fradin
et al., 2003). Thus, in our opinion future experiments
using patients’ blood samples should bring us closer
to identifying the SAP genes and proteins that are
directly involved in candidaemia in humans. Furthermore, a gradual observation of SAP7 expression during
blood infection ought to be conducted which may show
whether SAP7 is induced as a consequence of infection. Taylor et al., (2005) utilizing the Δsap7 mutant
showed a role of proteinase Sap7 in the intravenous
model of systemic candidiasis in mice which was in
agreement with our in vitro blood infection model
in humans. Furthermore, our study was a successful
attempt in finding conditions which induce SAP7 in
vitro while it was discussed (Taylor et al., 2005) that an
in vitro induction of SAP7 mRNA level has not yet been
detected. In conclusion, these data provided the first
in vitro evidence of SAP7-10 expression in C. albicans
strains under human serum influence. In this paper,
due to the strong induction of SAP7, we hypothesize
that it is essential for C. albicans survival and help the
cells to escape from bloodstream. Thus, SAP7 may help
the fungus to cause systemic infections. We also report
SAP9 expression in serum, which was associated with
hyphal invasive growth at the site of infection.
Acknowledgement
We are extremely grateful to many colleagues and all the individuals who were generous with their advice, and provided us with
strains and reagents; Professor Danuta Dzierżanowska-Madalińska
with the strain 83; Professor Bernhard Hube with the following
strains: ∆sap9 ∆sap10 and ∆sap9-10; Gabriela Smoleńska-Sym,
Ph.D with human serum. This work was supported by the NN
404 113639 grant from the Ministry of Science and Higher Education in Poland. The authors also acknowledge the financing from
the National Science Centre provided in compliance with Grant
No. DEC-2011/03/D/NZ7/06198.
Literature
Amberg, D.C., D.J. Burke and J.N. Strathern. 2005. Yeast DNA
isolation, techniques and protocols 3, p. 17. In: D.C. Amberg,
D.J. Burke and J.N. Strathern (eds). Methods in yeast genetics. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor.
Dalle F., B. Wächtler, C. L’Ollivier, G. Holland, N. Bannert,
D. Wilson, C. Labruère, A. Bonnin and B. Hube. 2010. Cellular
interactions of Candida albicans with human epithelial cells and
enterocytes. Cell. Microbiol. 12: 248–271.
Fonzi W.A. and M.Y. Irwin. 1993. Isogenic Strain Construction and
Gene Mapping in Candida albicans. Genetics 134: 717–728.
Fradin C., M. Kretschmar, T. Nitchterlein, C. Gaillardin,
C. d’Enfert and B. Hube. 2003. Stage-specific gene expression
of Candida albicans in human blood. Molecular Microbiology 47:
1523–1543.
1
Fradin C., P. De Groot, D. MacCallum, M. Schaller, F. Klis,
F.C. Odds and B. Hube. 2005. Granulocytes govern the transcriptional response, morphology and proliferation of Candida albicans
in human blood. Molecular Microbiology 56: 397–415.
Gillum A.M., E.Y.H. Tsay and D.R. Kirsch. 1984. Isolation of the
Candida albicans gene for orotidine-5’-phosphate decarboxylase by
complementation of S. cerevisiae ura3 and E. coli pyrF mutations.
Mol. Gen. Genet. 198: 179–182.
Hornbach A., A. Heyken, L. Schild, B. Hube, J. Löffler and
O. Kurzai. 2009. The glycosylphosphatidylinositol-anchored protease Sap9 modulates the interaction of Candida albicans with human
neutrophils. Infect Immun 77: 1–9.
Hube B., M. Monod, D.A. Schofield, A.J. Brown and N.A.R. Gow.
1994. Expression of seven members of the gene family encoding
secretory aspartyl proteinases in Candida albicans. Mol. Microbiol.
14: 87–90.
Lermann U. and J. Morschhäuser. 2008. Secreted aspartic proteases
are not required for invasion of reconstituted human epithelia by
Candida albicans. Microbiol. 154: 3281–3295.
Livak K.J. and T.D. Schmittgen. 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the 2(-Delta
Delta C(T)) Method. Methods 25: 402–428.
Naglik J.R., G. Newport, T.C. White, L.L. Fernandes-Naglik,
J.S. Greenspan, D. Greenspan, S.D. Sweet, S.J. Challacombe and
N. Agabian. 1999. In vivo analysis of secreted aspartyl proteinases
expression in human oral candidiasis. Infect. Immun. 67: 2482–2490.
Naglik J.R., C.A. Rodgers, P.J. Shirlaw, J.L. Dobbie, L.L. FernandesNaglik, D. Greenspan, N. Agabian and S.J. Challacombe. 2003.
Differential expression of Candida albicans secreted aspartyl proteinase and phospholipase B genes in humans correlates with active
oral and vaginal infections. J. Infect. Dis. 188: 469–479.
Naglik J.R., D. Moyes, J. Makwana, P. Kanzaria, E. Tsichlaki,
G. Weindl, A.R. Tappuni, C.A. Rodgers, A.J Woodman, S.J. Challacombe and others. 2008. Quantitative expression of the Candida
albicans secreted aspartyl proteinase gene family in human oral and
vaginal candidiasis. Microbiol. 154: 3266–3280.
Oliviera M.T., A.F.L. Specian, C.G.T.J. Andrade, E.J.G. França,
L. Furlaneto-Maia and M.C. Furlaneto. 2010. Interaction of Can
dida parapsilosis isolates with human hair and nail surfaces revealed
by scanning electron microscopy analysis. Micron 41:604–608
Rehaume L.M., T. Jouault and M. Chamaillard. 2010. Lessons
from the inflammasome: a molecular sentry linking Candida and
Crohn’s disease. Trends. Immunol. 31: 171–175.
Schelenz S. 2008. Management of candidiasis in the intensive care
unit. J. Antimicrob. Chemother. 61: i31–i34.
Schild L., A. Heyken, P.W.J. Groot, E. Hiller, M. Mock, C. de Koster,
U. Horn, S. Rupp and B. Hube. 2011. Proteolytic cleavage of covalently linked cell wall proteins by Candida albicans Sap9 and Sap10.
Eukaryot Cell 10: 98–109.
Staniszewska M. 2009. Ph.D. Thesis, Search for Candida albicans
virulence factors. NIPH-NIH. Warsaw. Poland.
Staniszewska M., M. Bondaryk, K. Siennicka, A. Kurek, J. Orłow
ski, M. Schaller and W. Kurzątkowski. 2012. In vitro study of
secreted aspartyl proteinases Sap1 to Sap3 and Sap4 to Sap6 expression in Candida albicans pleomorphic forms. Polish. J. Microbiol.
61: 247–256.
Staniszewska M., D. Rabczenko and W. Kurzątkowski. 2011b.
Discrimination between the enzymatic activities of Candida albicans
pleomorphic forms determined using the api® ZYM test. Mycoses 54:
e744–e750. doi: 10.1111/j.1439-0507.2010.02011.x
Taylor B.N., H. Hannemann, M. Sehnal, A. Biesemeier, A. Schwei
zer, M. Röllinghoff and K. Schröppel. 2005. Induction of SAP7
correlates with virulence in an intravenous infection model of candidiasis but not in a vaginal infection model in mice. Infect. Immun.
73: 7061–7063.
2014, Vol. 63, No 1, 21–25
ORIGINAL PAPER
The Effect of Oleanolic and Ursolic Acids on the Hemolytic Properties
and Biofilm Formation of Listeria monocytogenes
ANNA KUREK1, KATARZYNA MARKOWSKA1, ANNA M. GRUDNIAK1, WIRGINIA JANISZOWSKA2
and KRYSTYNA I. WOLSKA1*
Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology, University of Warsaw, Warsaw, Poland
Department of Plant Biochemistry, Institute of Biochemistry, Faculty of Biology, University of Warsaw, Warsaw, Poland
1
2
Submitted 5 September 2013, revised 5 November 2013, accepted 16 November 2013
Abstract
Oleanolic acid and ursolic acid are pentacyclic triterpenoids isolated from a variety of medicinal plants, which have antibacterial activity.
Listeria monocytogenes is a Gram-positive facultative pathogen, being the causative agent of listeriosis. The present study was carried out to
evaluate the in vitro effect of sub-inhibitory concentrations of both triterpene acids on the pathogenicity determinants of L. monocytogenes:
their hemolytic activity and biofilm forming ability. Oleanolic and ursolic acids inhibited listeriolysin O activity without influencing toxin
secretion. Biofilm formation, and the viability of L. monocytogenes cells in biofilms was diminished by both compounds. Thus, both acids
affected L. monocytogenes virulence. It was also demonstrated that oleanolic acid bound to the peptidoglycan of L. monocytogenes and this
interaction was influenced by teichoic acids.
K e y w o r d s: Listeria monocytogenes, biofilm, listeriolysin O, oleanolic acid, ursolic acid
Introduction
Compounds of therapeutic value extracted from
medicinal plants are mostly secondary metabolites
(Cowan, 1999). Oleanolic acid (OA) and ursolic acid
(UA) are representatives of the pentacyclic triterpenoids
whose structures are based on the isoprene moiety.
Both compounds exhibit several pharmacological activities. The hepatoprotective, anti-inflammatory, antioxidant and anticancer activities of OA and UA are well
documented (Ikeda et al., 2008; Pollier and Goossens,
2012). OA, UA and their derivatives also possess antibacterial activity, primarily against Gram-positive bacteria, including multidrug-resistant strains (Fontanay
et al., 2008; Wolska et al., 2010). However, the broad
application of OA/UA is currently restricted because
their mechanism of action is still poorly understood
and the side-effects on eukaryotic cells have not been
fully characterized.
A relatively small number of studies have investigated the cellular targets and functions affected by OA/
UA. Ren and coworkers (2005) showed that UA caused
differential gene expression in Escherichia coli and substantially inhibited biofilm formation by E. coli, Pseudo
monas aeruginosa and Vibrio harveyi. Subsequently,
Chen and coworkers (2009) demonstrated the ability
of the oleane-type triterpenoid, glycyrrhizin, to inhibit
the diarrhea-inducing activity of the heat-labile enterotoxin produced by ETEC (enterotoxicogenic E. coli).
The interaction between OA/UA and several other antibacterial agents – mainly conventional antibiotics – has
been also reported (Ge et al., 2010). Of particular interest is their synergistic action with β-lactam antibiotics
against Staphylococcus aureus and Staphylococcus epi
dermidis (Kurek et al., 2012) and the ability to induce
stress response (Grudniak et al., 2011).
The Gram-positive pathogen Listeria monocytogenes
is the causative agent of listeriosis, a disease that has
increased markedly in Europe in recent years (Allerberger and Wagner, 2010). Listeriolysin O (LLO) is
considered as a major virulence determinant of Listeria
(Kayal and Charbit, 2006; Schnupf and Portnoy, 2007).
Recent studies showed new roles for intracellular LLO,
such as control of autophagy upon vacuolar escape, and
revealed the extracellular activities of LLO, for example
induction of bacterial entry into the cells and modulation
of immune activity (Hamon et al., 2012). L. monocyto
genes forms biofilms with a structure that varies greatly
from one strain to another. Bacteria living in biofilms
are less susceptible than planktonic cells to antimicrobial
* Corresponding author: K.I. Wolska, Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology, University of
Warsaw, Miecznikowa St. 1, 02-096 Warsaw, Poland; phone: + 48 22 55 41 302, fax: + 48 22 55 41 402; e-mail: [email protected]
22
Kurek A. et al.
agents, especially antibiotics (Renier et al., 2011). The
factors responsible for this enhanced resistance include
restricted penetration of antimicrobials into the biofilm
structure, decreased growth rate and the expression of
possible resistance genes (Lewis, 2001). For this reason,
the ability to grow in a biofilm is known to enhance the
pathogenicity of certain bacterial species.
It was previously proved that the cell wall constitutes
a cellular target of OA/UA activity against the facultative pathogen Listeria monocytogenes. Both these pentacyclic triterpenoids affected morphology and enhanced
autolysis of bacterial cells, influenced autolysis of the
isolated cell wall, inhibited peptidoglycan turnover
and quantitatively changed the profile of muropeptides obtained after the digestion of peptidoglycan with
mutanolysin (Kurek et al., 2010). So far there is no available information on the ability of peptidoglycan to bind
either OA or UA.
The aim of the present study was to gain some
insight into the effect of OA/UA on L. monocytogenes
virulence factors. The influence of these compounds on
the secretion and activity of listeriolysin O, biofilm formation and L. monocytogenes viability in biofilms was
examined. As peptidoglycan is involved in L. monocy
togenes biofilm formation, the ability of UA/OA to bind
this compound was also studied.
Experimental
Bacterial strain, medium and reagents. Listeria
monocytogenes (PCM 1291) was obtained from the
Polish Culture Collection, Wrocław, Poland. The bacteria were grown in tryptic soy broth with yeast extract
– TSYEB at 37°C. OA, UA and all other reagents were
purchased from Sigma. OA containing a tritium-labeled
hydroxyl group (3H-OA, 1 mg mL–1, activity 5.1 GBq
mmol–1) was provided by the Department of Plant Biochemistry, Faculty of Biology, University of Warsaw.
Measurement of the hemolytic activity of L. monocytogenes. An overnight culture of L. monocytogenes
was grown in TSYEB medium with constant shaking.
After dilution to attain an A600 of 0.1, the cultures were
incubated further to an A600 of 0.5 in medium supplemented with sub-inhibitory concentrations of OA or
UA as required. Samples of 1 mL were centrifuged and
20 µL aliquots of the supernatants were incubated with
a 1% suspension of sheep red blood cells in phosphatebuffered saline (PBS), pH 6.5, in a total volume of 1 mL
at 37°C for 30 min. In the control set of experiments
sheep red blood cells were incubated only with OA/UA
in the conditions described above. After centrifugation,
the supernatants were collected and their absorbance
1
at 410 nm was measured. The extent of hemolysis was
calculated as the percentage of the complete hemolysis
achieved by lysing erythrocytes with 1% SDS.
Determination of the LLO concentration in culture supernatants. An overnight L. monocytogenes
culture was diluted to an A600 of 0.1 and then divided
into separate samples. One sample served as a control,
while sub-inhibitory concentrations of OA or UA were
added to others and incubation was continued to an
A600 of 0.5. Cells were harvested by centrifugation, and
proteins from the supernatants were precipitated and
concentrated using 10% tichloroacetic acid (TCA). The
protein concentration in each sample was estimated
using the bicinchoninic acid assay (Brown et al., 1989).
Samples containing 5 µg of precipitated protein were
subjected to sodium dodecyl sulphate-polyacrylamide
gel electrophoresis (SDS-PAGE) (Laemmli, 1970) and
the resolved protein bands were transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were incubated with rabbit anti-LLO polyclonal
antibody (Abcam, UK, 1:1500 dilution) for 1 h, washed,
then incubated with goat anti-rabbit IgG – alkaline
phosphatase conjugate, washed again and finally developed using 5-bromo-4-chloro-3-indolyl phosphate and
nitro-blue tetrazolium (BCIP/NBT) in carbonate buffer
as the chromogenic substrate. Images of the membranes
were captured and analyzed using Image Master VDS
(Fujifilm) and Image Master 1D Elite version 301 programs (NonLinear Dynamics, UK).
Quantitative determination of biofilm formation
and measurement of cell viability in biofilms. Bacterial biofilms were developed in wells of polystyrene
microtiter plates containing 200 µL samples of culture
diluted in TSYEB medium supplemented with 0.45%
glucose and various amounts of the tested compounds.
The lowest concentration of a compound that inhibited
biofilm growth, as determined by crystal violet staining,
was taken as the minimal biofilm inhibitory concentration (MBIC) (Smith et al., 2008). To determine the
amount of biofilm in the wells of polystyrene microtiter
plates, those formed after 24 h in the presence of OA,
UA or with control samples were stained with crystal
violet and, after brief washing with 0.85% NaCl, ethanol
was added to each well to solubilize the crystal violet
and the dye concentration in this wash was estimated
by measuring the A570 with a microtiter plate reader
(Sunrise, Tecan, Switzerland). To measure cell viability
in biofilms, the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) staining method was
employed (Kairo et al., 1999) with minor modifications
(Walencka et al., 2005). The intensity of the violet color
of the resulting formazan was determined by measuring
the A550 with a microtiter plate reader.
Measurement of the ability of OA to bind peptido
glycan. Peptidoglycan was isolated from L. monocyto
1
Effect of OA and UA on the pathogenicity determinants of L. monocytogenes
genes cells following the procedure described by Korsak
and coworkers (2005). The final peptidoglycan preparations were divided into two parts: one part was
lyophilized and the second was treated with 5% TCA
in order to remove teichoic acids. The prepared peptidoglycan samples were suspended in distilled water
(1 mg mL–1) and amounts of 100 µg were incubated with
3
H-OA (0.05, 0.25, 0.5 or 1 µg) for 30 min at room temperature. The binding reactions were terminated by adding a 10-fold excess of unlabeled OA followed by 5 min
incubation. The samples were centrifuged (16,000 g,
10 min), then the resulting pellets were washed with
distilled water and analyzed using a scintillation counter. In the negative controls, the cell wall fragments in
the binding reaction were replaced by water.
Statystical analysis. Data are shown as means of at
least three experiments ± SD. Statistical significance of
the differences between experimental groups was calculated using two-tailed unpaired Student’s test. p value
< 0.05 was considered statistically significant.
Results and Discussion
The hemolytic activity of the supernatants of
L. monocytogenes cultures treated with 0.5× or 0.75×
minimal inhibitory concentration (MIC) of OA/UA
and an untreated control culture was determined. MIC
values of both compounds were 8 g mL–1 as determined
previously (Kurek et al., 2012). Both triterpene acids
inhibited LLO hemolytic activity. Compared with the
control, the inhibition observed in cultures treated with
0.75 × MIC of OA or UA amounted to 2.5-fold and
2.8-fold, respectively (Fig. 1). As it was demonstrated
Fig. 1. Effect of OA and UA on LLO activity in L. monocytogenes
culture supernatants. The results are the means of three independent experiments and the error bars indicate standard deviations
(*p < 0.05 vs control).
23
Fig. 2. Influence of OA and UA on LLO concentration
in L. monocytogenes culture supernatants.
A representative Western blot is shown. MW – molecular weight standard; lane 1 – control culture without added OA/UA; lanes 2–4 – cultures treated with 0.25 MIC, 0.5 MIC and 0.75 MIC of OA, respectively;
lanes 5–7 – cultures treated with 0.25 MIC, 0.5 MIC and 0.75 MIC of
UA, respectively.
that triterpenoids are able to form complexes with
sterols (Osbourn, 1996) and cholesterol are present
in erythrocyte membrane, the influence of OA/UA on
erythrocytes in the absence of LLO was determined
in the control experiments. It was shown that OA and
UA in concentration 0.015 × MIC, i.e. equivalent to
0.75 × MIC present in LLO-containing supernatants
(supernatants were diluted 50 × in hemolytic activity
assay, see Material and Methods) did not cause the
lysis of erythrocytes. Analysis of SDS-PAGE followed
by Western blotting demonstrated that the level of
LLO in the culture supernatants was not diminished
by treatment with either OA or UA (Fig. 2). The differences between densitometric measurement of peak
areas did not exceeded 10%. The synthesis of LLO was
also not influenced by either of these compounds, since
the amount of this cytolysin in whole cell lysates was
unchanged by OA/UA treatment (data not shown). LLO
is translated as a precursor polypeptide of 529 residues
and its N-terminal signal sequence is cleaved after protein secretion (Mengaud et al., 1988). The results of the
present study indicate that OA and UA do not interfere with the functioning of the LLO secretion apparatus. Elucidation of the reason of the reduction of LLO
hemolytic activity, for example by inhibiting initial
binding to the erythrocyte membrane or subsequent
step of pore formation, demands further experiments.
In the control experiment the complexation capability
of OA or UA with listeriolysin was checked in nondenaturing polyacrylamide gel shift assay (Mori et al., 2004)
using 2.5 µg of LLO and 0.08 µg or 0.12 µg OA or UA.
No protein band shift was observed.
The ability of L. monocytogenes to form biofilms in
the presence of OA/UA was estimated by crystal violet staining. OA and UA were added at 0.125, 0.25 or
0.5 minimal biofilm inhibitory concentration (MBIC).
MBICs of both compounds were substantially higher
than respective MICs (24 µg mL–1). Both compounds
inhibited cell adhesion to the surface of polystyrene
multiwell plates. Decreases in biofilm formation of
about 15% and > 60% were observed in the presence of
0.25 × MBIC and 0.5 × MBIC of OA/UA, respectively. In
the presence of 0.125 × MBIC of OA or UA, the biofilm
biomass was decreased by only about 12.6% and 8.8%,
24
1
Kurek A. et al.
Table I
Influence of OA/UA on L. monocytogenes biofilm formation
OA/UA concentration
[MBIC]
A570
Table II
Binding of radioactive OA to L. monocytogenes peptidoglycan
3
OA
UA
Control
2.493 ± 0.049
2.493 ± 0.049
0.125 × MBIC
2.179 ± 0.038*
2.293 ± 0.015
0.25 × MBIC
2. 097 ± 0.042*
2.175 ± 0.021*
0.5 × MBIC
0.984 ± 0.037*
0.861 ± 0.032*
The results are the means of three independent experiments ± standard
deviation. MBICs of both OA and UA were 24 µg mL–1.
* Difference statistically significant (*p < 0.05 vs control).
respectively (Table I). The cell viability was reduced by
14% and 22% in the presence of 0.125 × MBIC of OA or
UA and by 42% and 56% in the presence of 0.5 × MBIC
of OA or UA, respectively (Fig. 3). Bacterial biofilms
development is a multi-step process and their formation is influenced by a number of environmental factors
including temperature, growth medium, pH and the
nature of the surface (Moltz, 2005). Moreover, numerous molecular determinants are involved in the early
stages of biofilm formation and the late stage of biofilm development among them is flagellum-mediated
motility (O’Neil and Marquis, 2006). We previously
observed that swarming-type, but not swimming-type
nor twitching-type, motility of Pseudomonas aeruginosa
was severely inhibited by OA and UA (data not shown),
therefore it may be speculated that OA/UA can dimi
nish L. monocytogenes biofilm formation by negatively
influencing its swarming movement ability.
It has been also established that peptidoglycan plays
an important role in L. monocytogenes biofilm formation. Previous results from our laboratory showed that
peptidoglycan metabolism was affected by OA/UA
H-OA concentration
[μg mL–1]
Radioactivity of peptidoglycan
(dpm per sample)
– Teichoic acids
+ Teichoic acids
0.5*
322.52 ± 55.32
134.57 ± 54.85
2.5*
469.33 ± 57.20
148.11 ± 46.84
5*
573.99 ± 35.19
320.02 ± 143.40
10
875.92 ± 31.12
864.62 ± 63.14
The presented values are the means of three independent experiments
after subtraction of the background value ± standard deviation.
* Difference statistically significant (*p < 0.05).
(Kurek et al., 2010). In the present study we found that
tritium-labeled OA bound to isolated peptidoglycan
and that the teichoic acids, long anionic polymers
threading through peptidoglycan layers that are crucial
in protecting bacteria against harmful molecules and
environmental stresses (Xia et al., 2010) only partially
inhibited this binding (Table II). Taken together these
results suggest that changes induced by OA and UA in
the peptidoglycan structure of L. monocytogenes influence biofilm formation. In conclusion, we have demonstrated that oleanolic
and ursolic acids affect the virulence factors of L. mono
cytogenes. Both triterpene acids inhibit listeriolysin O
activity without influencing its secretion and they also
diminish the ability of this species to grow in biofilms.
Acknowledgements
This work was financially supported by Polish Ministry of
Science and Higher Education grants no. N 304 11732/4332 and
NN 302 027937.
Literature
Fig. 3. Effect of OA and UA on the viability of L. monocytogenes
cells in a biofilm. The results are the means of three independent
experiments and the error bars indicate standard deviations
(*p < 0.05 vs control).
Allerberger F. and M. Wagner. 2010. Listeriosis: a resurgent foodborne infection. Clin. Microbiol. Infect. 16: 16–23.
Brown R.E., K.L. Jarvis and K.J. Hyland. 1989. Protein measurements using bicinchoninic acid: elimination of interfering substances. Anal. Biochem. 180: 136–139.
Chen J.C., T.Y. Ho, Y.S. Chang, S.L. Wu, C.C. Li and C.Y. Hsiang.
2009. Identification of Escherichia coli enterotoxin inhibitors from
traditional medical herbs by in silico, in vitro and in vivo analyses.
J. Ethnopharmacol. 121: 372–378.
Cowan M.M. 1999. Plant products as antimicrobial agents. Clin.
Microbiol. Rev. 12: 564–582.
Fontanay S., M. Grare, J. Mayer, C. Finance and R.E. Duval. 2008.
Ursolic, oleanolic and betulinic acids: Antibacterial spectra and
selectivity indexes. J. Ethnopharmacol. 120: 272–276.
Ge F., F. Zeng, S. Liu, N. Guo, H. Ye, Y. Song, J. Fan, X. Wu, X.
Deng, Q. Jin et al. 2010. In vitro synergistic interactions of oleanolic
acid in combination with isoniazid, rifampicin or ethambutol
against Mycobacterium tuberculosis. J. Med. Microbiol. 59: 567–572.
Grudniak A.M., A. Kurek, J. Szarlak and K.I. Wolska. 2011
Oleanolic and ursolic acids affect the expression of the cysteine
1
Effect of OA and UA on the pathogenicity determinants of L. monocytogenes
regulon and stress response in Escherichia coli. Curr. Microbiol. 62:
1331–1336.
Hamon M.A., D. Ribet, F. Stavru and P. Cossart. 2012. Listeriolysin
O: the Swiss army knife of Listeria. Trends Microbiol. 20: 360–368.
Ikeda Y., A. Murakami and H. Ohigashi. 2008. Ursolic acid: an antiand proinflammatory triterpenoid. Mol. Nutr. Food Res. 52: 26–42.
Kairo S.K., J. Bedwell, P.C. Tyler, A. Carter and M.J. Corbel. 1999.
Development of tetrazolium salt assay for rapid determination of
viability of BCG vaccines. Vaccine 17: 2423–2428.
Kayal S. and A. Charbit. 2006. Lysteriolysin O: a key protein of
Listeria monocytogenes with multiple functions. FEMS Microbiol.
Rev. 30: 514–529.
Korsak D., M. Popowska and Z. Markiewicz. 2005. Analysis of the
murein of a Listeria monocytogenes EGD mutant lacking functional
penicillin binding protein 5 (PBP5). Pol. J. Microbiol. 54: 339–342.
Kurek A., A.M. Grudniak, M. Szwed, A. Klicka, Ł. Samluk and
K.I. Wolska. 2010. Oleanolic acid and ursolic acid affect peptidoglycan metabolism in Listeria monocytogenes. Anton. Leeuven. Int.
J. Gen. Mol. Microbiol. 97: 61–68.
Kurek A., P. Nadkowska, S. Pliszka and K.I. Wolska. 2012. Modulation of antibiotic resistance in bacterial pathogens by oleanolic acid
and ursolic acid. Phytomedicine 19: 515–519.
Laemmli U.K. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227: 680–685.
Lewis K. 2001. Riddle of biofilm resistance. Antimicrob. Agents
Chemother. 45: 999–1007.
Mengaud J., M.F. Vincente, J. Chenevert, J.M. Pereira, C. Geoffroy, B. Gicquel-Sanzey, F. Baquero, J.C. Perez-Diaz and P. Cossart. 1988. Expression in Escherichia coli and sequence analysis of
the lysteriolysin O determinant of Listeria monocytogenes. Infect.
Immun. 56: 766–772.
Moltz A.G. 2005. Formation of biofilms by Listeria monocytogenes
under various growth conditions. J. Food Prot. 68: 92–97.
25
Mori M., M. Yoneyama, T. Ito, K. Takahashi, F. Inagaki and
T. Fujita. 2004. Identification of Ser-386 of interferon regulatory
factor 3 as critical target for inducible phosphorylation that determines activation. J. Biol. Chem. 279: 9698–9702.
O’Neil H.S. and H. Marquis. 2006. Listeria monocytogenes flagella
are used for motility, not as adhesins, to increase host cell invasion.
Infect. Immun. 74: 6675–6681.
Osbourn A.E. 1996. Preformed antimicrobial compounds and plant
defense against fungal attack. Plant Cell 8: 1821–1831.
Pollier J. and A. Goossens. 2012. Oleanolic acid. Phytochemistry
77: 10–15.
Ren D., R. Zuo, A.F.G. Barrios, L.A. Bedzyk, G.R. Eldridge,
M.E. Pasmore and T.K. Wood. 2005. Differential gene expression for investigation of Escherichia coli biofilm inhibition by plant
extract ursolic acid. Appl. Environ. Microbiol. 71: 4022–4034.
Renier S., M. Hébraud and M. Desvaux. 2011. Molecular biology of
surface colonization by Listeria monocytogenes: an additional facet
of an opportunistic Gram-positive foodborne pathogen. Environ.
Microbiol. 13: 835–850.
Schnupf P. and D.A. Portnoy. 2007. Listeriolysin O: a phagosomespecific lysin. Microb. Infect. 9: 1176–1187.
Smith K. A. Perez, G. Ramage, D. Lappin, C.G. Gemmell and
S. Lang. 2008. Biofilm formation by Scottish clinical isolates of
Staphylococcus aureus. J. Med. Microbiol. 57: 1018–1023.
Walencka E., B. Sadowska, S. Różalska, W. Hryniewicz and
B. Różalska. 2005. Lysostaphin as a potential therapeutic agent for
staphylococcal biofilm eradication. Pol. J. Microbiol. 54: 191–200.
Wolska K.I., A.M. Grudniak, B. Fiecek, A. Kraczkiewicz-Dowjat
and A. Kurek. 2010. Antibacterial activity of oleanolic and ursolic
acids and their derivatives. Centr. Eur. J. Biol. 5: 543–553.
Xia G., T. Kohler and A. Peschel. 2010. The wall teichoic acid and
lipoteichoic acid polymers of Staphylococcus aureus. Int. J. Med.
Microbiol. 300: 148–154.
2014, Vol. 63, No 1, 27–31
ORIGINAL PAPER
Iron Shortage and Bile Salts Play a Major Role in the Expression
of ompK Gene in Vibrio anguillarum
MOHAMMED A. HAMOD1, 2*, PATIT P. BHOWMICK1, YASSAMIN N. SHUKUR2, IDDYA KARUNASAGAR1
and INDRANI KARUNASAGAR1
Department of Fishery Microbiology, Karnataka Veterinary, Animal and Fisheries Sciences University,
College of Fisheries, Mangalore – 575 002, India.
2
Department of Biotechnology, College of Sciences, University of Baghdad, Baghdad – 10070, Iraq
1
Submitted 6 October 2013, revised 30 December 2013, accepted 1 February 2014
Abstract
The outer membrane protein K, OmpK first identified in Vibrio parahaemolyticus has been shown to be a receptor for a broad host range
vibriophage KVP40 infecting members of the Vibrionaceae. In the study, the effect of culture conditions on the expression of ompK in
V. anguillarum was studied using real-time PCR. The expression increased significantly in the presence of bile salts and iron chelating
agent 2, 2’ bipyridine, suggesting a role for this protein in bile resistance and also in iron acquisition by V. anguillarum. OmpK induction
by iron limitation and the presence of bile salts was reconfirmed by western blot technique after growing the cells in trypticase soy broth
supplemented with bile salts, blood and 2, 2’ bipyridine. We surmise that the expression of OmpK protein of V. anguillarum is bile salt and
iron chelating agent-dependent.
K e y w o r d s: Vibrio anguillarum, OmpK expresion, Real-time PCR, Western blot, bile salt, iron deprivation
Introduction
Vibrio anguillarum, a marine bacterium belonging
to the family Vibrionaceae is a major bacterial pathogen of marine and estuarine fish throughout the world
(Myhr et al., 1991). V. anguillarum infection results in
fatal haemorrhagic septicaemia in marine fish when
the immune system of fish is compromised or when the
mucosal surfaces are damaged (Croxatto et al., 2007).
The outer membrane of Gram-negative bacteria
consists of phospholipids and proteins. The proteins
make up to 50% of the outer membrane mass. In recent
years, these outer membrane proteins have attracted
attention, since they have an important role in the hostbacteria interaction in adherence, uptake of nutrients
including iron from the host, and subverting host
defense mechanisms (Li et al., 2008).
To date, studies on V. anguillarum outer membrane
proteins have focused on OmpU, the major outer membrane protein present in large quantities and OM2, the
induced outer membrane protein, which is known to be
linked with virulence of the organism (Pedersen et al.,
1997; Simón et al., 1996; Wang et al., 2003). However,
more interest has been given to the role of membrane
proteins involved in iron uptake such as FetA and FvtA.
Recently it was demonstrated that the expression of
these proteins decreases spectacularly with iron readiness (Naka and Crosa, 2012). Some Omps play a role
in efflux of salinity, therefore their expression increases
with the rise of salt concentration (Davey et al., 1998,
Kao et al., 2009).
Although the presence of OmpK has been demonstrated in V. cholerae, V. parahaemolyticus, V. harveyi
and V. alginolyticus (Inoue et al., 1995a), only the protective efficacy of V. alginolyticus OmpK against fish
vibriosis caused by V. alginolyticus has been reported
(Qian et al., 2008). Therefore in this study, we attempted
to look for OmpK at DNA and protein level; in addition, we also studied the expression of ompK gene by
real-time PCR and the effect of different culture conditions on the expression to get an insight on the role of
this outer membrane protein in V. anguillarum.
Experimental
Bacterial strain and growth condition. V. anguil
larum NB10 kindly provided by Dr. Sahul Hameed
(Abdul Hakeem College, India) was maintained at
* Corresponding author: M.A. Hamod, Department of Biotechnology, College of Sciences, University of Baghdad, Baghdad – 10070,
Iraq; phone: +964 7715130069; fax: +91 824 2246384, e-mail: [email protected]
28
Hamod M.A. et al.
–80°C in nutrient broth containing 30% glycerol (Sanyo
Corporation, Japan). The culture was set up by inoculating 5 ml of sterile trypticase soya broth (TSB) supplemented with 1% NaCl and incubated overnight at 28°C.
Nucleic acid extractions. DNA extraction was carried out from 1 ml of V. anguillarum culture using the
method described by Ausubel et al., 1995. The DNA
pellet was resuspended in Tris-EDTA buffer (10 mM
Tris-Cl, 1 mM EDTA, pH 8). RNA extraction and purification was done by RNeasy Protect Bacteria Mini Kit
(Qiagen, USA) according to the protocol described by
the manufacturer. Extracts were subsequently treated
with DNase I (Fermentas International Inc., Canada),
according to manufacturer’s guidelines to remove any
remaining DNA.
Primer design. To study the ompK gene of V. anguillarum, the primers F-k502: GGCTTCCAAATTTCAACCAA and R-k699: TTTAAGGCCGTAGCCAACAG
were designed using the Primer3 software ((http://
biotools.umassmed.edu/bioapps/primer3 www.cgi),
based on the ompK gene (GenBank accession no.
FJ705222.1). The primers F-rpoA: CGTAGCTGAAGGCAAAGATGA and R-rpoA: AGCTGGAACATAACCACGA previously reported by Defoirdt et al., 2007
were used to amplify rpoA, which served as an internal
standard gene.
Effect of growth conditions. The experiment was
carried out in 100 ml TSB inoculated with 1 ml overnight culture followed by incubation at 28°C. To study
the effect of NaCl on V. anguillarum growth, bacteria
were grown in TSB supplemented with the following
NaCl concentrations; 1% (control), 2%, 3% and 4%.
To study the effect of bile salts, the culture was grown
in media containing 0.1%, 0.2%, and 0.4% bile salts,
and also grown in media free of bile salt (control). The
effect of blood was determined by using 1%, and 2% of
fresh blood; culture grown in media without blood were
taken as control. The effect of the iron chelating agent
2, 2’-bipyridine was studied by growing the bacteria
with or without 20 mM 2, 2’-bipyridine. The effect of
a combination of 1% blood and 100 mM of 2, 2’-bipyridine was also studied.
cDNA synthesis. Reverse transcription was carried
out according to the protocol of Fermentas Life Sciences (Fermentas International Inc., Canada). Briefly,
the RNA was reverse transcribed to cDNA from 2 μg of
RNA using 2 μl of reverse primer (100 ng/μl) and 0.5 μl
of RevertAid H minus (Fermentas International Inc.,
Canada) at 42°C for 1 h. OmpK cDNA was tested by
PCR using primers F-k502, and R-k699 and cDNA of
the internal standard gene (rpoA subunit) was tested by
PCR using primers F-rpoA and R-rpoA. cDNA samples
were stored at –20°C for further use.
Real-time PCR analysis. Quantification of expression level of the ompK gene was done by real-time PCR
1
using 7300 Real-time PCR System (Applied Biosystems,
Foster city, USA). Validation of the real-time PCR was
done by amplifying serial dilutions of cDNA synthesized from 1 µg of RNA isolated from bacterial samples (Livak and Schmittgen, 2001). to carry out relative
quantification using the 2–ΔΔct formula.
The appropriate primer concentrations (200 nM
for ompK and 300 nM for rpoA) were used for thermal
cycling which included an initial activation at 50°C for
2 min, initial denaturation at 95°C for 10 min followed
by 45 cycles of denaturation at 95°C for 15 s, primer
annealing at 60°C for 45 s and elongation at 72°C for
30 s and a melting-curve program (95°C for 15 s and
60°C for 30 s). This was performed for each gene to
check for amplification of the targeted fragments. Each
reaction was performed in triplicate and the average
value was considered for data analysis and statistical
validation. Amplification data was recorded at the end
of each elongation step.
Analysis of relative gene expression was performed
using the 2–ΔΔct method of Livak and Schmittgen (2001).
The expression of the target genes was normalized
to the endogenous control by calculating ΔCT and
expressed relative to a calibrator by calculating ΔΔCT
(ΔΔCT = ΔCT target – ΔCT calibrator). The control values
(5 h time interval, 0.5% NaCl, 0% bile salt, iron and
2, 2’-bipyridine) of each experimental condition were
used as calibrator. The expression level of the ompK
gene in each condition of the study was tested by an
independent sample student t-test for calculating ΔCt
data. Significance level was taken at 5%.
Western blotting. Bacteria grown under different
culture conditions that resulted in a significant difference in the production of ompK gene were harvested
by centrifugation at 4000 g for 10 min and were lysed
by discontinuous sonication on ice at 20–30 W with
six 10 s bursts followed by centrifugation at 5000 g for
20 min to remove the unlysed cells. Cell lysates were
resolved in 15% SDS-PAGE (without staining) and
electrotransferred onto nitrocellulose blotting membrane (Pall, New York, USA) at a constant voltage of
50 V for 1 h according to our previous article (Hamod
et al., 2012). The membrane was blocked with 3%
bovine serum albumin (BSA) overnight at 4°C. This
was followed by three times washes with phosphate
buffer saline containing 0.05% Tween-20 (PBST) followed by 3 washes with phosphate buffer saline (PBS)
(1 min each time). The protein bands on the membrane
were allowed to react with the rabbit anti-OmpK serum
developed by us as described in our previous work
(Hamod et al., 2012) diluted 1:100 with gentle agitation at room temperature for 1 h, followed by washing
and further incubation with horse radish peroxidase
(HRP)-conjugated goat anti-rabbit immunoglobulin G
antibodies (Sigma, Missouri, USA) diluted 1:1000 for
1
29
Expression of ompK in V. anguillarum
Fig 1. Expression of V. anguillarum ompK gene (a) in the presence of different concentrations of bile salts (b) in the presence
of 1% blood, 2% blood, 20 Mm 2, 2’-bipyridine and 1% blood with 100 Mm 2, 2’-bipyridine. The error bars represent
the standard deviation of three independent measurements of ΔΔCT based on bacterial mRNAs. Data that are significantly
different (P < 0.01) from the calibrator are marked with an asterisk.
1 h. The reaction was carried out by dipping the membrane in tetramethylbenzidine solution (Merck, India)
after thorough washing with PBS, stopped by rinsing
with distilled water and visualized.
Results
Effect of culture conditions on the expression of
ompK gene. Study on the effect of varying salt concentrations on growth and OmpK expression of V. anguil
larum NB10 showed that NaCl concentrations up to
3% had a minimal effect. Expression of ompK at 2%
NaCl (2.74 fold) was observed to be higher than at
1%, 3% and 4% of NaCl. The growth of V. anguillarum
NB10 seemed to decrease with increasing bile salt
concentration in the medium while the expression of
ompK increased with increase in bile salt concentration
(Fig. 1a). Expression of ompK gene was the highest at
0.4% bile salt concentration (5.8 fold) (Fig. 1a). Supplementation of iron chelating agent 2, 2’-bipyridine
increased ompK 5.7 fold (Fig. 1b). On supplementation
of culture medium with fresh human blood, the expression of ompK decreased (Fig. 1b). When both 20 mM
2, 2’-bipyridine and blood were supplemented, ompK
expression was reduced to 2.3 fold compared to 5.7 fold
in the presence of 2, 2’-bipyridine alone (Fig. 1b).
Western blot analysis. Positive bands with molecular weight of 28 KDa were seen only in the lanes containing cell lysates of V. anguillarum grown with 0.4%
of bile salts, 20 mM bipyridine, and 1% of blood with
100 mM bipyridine (Fig. 2). No bands appeared in the
other lanes containing the cell lysates of V. anguillarum
grown with 4% NaCl, 2% blood supplement or bacteria
grown in TSB without any supplementation.
Discussion
V. anguillarum is a causative agent of vibriosis in finfish and invertebrates such as bivalves and crustaceans.
Vibriosis results in massive losses to the aquaculture
30
Hamod M.A. et al.
Fig. 2. Western blot for V. anguillarum OmpK grown inpresence
of bile salts, NaCl, bipyridine and blood. Protein marker (M),
TSB (1), 0.4% bile salt (2), 4% NaCl (3), 2% of blood (4), 20 mM
bipyridine (5), 1% of blood and 100 mM bipyridine(6).
industry (Garcia et al., 1997). V. anguillarum NB10
initially isolated by Norqvist et al., 1989 was the representative isolate chosen for this study, since it belongs
to serotype O1, which is globally accepted as a highly
pathogenic serotype. Since serotype O1 assumes variable outer membrane profile under different conditions
(Simón et al., 1996), the use of a strain of this serotype
would be appropriate for the study of any novel outer
membrane protein.
Gram-negative bacteria such as V. anguillarum are
surrounded by a bilayer outer membrane in which
proteins are interspersed. Porins in bacterial outer
membranes have a regulatory role in nutrient uptake,
facilitating the transport of specific nutrient molecules (Achouak et al., 2001; Nikaido, 1994). Few outer
membrane proteins such as OmpA and general porins
are constitutively expressed in high levels in the cell
whereas the majority of outer membrane proteins are
induced with increased synthesis occurring only under
certain circumstances (Koebnik et al., 2000). A 26 kDa
outer membrane protein, OmpK common to Vibrio
species was first reported by Inoue et al. (1995a; 1995b)
and shown to serve as a receptor for a broad-host-range
vibriophage, KVP40. Although the genes encoding
OmpK in V. cholerae, V. harveyi and V. alginolyticus are
similar (Inoue et al., 1995a), variations for this gene in
terms of the number of amino acids they encode have
been reported for V. alginolyticus and V. harveyi (Li
et al., 2008; Qian et al., 2008). So far, there has been no
report on the structure and functions of ompK gene in
V. anguillarum.
Polyclonal antibody was raised against the purified recombinant OmpK protein in rabbit in our work
(Hamod et al., 2012). Surprisingly a positive band was
detected only in the case of purified OmpK protein.
The protein in the cell lysate of V. anguillarum was
undetected by Western blot. It has been reported that
expression of OMP is related to environmental condi-
1
tions like temperature, salinity, availability of nutrients
and oxygen (Nandi et al., 2005).
Real-time PCR technique, a reliable quantitative
method for measuring gene expression (Nielsen and
Boye, 2005) was used in this study to determine the
effect of varying environmental factors such as salt concentration, bile salt concentration and iron chelating
agent on the expression of ompK gene in V. anguillarum.
V. anguillarum, a marine bacterium, well recognized
as a pathogen of marine and estuarine fish, encounters
different osmotic environments. The outer membrane
proteins have a crucial role in maintaining the osmotic
state of the organism during any salt stress. In this study
growing V. anguillarum at salt concentrations higher
than 2%, which is the optimum for its growth, did not
upregulate ompK expression suggesting that ompK
probably is not involved in osmoregulation. On the
contrary, using the proteomic approach of Kao et al.,
2009 showed that both ompU and ompW are highly
expressed at 3.5% NaCl and are possibly involved in
osmoregulatory function in V. anguillarum.
V. anguillarum being a fish pathogen, when ingested
by fish is likely to be exposed to bile in the fish gut
and therefore might be in possession of mechanisms
for survival in the gut environment. Our study shows
that expression of ompK is upregulated in the presence
of bile salts. Though growth seemed to be suppressed
at 0.4% bile salt (data not shown), expression of ompK
was 5 fold higher (Fig. 1a) suggesting a role for this protein in bile resistance. Wang et al., 2003 showed OmpU
to play a role in bile resistance in V. anguillarum. In
Escherichia coli two outer membrane proteins OmpF
and OmpC confer bile salt resistance. While OmpF
is sensitive to bile salt concentration changes at low
temperature and salinity, OmpC responds to alteration in bile salt concentration at elevated temperature
(Nikaido and Rosenberg, 1983). Similarly, we suggest
that in V. anguillarum, in addition to OmpU (Wang
et al, 2003), OmpK may also be playing an important
role in bile salt resistance and its uptake.
Iron uptake mechanisms are involved in conferring virulence to V. anguillarum. Two iron uptake
mechanisms have been reported in this organism viz
production of anguibactin and vanchrobactin (Lemos
et al., 1988). We observed that expression of ompK
was induced in the presence of iron chelating agent
2, 2’-bipyridine and this is partially offset if blood is
present in the medium (Fig. 1b), which probably suggests that OmpK in V. anguillarum responds to changes
in iron level in the environment.
Therefore, V. anguillarum strain was grown in TSB
medium supplemented with 20 m mol–1 2, 2’-bipyridine,
0.4% bile salt, 4% NaCl, 2% of blood and combination of
biypiridine and blood for the detection of OmpK protein by Western blot. A band with 28 kDa (Fig. 2) was
1
Expression of ompK in V. anguillarum
visualized in the case of V. anguillarum strain grown in
bile salt, bipyridine and combination of blood and bipyridine. This result further confirms the role of OmpK
protein in bile salt resistant and iron uptake.
Acknowledgment
The first author gratefully acknowledges the research fellowship awarded by DBT-TWAS Ph.D programme and also thankfully
acknowledges the support of the University of Baghdad.
Literatures
Achouak W., T. Heulin and J.M. Pagés. 2001. Multiple facets of
bacterial porins. FEMS Microbiol Lett. 199: 1–7.
Ausubel F.M., R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl. 1995. Short Protocols in Molecular Biology: A compendium of methods from Current Protocol in
Molecular Biology. New York John Wiley and Sons.
Croxatto A., J. Lauritz, C. Chen and D. Milton. 2007. Vibrio
anguillarum colonization of rainbow trout integument requires
a DNA locus involved in exopolysaccharide transport and biosynthesis. Environ. Microbiol. 9: 370–382.
Davey M.L., R.E.W. Hancock, L.M. Mutharia. 1998. Influence of
culture conditions on expression of the 40-kilodalton porin protein of Vibrio anguillarum serotype O2. Appl Environ Microbiol. 64:
138–146. Defoirdt T., C.M. Miyamoto, T.K. Wood, E.A. Meighen, P. Sorgeloos, W. Verstraete and P. Bossier. 2007. The natural furanone
(5Z)-4-bromo-5-(bromomethylene)-3-butyl-2(5H)-furanone disrupts quorum sensing-regulated gene expression in Vibrio harveyi
by decreasing the DNA-binding activity of the transcriptional regulator protein LuxR. Environ. Microbiol. 9: 2486–2495.
Garcia T., K. Otto, S. Kjelleberg and R. Nelson. 1997. Growth of
Vibrio anguillarum in Salmon intestinal mucus. App. Environ. Micro
biol. 63: 1034–1039.
Hamod M.A., M.S. Nithin, Y.N. Shukur, I. Karunasagar and
I. Karunasagar. 2012. Outer membrane protein K as a subunit vaccine against V. anguillarum. Aquaculture. 354–355: 107–110.
Inoue T., S. Matsuzaki and S. Tanaka. 1995a. A 26 kDa outer membrane protein, OmpK, common to Vibrio species is the receptor
for a broad-host-range vibriophage. KVP40. FEMS Microbiol. Lett.
125: 101–106.
Inoue T., S. Matsuzaki and S. Tanaka. 1995b. Cloning and
sequence analysis of Vibrio parahaemolyticus ompK gene coding
a 26-kDa outer membrane protein, OmpK, that serves as receptor
for a broad-host-range vibriophage, KVP40. FEMS Microbiol. Lett.
134: 245–249.
Kao D.Y., Y.C. Cheng, T.Y. Kuo, S.B. Lin, C.C. Lin, L.P. Chow
and W.J. Chen. 2009. Salt-responsive outer membrane proteins of
Vibrio anguillarum serotype O1 as revealed by comparative proteome analysis. J. Appl. Microbiol. 106: 2079–2085.
31
Koebnik R., Locher K.P and P. Van Gelde. 2000. Structure and
function of bacterial outer membrane proteins: barrels in a nut shell.
Mol. Microbiol. 37: 239–253.
Lemos M.L., P. Salinas, A.E. Toranzo, J.L. Braja and J.H. Crosa.
1988. Chromosome-mediated iron uptake system in pathogenic
strain of V. anguillarum. J. Bacteriol. 170: 1920–1925.
Li N., Bai J., S. Wu, X. Fu, H. Lao, Y. Xing and C. Shi. 2008. An
outer membrane protein, OmpK, is an effective vaccine candidate
for Vibrio harveyi in Orange-spotted grouper (Epinephelus coioides).
Fish Shellfish Immun. 25: 829–833.
Livak K.J. and T.D. 2001. Schmittgen. Analysis of relative gene
expression data using real-time quantitative PCR and the 2−ΔΔCT
method. Methods. 25: 402–408.
Miller E.S., J.F. Heidelberg, J.A. Eisen, W.C. Nelson, A.S. Durkin,
A. Ciecko, T.V. Feldblyum, O. White, I.T. Paulsen, W.C. Nierman,
J. Lee, B. Szczypinski and C.M. Fraser. 2003. Complete genome
sequence of the broad-host-range vibriophage KVP40: comparative
genomics of a T4-related bacteriophage. J. Bacteriol. 185: 5220–5233.
Myhr E.L., J.L. Larsen, A. Lillehaug, R. Gudding, M. Heum and
T. Hástein. 1991. Characterization of Vibrio anguillarum and closely
related species isolated from farmed fish in Norway. Appl. Environ.
Microbiol. 57: 2750–2757.
Nandi B., R.K. Nandy, A. Sarkar and A.C. Ghose. 2005. Structural
features, properties and regulation of the outermembrane protein W
(OmpW) of Vibrio cholerae. Microbiology 151: 2975–2986.
Naka H. and J.H. Crosa. 2012. Identification and characterization
of a novel outer membrane protein receptor FetA for ferric enterobactin transport in Vibrio anguillarum 775 (pJM1). Biometals. 25:
125–133.
Nielsen K. and M. Boye. 2005. Real-time quantitative reverse
transcription-PCR analysis of expression stability of Actinobacillus
pleuropneumoniae housekeeping genes during in vitro growth under
iron-depleted conditions. Appl Environ Microbiol. 71: 2949–2954.
Nikaido H. and E.Y. Rosenberg. 1983. Porin channels in Esch
erichia coli: studies with liposomes reconstituted from purified
proteins. J. Bacteriol. 153: 241–252.
Nikaido H. 1994. Porins and specific diffusion channels in bacterial
outer membranes. J. Biol. Chem. 296: 3905–3908.
Norqvist A., W.A. Hagstr and H. Wolf-Watz. 1989. Protection
of rainbow trout against vibriosis and furunculosis by the use of
attenuated strains of Vibrio anguillarum. Appl. Environ. Microbiol.
55: 1400–1405.
Pedersen K., L. Gram, D.A. Austin and Austin B. 1997. Pathogenicity of Vibrio anguillarum serogroup O1 strains compared to
plasmids, outer membrane protein profiles and siderophore production. J. Appl. Microbiol. 82: 365–371.
Qian R., Z. Xiao, C. Zhang, W. Chu, L. Wang, H. Zhou, Y. Wei and
L. Yu. 2008. A conserved outer membrane protein as an effective
vaccine candidate from Vibrio alginolyticus. Aquaculture. 278: 5–9.
Simón M., A. Mathes, A. Blanch and H. Engelhardt. 1996. Characterization of a porin from the outer membrane of Vibrio anguil
larum. J. Bacteriol. 178: 4182–4188.
Wang S., J. Lauritz, J. Jass and D. Milton. 2003. Role for the major
outer-membrane protein from Vibrio anguillarum in bile resistance
and biofilm formation. Microbiology 149: 1061–1071.
2014, Vol. 63, No 1, 33–41
ORIGINAL PAPER
Development of Synbiotics with Inulin, Palatinose, α-Cyclodextrin
and Probiotic Bacteria
RAMINTA PRANCKUTĖ*, ARNOLDAS KAUNIETIS, NOMEDA KUISIENĖ
and DONALDAS ČITAVIČIUS
Department of Microbiology and Biotechnology, Vilnius University, LT-03100, Vilnius, Lithuania
Submitted 20 June 2013, revised 20 October 2013, accepted 16 November 2013
Abstract
Success in creating a synbiotic depends on compatibility between the chosen components – prebiotic and probiotic. In this work the interactions between Lactobacillus sp. strains isolated from yogurts and type strains of Lactobacillus sp. and Lactococcus sp., and the dependence
of their growth and antibacterial activity on three oligosaccharides (OS) – palatinose, inulin and α-cyclodextrin were investigated. All
isolated lactobacilli produce antibacterial compounds, which possibly are the bacteriocins of Lactobacillus casei ATCC334 strain. Results
of growth analysis with different OS revealed that part of lactobacilli isolated from yogurts can effectively ferment inulin and may be
used for the development of synbiotics. Palatinose and Lactobacillus acidophilus could be used as symbiotics with effective antibacterial
activity. One of the types of Lactococcus sp. strains can assimilate palatinose and α-cyclodextrin, so they both can be used as components
of synbiotics with the investigated lactococci. Results of this analysis suggest that the investigated isolated and type strains of Lactobacil
lus sp. and Lactoccocus sp. can be useful as probiotics in the development of synbiotics. Together with prebiotics – palatinose, inulin and
α-cyclodextrin, the synbiotics, which could regulate not only the growth of beneficial bacteria in the gastrointestinal tract, but also their
antibacterial activity, can be created.
K e y w o r d s: Lactobacillus sp., Lactococcus sp., bacteriocin, probiotic, synbiotic
Introduction
Synbiotic is a combination of probiotic and prebiotic, which can synergistically promote the growth of
beneficial bacteria or newly added species in the colon
(Macfarlane et al., 2008). During the development of
new synbiotic products it is very important to ascertain
prebiotic and probiotic interactions and influence of
prebiotic on probiotic growth and antibacterial activity. Prebiotics are described as non-digestible poly-or
oligosaccharides that beneficially affect the host by
selectively stimulating the growth and/or activity of
one or a limited number of beneficial bacteria in the
colon (Gibson and Roberfroid, 1995). Prebiotics themselves have many health promoting properties. Moreover, there is evidence that they can help modulate the
growth of gut microbiota and stimulate bacteriocin
production (Kunova et al., 2011; Patel and Goyal, 2012).
Inulin, palatinose and α-cyclodextrin used in this
work are generally recognized as safe (GRAS) food
additives (Wagner et al., 2008; Holub et al., 2010). Inulin
is one of the most comprehensively studied OS and is
widely recognized as a bifidogenic prebiotic (Bosscher
et al., 2006; Patel and Goyal, 2012). Inulin is a liner
polymer consisting of β-(2→1)-fructosyl-fructose linkages (Roberfroid, 2007). Palatinose is a reducing sugar,
composed of glucose and fructose moieties, joined with
α-1,6-glycozil bonds. Commercially palatinose is made
from sucrose by enzymatically reorganizing glycosyl
bonds (Holub et al., 2010). Cyclodextrins (CDs) are
circular oligosaccharides, composed of glucose residues linked by α-1,4-glycosyl bonds. The hydrophilic
part of the molecule is faced to the outside of the ring,
and the hydrophobic part is inside the ring (del Valle,
2004; Wagner et al., 2008). Commercially cyclodextrins
are produced from a starch. These molecules are widely
used in pharmacy, chemistry and food industry due
to their ability to form inclusion complexes (del Valle,
2004). Although βCD is more industrially used due to
its lower price, αCD is characterized by better solubility in water (140 mg/ml) than βCD (18 mg/ml, 25°C)
(Szejtli, 2004).
Inulin, palatinose and α-cyclodextrin can act in
many health promoting ways, like stimulating immune
system, reducing the amounts of pathogenic (Bacillus
sp., Escherichia coli, Campylobacter jejuni, Salmonella
* Corresponding author: R. Pranckutė, Department of Microbiology and Biotechnology, Vilnius University, M.K. Čiurlionio str. 21/27,
Vilnius, Lithuania, LT-03100; phone: +37052398210; e-mail: [email protected]
34
1
Pranckutė R. et al.
enteritidis (Bosscher et al., 2006; Zhang et al., 2008)) or
oral plaque bacteria (Porphyromonas gingivalis (Ueno
et al., 2012)); reducing the risk of colon cancer; reducing triglycerides, fatty acids and cholesterol amounts in
the blood and thus preventing cardiovascular diseases
and decreasing the risk of obesity and type II diabetes
(Wagner et al., 2008; Ooi and Liong, 2010; Patel and
Goyal, 2012). Although these OS also have sweetness
due to their indigestibility they are characterized by low
glycaemic index (for example, palatinose has about half
the sweetness of sucrose, but its glycaemic index is only
32 (Holub et al., 2010)). This makes them even more
favorable food additives for diabetic patients.
Like most prebiotics, inulin, palatinose and α-cyclo
dextrin are not digested in the upper gastrointestinal
tract (except palatinose), which makes them available
and longer lasting carbon sources for beneficial colon
bacteria, like bifidobacteria (Bosscher et al., 2006;
Goderska et al., 2008) and lactobacilli (Kunova et al.,
2011). However, most investigations are focused on
the influence of these OS on bifidobacteria and little
is known about how they affect lactobacilli and other
beneficial bacteria from other genera, like lactococci,
widely used in the food industry (Pan et al., 2008;
Gänzle and Follador, 2012). Most of them produce
various antibacterially active compounds and bacteriocins among them (Chen et al., 2006). Not much
research is done in this area, but there is evidence that
bacteriocins may have various effects on the gut microbiota, like facilitating the introduction of the producing strain into the gastrointestinal tract, inhibiting the
invasion of competing and pathogenic strains, modulating the composition of the gut microbiota and
influencing the host immune system (Dobson et al.,
2012). While bacteriocin production is often growthassociated and is dependent on carbon availability,
slow digestion of prebiotics is very important as they
are much longer-lasting carbon sources and mostly
fermented only in the colon (Macfarlane et al., 2008).
In addition to this, it is important to clarify the effect
of prebiotics on the growth and antibacterial activity
of probiotic bacteria (Chen et al., 2006). It is shown
that inulin stimulates the secretion of bacteriocins by
Lactobacillus paracasei CMGB16 strain (Vamanu and
Vamanu, 2010). However, little is known about the
influence of αCD and palatinose on probiotic bacteria, but it has been shown that αCD can maintain the
growth of Lactobacillus casei and increase the amounts
of bifidobacteria (Jo et al., 2007). The analysis of L. casei
supragenome has revealed that the bacterial strains of
this species should be able to ferment inulin, palatinose and many other OS (Broadbent et al., 2012), which
could be useful parts of synbiotics for diabetic patients.
However, not many investigations of these properties
have been made in vitro.
Experimental
Strain isolation from yogurts. The sources of Lactic
Acid Bacteria (LAB) were probiotic yogurts: “Actimel”
and “Bifi”. For the isolation of strains, 1 g of each yogurt
were added to 99 ml of 0.85 % sterile saline solution.
Tenfold serial dilutions of the samples were made and
appropriate dilutions were streaked on de Man, Ragosa
and Sharpe (MRS) agar plates (Kormin et al., 2001).
The plates were incubated for two days under anaerobic
conditions at 37°C by placing a gas pack in the anaerobic jar (Merck).
Bacterial strains and growth conditions. Six Lacto
bacillus sp. and two Lactococcus sp. type strains were
obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ): Lactobacillus acidophi
lus DSM 20079 (LA), Lactobacillus delbrueckii subsp.
bulgaricus DSM 20081 (LD), Lactobacillus curvatus
DSM 20010 (LC), Lactobacillus sakei subsp. sakei DSM
20017(LS), Lactococcus lactis subsp. lactis DSM 20481
(LL) and L. lactis subsp. lactis DSM 20729 (LL2) (abbreviations of strains used further in the work are given in
the brackets). Isolated and type strains of Lactobacillus
sp. were cultured in MRS broth (Merck) or basal MRS
(Saminathan et al., 2010). Type strains of Lactococcus
sp. were grown in broth No. 92 (DSMZ culture medium
list), which consisted of Tryptic Soy Broth (TSB, Merck),
supplemented with 0.3% Yeast Extract (YE, Difco). Isolated strains were cultured aerobically or anaerobically,
with (100 rpm) or without agitation, at 30°C. Type
strains of L. acidophillus and L. delbrueckii subsp. bul
garicus were grown under anaerobic conditions, at 37°C.
Other type strains were cultured aerobically, at 30°C.
Oligosaccharide substrates. Three different commercially available oligosaccharides were used in this study:
inulin (Inl) (Alfa Aesar), palatinose hydrate (Pal) (TCI)
and α-cyclodextrin (Ctd, αCD) (Merck). Stock solutions
of these oligosaccharides were prepared in sterile distilled
water and filter sterilized with 0.22 μm filters (Roth).
The sterile oligosaccharide solutions were added to autoclaved basal MRS medium to obtain final oligosaccharide concentration of 1% (w/v). Glucose (Merck), which
was a favourable carbohydrate source for all used LAB
strains, was used as control (Saminathan et al., 2010).
Partial identification of isolated strains. Genomic
DNA of isolated strains was extracted using GeneJet
DNA Extraction Kit (Thermo Fisher Scientific). Universal bacterial 16S rDNA primers (27F and 1492R,
Thermo Fisher Scientific) were used for PCR reactions.
Reaction products were sequenced at the Sequencing
Center of the Institute of Biotechnology. In silico data
analysis was performed using the NCBI Blast programme (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
1
Development of synbiotics with oligosaccharides and probiotic bacteria
In order to determine the variety of strains isolated from yogurts, we performed PCR reaction with
all strains genomic DNA and universal BOX primers.
Results were analyzed by agarose gel electrophoresis
(Sambrook and Russell, 2001).
Antibacterial activity assay. The antibacterial activity of strains was determined using the spot-on-lawn
method (Kormin et al., 2001) with modifications. The
tested strain was grown overnight in the middle of Petri
dish with an appropriate agar medium. Then the layer
of agar medium with inoculated other presumably sensitive strain was poured on top of the grown culture.
The agar media with inoculated strain was prepared by
adding 20% of 1.2 OD culture inoculum into an appropriate agar media. Isolated and type strains were tested
against each other.
Agar well diffusion assay. 0.5 cm diameter wells were
made, using sterile plastic pipette tips, in the agar media
with inoculated sensitive strain, prepared as described
above. Culture samples were taken every two hours from
the beginning of culture cultivation in liquid media. Samples were centrifuged and the serial twofold dilutions
of the cell free supernatants were made. The amount
of 100 µl of every dilution was poured into the prepared wells and plates were incubated overnight at the
temperature appropriate for the used indicator strain.
Clear zones round the wells after incubation indicate the
inhibitory activity, which was expressed quantitatively
as arbitrary units per milliliter (AU/ml). The arbitrary
unit (AU) was defined as the reciprocal of the highest
dilution able to produce a clear zone of growth inhibition of the indicator strain (Vera Pingitore et al., 2007).
Disintegration of cells. Samples (5 ml) of the grown
cultures were taken every 6 h from the beginning of
growth. Samples were centrifuged, cells were suspended
in 5 ml of phosphate buffer (pH 6.0) and then disrupted
with the ultrasound disintegrator. Obtained cell disintegrate was filtered through 0.22 µm filter (Roth) or centrifuged (5 min, 14 000 × g). In order to determine the
antibacterial activity, 100 µl of the filtered, centrifuged
and untreated disintegrates were tested using agar welldiffusion assay using A20 strain as indicator.
Identification of bacteriocins. Primers (20 pairs
in total) used in this work were described in scientific
publications or constructed using typical well known
bacteriocin encoding gene sequences from the Genbank database (http://www.ncbi.nlm.nih.gov/Genbank/
index.html), are listed in Table I.
Results
Isolation of bacteria from yogurts. Since the morphology of bacteria grown on the MRS medium did not
have any differences, 9 strains of Lactobacillus sp. iso-
35
lates were randomly selected: 4 strains from “Actimel”
yogurt (“Danone”) (A isolates) and 4 from “Bifi” yogurt
(UAB “Rokiškio pienas”) (B isolates). The amount of
Lactobacillus sp. bacteria in examined yogurts was
estimated at 108 cells in 1 gram of yogurt. These data
coincide with the information given by the producers.
For a more detailed identification of the isolates
16S rDNA analysis was made. Results have shown that
the isolated strains are most similar to L. casei and
L. paracasei subsp. tolerans species (reliability of BLAST
analysis results is 100%). Implementation of BOX-PCR
reaction, used to estimate the variety of bacterial strains
among isolates, has revealed distribution of strains in
the profiles, fully complying with strains origin from
different yogurts (data not shown).
Antagonistic activity assay of isolated strains.
3 strains from group A and 3 strains from group B were
selected for the antagonistic activity assay. Using spoton-lawn method it was determined that all isolated
lactobacilli strains were able to produce clear zones
inhibiting the growth of the strains, used as indicator
(isolated strains were tested against each other). Results,
given in Table II, reflect the antagonistic spectrum of
the tested strains. The obtained results allow us to assert
that stains belonging to groups A and B produce antibacterially active compounds. The size of the formed
clear zones (Table II.) shows that the antibacterial
compound of B group strains is more active or a larger
amount of it is produced.
Antibacterial activity of isolated and type strains.
Antibacterial activity of 3 isolated (A11, B13, A20) and
6 type strains against each other was determined and
phenotypically evaluated (Table III.). Results have
shown that LL2 strain possesses the highest antibacterial activity among type strains. The antibacterial spectrum and ability to inhibit the growth of tested strains
of this strain did not differ from antibacterial spectrum and activity of isolated lactobacilli strains A11,
A20 and B13. However, only LD strain had no antibac
terial activity against any of the tested strains and was
sensitive to all antibacterial compounds secreted by
the tested strains.
Identification of bacteriocins produced by isolated and type strains. One of the possibilities to
identify secreted bacteriocins is a search of bacteriocin
encoding genes in the genomes of analyzed strains. For
this purpose we used 20 pairs of primers constructed
in accordance with genes of well known bacteriocins (GeneBank Database) or selected from scientific
publications (Table I.). All primers were used for PCR
reactions with genomic DNA of 15 strains (9 isolated
and 6 type strains). The results of the size and sequence
analysis of the obtained PCR products can be divided
into five groups: 1) Two PCR products compatible
with genes encoding nisin by their size and results of
36
1
Table I
Primers used for bacteriocin genes identification in studied bacterial strains.
No
Primer
(abbrevation)
Tm,
°C
Sequence
Expected product
(size, bp)
Source
1 1BACTP (1)
F: 5’-TGA AGA TGT ATT TGG GTG CGT-3’
R: 5’-CAG GAG TTG CTG GTG TTG TT-3’
57
(Digaitiene
Lakticin 3147 (257)
58
et al., 2012)
2 2BACTP (2)
F: 5’-GCG CCT GCA GGG CTT TCT TTC GAT CAC GAT-3’
R: 5’-GCG CGT CGA CGG TTC GAT AGT TCG TGC TT-3’
75
Pediocin PA (541)
75
(Digaitiene
et al., 2012)
3 3BACTP (3)
F: 5’-CTA TGT ACA CCC GGT TGT AA-3’
R: 5’-TTT ATG AAC TAG GCG AAT CA-3’
56
Nizin (590)
52
(Digaitiene
et al., 2012)
4 4BACTP (4)
F: 5’-ACA GGT GGA AAA TAT TAT GGT A-3’
R: 5’-TTT TGC TTA TTA TTT ATT CCA G-3’
55
Sakacin P (150)
51
(Digaitiene
et al., 2012)
BACTA164-
5
-NIZLL (A)
F: 5’-ATG AGT ACA AAG ATT TTA ACT TGG ATT GGT-3’
R: 5’-ATA AAC GAA TGC ACT TAT GAT GTT ACT GT-3’
64
Nizin
63
(Swetwiwathana
et al., 2009)
BACTWNC- F: 5’-CCG GAA TTC ATA AGG AGG CAC TCA AAA TG-3’
6
-NIZLL (W) R: 5’-CGG GGT ACC TAC TAT CCT TTG ATT TGG TT-3’
69
Nizin A
69
(Millette
et al., 2008)
7 LacS (L)
F: 5’-ATG GAA TTR TTR CCR ACK GCY GCY GTY YTR TA-3’
R: 5’-ATG RTG TTT RGC NSW RTA YTT-3’
72
Lakticin S
54
(Rodrígues
et al., 1995)
8 m2163 (63)
F: 5’-AAA CAT ATG AAA CGA AAG TGC CCC AAA AC-3’
R: 5’-TTT GAA TTC GCG ACG ATC TCT TGA ACA TTC-3’
66 Class II bacteriocin (Kuo Y.-C.
68(≤ 300)
et al., 2012)
9 m2386 (86)
F: 5’-ATT CAT ATG GAC AGC ATC CGT GAT GTT TC-3’
R: 5’-TTT GAA TTC GCT GCC AGA ACA AGT TGG TT-3’
68 (≤ 300)
et al., 2012)
10 m2393 (93)
F: 5’-GCT CAT ATG GAA AAC GGT GGT TTA TGG TCA-3’
R: 5’-AAA GAA TTC GGA ATC CCA GAA TGG CAG C-3’
69 (≤ 300)
et al., 2012)
11 m2405 (5)
F: 5’-CAA CAT ATG GCC AAG CGA CGC-3’
R: 5’-CGA GAA TTC CGC TAC TAT TTC CC-3’
63 (≤ 300)
et al., 2012)
12 m2406 (6)
F: 5’-TCA CAT ATG AAA AAG AAA TTT GAT TGT GCT-3’
R: 5’-TAA GAA TTC GCC CAC TTC TTT AC-3’
59(≤ 300)
et al., 2012)
13 AcdT (AT)
F: 5’-ATG ATT TCA TCT CAT CAA AAA ACG-3’
R: 5’-CTA AAAACC GTC AGT ATA ACG AAG GC-3’
57 Acidocin 8120
65 (141)
14 CurA (CA)
F: 5’-GCG CAG GAA TGA TTT CTG TAG GC-3’
R: 5’-GCT CTG CCT TCA AAT TAG ACC CTC-3’
65
Curvacin A (179)
65
This work
This work
F: 5’-GCG CAG GAA TGA TTT CTG TAG GC-3’
15 CurA2 (CA2)
R: 5’-TGG GAT CAT TTG GCG TCT GC-3’
65 Curvacin A and
This work
60 imunity gene (837)
16 SakA (SA)
F: 5’-GCG CAG AGG AGA TTC TTA GTT ATG-3’
R: 5’-CAT TCC AGC TAA ACC ACT AGC CC-3’
64
Sakacin A (197)
65
This work
17 SakP (SP)
F: 5’-GCA GAA GTA ACA GCA ATT ACA GGT GG-3’
R: 5’-CGC TAG CGT ATT CTT AGA ATA GTG TGC-3’
66
Sakacin P (622)
67
This work
18 92
F: 5’-ATG AAA AAA CAA GAA ACA CAA TTG TTT GAA GC-3’
R: 5’-TCA TCT AAA AAT CTG AGT CAA TCC CC-3’
65Prebakteriocin
63 (186)
This work
19 94
F: 5’-TTG GGT GGA AAG GAA ACA CGG TTA TTT CAG GC-3’
R: 5’-TCA AAG CCA AAC GCT CAA CCC GCC-3’
72Prebakteriocin
69 (192)
This work
20 111
F: 5’-ATG ACA GAC AAA CGT GAAACT TTA ATG TCG-3’
R: 5’-GTA ATG CCC CCA AAC AAT GGG AAT GG-3’
67 Prebakteriocin
68(333)
This work
BLAST analysis (primers 3 and W, genomic DNAs of
LL2 and LL strains respectively, Table I). 2) PCR products, obtained with 5 primers constructed for detection of new bacteriocins of L. casei ATCC334 (63, 86,
93, 405, 406) (Kuo et al., 2013) and genomic DNAs of
isolated strains. Sequences of the products had homo
logy with the sequences of new bacteriocins, mentioned
before. 3) PCR products obtained with primers constructed according to prebacteriocin genes found in the
genome of L. casei BDII strain (Genbank Database, GI:
385821700) (primers 92, 94 and 111 (Table I.), genomic
DNAs of isolated strains), which were compatible with
1
Table II
Results of antibacterial spectrum of isolated strains.
Sensitive strain
A11
A15
A20
B1
B4
B13
Secreting strain
A11 +++ + + +
A15 + +++ + +
A20 + + + ++
B1
++ +++++ ++ ++
B4
++ +++++ +
B13
+++ ++++++ ++ ++
+
“+” – diameter of the clear zone arround the secreting culture exeeds
1.5 mm; “++” – clear zone ≤ 2.5 mm, “+++” – zone > 2.5 mm.
Table III
Results of antibacterial activity of isolated and type strains.
Sensitive strain
A11 B13 A20
A11 + ++
LA
LD
LL
LL2
LC
LS
+ +++++++++ ++ ++
B13 +++ +++ + +++++++++ ++ ++
Secreting strain
A20 +
+
++ +++++++++ ++ ++
LA +/– +/–+/– ++ + + +/– +
LD– – – – ––– –
LL +/––+/––+/––+/–– +
+
+
+
LL2
+++++++++
++ +++
+++
LC – +/–+/– +/– ++ + + +
LS ++/–++/–++++
“+/––” – clear zone is visible only by the borders of the secreting culture;
“+/–” – clear zone is hardly visible, ≤ 0.5 mm; “+” – clear zone ≤ 1.5 mm;
“++” – clear zone ≤ 2.5 mm, “+++” – clear zone > 2.5 mm.
the prebacteriocin genes by their size and sequence.
However, more detailed in silico analysis of these
products, using Bactibase database (http://bactibase.
pfba-lab-tun.org/physicochem), has shown that, most
likely, these genes do not encode bacteriocins. 4) PCR
products, obtained with primers for well known bacteriocin genes and genomic DNAs of isolated and some
of the type strains (primer for nisin (3) with genomic
DNA of isolated, LL and LA strains; primer for lacticin
3147 (1) with genomic DNA of isolated and LD strains;
primer for curvacin A (CA2) with genomic DNA of isolated and LD strains), which were not compatible with
these bacteriocin genes by their size and sequence analysis, but were identified as hypothetical or unrelated
function proteins. 5) No PCR products were obtained
with 7 primers for the well known bacteriocin genes
(pediocin PA (2), sakacin P (4 and SP), sakacin A (SA),
lacticin S (L), acidocin 8120 (AT), curvacin A (CA)
(Table I)) and genomic DNAs of all strains.
Ability of the isolated and type strains to assimilate OS. Considering the results of BLAST and BOXPCR analysis, only strains A11 and B13 were used for
37
further experiments, as they represent different groups
of BOX-PCR profiles and possess the highest antibacterial activity among the strains of their groups (Table II.).
Data from the graphs presented in Fig. 1. (A and B)
suggest that in all cases both A11 and B13 strains most
weakly assimilate palatinose hydrate. On the other
hand, inulin is poorly assimilated only by strain A11
(Fig. 1A). The growth of strain B13 with inulin is equi
valent to the growth of this strain with glucose, except
that the exponential growth phase begins about 4 h later
(Fig. 1B). The increase of OS concentration does not
influence the growth of strains.
Analysing the influence of different carbon sources
(glucose, inulin and palatinose) on the type strains of
Lactobacillus sp. and Lactococcus sp., the following was
determined:
1.In the medium with glucose as an only carbon source
L. lactis subsp. lactis strains (LL and LL2) grew faster
than strains LS and LA. LL and LL2 strains reached
the stationary phase after 6 and 8 h respectively
(Fig. 1C and D), while strains LS and LA reached
this phase of growth after 14 and 28 h respectively
(Fig. 1E and F). Evaluation of growth time and cell
density at the beginning of the stationary phase suggests that strain LL2 grows fastest in the medium
with glucose.
2.Strain LL assimilates palatinose best among the type
strains (Fig. 1C). The culture reaches cell density of
1.2 OD in the beginning of stationary phase after 14 h
of growth, while assimilation of inulin is ineffective
– maximum reached OD was 0.5.
3.The assimilation of inulin and palatinose by strain LS
is completely ineffective (Fig. 1E).
4.Strain LL2 equally poorly assimilates both inulin and
palatinose. Only 0.5 OD cell density is reached in the
beginning of the stationary phase, after 5 h of growth
(Fig. 1D).
5.LA also ineffectively assimilates inulin and palatinose. The stationary phase with the cell density of
0.5 OD is reached after 12 h in the medium with inulin and only after 24 h when growing with palatinose
(0.45 OD) (Fig. 1F).
The MRSb medium becomes opaque after addition of αCD and it becomes impossible to track the
alterations of OD. Therefore, the influence αCD on the
growth of strains was analysed only with strains LL and
LL2. Results (Fig. 1C and D) have shown that αCD is
actively assimilated by LL2 strain.
Evaluation of antibacterial activity of isolated
strains. Antibacterial activity of culture supernatants
was evaluated by the well-diffusion method during the
growth (Vera Pingitore et al., 2007). Strain A20 was
used as indicator for the evaluation antibacterial activity
of the isolated strains, while testing on agard medium
by spot-on-lawn method it demonstrated the highest
38
1
Fig. 1. OS influence on the growth and antibacterial activity of isolated and type strains of Lactobacillus sp. and Lactococcus sp. Curves
are marked with abbreviations of used OS: Glu – glucose; Pal – palatinose; Inl – inulin; Cdt – α-cyclodextrin. Concentration of
OS – 1 %, ×2 – 2 % (w/v). A – OS influence on the growth of A11 strain. B – OS influence on the growth of B13 strain. C – OS influence
on the growth of L. lactis subsp. lactis (LL) strain. D – OS influence on the growth of L. lactis subsp. lactis (LL2) strain. E – OS influence
on the growth of L. sakei subsp. sakei (LS) strain. F-OS influence on the growth of L. acidophilus (LA) strain. G – OS influence on the
antibacterial activity of L. lactis subsp. lactis (LL2) strain. H – OS influence on the L. acidophilus (LA) strain.
sensitivity to the antibacterial compounds secreted by
other isolated strains (Table II). However, no antibacterial activity was detected while testing supernatants
from the cultures grown in the liquid medium. The
negative results could be caused by:
•interaction between antibacterial compound and
cell surface;
•accumulation of antibacterial compound inside the
cell;
•low concentration of the secreted antibacterial
compound.
Accordingly, the cultivation of strains A11 and B13
was repeated after addition of 0.5% and 1% of Tween-80,
which should reduce the interaction between proteins
and cell surface and also enlarge the amount of antibacterial compound in the culture supernatant (the
initial concentration of Tween-80 in the MRS medium
is 0.1%). However, no clear zones were detected after
repeated evaluation of antibacterial activity of culture
supernatants.
Culture samples (5 ml) were taken every 6 hours
from the beginning of growth. The samples were centri-
1
fuged and cells were disintegrated. Antibacterial activity
of filtered, centrifuged and untreated cell disintegrates
was tested by the well-diffusion assay, but no antibacterial activity was detected.
Aiming to increase the amount of antibacterial compound, A11 and B13 strains were grown in the liquid
medium till the end of exponential growth phase. 50 ml
of every culture supernatants were salted out with 80%
saturation of ammonium sulphate. Suspension of proteins was dialyzed in the phosphate buffer and concentrated up to 2 ml of volume. The antibacterial activity of
the crude protein extracts was tested by the well-diffusion method, but no definite clear zones were detected.
Another factor that could influence the production of bacteriocins is a deficiency of certain minerals. So strains A11 and B13 were grown in medium
supplemented with combination of minerals, which
were optimized in our laboratory to the growth and
bacteriocin production of bacteria from other genera. It
was shown that addition of NaHSO4 and MnSO4 to the
medium (MnSO4 is an ingredient of MRSb medium)
almost completely inhibits the growth of strain A11, but
in the case of strain B13, these minerals only prolong
the lag phase of growth. Other used combinations of
minerals practically have no influence on the growth
of the strains. However, culture supernatants did not
possess any antibacterial activity either.
It is known that pH of the growth medium strongly
influences to the bacteriocin expression. But no antibacterial activity in culture supernatants after changing the pH of the growth medium from 5.6 to 7.2 was
detected.
OS influence on bacteriocin secretion. Strain A20
was replaced with LL as indicator strain (Table III.)
and the antibacterial activity of A11 and B13 culture
supernatants repeatedly grown with different carbon
sources (glucose or 1% OS) was evaluated by welldiffusion assay. In this case about 2 mm of diameter
unclear transparency zones around the wells with
the culture supernatants after 12 and 14 h of growth
were detected. The activity of secreted putative bacteriocins was minor – after diluting the supernatants
only two times the activity was not detected. LL2,
LS, LD and LC strains were also used as indicators
but no clear zones had been detected around the wells
with A11 and B13 strains grown in liquid medium culture supernatants either.
No antibacterial activity was detected in culture
supernatants while analyzing the influence of OS on
the type strains, although all type strains, sensitive to
the grown strains respectively (Table III.), were used as
sensitive. Positive results were obtained only with strains
LL2 and LA while using LS and LC strains as indicators.
The antibacterial activity of strain LL2 culture
supernatants was tested using LC strain as indicator,
39
as it is characterized by the highest sensitivity to the
bacteriocin secreted by LL2 strain (Table III). After 6 h
of growth of this strain in the medium with glucose
or α-cyclodextrin, the antibacterial activity of culture supernatants was two times higher (80 AU/ml)
when grown with αCD, than with glucose (40 AU/ml),
although the cell density of the culture grown with
glucose at that moment was almost two times bigger,
than grown with αCD (1.5 OD and 0.8 OD respectively) (Fig. 1G). These results show that αCD positively
influences bacteriocin production or activity. While
growing the strain in the medium with inulin or palatinose, the antibacterial activity was detected only
after 8 h (20 AU/ml). That suggests that strain LL2 is
not capable of assimilating palatinose and inulin and,
therefore, the antibacterial activity of culture supernatants is very weak (Fig. 1G). It should be noted that
culture supernatant, obtained after 10 h of growth with
αCD, maintains the same activity as after 8 h of growth
(320 AU/ml), and while growing in the medium with
glucose, the activity of culture supernatant decreases
two times (Fig. 1G).
Strain LS is characterized by high sensitivity to
the antibacterial compound produced by strain LA
(Table III). Due to this fact, this strain was used as
indicator for evaluation of the antibacterial activity of
strain LA grown in the liquid medium. Besides, both
these strains can be cultivated in the MRS medium.
Diverse influence of OS on the antibacterial activity of
LA strain, grown with different carbon sources – glucose, palatinose and inulin was shown (Fig. 1H). During the growth of this strain, the antibacterial activity of culture supernatant occurred in the 8th hour of
growth. Culture supernatants of 16, 20 and 24 hours
possessed the highest activity (320 AU/ml) during the
exponential growth phase of the investigated strain.
Cell density of the LA culture after 8 h of growth in
the medium with glucose or with palatinose practically
does not differ. Although the antibacterial activity of
the culture supernatant with palatinose is two times
lower, the activities becomes equal after 28 h of growth,
when the culture ends the exponential growth in the
medium with glucose and is already in the stationary
phase in the medium with palatinose (Fig. 1F and H).
The cell density of the culture is equal (0.5 OD) after
12 h of growth in the medium with glucose and in
the medium with inulin, but the antibacterial activity
of the culture supernatant with inulin is 8 times lower.
The antibacterial activity decreases two times after 16 h
of growth in the medium with inulin and becomes
undetectible after 20 h.
It should be noted that the growth of the LA
strain measuring the cell density of the cultures in
the media with inulin and palatinose only slightly differs (1.25 times) (Fig. 1F). However, the antibacterial
40
1
activity of culture supernatants with palatinose at those
hours, when it is possible to evaluate the antibacterial activity of the supernatants with inulin, is at least
8 times higher (Fig. 1H).
Discussion
Three oligosaccharides were used in this work: palatinose and inulin, characterized by low caloricity and
prebiotic properties, and α-cyclodextrin – practically
not investigated as a component of synbiotics. The possibility to use these prebiotics in the development of
synbiotics for healthy and especially for diabetic people, may be an effective mean for enhancement of the
immune system and prevention of colon infections by
pathogenic microorganizms.
Probiotics are the second component of synbiotics. One of the ways by which probiotics may influence
proliferation of pathogenic bacteria in the gastrointestinal tract are bacteriocins, secreted by them. In this
work, it has been demonstrated that Lactobacillus sp.
strains, isolated from “Activia” and “Bifi” yogurts, are
bacteriocin producers. In solid medium clear transparent zones, indicating growth inhibition of the sensitive strain, independently of whether glucose or OS
were used as an only carbon source, were obtained.
However, no antibacterial activity was detected in the
liquid media. According to the literature, there was
shown, that in many cases LAB strains exhibits antibacterial activity on solid but not in liquid media. However, further investigations showed that most of these
bacteriocins could be produced also in liquid media,
but only under optimized conditions (MaldonadoBarragán et al., 2009). We did not succeed to obtain
crude extracts of these bacteriocins, although all
methodical procedures usual for bacteriocin extraction
were carried out. However, the obtained PCR products
suggests that they may be the newly characterized bacteriocins of L. casei ATCC 334 (Kuo et al., 2013). Furthermore, analysis results of the ability to ferment the
used carbon sources and influence of microelements on
the growth of A11 and B13 strains confirm the distribution of isolated lactobacilli strains into two physiological groups, compatible with BOX-PCR profiles and
isolation sources. These results suggest that B group lactobacilli have specific genetic systems enabling them to
ferment inulin. However, palatinose is not assimilated
by strains belonging to both A and B groups.
In the case of two type L. lactis and two type Lac
tobacillus strains it was determined that in the growth
media with different OS as an only carbon source L. lac
tis subsp. lactis strains demonstrated good fermentation of α-cyclodextrin, almost equal to that of glucose.
However, Lactococcus sp. strains differ in the efficiency
of palatinose assimilation – LL stands out of all tested
strains for the ability to ferment palatinose. It shows
that this strain has specific enzymes, required for the
transport and hydrolysis of this disaccharide.
LS strain is totally unable to assimilate inulin and
palatinose. On the other hand, LA strain ferments these
OS inefficiently. Analysis of the influence of glucose,
palatinose, inulin and α-cyclodextrin on the bacteriocin
expression of LL and LL2 strains shows that in the case
of glucose and α-cyclodextrin bacteriocins appear in
the medium in the late stationary phase, which suggests
that these antibacterial substances, according to PCR
results – possibly nisin, are released into the growth
medium during the lysis of cells.
The analysis of isolated lactobacilli in the medium
with inulin as an only carbon source show that this
OS can be used as a prebiotic to create synbiotics with
B group lactobacilli isolated from yogurts. According to
the analysis of L. casei genomes, carried out by Broadbent and coworkers (2012), members of this species are
able to ferment inulin. This and the results of 16S rDNA
analysis suggest that our isolated strain B13 belongs
to the L. casei species. Palatinose and LA strain could
be used as synbiotics with the effective antibacterial
activity. The same property would be characteristic of
a synbiotic based on α-cyclodextrin and strain LL2.
The presented results offer the possibility to create
synbiotics on the basis of probiotics – Lactobacillus sp.
and Lactococcus sp. and prebiotics – palatinose, inulin
and α-cyclodextrin, which could regulate not only the
growth of different lactobacilli and lactococci, but also
the efficiency of their antibacterial activity.
Acknowledgements
This work was supported by the “ThermozymOS” project (Grant
No. SVE-08/2011) of the Research Council of Lithuania.
Literature
Bosscher D., J. Van Loo and A. Franck. 2006. Inulin and ologofructose as prebiotics in the prevention of intestinal infections and
diseases. Nutr. Res. Rev. 19(2): 216–26.
Broadbent J.R., E.C. Neeno-Eckwall, B. Stahl, K. Tandee, H. Cai,
W. Morovic, P. Horvath, J. Heidenreich, N.T. Perna, R. Barrangou
and J.L. Steele. 2012. Analysis of the Lactobacillus casei supragenome and its influence in species evolution and lifestyle adaptation.
BCM Genomics 13: 533.
Chen Y.-S., S. Srionnual, T. Onda and F. Yanagida. 2007. Effects
of prebiotic oligosaccharides and trehalose on growth and production of bacteriocins by lactic acid bateria. Lett. Appl. Microbiol. 45:
190–193.
Digaitiene A., Å.S. Hansen, G. Juodeikiene, D. Eidukonyte and
J. Josephsen. 2012. Lactic acid bacteria isolated from rye sourdoughs produce bacteriocin-like inhibitory substances active against
Bacillus subtilis and fungi. J. Appl. Microbiol. 112: 732–742.
Dobson A., P.D. Cotter, R.P. Ross and C. Hill. 2012. Bacteriocin
Production: a Probiotic Trait? Appl. Environ. Microb. 78(1): 1–6.
1
Gänzle M.G. and R. Fallador. 2012. Metabolism of oligosaccharides
and starch in lactobacilli: a review. Food Microbiol. 340(3): 1–15.
Gibson G.R. and M.B. Roberfroid. 1995. Dietary modulation of the
human colonic microbiota: introducing the concept of prebiotics.
J. Nutr. 125: 1401–1412.
Goderska K., J. Nowak and Z. Czarnecki. 2008. Comparison of
the growth of Lactobacillus acidophilus and Bifidobacterium bifidum
species in media supplemented with selected saccharides including
prebiotics. Acta Sci. Pol. 7(2): 5–20.
Holub I., A. Gostner, S. Theis, L. Nosek, T. Kudlich, R. Melcher
and W. Scheppach. 2010. Novel findings of the metabolic effects of
the low glycaemic carbohydrate isomaltulose (PalatinoseTM). Brit.
J. Nutr. 103: 1730–1737.
Jo A., D. Nakata, K. Terao, M. Otani and K. Sano. 2007. New
Synbiotics by the combination of α-cyclodextrin and lactic acid bacteria, Proceedings of 25th Cyclodextrin Symposium in Japan Tottori,
Japan. p. 144–145.
Kormin S., G. Rusul, S. Radu and F.H. Ling. 2001. Bacteriocinproducing lactic acid bacteria isolated from traditional fermented
food. Malays. J. Med. Sci. 8(1): 63–68.
Kunová G., V. Rada, I. Lisová, Š. Ročková and E. Vilková. 2011. In
vitro Fermentability of Prebiotic Oligosaccharides by Lactobacilli.
Czech. J. Food Sci. 29(Special Issue): 49–54.
Kuo Y.-C., C.-F. Liu, J.-F. Lin, A.-C. Li, T.-C. Lo and T.-H. Lin.
2013. Characterisation of putative class II bacteriocins identified
from a non-bacteriocin-producing strain Lactobacillus casei ATCC
334. Appl. Microbiol. Biotechnol. 97(1): 237–246.
Macfarlane G.T., H. Steed and S. Macfarlane. 2008. Bacterial
metabolism and health-related effects of galacto-oligosaccharides
and other prebiotics. J. Appl. Microbiol. 104: 305–344.
Maldonado-Barragán A., J.L. Ruiz-Barba and R. Jiménez-Díaz.
2009. Knockout of three-component regulatory systems reveals
that the apparently constitutive plantaricin-production phenotype
shown by Lactobacillus plantarum on solid medium is regulated via
quorum sensing. Int. J. Food Microbiol. 130(1): 35–42.
Millette M., G. Carnut, C. Dupont, F. Shareck, D. Archambault
and M. Lacroix. 2008. Capacity of Human Nisin-and PediocinProducing Lactic Acid Bacteria To reduce Intestinal Colonization
by Vancomycin-Resistant Enterococci. Appl. Environ. Microbiol.
74(7): 1997–2003.
Ooi L.-G. and M.-T. Liong. 2010. Cholesterol-Lowering Effects of
Probiotics and Prebiotics: A Review of in Vivo and in Vitro Findings.
Int. J. Mol. Sci. 11: 2499–2522.
Pan X., T. Wu, L. Zhang, L. Cai and Z. Song. 2009. Influence of
oligosaccharides on the growth and tolerance capacity of lactobacilli
41
to simulated stress environment. Lett. Appl. Microbiol. 48: 362–367.
Patel S. and A. Goyal. 2012. The current trends and future perspectives of prebiotics research: a review. 3 Biotech 2: 115–125.
Roberfroid M.B. 2007. Inulin-Type Fructans: Functional Food
Ingredients. J. Nutr. 137: 2493S–2502S.
Rodríguez J.M., L.M. Cintas, P. Casaus, A. Suárez and P.E.
Hernández. 1995. PCR Detection of the Lactocin S Structural Gene
in Bacteriocin-Producing Lactobacilli from Meat. Appl. Environ.
Microbiol. 61(7): 2802–2805.
Sambrook J. and D.W. Russell. 2001. Molecular cloning; a laboratory manual. 3rd ed. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory.
Saminathan M., C.C. Sieo, R. Kalavathy, N. Abdullah and
Y.W. Ho. 2010. Effect of prebiotic oligosaccharides on growth of
Lactobacillus strains used as probiotic for chickens. Afr. J. Microbiol.
Res. 5(1): 57–64.
Swetwiwathana A., T. Zendo, J. Nakayama and K. Sonomoto.
2009. Identification of Nisin Z producing Lactococcus lactis N12
associated with traditional Thai fermented rice noodle (Kanom
Jien). As. J. Food. Ag-Ind. 2(02): 116–125.
Szejtli J. 2004. Past, present and future of cyclodextrin research.
Pure Appl. Chem. 76(10): 1825–1845.
Ueno C., A. Jo, D. Nakata, K. Terao, M. Otani, K. Sano,
T. Oshima and N. Naeda. 2012. Enhacement of Antibacterial
Activity of Manuka Honey on Periodontal Pathogenic Bacteria
with α-Cyclodextrin, Proceedings of 29th Cyclodextrin Symposium.
Hoshi univ., Tokyo, Japan. p. 198–199.
del Valle E.M.M. 2004. Cyclodextrins and their uses: a review, Pro
cess Biochem. 39(9): 1033–1046.
Vamanu E. and A. Vamanu. 2010. The influence of prebiotics
on bacteriocin synthesis using the strain Lactobacillus paracasei
CMGB16. Afr. J. Microbiol. Res. 4(7): 534–537.
Vera Pingitore E., E. Salvucci, F. Sesma and M.E. Nader-Macías.
2007. Different strategies for purification of antimicrobial peptides
from Lactic Acid Bacteria (LAB), p. 557–568. In: Mendez-Vilas A.
(Ed.). Communicating Current Research and Education Topics and
Trends in Applied Microbiology. Microbiology Series n° 1, Vol. 2.
Formatex, Spain.
Wagner E.M., K.-L.C. Jen, J.D. Artiss and A.T. Remaley. 2008.
Dietary alpha-cyclodextrin lowers LDL-C and alters plasma fatty
acid profile in LDLr-KO mice on a high-fat diet. Metabolism 57(8):
1046–1051.
Zhang H.-M., Z. Li, K. Uematsu, T. Kobayashi and K. Horikoshi.
2008. Antibacterial activity of cyclodextrins against Bacillus strains.
Arch. Microbiol. 190: 605–609.
2014, Vol. 63, No 1, 43–49
ORIGINAL PAPER
Uropathogenic Escherichia coli Isolates with Different Virulence Genes Content
Exhibit Similar Pathologic Influence on Vero Cells
JAMIL M.A.S. OBAIDA, *, SAMIRA R. MANSOURB, MOHAMMED S. ELSHAHEDYC, TARIK E. RABIED
and ADEL M.H. AZABE
a
Medical Research Institute, Alexandria University, Egypt; b Faculty of Science, Suez Canal University, Egypt
Faculty of Veterinary Medicine, Suez Canal University, Egypt; d Faculty of Agriculture, Suez Canal University, Egypt
e
Veterinary Serum and Vaccine Research Institute Abbasia-Cairo, Egypt
c
Submitted 11 January 2013, revised 27 February 2013, accepted 18 October 2013
Abstract
Uropathogenic Escherichia coli are the major causative agent of urinary tract infection – they may simultaneously express a number of
virulence factors to cause disease. The aim of this study was to investigate the relation between virulence factors content of fifteen UPEC
isolates and their pathogenic potential. The isolates belonged to the five serotypes O78:K80, O114:K90, O142:K86, O164 and O157. Nine
of the virulence factors have been explored, ibeA, pap, sfa/foc, cnf1, hly, fyuA, pil, ompT and traT. Virulence factors profiling of the isolates
revealed a different content ranging from 22% to 100% of the virulence genes explored. The pathogenic capacity of all fifteen isolates when
tested on Vero cells showed that the cytotoxicity for all tested strains on Vero cells was approximately equal and enhanced after growth
in syncase broth, leading mainly to cell lysis. The toxic effects reduced slightly after heat treatment of the toxin, and greatly after formalin
detoxification, but not all the deleterious effect was abolished. Endotoxin also has cytotoxic effects on Vero cells, but longer time is needed
for cytolysis which is greatly diminished with formalin treatment. In conclusion, our study revealed that pathogenic strains of UPEC can
exert their pathogenic effect on live cells or system with limited virulence factors gene content.
K e y w o r d s: cytolysis, UPEC, urinary tract infection, Vero cells, virulence factors
Introduction
Urinary tract infections (UTI) are probably the most
common bacterial infections. Bacteria responsible for
UTI often originate from the faecal and perineal flora.
Under normal circumstances, these bacteria are cleared
from the urinary system by effective protective mechanisms. If, however, they overcome these mechanisms,
they can colonize the lower urinary tract. Subsequent
progress is determined by the host susceptibility and bacterial virulent factors (Kaper et al., 2004; Wullt, 2002).
Several in vitro and in vivo models of infection have
provided insights into the progression of uropathogenic
Escherichia coli (UPEC)-induced UTI (Justice et al.,
2004). The unique ability to colonize different sites and
to cause a UTI is potentially due, at least in part, to the
versatile genome of UPEC, which are able to remodel
their genetic repertoire by acquiring and losing virulence attributes.
A number of virulence determinants facilitate the
ability of UPEC to colonize the urinary tract and exert
cytopathic effects, including type 1 fimbriae, P fimbriae, Dr adhesins, hemolysin, cytotoxic necrotizing
factor 1, flagella, capsule polysaccharide, lipopolysaccharide O antigen, and iron transport systems (Hagan
and Mobley, 2007; Slavchev et al., 2009). The distribution of virulence properties can also vary depending on
host characteristics and type of infection. It has been
found that these virulent genes are the distinguishing
factor between pathogenic and non-pathogenic strains
of E. coli (Bisi-Johnson et al., 2011). According to the
conventional notion pathogens can develop from commensals by acquisition of virulence-associated genes
located for example on pathogenicity islands or plasmids, and the commensal-to-pathogen shift in E. coli
is bi-directional (Klemm et al., 2007).
The question is how many virulent genes are sufficient for UPEC to produce pathogenic properties?
To give insight for answering this question, we studied
many UPEC strains freshly isolated from patients with
urinary tract infection after complete cultural, biochemical and serological identification, explored them
* Corresponding author: J. M.A.S. Obaid; Alexandria, 151 Abdelnaser St. Egypt; phone: 002-01140644194; e-mail: jamilobaid@
yahoo.com
44
1
Obaid J.M.A.S. et al.
for virulence factor genes and studied the pathogenic
effect of their cell-free culture supernatant in vitro on
tissue culture of Vero cells (green monkey kidney cells).
Experimental
Sample collection. A total of 15 UPEC isolates
obtained in counts of > 105 cfu/ml and in pure growth,
from routine urine cultures (William and Parasuraman,
2001) of urinary tract infected patients presenting to
the urology department in Ismailia university hospital,
Suez canal university, Egypt. Identification of isolates
was done using standard microbiological techniques
(Cheesbrough, 1993). Serotyping for each pathogenic strain was performed by standard techniques as
described by Ørskov and Ørskov (1984) using a commercial kit of Denka Seiken Co. LTD.
Virulence factor profiling with PCR. DNA was
extracted from UPEC isolates cultured on Luria broth,
with spin column according to the instructions of
the manufacturer Bioer co. China. Amplification was
performed in a 25 µl reaction mixture containing
8 µl of DNA template, 0.1 µl of each of nine primers
(0.1–0.2 µM) from Bio Basic Inc., Canada and 8 µl of
ready to go master mix 1X (containing thermostable DNA polymerase, dNTPs, reaction buffer with
(NH4)2SO4, MgCl2 and Triton X-100, stabilizers) from
Jena Bioscience co., Germany. PCR tubes were filled
to 25 μl volume with PCR-grade water.The reaction
was carried out in a PCR thermal cycler (Techgen co.,
USA) according to Takahashi et al. with modification in the following schedule: preheating at 94°C for
10 min followed by 32 cycles of denaturation at 94°C
for 1 min, annealing at 60°C or 55°C, and extension at
72°C for 2 min, with a final extension at 72°C for 7 min
(Table I). The PCR products were electrophoresed
on 2% agarose gels, then stained with ethidium bromide, and examined under UV transillumination
(Takahashi et al., 2006).
Tissue culture preparation (Vero cells). Vero
cells were supplied as 90% confluent monolayer sheet
in growth medium with10% new born calf serum.
The confluent monolayer sheet was trypsinized with
trypsin-versin 0.25% to separate the individual cells.
The cells were distributed in tissue culture microtiter
plate in which each well contained 103 cell/ml and were
cultivated at 37°C in a 5% CO2 atmosphere until the
monolayer was confluent.
Exotoxin production. The selected strains were
seeded in nutrient and syncase broth and then incubated for 24 h at 37°C in rotary shaker. Cultures were
later centrifuged at 1800 xg for 30 min. The superna-
tants were then filtered through 0.22 mm Millipore
filters. Two parts of exotoxins from syncase broth for
each isolates were treated with heat and formalin.
Endotoxin production. Endotoxin was obtained
following the procedure of Clugston and Nielson, in
which bacterial suspension was harvested in PBS, and
the toxin obtained after ten cycles of freezing and thawing (Culgston and Nielsen, 1974). One part of endotoxin for each isolate was formalin treated.
Toxigenicity test in cell cultures. Toxin preparations were added to the cell culture in maintenance
medium consisting of MEM supplemented with 2%
fetal bovine serum (Caprioli et al., 1983; Slavchev et al.,
2009). The assays were incubated for 24 h at 37°C. The
control consisted of cell monolayer containing maintenance media, PBS, nutrient broth, syncase broth or
0.05% formalin alone after staining, cells were examined with inverted microscope (Olympus 1X70-S8F2,
Olympus Optical Co., LTD. Japan).
Results
Serotypes. The 14 UPEC isolates belonged to 5 serogroups, while one of the isolate had no detectable reaction when available somatic and capsular antigens reagent were tested. This strain was identified as untypable.
Five of these isolates have antigenic formula O78:K80
which represented 33% of the isolates and four isolates
have antigenic formula O114:K90 (27% of the isolates).
However, two of the isolates were with antigenic formula O142:K86 (13% of the isolates). Another two of
the isolates were O164 antigen (13% of the isolates) and
one isolate with formula O157 somatic antigen (7% of
the isolates) and neither of them with unidentified capsular antigen (Table II).
Virulent factor gene profiles of UPEC isolates.
Nine virulent factor genes were explored for all fifteen
UPEC isolates. Of the fifteen strains obtained only
one (strain 11) carried all tested virulent gene factors.
However, two strains showed the presence of 78% of
tested genes, and other two UPEC strains showed 67%
of the nine virulent genes. Four strains showed evidence for pathogenicity by detection of the most virulence gene factors, which represent 56% of the tested
genes. Among the rest of the UPEC strains, four strains
showed the presence of 44% of virulence gene factors,
and two strains showed fewer virulence gene, i.e. 22%
and 33%, respectively.
The distribution patterns of virulent factor genes of
our isolated UPEC strains are presented in Table II. The
high prevalence one is traT gene, with 100% frequency
within tested strains, followed by fyuA which was 93%.
The third most prevalent gene was ompT gene with
incidence of 87%. Genes with lower incidence among
605’-CCCGGGTCATAGTGTTCATC-3’
605’-CACGGTTCAGCCATCCCTGAG-3’
207
pil
ompT 559
traT 290
5’-AACAAGGATAAGCACTGTTCTGGCT-3’
Pap
sfa/foc
cnf1
hly
ompT
traT
fyuA
VG content
(%)
801353 401387 100
9327
O114 K90
O78 K80
O78 K80
O114 K90
O78 K80
O164 k Untypable
+–– ––+ ++– 44
––– ––+ ++– 33
O142 K86
O157 k Untypable
+–++–+ ++– 67
––++–+ ++– 56
O114 K90
O164 k Untypable
+–++–+ ++– 67
+–– +–+ ++– 56
O142 K86
O114 K90
Untypable
O78 K80
3
4
5
6
7
8
9
10
11
12
13
14
15
Gene’s incidence (%)
–
+
–
–
+
+
+
+
56
+–++–+ +++ 78
+++ +++ +++ 100
+–+ ––– ++– 44
+++ ––+ +++ 78
–
+–– –++ ++– 56
+–– ––+ ++– 44
+–– ––– +–– 22
O78 K80
+–– ––+ ++– 44
Pil
Virulence genes (VG)
ibeA
5’-GGTGTGGTGCGATGAGCACAG-3’
5’-ATCTAGCCGAAGAAGGAGGC-3’
5’-CATTCGCCTGTAAAACCGCC-3’
5’-TGATTAACCCCGCGACGGGAA-3’
2
UPEC
serotypes
ibe f/r
Primer used
traT f/r
ompT-f/r
fimH f/r
FyuA f/r
hly 1/2
cnf 1/2
5’-CTCCGGAGAACTGGGTGCATCTTAC-3’ sfa/foc 1/2
5’-AAGATGGAGTTTCCTATGCAGGAG-3’
1
Strain
No.
605’-ATAACACGCCGCCATAAGCC-3’
FyuA 880
5’-AGGCAGGTGTGCGCCGCGTAC-3’
Forward sequence
5’-GCAACAGCAACGCTGGTTGCATCAT-3’ pap 3/4
Table II
Distribution of virulent genes within UPEC serotypes and gene’s incidence rate.
60
555’-CGCAGTAGGCACGATGTTGTA-3’
hly 1,177
5’-ACCATATAAGCGGTCATTCCCGTCA-3’
605’-CGGAGGAGTAATTACAAACCTGGCA-3’
605’-CATTCAGAGTCCTGCCCTCATTATT-3’
cnf1
498
sfa/foc 410
555’-TGGTGCTCCGGCAAACCATGC-3’
605’-AGAGAGAGCCACTCTTATACGGACA-3’
170
Reverse sequence
336
Annealing
Temp. °C
pap
Product size
(bp)
ibeA VF gene
Table I
Virulence factors genes primer sets used for PCR.
Johnson & Stell, 2000
Johnson et al., 2000
Tseng et al., 2001
Yamamoto et al., 1995
Reference
1
Uropathogenic E. coli isolates with different virulence genes
45
46
1
Fig. 1. Normal Vero cell monolayer after incubation for 24 hours
with sterile broth. 300X
the detected virulent gene factors were 27% for ibeA
and 13% for both hly and pap.
Cytotoxic effects of UPEC on Vero cells. Cytopathic
effects were observed in 15 culture filtrates and endotoxin preparations of UPEC strains. After incubation
there were changes from monolayer spindle-shaped
cells characteristic of normal Vero cells to abnormal
shapes and arrangements, in addition to complete lysis
which represented the major cytopathological effect
(Fig. 1 and 2). These effects are expressed as percentage and cytopathological scores for comparison.
Percent of lysed cells on nutrient broth compared
to syncase broth showed that significant higher numbers of lysed cells were observed in syncase broth as
untreated exotoxin. However, treated filtrates, for all
strains, showed significantly less virulence compared
to the same syncase broth growth medium of untreated
filtrate. Formalin treated-filtrates showed less pathologic effect compared to untreated filtrates, obtained
from cells grown in syncase broth, or to heat-treated
filtrates. All UPEC strains showed 100% cell lysed after
incubation for 24 hrs except for strains 2 and 9 which
showed 80% lysis when grown in syncase broth. Generally, we can conclude that cytopathic effects were varied among the UPEC strains when grown in nutrient
broth but less virulent effect when compared to those
recorded in syncase broth or heat-treated filtrates.
When exotoxins obtained from Syncase broth were
treated with heat, the complete lysis of cells decreased
Fig. 2. Complete Vero cell lysis with debris after incubation with
exotoxin of UPEC isolate prepared in syncase broth for 24 hours.
300X
to approximately 50–70% lysis with debris. The remaining cells showed some distortions of the cytoplasm with
conserved nuclei and clumped chromatin but still even
a short rim of cytoplasm around. When treating the
UPEC exotoxins obtained from syncase broth with formalin, the cell lysis decreased to about 10–20% in all
UPEC strains and the monolayer kept its general architecture. Few cells show slight enlargement, and some
showed loss of nuclear or cytoplasmic membrane. Few
cells showed with cell dendrites.
The cytopathological effect of untreated UPEC
endotoxins on Vero cells is shown in Fig. 3. It’s mainly
effects were pathological changes with no cell lysis. The
Vero cell monolayer sheet with most strains lead to lost
their communication and makes the cells to be separated with shrinking. Most cells were distorted without
distinction between nucleus and cytoplasm. Most of the
cytoplasm was taken up by vacuolation. When the cell
lysate was treated with formalin the most pathological
changes disappeared.
Discussion
Pathogenesis is a multi-factorial process which
depends on the immune status of the host, the nature
of the species or strain and the number of organisms
in the initial exposure. The pathogenic mechanisms of
urinary tract infection have already been investigated
1
Fig. 3. Vero cell shrinkage after incubation with untreated endotoxin of UPEC isolate for 24 hours, no discrimination between
nucleus and cytoplasm. 300X
in detail. UPEC strains initiate infection by binding to
the superficial bladder epithelial cells that line the luminal surface of the bladder. This adherence prevents the
pathogen from being washed out by the urine flow. Subsequently, bladder cells internalize the UPEC, a process
that is considered an escape mechanism to protect the
bacteria from the host immune system. However, internalization causes exfoliation of the superficial bladder
cells harboring internalized bacteria into the urine.
Before clearance, intracellular bacteria start to replicate and induce host cytokine responses, leading to the
symptoms of UTI (Marquis et al., 1995; Schilling et al.,
2001; Mulvey, 2002; Schmidt and Hensel, 2004). UPEC
strains express a collection of strain-specific anti-host
weapons called virulence markers (that include virulence factors), these markers specified bacteria to be
pathogenic as mentioned later.
The five serogroups were classified toxigenic E. coli
either O78 and O114, pathogenic E. coli O142, O157
or O114 and invasive E. coli as O164 according to the
classification described by Scheutz and Strockbine
(Scheutz and Strockbine, 2001). Most of them were
isolated previously from urine cultures of UTI patients
(Olesen et al., 1994; Gonzalez et al., 1997; Klapproth
et al., 2000; Abullah and Al-Moslih, 2005; Ananias
and Yano, 2008). E. coli O157 which is mainly enterohaemorrhagic pathotype, isolated here from urine may
be a transmission from the intestine, as in India there
was a urinary Gram negative isolate, which studied by
47
sequencing and phylogenetic analysis showed 100%
similarity to reference strain E. coli O157 (Nandy et al.,
2007). Other evidence for the suspected uropathogenicity of this strain was the sharing of 41.8% of genes not
found in K12 (non-pathogenic strain) with the prototype CFT073 UPEC (Landraud et al., 2004).
Cytotoxic effect of UPEC toxin on Vero cells using
different media and different treatment is a good and
applicable effect study for pathogenicity extent of UPEC
in vitro, which yielded a wide array of cytopathological
effects worthy to be studied.
Using Syncase broth in the production of exotoxin,
it was striking because of great difference and severity
in cytopathological effects compared with that produced upon using nutrient broth. This may attribute
to the increased production of toxins with casamino
acids, which is the major constituent of syncase broth
with low carbohydrate and iron. Increased toxin up to
three fold with this media was proved with recombinant cholera toxin previously (Osek et al., 1995). These
toxins caused a complete Vero cell lysis, and this strong
effect persists with small concentrations of toxins.
The toxins produced by UPEC here were thought
to be more than one type because some of these Verotoxins (toxic to Vero cells) was detoxified with heat
while others detoxified with formalin, the last one was
still effective even after formalinization, in contrast
with known Vero toxin and Shiga toxin, which were
inactivated by heat (Caprioli et al., 1983; Carbonell
et al., 1997; Speirs et al., 1997). Vero cells cytopathic
effect of treated toxin in non lysed cells presented as
enlarged cells, cell membrane change and little nuclear
membrane change.
Freeze-thaw lysate affects cell as a whole leading to
inability to distinguishing the cytoplasm and nucleus.
These may be due to cell preparation for apoptosis, vacuolation and loss of continuation between cells present
may enhance this suggestion. This effect was negated
after endotoxin formalinization.
In essence, the ability of pathogenic bacteria to cause
disease in a susceptible host is determined by multiple
virulent factors acting individually or together at different stages of infection, so bacteria equipped with virulent genes coded for these VFs. Several of these virulent
genes are involved in increasing the pathogen’s fitness
and adaptability.
Some researchers described the use of VFs genes
content for the prediction of UTI status. Johnson
et al., (2005) found that the predictors of pyelonephritis included three traditionally recognized uropathogenic traits adhesins genes (pap, afa/dra, and sfa/
foc), and meningitis-associated trait (ibeA). Vranes
et al. noted that the strains isolated from patients with
acute pyelonephritis were found to mostly express all
five or four virulence markers (O-serogroup, adhesin
48
type, motility, production of hemolysin, and the
amount of capsular polysaccharide antigen) tested,
while the less virulent strains were detected in the
group of patients with chronic pyelonephritis. The lowest virulence was observed among the strains isolated
in the group of patients with asymptomatic bacteriuria
(Vranes et al., 2001).
To what extent can these VFs bring about the net
pathological effect? We investigated VFs genes or socalled pathogenicity genes content of the isolates. It was
obvious that for all isolates with a different content of
VFs genes, all were produce a destructive pathogenic
effect (complete cell lysis) on Vero cells equally, i.e. no
significant difference between those isolates with high
VFs gene content and those with low VFs gene.
In vivo other conditions affect the environment of
infection. As one can see, cytotoxins, secretion systems, fimbriae and others can be virulent factors in
some conditions, colonization factors in other conditions and symbiosis factors in yet other conditions.
Pathogenic and commensal microorganisms appear
to employ similar or even identical molecular mechanisms to express their pathogenic or symbiotic potential
(Hentschel et al., 2000). In particular, both pathogenic
and symbiotic bacteria must actively manipulate the
host immune system to make it possible for them to
colonize the body. Any microorganisms will be pathogenic or commensal in a given context, under given
conditions. It is the interplay between the context and
the intrinsic features of a microbe that make it pathogenic or safe (Swiatczak et al., 2011). The major conclusion of our study is that pathogenic strains of UPEC can
exert their pathogenic effect on living cells or systems
with a few amount of virulent factors gene content in
a given condition with a given context of host factors
and molecules in the environment.
Disclosures
The authors have no financial conflicts of interest.
Literature
Abdullah A.A. and M.I. Al-Moslih. 2005. Prevalence of asymptomatic bacteriuria in pregnant women in Sharjah, United Arab
Emirates. East Mediterr. Health J. 11: 1045–1052.
Ananias M. and T. Yano. 2008. Serogroups and virulence genotypes
of Escherichia coli isolated from patients with Sepsis. Braz. J. Med.
Biol. Res. 41: 877–883.
Bisi-Johnson M.A., C.L Obi, S.D. Vasaikar, K.A. Baba and T. Hattori. 2011. Molecular basis of virulence in clinical isolates of Esche
richia coli and Salmonella species from a tertiary hospital in the
Eastern Cape, South Africa. Gut Pathog. 3: 9.
Caprioli A., V. Falbo, L.G. Roda, F.M. Ruggeri and C. Zona. 1983.
Partial purification and characterization of an Escherichia coli toxic
factor that induces morphological cell alterations. Infect. Immun.
39: 1300–1306.
1
Carbonell G.V., A.F. Alfieri, A.A.M. Alfieri, M.C. Vidotto,
C.E. Levy, A.L.C. Darini and R.M. Yanaguita. 1997. Detection of
cytotoxic activity on Vero cells in clinical isolates of Serratia marces
cens. Braz. J. Med. Biol. Res. 30: 1291–1298.
Cheesbrough M. 1993. Medical laboratory manual for tropical
countries, vol II. 2nd ed. ELBS, University Press Cambridge, Great
Britain.
Clugston R.E. and N.O. Nielsen. 1974. Experimental edema disease
of swine (E. coli Enterotoxemia). I. Detection and preparation of an
active principle. Can. J. Comp. Med. 38: 22–28.
Gonzalez R., C. Diaz, M. Marino, R. Cloralt, M. Pequeneze and
I. Perez-Schael. 1997. Age-specific prevalence of Escherichia coli
with localized and aggregative adherence in Venezuelan infants with
acute diarrhea. J. Clin. Microbiol. 35: 1103–1107.
Hagan E.C. and H.L. Mobley. 2007. Uropathogenic Escherichia coli
outer membrane antigens expressed during urinary tract infection.
Infect. Immun. 75: 3941–3949.
Hentschel U., M. Steinert and J. Hacker. 2000. Common molecular
mechanisms of symbiosis and pathogenesis. Trends Microbiol. 8:
226–231.
Johnson J.R., T.T. O’Bryan, D.A Low., G. Ling, P. Delavari,
C. Fasching, T.A Russo, U. Carlino and A.L. Stell. 2000. Evidence of commonality between canine and human extraintestinal
pathogenic Escherichia coli strains that express papG allele 3. Infect.
Immun. 68: 3327–3336.
Johnson J.R. and A.L. Stell. 2000. Extended virulence genotypes
of Escherichia coli strains from patients with urosepsis in relation
to phylogeny and host compromise. J. Infect. Dis. 181: 261–273.
Johnson R.J., K. Owens, A. Gajewski and M.A. Kuskowski. 2005.
Bacterial characteristics in relation to clinical source of Escherichia
coli isolates from women with acute cystitis or pyelonephritis and
uninfected women. J. Clinic. Microbiol. 43: 6064–6072.
Justice S.S., C. Hung, J.A. Theriot, D.A. Fletcher, G.G. Anderson,
M.J. Footer and S.J. Hultgren. 2004. Differentiation and developmental pathways of uropathogenic Escherichia coli in urinary tract
pathogenesis. PNAS 101: 1333–1338.
Kaper J.B., J.P. Nataro and H.L. Mobley. 2004 Pathogenic Esche
richia coli. Nat. Rev. Microbiol. 2: 123–140.
Klapproth J.A., I.C.A.Scaletsky, B.P. Mcnamara, L. Lai, C. Malstrom, S.P. James and M.S. Donnenberg. 2000. A large toxin from
pathogenic Escherichia coli strains that inhibits lymphocyte activation. Infect. Immun. 68: 2148–2155.
Klemm P., V.Hancock and M.A. Schembri. 2007. Mellowing out:
adaptation to commensalism by Escherichia coli asymptomatic bacteriuria strain 83972. Infect. Immun. 75: 3688–3695.
Landraud L., C.Pulcini, P.Gounon, G. Flatau, P.Boquet and
E. Lemichez. 2004. E. coli CNF1 toxin; a two-in-one system for hostcell invasion. Int. J. Med. Microbiol. 293: 513–518.
Marquis H., V. Doshi and D.A. Portnoy. 1995. The broad-range
phospholipase C and a metalloprotease mediate listeriolysin O-independent escape of Listeria monocytogenes from a primary vacuole in
human epithelial cells. Infect. Immun. 63: 4531–4534.
Mulvey M.A. 2002. Adhesion and entry of uropathogenic Esche
richia coli. Cell. Microbiol. 4: 257–271.
Nandy P., A.R.Thakur and S.R. Chaudhuri. 2007. Characterization of bacterial strains isolated through microbial profiling of urine
samples. J. Biol. Sci. 7: 44–51.
Olesen B., H.J. Komos, F. Orskov and I. Orskov. 1994. Cluster
of multiresistant Escherichia coli O78:H10 in Greater Copenhagen.
Scand. J. Infect. Dis. 26: 406–410.
Ørskov F. and I. Ørskov. 1984. Serotyping of Escherichia coli.
Methods Microbiol. 14: 43–112.
Osek J., M. Lebens and J. Holmgren. 1995. Improved medium for
large-scale production of recombinant cholera toxin B subunit for
vaccine purposes. J. Microbiol. Methods 24: 117–123.
1
Scheutz F. and N. Strockbine. 2001. Genus Escherichia, In:
Bergey’s manual of Systematic Bacteriology, 2nd ed. volume 2 part B,
Springer USA.
Schilling J.D., M.A. Mulvey and S.J. Hultgren. 2001. Dynamic
interactions between host and pathogen during acute urinary tract
infections. Urology 57(6 Suppl 1): 56–61.
Schmidt H. and M. Hensel. 2004. Pathogenicity islands in bacterial
pathogenesis. Clin. Microbiol. Rev. 17: 14–56.
Slavchev G., E. Pisareva and N. Markova. 2009. Virulence of uropathogenic Escherichia coli. J. Cult. Collect. 6: 3–9.
Speirs J.I., S. Stavric and J. Konowalchuk. 1997. Assay of Esche
richia coli heat-labile enterotoxin with Vero cells. Infect. Immun.
16: 617–622.
Swiatczak B., M. Rescigno and I.R. Cohen. 2011. Systemic features of immune recognition in the gut. Microbes Infect. 13:
983–991.
Takahashi A., S. Kanamaru, H. Kurazono, Y. Kunishima,
Y. Tsukamoto, O. Ogawa and S. Yamamoto. 2006. Escherichia coli
isolates associated with uncomplicated and complicated cystitis
and asymptomatic bacteriuria possess similar phylogenies, viru-
49
lence genes, and O-serogroup profiles. J. Clinic. Microbiol. 44:
4589–4592.
Tseng C.C., J.J. Huang, W.C. Ko, J.J. Yan and J.J. Wu. 2001.
Decreased predominance of papG class 2 allele in Escherichia coli
strains isolated from adults with acute pyelonephritis and urinary
tract abnormalities. J. Urol. 166: 1643–1646.
Vranes J., S. Schonwald, N. Sterk-Kuzmanoviæ and B. Ivanèiæ.
2001. Low virulence of Escherichia coli strains causing exacerbation
of chronic pyelonephritis. Acta clin. Croat. 40: 165–170.
Williams P.J. and M. Parasuraman. 2001. Urine. In: Myer’s and
Koshi’s Manual of Diagnostic Procedures in Medical Microbiology
and Immunology/Serology. Vellore: Department of Microbiology,
Christian Medical College and Hospital. pp. 57–62.
Wullt B. 2002. The role of P fimbriae for Escherichia coli establishment and mucosal inflammation in the human urinary tract. Int.
J. Antimicrob. Agents 221: 605–621.
Yamamoto S., A. Terai K. Yuri H. Kurazono Y. Takeda and
O. Yoshida. 1995. Detection of urovirulence factors in Escherichia
coli by multiplex polymerase chain reaction. FEMS Immunol. Med.
Microbiol. 12: 85–90.
2014, Vol. 63, No 1, 51–56
ORIGINAL PAPER
Novobiocin Sensitivity of Salmonella typhimurium dam
and/or seqA Mutants
ABDELWAHEB CHATTI1*, MERIEM ALOUI2, JIHEN TAGOURTI2, MOUADH MIHOUB2
and AHMED LANDOULSI2
Laboratoire de traitement des eaux usées, Centre des Recherches et Technologies des Eaux,
Technopole Borj-cédria, BP 273- Soliman 8020
2 Laboratoire de Biochimie et Biologie moléculaire, Faculté des Sciences de Bizerte, Faculté des Sciences de Bizerte,
Zarzouna 7021, Université de Carthage, Tunisie
1 Submitted 4 January 2013, revised 22 August 2013, accepted 16 November 2013
Abstract
This study was carried out to determine the effects of novobiocin, a gyrase inhibitor, on the growth, survival, motility and whole cell proteins
of S. Typhimurium dam and/or seqA strains. Our results showed that the dam and seqA/dam mutants are the most sensitive to novobiocin,
compared to wild type and seqA strains. Surprisingly, the motility of seqA mutants increased after exposure to novobiocin only in stationary
phase cells. All the other strains showed a significant decrease in their motility. The analysis of protein profiles of all strains demonstrated
several modifications as manifested by the alteration of the expression levels of certain bands. Our work is therefore of great interest in
understanding the effects of novobiocin on S. Typhimurium and the involvement of DNA methylation.
K e y w o r d s: Salmonella, DNA methylation, seqA, motility, novobiocin, proteins
Introduction
DNA methylation is a mechanism by which bacteria regulate gene expression and control several cellular
processes such as transposition, DNA replication, segregation of chromosomal DNA and mismatch repair.
It has been proved that Dam protein regulates gene
expression and virulence of S. Typhimurium (Heithoff
et al., 1999; Balbontin et al., 2006). Indeed, lack of Dam
methylation disturbs the expression of std fimbriae.
Heithoff et al. (Heithoff et al., 1999) have demonstrated
that methylation at speciﬁc GATC sequences of promoters is crucial for transcription and alterations in
the degree of methylation at promoter sequences may
inﬂuence gene expression. Dam methyltransferase and
regulatory proteins, such as Cap, Lrp, or OxyR compete
for overlapping sites in or near promoters (Chatti and
Landoulsi, 2008). Oshima et al. (2002) demonstrated
that the promoters of most Dam controlled genes contained GATC sequences that overlap with recognition
sites for fumarate nitrate reduction (Fnr) and catabolite activator protein (CAP) regulators. These authors
suggested that the GATC network regulation takes
place upstream of the coding sequences and that it is
the consequence of an interaction with a regulatory
protein like Fnr or CAP.
Like the Dam methyltransferase, it has been demonstrated that seqA also profoundly affects the transcription of various genes (Lobner-Olesen et al., 2003).
In Escherichia coli, the product of the seqA gene is the
main negative regulator of chromosome replication
initiation (Lu et al., 1994, Slater et al., 1995). SeqA protein binds preferentially to hemi-methylated GATC
sites and sequesters the oriC region immediately after
replication (Boye et al., 1996). SeqA can also specifically bind to fully-methylated GATC sequences, not
only hemimethylated, if regions other than oriC are
considered. Our previous results have demonstrated
that lack of seqA attenuates the virulence of S. Typhimurium in the mouse model (Chatti et al., 2007).

Jakomin et al. (2008) proved that std operon is regulated
by SeqA protein. The effect of SeqA on plasmid topo
logy has been also demonstrated (Norunn and Skarstad,
1999). Indeed, it has been shown that the seqA mutation increases negative superhelicity of chromosomal
and plasmid DNA (Klungsøyr and Skarstad, 2004). So,
these findings may reﬂect a similar effect of SeqA on
chromosome topology.
* Corresponding author: A. Chatti, Laboratoire de Traitement des Eaux Usées, Centre des Recherches et Technologies des Eaux,
Technopole Borj-cédria, BP 273- Soliman 8020, Tunisie; phone: 216 79 325 199; fax: 216 79 325 802; e-mail: [email protected]
52
1
Chatti A. et al.
It was demonstrated that novobiocin (a member
of the coumermycin family of antibiotics) inhibits
bacterial DNA replication and transcription. Novobiocin inhibits the DNA gyrase (Gellert et al., 1976),
an enzyme that catalyzes the ATP-dependent introduction of negative superhelical turns into circular
double-stranded DNA. Gyrase is needed for processes that require negatively superhelical DNA, such
as DNA replication, transcription, DNA repair, and
recombination (Chatterji et al., 2001). Also, it has been
reported that novobiocin affects membrane integrity,
nucleic acid synthesis, and cell wall synthesis (Smith
and Davis, 1967).
In this study, we investigated the effects of novobiocin
treatment on the survival, motility and whole cell proteins of seqA and/or dam mutants of S. Typhimurium.
Experimental
Bacterial strains and growth conditions. Bacterial strains used in this study, derived from the wild
type strain S. Typhimurium 14028 are SV1610 (dam228::MudJ) SV4752 (ΔseqA1) and SV4784 (dam225::MudJ/ΔseqA1) (Jakomin et al., 2008). Overnight
cultures of Salmonella were grown in nutrient broth
(NB) medium and diluted into 50 ml of fresh sterile
broth medium. Bacteria were routinely incubated in
nutrient broth (NB) (Pronadisa, Spain) at 37°C overnight with shaking (200 rpm). Novobiocin was added at
various concentrations directly to the flask and turbidity was monitored by measuring the optical density at
600 nm of the medium.
Survival study. The strains to be tested were incubated overnight at 37°C in NB. Appropriate dilutions of
bacteria (108 cfu/ml) were made in sterile PBS solution
buffer containing various concentration of novobiocin
or no drug (0, 80, 200 and 400 µg/ml) and incubated
for 1 to 4 hours at room temperature. At the given time
points, 100 µL of cultures were plated on Nutrient agar,
after which the resulting colonies were counted and the
fractional survival was calculated.
Minimal inhibitory concentration (MIC) and
minimal bactericidal concentration (MBC) determination by broth dilution. For MIC and MBC determinations, serial dilutions of novobiocin were prepared.
The tubes were incubated at 37°C overnight with shaking and the highest dilution in which there were no
growth was recorded as the MIC. For MBC testing, aliquots (20 µl) of broth from tubes containing no growth
were plated onto solid medium and again incubated
overnight at 37°C. The highest dilution in which there
were no survivors was recorded as the MBC. In the
above method, controls for each strain were performed
using the sterile liquid medium without novobiocin. All
MICs and MBCs were confirmed by triplicate assays.
Motility assays. Bacterial strains were grown in NB
broth at 37°C overnight with agitation. The bacteria
were then diluted 1:100 with fresh NB and incubated
at 37°C with shaking. Cells were considered to be in
exponential and stationary phases when they reach an
optical density of 0.5 and 1, respectively. Bacterial culture (50 μl) was spotted onto an NB plate with 0.3% agar
and incubated at 37°C. The concentration of novobiocin
used to study the motility of all strains was 200 µg/ml.
The swimming motility was estimated by measuring
the diameter of the bacterial zone after incubation at
37°C during 24 hours. Media used for swarming consisted of 0.5% bacto-agar with 8 g/liter nutrient broth,
to which 5 g/liter glucose was added. Swarm plates were
typically allowed to dry at room temperature overnight
before being used.
Whole cell proteins extraction. Pellets were resuspended in TRIS buffer (20 mM, pH 7.5) containing
EDTA (5 mM) and MgCl2 (5 mM). The cells were lysed
by sonication. The cell debris was removed by centrifugation at 14 000 × g for 10 min at 4°C. The supernatant
containing extracted proteins was stored at –20°C until
further analysis. Protein concentration was determined
according to the method of Lowry (1959).
Statistical. The experiment was repeated three
times, and statistical significance was calculated using
Student’s t test.
Results
Effect of novobiocin on the growth of mutants.
To study the effect of the novobiocin on Salmonella
growth, different concentrations ranging from zero to
400 µg/ml were tested. Compared with the control cell
suspensions without novobiocin, we observed a modification of the classical cell growth curves of the different
strains. Fig. 1 shows the basic phenomena observed in
the inhibition of cell growth by novobiocin. The results
showed that the antimicrobial activity of novobiocin
increases with concentration. These two mutants do not
reach the stationary phase after treatment with novobiocin at a concentration of 400 μg/ml. As the novobiocin concentration was increased, so did the duration
of the lag phase whereas the rate of the growth after
inhibition decreased and the cell density at which stationary phase was entered also decreased. The duration
of the lag phase was proportional to the novobiocin
concentration and variable according to the different
Salmonella strains tested.
Effects of novobiocin on the survival of the
mutants. The percentage of strains’ survival was fol-
1
53
Novobiocin sensitivity of S. typhimurium dam and/or seq A
Fig. 1. Growth kinetics of Salmonella typhimurium and its isogenic mutants (dam, seqA and dam/seqA) under different concentrations
of novobiocin: 0 µg/ml (black square), 80 (without marker), 200 µg/ml (white triangle) and 400 µg/ml (X).
lowed for 4 hours. Control strains were used for
comparative study. Significant differences between
all strains were mainly observed after treatment during 1 hour. The results obtained showed that the dam
and seqA/dam strains are significantly more sensitive
to novobiocin, compared to the other strains (Fig. 2).
seqA mutant was significantly more resistant than dam
and seqA/dam strains.
Determination of MIC and MBC. The MIC and
MBC values obtained are expressed in terms of the
novobiocin concentration (Table I). The MIC values
shown were determined by broth dilution. MICs range
from 0.6 to 1.1 mg/ml of novobiocin. The MBC values
range from 2 mg/ml to 5.6 mg/ml. The double mutant
dam/seqA presents the lowest MBC value.
Novobiocin alters the motility of mutants. The
motility of novobiocin-treated bacteria was investigated
(Fig. 3A). Statistical analysis showed significant differences in the motility of wild type, dam and seqA/dam
at exponential phase after drug exposure. At stationary
phase, significant difference was observed only in dam
and dam/seqA strains (Fig. 3A).
Effect of novobiocin on the whole cell proteins.
The whole cell proteins of S. Typhimurium and its isogenic mutants were analyzed using SDS-PAGE. When
comparing the whole cell preparations on SDS-PAGE,
Table I
MIC and MBC of novobiocin for Salmonella typhimurium
(wild type) and isogenic seqA and/or dam mutants
Fig. 2. Novobiocin sensitivity of Salmonella typhimurium and its
isogenic seqA and/or dam mutants. Results mentioned are the
means of three repetitions. The survival assay was estimated by
counting the colony forming units (CFU). The experience was
monitored for 4 hours.
MIC (mg/ml)
MBC (mg/ml)
MBC/MIC
WT
1.1 ± 0.11
5.6 ± 0.21
5.09
seqA
1.1 ± 0.14
5.0 ± 0.13
4.54
dam
0.6 ± 0.09
2.5 ± 0.13
4.16
dam/seqA
0.6 ± 0.05
2.0 ± 0.08
3.33
54
1
Chatti A. et al.
Table II
Ratio of protein levels in each strain before and after drug treatment. Only bands in Line L1 to L6 are analyzed. B: band, the
number refers to the column.
L1
L2
L3
L4
L5
L6
B1/B51.151.055 1.4031.23 1.1421.211
B2/B61.49 1.0001 1.220 1.042
3.05
0.607
B3/B7
1.27
1.0033
1.22
1.098
3.125
1.064
B4/B8
1.31
1.22131 1.33
1.185
3.21
1.222
of some proteins for all tested strains. Changes of protein bands are estimated by calculating the ratio of band
area before and after novobiocin treatment. Table II
shows the changes observed after drug treatment.
Discussion
Fig. 3. The motility of exponential (A) and stationary phase (B)
cells treated (grey) and untreated (white) strains.
* Significant difference (p < 0.05).
changes in protein profiles were observed under the
two growth conditions. Therefore, as shown in Fig. 4,
changes were manifested either by disappearance or
modification of the expression level. In the absence of
novobiocin, the alteration of protein profiles of dam
and/or seqA was manifested by modification of the
expression level of certain bands. After exposure to
novobiocin, we noted changes of the expression level
Fig. 4. The whole cell proteins of Salmonella typhimurium and
its isogenic dam and/or seqA mutants in the absence (Column 1
to 4) or presence (Column 5 to 8) of novobiocin. Column 1 and
5: WT, Column 2 and 6: dam: Column 3 and 7: seqA, Column 4
and 8: dam/seqA. Arrows indicated the lines which show the most
bands alterations.
It is well known that supercoiling can influence
promoter activity (Wang and Lynch, 1993). Thus, DNA
supercoiling affects binding of regulatory proteins, such
as Dam and SeqA. In our previous work, we suggested
that GATC sites could regulate virulence and stress
response of S. Typhimurium (Chatti and Landoulsi,
2008). The growth of wild-type, dam, seqA and dam/seqA
mutants were detected in the presence and absence of
novobiocin. There was no difference in the growth rates
between wild-type and seqA mutant str ains of S. Typhimurium in NB medium with or without novobiocin.
However, our results showed that the growth of dam and
seqA/dam was the most sensitive mutants. Soutourina
et al. (2001) have demonstrated that novobiocin (200
and 400 µM) induces a small decrease of the growth rate
for Pseudomonas and Enterobacter. E. coli dam mutant
was previously shown to be more sensitive to novobiocin than the wild type strain (Onogi et al., 2000).
To assess the effect of the seqA and/or dam deletions
on the in vitro susceptibility to novobiocin, we determined the MICs and MBCs as well as the loss of viable
counts after exposure to 400 µg/ml of novobiocin. The
MICs of novobiocin were not affected by the seqA inactivation but decreased in dam and seqA/dam strains.
The viable losses in time kill experiments confirm also
that the seqA mutant is the most resistant compared to
the dam and dam/seqA. Several studies have proved
that dam strains are the most sensitive mutant toward
many stresses such as hydrogen peroxide, bile (Chatti
et al., 2012; Badie et al., 2007). However, all the mutants
were more sensitive than the parent wild type strain.
Therefore, novobiocin-induced gyrase inhibition can be
expected to cause DNA strand breaks. Hence, it is not
surprising that dam mutants, which suffer a basal level
of MutHLS-induced DNA breaks, are more sensitive.
Bacterial motility is a complex phenotype that is modu-
1
Novobiocin sensitivity of S. typhimurium dam and/or seq A
lated by many regulators. In this study, we found that
seqA mutants did not show significant defects in motility, unlike WT, dam and dam/seqA strains under this
drug during exponential phase. The stationary culture
of these strains demonstrated a significant increase of
the motility of seqA mutant and a significant decrease
in the motility of both of dam and seqA/dam mutants.
However, the motility of WT strain did not change in
the stationary phase. These findings suggest the implication of the nucleoid-associated protein FIS which
modulate the dynamics of DNA supercoiling during
the growth phase (Traversa et al., 2001). Fis promoter is
activated by high negative superhelicity of the DNA in
vivo and in vitro (Schneider et al., 2000). In addition, it
has been proved that CRP-cAMP modulates fis expression and the inhibition of DNA gyrase represses the
expression of several CRP-cAMP sensitive genes. Taken
together, we can suggest that phase dependant motility
especially for seqA mutant could be the consequences
of a direct or indirect action of FIS and/or CRP-cAMP
(Soutourina et al., 2002). The reduction in motility has
been observed in E. coli in the presence of DNA gyrase
inhibitors (Schneider et al., 2000). In the presence of
novobiocin, a more than two fold decrease in the flhDC
activity was obtained in E. coli (Soutourina et al., 2002).
Also, inhibiting the DNA gyrase promotes the FimBmediating inversion from OFF to ON and therefore it
was concluded that DNA supercoiling determines the
directionality of the FimB-mediated recombination
(Dove and Dorman, 1994). The decrease of motility
in Salmonella in the presence of novobiocin supports
the link between the DNA supercoiling and motility
regulation. Therefore, motility could be modulated by
alteration of DNA topology, resulting from interactions
between Dam or SeqA and the regulatory regions.
Whole cell proteins were investigated in the presence or absence of novobiocin. Our results showed that
this drug alters the protein profiles of all strains. These
changes as manifested by disappearance or modification of the expression levels of several bands. These data
suggest that proteins of these strains are associated with
growth and survival in the presence of novobiocin. The
function of these proteins is subject to further investigation. However, changed proteins could be under
the control of CRP-cAMP regulon. Further analysis
by 2-DE would be needed for a better separation of
proteins and more accurate estimation of sizes and to
elucidate their role in bacterial response to novobiocin.
In conclusion, we suggest the involvement of DNA
supercoiling on the DNA methylation control of several cellular processes. The difference in the sensitivity
toward novobiocin may be due to the fatty acid composition of the membrane of each strain. Further studies
on the effects of gyrase inhibitors on virulence genes
expression and the deletion of gyrA and/or gyrB in seqA
55
and/or dam mutants could help researchers to understand the relationship between DNA methylation and
DNA supercoiling.
Acknowledgment
This work was supported by: «Ministère de l’Enseignement
Supérieur; Faculté des Sciences de Bizerte-Département de Bio
logie». We thank Pr. Casadesus J. for providing Salmonella strains.
Literature
Badie G., D.M. Heithoff, R.L. Sinsheimer and M.J. Mahan. 2007.
Altered levels of Salmonella DNA adenine methylase are associated
with defects in gene expression, motility, flagellar synthesis, and bile
resistance in the pathogenic strain 14028 but not in the laboratory
strain LT2. J. Bacteriol. 189: 1556–1564.
Balbontín R., G. Rowley, M.G. Pucciarelli, J. López-Garrido,
Y. Wormstone, S. Lucchini, F. García-del Portillo, J.C.D. Hinton
and J. Casadesús. 2006. DNA adenine methylation regulates virulence gene expression in Salmonella enterica serovar Typhimurium.
J. Bacteriol. 188: 8160–8168.
Boye E., T. Stokke, N. Kleckner and K. Skarstad. 1996. Coordinating DNA replication initiation with cell growth: differential
roles for DnaA and SeqA proteins. Proc. Natl. Acad. Sci. USA 93:
12206–12211.
Chatterji M., S. Unniraman, S. Mahadevan and V. Nagaraja. 2001.
Effect of different classes of inhibitors on DNA gyrase from Myco
bacterium smegmatis. J. Antimicrob. Chemother. 48: 479–485.
Chatti A., D. Daghfous and A. Landoulsi. 2007. Effect of seqA mutation on Salmonella typhimurium virulence. J. Infect. 54: e241–e245.
Chatti A. and A. Landoulsi. 2008. The DNA-methylation state
regulates virulence and stress response of Salmonella. C.R. Biol.
331: 648–654.
Chatti A., N. Messaoudi, M. Mihoub and A. Landoulsi. 2012.
Effect of hydrogen peroxide on the motility, catalase and superoxide
dismutase of dam and/or seqA mutant of Salmonella Typhimurium.
World J. Microbiol. Biotechnol. 28: 129–33.
Dove S.L. and C.J. Dorman. 1994. The site-specific recombination
system regulating expression of the type 1 fimbrial subunit gene of
Escherichia coli is sensitive to changes in DNA supercoiling. Mol.
Microbiol. 14:975–988.
Gellert M., M.H. O’dea, T. ITOH and J-I. Tomizawa. 1976. Novobiocin and coumermycin inhibit DNA supercoiling catalyzed by
DNA gyrase. Proc. Natl. Acad. Sci. USA 73: 4474–4478.
Heithoff D.M., R.L. Sinsheimer, D.A. Low and M.J. Mahan. 1999.
An essential role for DNA adenine methylation in bacterial virulence. Science 284: 967–970.
Jakomin M., D. Chessa, A.J. Baumler and J. Casadesus. 2008.
Regulation of the Salmonella enterica std Fimbrial Operon by DNA
Adenine Methylation, SeqA, and HdfR. J. Bacteriol. 190: 7406–7413.
Klungsøyr H.K. and K. Skarstad. 2004. Positive supercoiling is
generated in the presence of Escherichia coli SeqA protein. Mol.
Microbiol. 54: 123–31.
Lobner-Olesen A., M. Marinus and F. Hansen. 2003. Role of SeqA
and Dam in Escherichia coli gene expression: a global microarray
analysis. Proc. Natl. Acad. Sci. USA 100: 4672–4677.
Lowry O.H., N.J. Rosenbrough and A.L. Farr. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193: 265–275.
Lu M., J.L. Campbell, E. Boye and N. Kleckner. 1994. SeqA: a negative modulator of replication initiation in E. coli. Cell 77: 413–426.
Norunn K.T. and K. Skarstad. 1999. Escherichia coli SeqA protein
affects DNA topology and inhibits open complex formation at oriC.
EMBO J. 18: 4882–4888.
56
Chatti A. et al.
Onogi T., M. Yamazoe, C. Ichinose, H. Niki and S. Hiraga. 2000.
Null mutation of the dam or seqA gene suppresses temperaturesensitive lethality but not hypersensitivity to novobiocin of muk
null mutants. J. Bacteriol. 182: 5898–5901.
Oshima T., C. Wada, Y. Kawagoe, T. Ara, M. Maeda, Y. Masuda,
S. Hiraga and H. Mori. 2002. Genome-wide analysis of deoxyadenosine methyltransferase-mediated control of gene expression
in Escherichia coli. Mol. Microbiol. 45: 673–675.
Slater S., S. Wold, M. Lu, E. Boye, K. Skarstad and N. Kleckner.
1995. E. coli SeqA protein binds oriC in two different methyl-modulated reactions appropriate to its roles in DNA replication initiation
and origin sequestration. Cell 82: 927–926.
Schneider R., A. Travers and G. Muskhelishvili. 2000. The expression of the Escherichia coli ﬁs gene is strongly dependent on the
superhelical density of DNA. Mol. Microbiol. 38: 167–176.
1
Smith D.H. and B.D. Davis. 1967. Mode of Action of Novobiocin
in Escherichia coli. J. Bacteriol. 93:71–79
Soutourina O.A., E.A. Semenova, V.V. Parfenova, A. Danchin and
P. Bertin. 2001. Control of Bacterial Motility by Environmental Factors in Polarly Flagellated and Peritrichous Bacteria Isolated from
Lake Baikal. App. Environ. Microbiol. 67: 3852–3859.
Soutourina O.A., E. Krin, C. Laurent-Winter, F. Hommais,
A. Danchin and P.N. Bertin. 2002. Regulation of bacterial motility
in response to low pH in Escherichia coli: the role of H-NS protein.
Microbiology 148: 1543–1551.
Traversa A., R. Schneider and G. Muskhelishvili. 2001. DNA
supercoiling and transcription in Escherichia coli : The FIS connection. Biochimie 83:213−217.
Wang J.C. and A.S. Lynch. 1993. Transcription and DNA supercoiling. Curr. Opin. Genet. Dev. 3: 764–768.
2014, Vol. 63, No 1, 57–61
ORIGINAL PAPER
The Antimicrobial Susceptibility of Helicobacter pylori Strains Isolated
from Children and Adults with Primary Infection
in the Lower Silesia Region, Poland
GRAŻYNA GOŚCINIAK1, MONIKA BIERNAT1*, JOANNA GRABIŃSKA1, ALDONA BIŃKOWSKA1,
ELŻBIETA PONIEWIERKA3 and BARBARA IWAŃCZAK2
1
Department of Microbiology, Wroclaw Medical University
IInd Department and Clinic of Pediatric Gastroenterology and Nutrition, Wroclaw Medical University,
3
Department and Clinic of Gastroenterology and Hepatology, Wroclaw Medical University
2
Submitted 27 April 2013, revised 22 August 2013, accepted 16 November 2013
Abstract
The resistance of microorganisms to antibiotics has become a serious issue in recent years in the therapy of bacterial infections. This problem also concerns the treatment of infections caused by Helicobacter pylori strains. The aim of this study was to evaluate the frequency of
primary resistance of H. pylori strains isolated from children and adults. The subject of the research was 105 strains of H. pylori isolated
from children and 60 strains from adults in the Lower Silesia Region in the years 2008–2011. Antimicrobial susceptibility to the following
antibiotics was assessed: amoxicillin (AC), clarithromycin (CH), metronidazole (MZ), tetracycline (TC), levofloxacin (LEV) and rifabutin
(RB). Among the strains isolated from children, 33.3% were resistant to CH, 44.8% to MZ whereas 1.9% of strains were resistant simultaneously to CH, MZ and LEV. Among 60 strains isolated from adults, 23.3% were resistant to CH, 66.7% to MZ, and 6.7% to LEV. Moreover,
16 multidrug resistant strains were isolated from adults, including 12 resistant to CH and MZ, 3 to MZ and LEV, and 1 to CH, MZ and
LEV. All examined strains were susceptible to AC, TC and RB. The high incidence of resistance to CH and MZ suggests that standard triple
therapies may not be useful as first-line treatment in Poland without earlier susceptibility testing.
K e y w o r d s: Helicobacter pylori, adults, children, resistance
Introduction
Colonization of the human gastric mucosa with
Helicobacter pylori induces chronic gastritis and peptic ulcer disease. In addition, H. pylori plays a role
in pathogenesis of gastric cancer and cancer of the
mucosa-associated lymphoid tissue (Mishra, 2012).
Treatment of H. pylori infection usually includes a combination of two antimicrobial agents (among amoxicillin, metronidazole and clarithromycin) and a proton
pump inhibitor or bismuth salts. The ideal antimicrobial therapy should have an eradication rate of at least
90% and a low incidence of significant side effects and
the drugs should be available worldwide. However,
more recent publications have suggested that this level
has fallen alarmingly to around 70% in many areas and
even as low as 60% in some other regions (Kadayifci
et al., 2006). Attempts are being made to use traditional
therapeutic patterns in combination with various probiotics, e.g. Lactobacillus acidophilus (Da Silva Mendeiros et al., 2011). The success of the therapy depends on
several factors, but one of the most important seems
to be the increasing resistance of H. pylori strains to
antibiotics (Glupczynski et al., 2001). Drug susceptibility of H. pylori strains is changeable both in different regions of the world and in different regions of the
same country, so it is essential to have knowledge of
the local profile of drug susceptibility of microorganisms in order to choose the most effective therapy. The
aim of this study was to assess the primary resistance
of H. pylori strains isolated from children and adults in
the Lower Silesia Region in Poland.
Experimental
Material and Methods
The study was performed on 165 strains isolated
from pediatric and adult patients of the Lower Silesia
Region in the years 2008–2012. Our study involved
105 children aged 4–18 and 60 adults aged 19–89 who
* Corresponding author: M. Biernat, Department of Microbiology, Wroclaw Medical University, Chałubińskiego Street 4, 50-368
Wrocław, Poland; phone: +48 71 784 12 86; fax. +48 71 784 01 17; e-mail: [email protected]
58
1
Gościniak G. et al.
underwent endoscopic examination of the upper gastrointestinal tract due to complaints from the upper
gastrointestinal tract, such as abdominal pain, nausea, or vomiting suggesting the presence of pathology. Patients had not been previously diagnosed
and treated for H. pylori infection. Patients who had
previously had H. pylori infection or received antibiotics within the last 2 months were excluded. Other
exclusion criteria were parasitic diseases, allergies and
autoimmune diseases. Informed written consent was
obtained from each patient. The study was approved by
the Bioethics Committee of Wroclaw Medical University, Approval No. 226/2011. Biopsies from the antrum
and, in the case of present changes, from the corpus
were taken from each patient during endoscopy of the
upper gastrointestinal tract for histopathology and
microbiology. Biopsies collected for microbiological
examination were placed immediately after collection
in sterile saline (0.15 M NaCl) and processed within
two to three hours in a microbiological laboratory. The
isolation and identification of strains were performed
as described previously. [5] After the primary isolation and identification, the strains were kept frozen at
–70°C in Brucella broth containing 15% glycerol. Then
the drug to six antibiotics- amoxicillin (AM), clarithromycin (CH), metronidazole (MZ), tetracycline (TC),
levofloxacin (LEV) and rifabutin (RB) sensitivity – was
determined by gradient diffusion (E-test, BioMerieux)
with the method described by Glupczynski et al. (2001).
Criteria for interpretation of results were as follows:
MIC (µg/mL) for resistant strains: amoxicillin > 0.5,
clarithromycin> 1, metronidazole > 8, tetracycline > 1,
levofloxacin > 0.5 and rifabutin > 1 (Glupczynski et al.,
2001; Megraud and Lehours, 2007).
Statistical analysis was performed by chi-square test
with or without Yates’ correction and chi-square test
among age groups. A p value < 0.05 was considered
significant for all tests.
Results
The total resistance of strains isolated from adults
and children is shown in Table I. Among the strains
isolated from children, susceptibility was indicated
in 40 (38.1%) strains and 65 (61.9%) were resistant.
Among the resistant strains, 35 (33.3%) were resistant
to CH, including 18 (17.1%) resistant only to CH,
15 (14.3%) to CH and MZ and 2 (1.9%) to CH, MZ and
LEV. Resistance to MZ was detected among 47 (44.8%)
strains, 30 (28.6%) were resistant only to MZ and the
others were multidrug resistant. Among 60 strains isolated from adults, 42 (70%) were resistant to at least one
antibiotic, including the total resistance to CH amounting to 23.3% (n = 14), to MZ 66.7% (n = 40), and to LEV
Table I
A comparison of the frequency of primary resistance of H. pylori
isolated from children and adults.
Resistance
Children (105)
No.
%
Adults (60)
Total (165)
No.
No.
%
%
CH (total)
3533.315 25.050 30.3
CH (single)
18
CH+MZ
1514.313 21.728 17.0
17.1 0 0.0
18
10.9
CH+MZ+LEV 2 1.9 2 3.3 4 2.4
MZ (total)
4744.842 70.089 53.9
MZ (single)
3028.624 40.054 32.7
MZ+CH
1514.313 21.728 17.0
MZ+CH+LEV 2 1.9 2 3.3 4 2.4
MZ+LEV 0 0.0 3 5.0 3 1.8
LEV (total) 2
1.9 7
11.7 9 5.5
LEV (single) 0 0.0 2 3.3 2 1.2
MZ+CH+LEV 2 1.9 2 3.3 4 2.4
MZ+LEV 0 0.0 3 5.0 3 1.8
No – number, CH – clarithromycin, MZ – metronidazole,
LEV – levofloxacin
6.7% (n = 4). H. pylori strains resistant to levofloxacin
were resistant in 75% to clarithromycin and/or metronidazole. Moreover, 16 multidrug resistant strains
were isolated from adults, including 12 resistant to CH
and MZ, 3 to MZ and LEV, and 1 to CH, MZ and LEV.
No strains were resistant to AM, TC and RB (Table II).
In order to analyze the drug resistance of H. pylori
strains depending on age, patients were divided into
6 age groups (2–7, 8–12, 13–18, 19–44, 45–64, > 65 years)
(Fig. 1). The resistance of strains to clarithromycin was
the highest among children aged 13–18; the percentage of strains resistant to this antibiotic decreases with
age. However, in the case of metronidazole, a gradual
increase of resistant strains was found, the highest percentage being noted in the group aged 45–64 (78%).
Strains resistant to levofloxacin were found among the
oldest children and in the group of adults aged 45–64
(14.8%). The percentage of strains resistant to both
CH and MZ remained steady among children in all
age groups (14–16%) and adults (18.5–25%). Strains
resistant to CH, MZ and LEV were observed in the
group aged 14–64 at a similar level (3.7–4.8%).
Discussion
In the last decade one of the most important problems of contemporary medicine has become the resistance of micro-organisms to antibiotics. This problem
does not exclude H. pylori bacilli. It is acknowledged
that the appropriate course of antibiotic therapy contributes to the eradication of this micro-organism in
1
59
The antimicrobial susceptibility of H. pylori strains
Table II
In vitro activity of six antimicrobial agents against H. pylori
Antibiotic
Resistant strains
No.
% (95% confidence interval)
MIC50
CH
50
30.3 (26.9–33.7) 0.016
MZ
89
53.9 (44.41–63.47)
16
MIC90
1.5
Range
0.016–256
126
0.016–256
LEV
9 5.5 (3.69–7.22) 0.064
0.125
0.002–32
AM
0 0 (0.0–0.0) 0.016
0.016
0.016–256
RB
0 0 (0.0–0.0) 0.02
0.02
0.002–32
TC
0 0 (0.00–0.01) 0.023
0.047
0.016–256
No – number, CH – clarithromycin, MZ – metronidazole , LEV – levofloxacin, AM – amoxicillin,
TC – tetracycline, RB – rifabutin, MIC50 – Minimum Inhibitory Concentration required to inhibit the
growth of 50% of organisms, MIC90 – Minimum Inhibitory Concentration required to inhibit the growth
of 90% of organisms
about 80% of patients (Selgrad and Malfertheiner,
2011). According to Graham and Shiotani an effective
antibiotic therapy should contribute to the eradication
of this micro-organism in 90–94% of patients and an
excellent therapy ≥ 95% (Graham and Shiotani, 2008).
The phenomenon of drug resistance of H. pylori strains
is significant in the case of eradication therapy. In the
classical therapy (IPP + AC+CH or IPP + MZ + CH) the
most significant is H. pylori resistance to clarithromycin, which, with maintained susceptibility to MZ, lowers
the effectiveness of eradication to 66% and 35% respectively (Megraud, 2004). Multicenter studies conducted
in 2008–2009 by Megraud et al. concerning the primary resistance of H. pylori strains indicated that 31.8%
of strains isolated from children and 17.5% of strains
isolated from adults were resistant to clarithromycin.
However, the resistance of strains to metronidazole was
25.7% and 34.9% respectively (Megraud et al., 2013).
Our studies have indicated high resistance to clarithromycin among children (33%) and adults (25%). The
resistance of examined strains to metronidazole in both
groups was considerably higher (average 53.9%). Since
the mid-1990s, the gradual increase of H. pylori primary
resistance to applied antibiotics has been observed. In
Poland, the percentage of strains resistant to clarithromycin varies depending on the region, from 21% to
28% (Karczewska et al., 2011, Dzierżanowska-Fangrat
et al., 2005, Andrzejewska et al., 2009). A diverse level
of resistance to clarithromycin was noted in other countries (5.6–36%). The resistance rates in Europe (11.1%),
Fig. 1. Resistance of H. pylori strains in different age groups.
60
1
Gościniak G. et al.
Asia (18.9%) and America (29.3%) significantly differ
(De Francesco et al., 2010). In Europe we can observe
large differences in resistance of strains to clarithromycin between northern (10.0%) and southern Europe
(20.0%) (Megraud et al., 2013).
Ten years ago, in Poland, the level of strains resistance to metronidazole was in the range 27–52% (average 37%) (Dzierżanowska-Fangrat et al., 2002) and
regional variation was observed. Children from the
Lower Silesia region have the highest noted resistance,
at 52%. A lower percentage of resistant strains could be
observed in children from Warsaw (37%), Wielkopolska
Region (45%), Kujawsko-Pomorskie Region (20%) and
from Łódzki Region (18%) (Bąk-Romaniszyn et al.,
2004; Łaszewicz, 2003). The frequency of primary
resistance to metronidazole among adults in Europe
fluctuated between 28% and 44%. No significant differences were found between southern and northern
parts of the continent (respectively – 29.7% and 28.6%).
It was noted, however, that the resistance of strains is
considerably higher in western and in central Europe
(43.8%) (Megraud et al., 2013). In connection with
more frequent usage of both clarithromycin and metronidazole in H. pylori eradication therapy, the steady
increase of strains resistant to two antibiotics at the
same time was noted. Towards the end of the 1990s,
such resistance was low in Europe and amounted to
only 0.8–9.1% (Boyanova, 2009; Elviss et al., 2004).
In 2009, in Spain 17.2% of strains were noted to be
resistant to both clarithromycin and metronidazole
among children (Aqudo et al., 2009). In our study, the
percentage of strains primarily resistant to clarithromycin and metronidazole was 14% among children
and 21.7% among adults (average 17%). Similar results
were obtained in other regions of Poland (13–15.5%)
(Dzierżanowska-Fangrat et al., 2005).
The growth tendency also shows the resistance
of strains to levofloxacin and currently in Europe,
from 7% to 13% of H. pylori strains were noted to be
resistant. In southern Poland, this resistance level is
12% (Karczewska et al., 2012; Megraud et al., 2013). In
our study total primary resistance to LEV was 5.5%,
including resistance in children (1.9%) and in adults
(11.7%). Moreover, alarmingly, in our region we have
observed 1.9% of strains resistant among children and
3.3% among adults to three antibiotics simultaneously.
Multidrug-resistant H. pylori strains were also observed
in other countries, such as Italy, Bulgaria and Taiwan
(Boyanova and Mitov, 2010; Yang et al., 2010).
In this work no resistance of H. pylori strains to
amoxicillin, tetracycline and rifabutin was noted. Other
authors also have not found resistance to these antibiotics (Megraud et al., 2013; Karczewska et al., 2011;
Gościniak et al., 2004). Primary amoxicillin resistance
has been low (< 2%) in Europe but higher (6–59%) in
Africa, Asia and South America (Boyanova and Mitov,
2010; Yang et al., 2010). Resistance to tetracycline is
low (< 3%) all over the world, except for Africa, where
it amounts to 44% (De Francesco et al., 2010). The
observed low resistance to rifabutin so far is very low,
1.3%, and the effectiveness of therapy with rifabutin
is good, 73%. Treatment of H. pylori infections with
rifabutin is promising, especially after failures of eradication with standard antibiotics such as: amoxicillin,
metronidazole, clarithromycin, levofloxacin, and tetracycline (Gisbert and Calvet, 2012). However, it should
be remembered that the low resistance of H. pylori to
rifabutin arises from using this antibiotic only to treat
Mycobacterium tuberculosis (Nishizawa et al., 2011).
In conclusion, high incidence of resistance to CH and
MZ suggests that standard triple therapies may not be
useful as first-line treatment in Poland without earlier
susceptibility testing. The use of antibiotics for other
indications seems to be the major risk factor for development of primary resistance.
The authors declare no conflict of interest.
Literature
Andrzejewska E., A. Szkaradkiewicz and T. Karpiński. 2009. Antimicrobial resistance of Helicobacter pylori clinical strains in the last
10 years. Pol. J. Microbiol. 4: 301–305.
Aqudo S., T. Alarcon, L. Cibrelus, P. Urruzuno, M.J. Martinez and
M. Lopez-Brea. 2009. High percentage of clarithromycin and metronidazole resistance in Helicobacter pylori clinical isolates obtained
from Spanish children. Rev. Esp. Quimioter. 22: 88–92.
Bąk-Romaniszyn L. and I. Płaneta-Małecka. 2004. Przyczyny
niepowodzenia eradykacji zakażenia Helicobacter pylori. Ped. Wsp.
Gastroenterol Hep. Żyw. Dziecka 4: 387–392.
Boyanova L. 2009. Prevalence of multidrug-resistant Helicobacter
pylori in Bulgaria. J. Med. Microbiol. 58: 930–935.
Boyanova L. and I. Mitov. 2010. Geographic map and evolution of
primary Helicobacter pylori resistance to antibacterial agents. Expert
Rev. Anti. Infect. Ther. 8: 59–70.
Da Silva Mendeiros J.A, T.M.F.O. Goncalves, L. Boyanova,
M.I. de Correia Pereira, J.N. da Silva Paiva de Carvalho,
A.M. de Sousa Pereira, and A.M. Silverio Carbita. 2011. Evaluation of Helicobacter pylori eradication by triple therapy plus Lacto
bacillus acidophilus compared to triple therapy alone. Eur. J. Clin.
Microbiol. Infect. Dis. 30: 555–559.
De Francesco V., F. Georgio, C. Hassan, G. Manes, L. Vannella,
C. Panella, E. Ierardi, and A. Zullo. 2010. Worldwide H. pylori
antibiotic resistance: a systematic review. J. Gastointestin. Liver Dis.
19: 409–414.
Dzierżanowska-Fangrat K., E. Rożynek, D. Celińska-Cedro,
P. Jóźwiak, K. Madaliński and D. Dzierżanowska. 2002. Primary
resistance of H. pylori to antimicrobial agents in Polish children.
Acta Micriobiol. Pol. 51: 255–263.
Dzierżanowska-Fangrat K., E. Rożynek, D. Celińska-Cedro,
M. Jarosz, J. Pawłowska, A. Szadkowski, A. Budzyńska, J. Nowak,
W. Romańczuk, R. Prosiecki and others. 2005. Antimicrobial
resistance of Helicobacter pylori in Poland: a multicenter study. Int.
J. Antimicrob. Agents 26: 230–234.
1
The antimicrobial susceptibility of H. pylori strains
Elviss N.C., R. J. Owen, J. Xerry, A.M. Walker and K. Davies. 2004.
Helicobacter pylori antibiotic resistance patterns and genotypes in
adult dyspeptic patients from a regional population in North Wales.
J. Antimicrob. Chemioter. 54: 435–440.
Gisbert J.P. and X. Calvet. 2012. Rifabutin in the treatment of
refractory Helicobacter pylori infection. Aliment. Pharmacol. Ther.
35: 209–221.
Glupczynski Y., F. Megraud, M. Lopez-Brea and L.P. Andersen.
2001. European multicenter survey of in vitro antimicrobial resistance in Helicobacter pylori. Eur. J. Clin. Microbiol. Infect. Dis. 20:
820–823.
Glupczynski Y, N. Broutet, A. Cantagrel, L.P. Andersen, T. Alarcon, M. Lopez-Brea and F. Megraud. 2002. Comparison of the
E-test and agar dilution method for antimicrobial susceptibility
testing of Helicobacter pylori. Eur. J. Clin. Microbiol. Infect. Dis. 21:
549–552.
Gościniak G. Y. Glupczyński, S. Goutier, C. Van Den Borre,
J.P. Butzler and A. Przondo-Mordarska. 1998. Prevalence of antibiotic resistance in Helicobacter pylori strains in Poland. Clin. Micro
bial. Infect. 12: 726–728.
Gościniak G., B. Iwańczak, A. Przondo-Mordarska, J. Grabińska
and F. Iwańczak. 2004. High Level of resistance to metronidazole
and clarithromycin in Helicobacter pylori isolated from pediatric
patients in Poland. Folia Microbiol. 49: 133–136.
Graham D.Y. and A. Shiotani. 2008. New concepts of resistance in
the treatment of Helicobacter pylori infections. Nature Clin. Practice
Gastroenterol. Hepatol. 5: 321–331.
Kadayifci A., Buyukhatipoglu H., Cemil Savas M. and I. Simsek.
2006. Eradication of Helicobacter pylori with triple therapy: an epidemiologic analysis of trends in Turkey over 10 years. Clin. Ther.
28: 1960–1966.
61
Karczewska E, I. Wojtas-Bonior, E. Sito, M. Zwolińska-Wcisło
and A. Budak. 2011. Primary and secondary clarithromycin, metronidazole, amoxicillin and levofloxacin resistance to Helicobacter
pylori in southern Poland. Pharmacol. Rep. 63: 799–807.
Karczewska E., K. Klesiewicz, I. Skiba, I. Wojtas-Bonior, E. Sito,
K. Czajecki, M. Zwolińska-Wcisło and A. Budak. 2012. Variability
in prevalence of Helicobacter pylori strains resistant to clarithromycin and levofloxacin in Southern Poland. Gastroenterol. Res. Pract.
doi: 10.1155/2012/418010.
Łaszewicz W. 2003. H. pylori infection in Poland – epidemiological study in children and adults (in Polish). Acad. Med. Bialostocensis 30–39.
Megraud F. 2004. H. pylori antibiotic resistance: prevalence, importance, and advances in testing. Gut 53: 1374–1384.
Megraud F. and P. Lehours. 2007. Helicobacter pylori detection and
antimicrobial susceptibility testing. Clin. Microbiol. Rev. 20: 280–322.
Megraud F., S. Coenen, A. Versporten, M. Kist, M. Lopez-Brea,
A.M. Hirschl, L.P. Andersen, H. Goossens, Y. Glupczynski on
behalf of the Study Group participants. 2013. Helicobacter pylori
resistance to antibiotic in Europe and its relationship to antibiotic
consumption. Gut 62: 34–42.
Mishra S. 2012. Is Helicobacter pylori good or bad? Eur. J. Clin.
Microbiol. Infect. Dis. Doi: 10.1007/s10096-012-1773-9.
Nishizawa T., H. Suzuki, J. Matsuzaki, H. Muraoka, H. Tsuqawa,
K. Hirata and T. Hibi. 2011. Helicobacter pylori resistance to rifabutin in the last 7 years. Antimicrob. Agents Chem. 55: 5374–5375.
Selgrad M. and P. Malfertheiner. 2011. Treatment of Helicobacter
pylori. Curr. Opin. Gastroenterol. 27: 565–570.
Yang J.C., P.I. Lee and P.R. Hsueh. 2010. In vitro activity of
nemonoxacin, tigecycline, and other antimicrobial agents against
Helicobacter pylori isolates in Taiwan, 1998–2007. Eur. J. Clin. Micro
biol. Infect. Dis. 29: 1369–75.
2014, Vol. 63, No 1, 63–67
ORIGINAL PAPER
Helicobacter pylori Infection in Type 1 Diabetes Children
and Adolescents Using 13C Urea Breath Test
AGATA CHOBOT1*, KATARZYNA BĄK-DRABIK2, ELIZA SKAŁA-ZAMOROWSKA3,
AGNIESZKA KRZYWICKA1, JAROSŁAW KWIECIEŃ2 and JOANNA POLAŃSKA4
Clinical Hospital No1, Zabrze, Poland; 2 Medical University of Silesia, Katowice, Poland
3
Upper Silesian Center of Child’s Health, Katowice, Poland
4
Data Mining Group, Silesian University of Technology, Gliwice, Poland
1
Submitted 8 August 2013, revised 31 October 2013, accepted 16 November 2013
Abstract
There is a 10–30% prevalence of HP infection in the general pediatric population in Poland. This study aimed to determine its prevalence
in T1DM children in Upper Silesia, Poland and estimate its influence on metabolic control of patients. We studied 149(82♀) children with
T1DM (duration > 12 months, mean HbA1c) and 298(164♀) age-matched controls. In all cases height and weight z-scores and Cole’s index
were assessed. In T1DM patients additionally glycated hemoglobin A1c and T1DM duration were analyzed. Presence of HP infection was
determined using 13C-isotope-labeled urea breath test (UBT) (fasting and 30min after ingestion 75 mg of 13C urea). HP infection was
present in 17 (11.4%) T1DM patients and in 49 (16.4%) controls (p > 0.05). T1DM patients presented higher values of anthropometric
parameters than healthy controls (weight SDS 0.25[–0.46÷0.84] vs. –0.25[–1.06÷0.26], height SDS 0.09[–0.60÷0.69] vs. –0.31[–1.17÷0.48]
and Cole’s index 103%[93÷111%] vs. 97%[86÷106%]; for all p < 0001). Within both groups – T1DM children and controls – no differences regarding sex, age and any of the anthropometric parameters were determined. T1DM duration and HbA1c showed no relation
to prevalence of HP infection. Prevalence of HP infection in pediatric T1DM patients is similar to that of healthy peers and shows no
relation to glycemic control.
Key words: Helicobacter pylori, HbA1c, type 1 diabetes, urea breath test
Introduction
Helicobacter pylori (HP) causes one of the most
common chronic infections worldwide. This is a gramnegative, spiral-shaped pathogenic bacterium that specifically colonizes the gastric epithelium and is related
to chronic gastritis and duodenitis, peptic ulcer disease and functional gastrointestinal motor disorders
(Marshall and Warren, 1984; Wotherspoon et al., 1991).
The remote consequences of a chronic infection, which
appear especially in adulthood, include: peptic ulcer,
mucosa-associated lymphoid tissue (MALT) lymphoma
and gastric cancer.
The prevalence of HP infection varies between
countries and depends on the age and socio-economical status. It is estimated that in developed European
countries 10–30% of the population is infected, however most cases remain asymptomatic. In developing
countries the prevalence in the adult population raises
even up to 70% (Goh et al., 2011). In previous research
the prevalence of HP infection in the general pediatric
population in Poland was assessed to be 30% (Iwańczak
et al., 2004). Nowadays the frequency of infection seems
to be lower than formerly reported. An assessment by
Żabka et al. (2010) revealed a 10% prevalence and
a most recent publication showed that the frequency
of HP infection in healthy children in Poland was 15.7%
(Krusiec-Świdergoł et al., 2010).
It is known that patients with diabetes are more
prone to infection than healthy people. This is probably because of the fact that both cellular and humoral
immune systems are perturbed, especially in the context of poor glycemic control with severe complications
(de Luis et al., 1998; Mustapha et al., 2005). Many studies have evaluated the prevalence of the HP infection in
diabetic patients, but the epidemiological relationship
remains controversial (Ariizumi et al., 2008; Ciortescu
et al., 2009; Ojetti et al., 2001, 2010; Otto-Buczkowska,
* Corresponding author: A. Chobot, Clinical Hospital No1, 3 Maja 13–15, 41-800 Zabrze, Poland; phone: 0048 323704267; e-mail:
[email protected]
64
1
Chobot A. et al.
2012; Stępkowski and Grzeszczak, 2009). Furthermore,
publications investigating HP infection in children and
adolescents with type 1 diabetes (T1DM) are sparse
and their conclusions contradictory (Arslan et al.,
2000; Colombo et al., 2002; Khalil et al., 2007; Ojetti
et al., 2010; Toporowska-Kowalska et al., 2006, 2007).
Some researchers revealed higher prevalence of HP
infection in diabetic patients in general as well as in
the pediatric population with T1DM (Ariizumi et al.,
2008; Arslan et al., 2000; Ciortescu et al., 2009; de Luis
et al., 1998; Ojetti et al., 2001, 2010; Otto-Buczkowska,
2012; Stępkowski and Grzeszczak, 2009). Nevertheless,
the results of other authors have not confirmed such
observations (Ciortescu et al., 2009; Colombo et al.,
2002; Khalil et al., 2007; Ojetti et al., 2001; ToporowskaKowalska et al., 2006, 2007).
The studies in T1DM subjects yielded also additional data on the relationship between HP infection
and glycemic control, although their conclusions are
also not unequivocal. On one hand, there are reports
of a negative impact of HP infection on HbA1c levels
(Toporowska-Kowalska et al., 2006, 2007), but discordant conclusions have also been published (Candelli
et al., 2003; Colombo et al., 2002; Khalil et al., 2007).
A supplementary interesting assessment revealed that
the eradication of HP infection did not improve the
metabolic control in a short-term follow-up (Candelli
et al., 2004, 2012; Khalil et al., 2007). Although a study
by Begue et al. (1999) demonstrated that HP eradication might decrease HbA1c.
The aim of the present study was to determine the
prevalence of HP infection in children and adolescents
with T1DM in Upper Silesia, Poland and to estimate
the influence of HP presence on metabolic control of
the patients.
Experimental
Patients. The study group comprised of 149
(82 female and 67 male) T1DM children and adolescents, aged 13.4 ± 3.4 years. Volunteers from the
regional out-patient diabetes clinic were enrolled using
the following criteria: DM duration > 12 months, no
history of antibiotic or proton pump inhibitor therapy in the past 4 weeks. The patients were examined
between July 2011 and June 2012. Table I. shows the
detailed characteristics of the studied patients. The control group consisted of 298 age- and sex-matched children and adolescents (164 female and 134 male) with
no known glucose metabolism disorders – characteristics are presented in Table I. This group was enrolled
from a large cohort (n = 1253) of children investigated
Table I
Characteristics and comparison of the study and control groups.
UBT result
N
Age [yrs]
T1DM Patients
Controls
Total
149
Total
298
P
13.4 ± 3.4 13.3 ± 3.3
ns
Weight Z-score
0.25 ± 0.93–0.25 ± 1.07<0.001
[–0.46 ÷ 0.84] [–1.06 ÷ 0.26]
Height Z-score
0.09 ± 0.97–0.31 ± 1.23<0.001
[–0.60 ÷ 0.69] [–1.17 ÷ 0.48]
Cole’s index [%] T1DM Duration [yrs]
HbA1c [%]
103 ± 1397 ± 15
[93 ÷ 111]
[86 ÷ 106]
<0.001
4.6 ± 3.5 7.69 ± 1.63
Legend: N – number of children, ± SD, [± 95% CI], SDS – standard deviation score, T1DM – Type 1 diabetes mellitus, UBT – urea breath test,
HbA1c – hemoglobin A1c
during the program “Good diagnosis-Treatment-Live”
carried out at the Clinical Hospital No 1 in Zabrze,
Poland between March 2010 and June 2012.
Methods. In all T1DM patients Z-score for height
and weight, Cole’s index and glycated hemoglobin A1c
(HbA1c) were assessed. Height and weight in T1DM
patients were measured using a standardized scale and
the Martin stadiometer. HbA1c measurements were
carried out in the same laboratory using the recommended high pressure liquid chromatography (HPLC),
which is a DCCT reference method. The normal range
for this laboratory is < 6%.
The presence of HP infection was determined in
all subjects by means of a breath test (UBT) with 13C
isotope-labeled urea, which was performed fasting.
Breath samples – at baseline and 30 minutes after ingestion of 75 mg of 13C isotope-labeled urea – were collected in 650 ml aluminized bags with one-way valves.
An infrared spectrophotometer (IRIS, Wagner GMBH,
Germany) was used to measure the 12CO2/13CO2
ratio. The results of the test were considered positive if
C13 concentration (delta over baseline, DOB [o/oo])
raised in the exhaled air by more than 4.0‰ (Żabka
et al., 2010).
Statistical analysis. Statistical analysis was performed with the R software (www.bioconductor.org).
Descriptive statistics were calculated for all analyzed
parameters, and adequate figures were generated. To
detect the outlying values Tukey’s criterion was used.
To check distribution normality Lilliefors test was
employed. The verification of the variance homogeneity hypothesis was carried out using the F or Bartlett
statistic. ANOVA algorithm and Student’s t test were
performed for comparative analysis of normally distributed variables. In the case of a distribution other
than normal, we used the non-parametric ANOVA
1
65
H. pylori infection in type 1 diabetes children
Kruskal-Wallis test and Mann-Whitney U test to verify
the concordance between groups. Pearson’s or Spearman’s correlation coefficients were used to estimate the
associations between two variables – depending on the
distribution of the analyzed continuous variables. Storey’s multiple testing correction algorithm of the p value
was used. For the analysis of discrete variables the χ2 test
or likelihood-ratio G test was performed. In each case
an appropriate contingency table was constructed. The
results were considered as significant at p < 0.05.
Ethical considerations. This study was approved
by the institutional ethical committee of the Medical
University of Silesia, Katowice, Poland.
Results
HP infection was present in 17 (11.4%) of T1DM
patients. No differences between genders were found.
Additionally no relation of the UBT result to age as
well as any of the anthropometric parameters – height
z-score, weight z-score, Cole’s index – was determined
(Table II). Parameters associated to T1DM – disease
duration as well as HbA1c – showed no relation to the
prevalence of HP infection (Table II).
Within the control group a positive UBT result was
obtained in 49 (16.4%) cases. Similar as in the T1DM
group no differences regarding sex, age and no relation
to the investigated anthropometric parameters were
found (Table II).
The comparison of the frequency of HP infection in
T1DM patients and non-diabetic children revealed no
discrepancy. All anthropometric parameters – height
and weight z-scores as well as the Cole’s index – were
significantly higher in T1DM patients (Table I).
Discussion
This study was performed using the UBT as a gold
standard method (Koletzko et al., 2011). It was conducted in a large number of T1DM pediatric patients
presenting quite good metabolic control (HbA1c
7.69%). The observed frequency of HP infection among
the non-diabetic cohort (approximately 16%) was similar to the newest reports regarding the general polish
pediatric population, which demonstrated a decrease
of the prevalence in comparison to the past decade
(Iwańczak et al., 2004; Krusiec-Świdergoł et al., 2010;
Żabka et al., 2010).
The results of former studies investigating HP infection in patients with T1DM are contradictory and there
are only few publications concerning the pediatric
population (Arslan et al., 2000; Ciortescu et al., 2009;
Colombo et al., 2002; de Luis et al., 1998; Ojetti et al.,
2001; Toporowska-Kowalska et al., 2006, 2007). Some
of them revealed a higher prevalence of HP infection in
children with T1DM (Arslan et al., 2000; de Luis et al.,
1998). However, our findings and the results of other
authors have not confirmed such observations (Candelli et al., 2003; Ciortescu et al., 2009; Colombo et al.,
2002; Khalil et al., 2007; Ojetti et al., 2001; ToporowskaKowalska et al., 2006, 2007). Given the facts mentioned
in the former paragraph it seems justified to make an
assumption that the prevalence of HP infection in
T1DM children is the same as in healthy peers. The
frequency of HP infection in the studied patients is
lower than in earlier publications (Candelli et al., 2003;
Colombo et al., 2002; Toporowska-Kowalska et al.,
2006, 2007). This might be explained by the fact that
some of the studies were based on a serological screening that does not distinguish past and present infections
Table II
T1DM patients and non-diabetic subjects – comparison between subgroups according to the UBT result.
UBT result
N
Age [yrs]
T1DM Patients
Controls
Positive
17
Negative
132
P
Positive
49
Negative
249
P
13.3 ± 3.3
13.9 ± 3.6
Ns
13.9 ± 3.2
13.2 ± 3.3 Ns
Weight Z-score
0.34 ± 0.970.24 ± 0.93Ns–0.39 ± 1.02–0.22 ± 1.08Ns
[–0.21 ÷ 0.94]
[–0.46 ÷ 0.83]
[–1.22 ÷ 0.16]
[–1.01 ÷ 0.30]
Height Z-score
–0.01 ± 1.090.10 ± 0.96Ns–0.48 ± 1.48–0.28 ± 1.18Ns
[–0.60 ÷ 0.69]
[–0.60 ÷ 0.69]
[–1.27 ÷ 0.60]
[–1.16 ÷ 0.46]
Cole’s index [%] 105 ± 12103 ± 13Ns 97 ± 1697 ± 17Ns
[96 ÷ 109]
[92 ÷ 111]
[86 ÷ 107]
[86 ÷ 106]
T1DM Duration [yrs]
5.3 ± 3.94.4 ± 3.4Ns
[2.8 ÷ 7.8]
[1.9 ÷ 6.4]
HbA1c [%]
7.82 ± 1.427.60 ± 1.66Ns
[6.90 ÷ 8.70][6.60 ÷ 8.15]
Legend: N – number of children, ± SD, [± 95%CI], SDS – standard deviation score, T1DM – Type 1 diabetes mellitus,
UBT – urea breath test, HbA1c – hemoglobin A1c, ns – not significant
66
1
Chobot A. et al.
as well as by the general decrease of HP infection in
Polish and European children during the last decade
(Colombo et al., 2002; Iwańczak et al., 2004; KrusiecŚwidergoł et al., 2010; Żabka et al., 2010).
In our study T1DM children with a confirmed
HP infection did not differ significantly in terms of
metabolic control and disease duration. No association between HP infection and HbA1c was also found
by other authors (Candelli et al., 2003; Colombo et al.,
2002; Khalil et al., 2007). In addition HP eradication
was shown to have no impact on metabolic control
(Candelli et al., 2004, 2012; Khalil et al., 2007). However, in the former study in T1DM polish children,
those infected with HP presented higher HbA1c levels
(Toporowska-Kowalska et al., 2007). Also Begue et al.
(1999) suggested a positive relation between HP eradication and metabolic control. These discrepancies might
be related to the differences between the study groups,
especially regarding age, race and socioeconomic status.
Moreover, the link between HP infection and metabolic
control might be indirect (i.e. HP is known to influence the gastric motility and was shown to affect insulin
resistance and may in this way influence blood glucose
and HbA1c levels) and therefore difficult to determine
clearly (Gen et al., 2010; Toporowska-Kowalska et al.,
2006). The relation between HP infection and diabetes
duration was investigated only by few other researchers, but all findings are similar to our results (Candelli
et al., 2003; Colombo et al., 2002; Khalil et al., 2007;
Toporowska-Kowalska et al., 2006, 2007).
Epidemiological studies suggest that the prevalence
of HP infection should rise with age (Krusiec-Świdergoł
et al., 2010). Despite that fact research conducted in
T1DM children showed no significant relation between
HP infection and age (Khalil et al., 2007; ToporowskaKowalska et al., 2006, 2007). Our results revealed also
no dissimilarities in age between HP positive and negative children in both groups – T1DM and controls.
Because HP was in the past described to potentially
impair growth in the pediatric population, our study
also assessed the standardized anthropometric parameters of T1DM patients and non-diabetic controls
(Krusiec-Świdergoł et al., 2010). All mean values for
both groups remained well within the normal ranges
(90–110% for Cole’s index and –1.0–1.0 for Z-scores),
although both cohorts differed significantly by all of
the anthropometric measurements. As expected T1DM
children had slightly higher mean weight and height
Z-scores as well as a little higher mean Cole’s index.
Nonetheless, within both groups HP positive and negative children presented no discrepancies regarding the
analyzed anthropometric parameters.
The strong aspects of this study are – except for the
ones mentioned in the beginning of the discussion – the
race and ethnical homogeneity of the studied groups.
Nonetheless, because patients were not randomly chosen for this study, the presented data cannot be considered to represent the incidence of HP infection in the
whole pediatric T1DM population in Poland.
The observed prevalence of HP infection in children
and adolescents with T1DM is similar to that of healthy
peers. No evidence for a relationship between the glycemic control and presence of HP infection in patients
with T1DM could be determined.
Acknowledgements
This study was partially financed by the grant SUT-BK/
RAU1/2013/10. Agata Chobot received partial financing by MNiSW
IP2012 007672.
Literature
Ariizumi K., T. Koike, S. Ohara, I. Yoshifumi, A. Yasuhiko,
I. Katsunori, I. Akira, O. Yoshiromo and S. Tooru. 2008. Incidence
of reflux esophagitis and Helicobacter pylori infection in diabetic
patients. World J. Gastroenterol. 14: 3212–3217.
Arslan D., M. Kendirci, S. Kurtoglu and M. Kula. 2000. Helicobacter pylori infection in children with insulin dependent diabetes
mellitus. J. Pediatr. Endocrinol. Metab. 13: 553–556.
Begue R.E., A. Mirza, T. Compton, R. Gomez and A. Vargas. 1999.
Helicobacter pylori infection and insulin requirement among children with type 1 diabetes mellitus. Pediatrics. 103: e83.
Candelli M., D. Rigante, G. Marietti, E.C. Nista, F. Crea, F. Bartolozzi, A. Schiavino, G. Pignataro, N.G. Silveri, G. Gasbarrini
and others. 2003. Helicobacter pylori, gastrointestinal symptoms,
and metabolic control in young type 1 diabetes mellitus patients.
Pediatrics. 111: 800–803.
Candelli M., D. Rigante, G. Marietti, E. C. Nista, F. Crea, A. Schiavino, G. Cammarota, G. Pignataro, S. Petrucci, G. Gasbarrini
and others. 2004. Helicobacter pylori eradication rate and glycemic
control in young patients with type 1 diabetes. J. Pediatr. Gastro
enterol. Nutr. 38: 422–425.
Candelli M., D. Rigante, A. Schiavino, M. Gabrielli, F. Crea,
L. Minguell Del Lungo, G. Pignataro, E. Sacco, S. Monaco,
N. Gentiloni Silveri and others. 2012. High reinfection rate of
Helicobacter pylori in young type 1 diabetic patients: a three-year
follow-up study. Eur. Rev. Med. Pharmacol. Sci. 16: 1468–1472.
Ciortescu I., C. Sfarti, M. Stan, M. Graur and C. Stanciu. 2009.
Prevalence of Helicobacter pylori infection in patients with diabetes
mellitus. Rev. Med. Chir. Soc. Med. Nat. Iasi. 113: 1048–1055.
Colombo C., P.A. Tomasi, G.F. Meloni, A.M. Marinaro, A. Ogana
and T. Meloni. 2002. Seroprevalence of Helicobacter pylori in children with type 1 diabetes mellitus in Sardinia. Diabetes. Nutr. Metab.
15: 91–95.
Gen R., M. Demir and H. Ataseven. 2010. Effect of Helicobacter
pylori eradication on insulin resistance, serum lipids and low-grade
inflammation. Southern Medical Journal. 103: 190–196.
Goh K.L., W.K. Chan, S. Shiota and Y. Yamaoka. 2011. Epidemio
logy of Helicobacter pylori infection and public health implications.
Helicobacter 16; Suppl 1: 1–9.
Iwańczak F., E. Madorskowska, M. Kaczmarski, L. Bąk-Romani
szyn, I. Płaneta-Małecka, W. Romańczuk, B. Iwańczak, T. Pytrus,
M. Czerwionka-Szaflarska, G. Mierzwa and others. 2004. Badania epidemiologiczne częstości występowania zakażenia Helicobacter pylori u dzieci w Polsce (in Polish). Pediatria Współczesna
4: 345–350.
1
H. pylori infection in type 1 diabetes children
Khalil T., H. Dorchy, M. Scaillon and C. Melot. 2007. Helicobacter
pylori infection and eradication are not related to glycosylated
hemoglobin levels (HbA1c) in young patients with type 1 diabetes.
Presse Med. 36: 1191–1195.
Koletzko S., N.L. Jones, K.J. Goodman, B. Gold, M. Rowland,
S. Cadranel S. Chong, R.B. Colletti, T. Casswall, Y. Elitsur and
others. 2011. Evidence-based guidelines from ESPGHAN and
NASPGHAN for Helicobacter pylori infection in children. J. Pedi
atr. Gastroenterol. Nutr. 53: 230–243.
Krusiec-Świdergoł B., J. Kwiecień, K. Jonderko, L. Strój,
A. Kasicka-Jonderko and B. Błońska-Fajfrowska. 2010. Decreasing
prevalence of Helicobacter pylori infection in children in Poland.
Przegląd Gastroenterologiczny 5: 279–284.
de Luis D.A., H. de la Calle, G. Roy, C.M. de Argila, S. Valdezate,
R. Canton and D. Boixeda. 1998. Helicobacter pylori infection and
insulin-dependent diabetes mellitus. Diabetes Res. Clin. Pract. 39:
143–146.
Marshall B.J. and J.R. Warren. 1984. Unidentified curved bacilli in
the stomach of patients with gastritis and peptic ulceration. Lancet.
1: 1311–1315.
Mustapha S., E. Sellers and H. Dean. 2005. Are children with type 1
diabetes immunocompromised? CMAJ 16; 173: 341.
Ojetti V., R. Pellicano, S. Fagoonee, A. Migneco, M. Berrutti and
A. Gasbarrini. 2010. Helicobacter pylori infection and diabetes.
Minerva Med. 101: 115–119.
67
Ojetti V., D. Pitocco, G. Ghirlanda, G. Gasbarrini and A. Gasbarrini. 2001. Role of Helicobacter pylori infection in insulin-dependent
diabetes mellitus. Minerva Med. 92: 137–144.
Otto-Buczkowska E. 2012. The helicobacter pylori infection is
problem in diabetic patients? (in Polish) Przegląd Medyczny Uni
wersytetu Rzeszowskiego i Narodowego Instytutu leków w Warszawie
2: 252–255.
Stępkowski T. and W. Grzeszczak. 2009. Comparison of Helicobacter pylori infection prevalence in patients with or without type
2 diabetes. Experimental and Clinical Diabetology 9: 29–32.
Toporowska-Kowalska E., K. Wasowska-Królikowska, A. Szadkowska and J. Bodalski. 2007. Helicobacter pylori infection and
its metabolic consequences in children and adolescents with type 1
diabetes mellitus. Med. Wieku Rozwoj 11: 103–108.
Toporowska-Kowalska E., A. Szadkowska, J. Bodalski and
K. Wąsowska-Królikowska. 2006. Ocena ryzyka zakażenia Helico
bacter pylori u dzieci i młodocianych chorych na cukrzycę typu I
(in Polish). Ped. Pol. 81: 409–412.
Wotherspoon A.C., C. Ortiz-Hidalgo, M.R. Falzon and P.G. Isaac
son. 1991. Helicobacter pylori-associated gastritis and primary
B-cell gastric lymphoma. Lancet 338: 1175–1176.
Żabka A., J. Kwiecień, K. Bąk-Drabik, A. Krzywicka, J. Porębska
and W Pieniążek. 2010. Czy częstość zakażeń H. pylori u dzieci
w wieku od 3 do 18 lat spada? (Doniesienie wstępne) (in Polish).
Probl. Med. Rodz. 2: 18–20.
2014, Vol. 63, No 1, 69–73
ORIGINAL PAPER
The Utility of Caco-2 cells in Isolation of Enteroviruses
from Environmental and Clinical Material
MAGDALENA WIECZOREK*, AGNIESZKA CIĄĆKA, AGNIESZKA WITEK
and BOGUMIŁA LITWIŃSKA.
National Institute of Public Health – National Institute of Hygiene, Department of Virology, Warsaw, Poland
Submitted 2 September 2013, revised 30 October 2013, accepted 16 November 2013
Abstract
The work presented here demonstrates the utility of Caco-2 cells in the isolation of enteroviruses (EVs) from environmental and clinical
materials. Thirty-two samples of cerebrospinal fluid positive in Pan-entero RT-PCR were taken for EV strain isolation in cell culture. Out
of the 32 samples analysed, 22 (68.75%) were positive for enteroviruses by isolation in Caco-2 cells, and 10 (31.25%) were positive by isolation in RD cells. High viral titre in clinical specimens resulted in rate increase for isolation in Caco-2 cells and RD cells (87.5% and 50%,
respectively). Also, the probability of isolation of enteroviruses from sewage in Caco-2 cells was 20 times higher that in RD cells. We proved
that Caco-2 cells were more effective than RD cells in enterovirus isolation, irrespective of the material used in the inoculation process.
K e y w o r d s: Caco-2 cells, cerebrospinal fluid, enteroviruses, sewage
Introduction
Enteroviruses (EVs) are members of the Picor
naviridae family, a large and diverse group of small
RNA viruses characterized by a single-positive-strand
genomic RNA. They affect millions of people worldwide each year, and are often found in the respiratory
secretions and stool of an infected person. Infection
can result in a wide variety of symptoms ranging from
mild respiratory illness (common cold), through hand,
foot, and mouth disease, acute haemorrhagic conjunctivitis, aseptic meningitis, and myocarditis, to severe
neonatal sepsis-like disease and acute flaccid paralysis.
(Tapparel, 2012)
The classic method for diagnosis of infection with
EVs has been virus isolation by cell culture from stool
samples, throat swabs, or cerebrospinal fluid (CSF).
Cell culture is still the best method for determining
the occurrence of infectious viruses in environment, as
well. Viral isolation is possible in a variety of cell lines;
however, no single cell line is optimal for all EVs.
PCR methods for detecting enteroviruses have been
developed during the past decade. Many studies have
shown that PCR is more sensitive and rapid than virus
isolation for the diagnosis of enteroviral infection.
Although detection by PCR reveals the presence of viral
RNA, it does not indicate the infectivity of the virus.
The determination of viral infectivity is important
especially in environmental monitoring. The detected
genomic material may be present in otherwise defective
virus particles that are not able to bind to or replicate in
the host cells. Knowing if a virus is infectious is important from a public health perspective to determine if
there is a public health concern. The infectivity of
viruses may be determined with the use of cell cultures,
such as Caco-2 and RD (Terletskaia-Ladwig et al., 2008;
Sedmak et al., 2005). Caco-2 cell line is a continuous line of heterogeneous human epithelial colorectal
adenocarcinoma cells. It has been found that Caco-2
cells support the growth of many viruses, including
enteroviruses, rotaviruses, adenoviruses, and astroviruses (Hamza 2011; Pinto et al., 1995). However, WHO
recommended RD cells for isolation of polioviruses and
other enteroviruses. Most of the enterovirus serotypes
have been propagated in RD cells, but in practice isolation from clinical and environmental material is often
unsuccessful (Lipson et al., 1988; Witek et al., 2011).
The present study was conducted to obtain information about the utility of Caco-2 cell in the isolation of
enteroviruses from environmental (sewage) and clinical
samples (CSF). CSF is not a simple material for enterovirus strains isolation, because the enterovirus load is
lower than in faeces during enteroviral meningitis, and
also is rich in replication-defective particles. Sewage is
* Corresponding author: M. Wieczorek, Chocimska 24 Str., 00-791 Warsaw, Poland; phone: +48 22 54 21 230, fax: +48 22 54 385;
e-mail: [email protected]
70
1
Wieczorek M. et al.
a heterogeneous material rich in factors such as metals,
humic acids, and other organic matter which can be
toxic for cells. Our goal was to compare EVs’ isolation
from this material in Caco-2 and RD cells.
Experimental
CSF samples. Cerebrospinal fluid samples were
obtained in 2011 and 2012 from patients with suspicion of enteroviral infection, and sent to the Laboratory of Virology in the National Institute of Health
for viral diagnostics. Thirty-two samples of CSF positive in Pan-entero RT-PCR were taken for EV strain
isolation in cell culture. These samples were divided
into two groups: strong positive – with intensive band
after RT-PCR reaction and weak positive – with not
clearly seen band. A volume of 200 µl of cerebrospinal
fluid was inoculated into tubes with RD and Caco-2
cells. The tubes were incubated at 37°C. Each specimen underwent two passages in RD and Caco-2 cells.
Samples demonstrating viral cytopathic effect (CPE)
were identified by neutralization assay using specific
antisera (National Institute of Public Health and the
Environment, the Netherlands).
Sewage samples. Samples of raw sewage were processed according to the protocol described earlier (Zurbriggen et al., 2008). Tubes with monolayer of RD and
Caco-2 cells in maintenance medium were inoculated
with 100 μl of sewage sample; before inoculation, samples were incubated with different concentrations of
trypsin (from 0 to 50 μg/ml) for different times (from
0 min to 2 h) at 37°C and next were added to those
tubes. Cytopathic effects were read daily for 7 days,
and two passages were performed. Supernatant fluids
from samples demonstrating viral CPE were used for
the RT-PCR detection to confirm the presence of the
virus. Four independent experiments were performed.
RNA extraction and RT-PCR. Viral RNA was
extracted from 140 µl of CSF, cell culture supernatant
or concentrated sewage using spin columns (Qiagen)
following the manufacturer’s instructions. RT-PCR was
carried out using Pan-enterovirus primers for enterovirus detection based on the WHO manual (WHO, 2004).
This set of primers produces a product of 114 bp and
has been designed to detect and amplify a genome segment present at the 5’-UTR of the enterovirus genomes.
RT-PCR amplification was performed: one cycle of
reverse transcription at 45°C for 20 min; one cycle of
denaturation at 94°C for 2 min; 30 cycles of denaturation at 94°C for 30 s; annealing at 55°C for 30 s; elongation at 70°C for 30 s followed by one cycle of elongation
at 70°C for 7 min. Reaction mixtures were then held at
4°C. Amplification products were analysed in 2% agarose gels, GelRed-stained, and examined under a UV
DNA trans-illuminator.
Statistical analysis. Received data were analysed
with Statgraphics for Windows, Centurion, v.XV. StatPointTech.Inc. USA. Simple linear regression and multiple regression model was used to estimate relationships among variables.
Results
A total of 177 cerebrospinal fluid samples were
obtained in 2011 (59) and 2012 (118) from patients
with suspicion of enteroviral infection, and sent to
the Laboratory of Virology in the National Institute
of Health for viral diagnosis. Of 177 CSF samples, 85
(48%) samples were positive in RT-PCR reaction (36%
in 2011 and 60% in 2012). Thirty-two CSF samples
were selected from all positive samples. These samples were divided into two groups: strong positive (16)
– with intensive band after RT-PCR reaction and weak
positive (16) – with not clearly seen band. A volume of
200 µl of cerebrospinal fluid was inoculated into tubes
with RD and Caco-2 cells according to WHO procedures. Out of the 32 samples analysed, 22 (68.75%) were
positive for enteroviruses by isolation in Caco-2 cells,
and 10 (31,25%) were positive by isolation in RD cells
(Table I). There were two positive isolations in RD cells
(12.5%) in the group of weak-positive samples unlike
isolation in Caco-2 cells – 50.0% (8) positive results.
The best results were obtained in the group of strongpositive samples (intensive band) isolated in Caco-2
cells – 87.5% positive results. However, positive isolation from this group of material in RD cells was much
lower (50.0%). Serotyping revealed the predominance
of echovirus 6 (E6), followed by E11.
Samples of sewage were collected from several locations around Poland in 2011. Samples were evaluated
Tabele I
Enteroviruses isolation from CSF in RD and Caco-2 cells.
RT-PCR
Pan-entero results
Strong-positive
Weak-positive
No.
of samples
16
Total no.
of samples
32 (100%)
16
RD
Total RD
Caco-2
Total Caco-2
positive isolation positive isolation positive isolation positive isolation
8 (50.0%)
14 (87.5%)
10 (31.25%)
2 (12.5%) 8 (50.0%)
22 (68.75%)
1
71
The utility of Caco-2 cells in isolation of enteroviruses
Table II
Sewage samples analysis for enteroviruses in RD cells.
Incubation time
Tryspin concentration
(μg/ml)
0’
10’
30’
1 h
2 h
No of positive
results
0
0000 0000000000000000
0
P = 0
P = 0
P = 0
P = 0
P = 0
P = 0
5
0000 00000000 0000+000
1
P = 0
P = 0
P = 0
P = 0
P = 0.25
P = 0.05
10
0000 0000000000000000
0
P = 0
P = 0
P = 0
P = 0
P = 0
P = 0
50
0000 +000000000000000
1
P = 0
P = 0.25
P = 0
P = 0
P = 0
P = 0.05
No of positive results
0
P = 0
1
P = 0.06
0
P = 0
0
P = 0
1
P = 0.06
P – propability; 0 – lack of cytopathic effect; + – characteristic enterovirus cytopathic effect.
Table III
Sewage samples analysis for enteroviruses in Caco-2 cells.
Incubation time
Tryspin concentration
(μg/ml)
0’
10’
30’
1 h
2 h
No of positive
results
0
+++0 +++0+++0 +000++00
12
P = 0.75
P = 0.75
P = 0.75
P = 0.25 P = 0.50
P = 0.60
5
+000 +++0 ++00 ++00+++0
11
P = 0.25
P = 0.75
P = 0.50
P = 0.50 P = 0.75
P = 0.55
10
+++0 +++0+++0 +000++00
12
P = 0.75
P = 0.75
P = 0.75
P = 0.25 P = 0.50
P = 0.60
50
+000 +000+++0 ++00+000
8
P = 0.25
P = 0.25
P = 0.75
P = 0.50 P = 0.25
P = 0.40
No of positive results
8
10
11
6
8
P = 0.50P = 0.62P = 0.69P = 0.38P = 0.50
P – propability; 0 – lack of cytopathic effect; + – characteristic enterovirus cytopathic effect.
by RT-PCR assay for the presence of enteroviruses.
Positive samples were pooled and isolated in Caco-2
and RD cells. Before inoculation, sewage samples were
incubated with different concentrations of trypsin
(from 0 to 50 μg/ml) for different times (from 0 min to
2 h) at 37°C. Among 80 samples isolated in RD cells,
only 2 were positive (Table II) in contrast to 43 positive
samples in Caco-2 cells (Table III). The probability of
isolation in RD cells (P = 0.025) was 20 times lower that
in Caco-2 cells (P = 0.538). The processing of samples
before inoculation (different concentrations of trypsin
and different incubation times) did not significantly
influence on the isolation of enterovirus strains in RD
and Caco-2 cells. There was no significant difference
between incubation time and concentration of trypsin
and positive results of isolation.
All samples demonstrating characteristic cytopathic
effect were positive in Pan-enterovirus RT-PCR. Thus,
it confirmed that observing cytopathic effect was connected with the presence of enterovirus.
Discussion
There is currently no cell line that supports the
growth of all enterovirus serotypes. Different cell lines
such as HEL, Caco-2, RD, HEp2, A549, and buffalo
green monkey kidney cells (BGMK) are used for isolation of enteroviruses (Schmidt et al., 1975; Kok et al.,
1998; Buxbaum et al., 2001; Otero et al., 2001; Buck
et al., 2002). In this study, Caco-2 cell line was used for
isolation of enteroviruses from sewage and cerebrospinal samples. In addition to Caco-2 cells, samples were
also evaluated by RT-PCR assay for the presence of
enteroviruses, and isolated in RD cells. Caco-2 cells were
more effective in enterovirus isolation than RD cells.
The rates of enterovirus isolation for 32 samples of cerebrospinal fluid positive in RT-PCR assay were 68.75%
by Caco-2 cells, in contrast to 31.25% by RD cells. The
high viral titre in clinical specimen (intensive band after
PCR reaction) resulted in rate increase for isolation in
Caco-2 cells and RD cells (87.5% and 50%, respectively).
72
1
Wieczorek M. et al.
Also, the probability of isolation of enteroviruses
from sewage in Caco-2 cells was 20 times higher that
in RD cells. All positive isolations in Caco-2 cells were
observed in the first passage; it was impossible in RD
cells. In the case of RD cells, all positive isolations
were observed in the second passage. The cell culture
of Caco-2 cells after inoculation was in good condition
for several days in contrast to RD cell culture. RD cells
showed rapid degeneration due to non-specific toxicity
of the specimen (sewage). Negative results of isolation
in RD cells are probably a consequence of the presence
of compounds that are toxic for cells. The presence of
factors such as metals, humic acids, and other organic
matter can interfere with cell growth. Toxic or inhibitory compounds which can impair the sensitivity of
cell culture and molecular systems are found frequently
in environmental samples (Murrin and Slade 1997;
Reynolds et al., 1996). Toxicity in cell culture can be
variable; excessive toxicity causes widespread cell death
while limited toxicity may adversely affect virus attachment to cells.
It is interesting to note that in a study by Reigel
(1985), different viruses from clinical material replicated in Caco-2 cells: enteroviruses (coxsackieviruses
B1-B6, poliovirus types 1-3, most echoviruses and coxsackieviruses A), adenoviruses, herpes simplex virus
types 1 and 2, measles viruses, respiratory syncytial
viruses, parainfluenza type 2 viruses, and to a lesser
extent rubella and mumps viruses. However, Caco-2
cells are not popular in environmental analysis. Our
study demonstrates that the resistance of Caco-2 cells
for cytotoxic components from sewage is of crucial
importance. It should also be considered that in years
with high activity of types growing well in cell culture,
the sensitivity of cell culture can be higher than in years
with lower enterovirus activity (Roth et al., 2007).
The addition of trypsin does not affect enterovirus
isolation. The proteolytic enzymes have been reported
to have several effects on cell cultures and virus cultivation. Enzyme treatment enhanced infectivity in
most enteric viruses, for example in reoviruses (Rutjes
et al., 2009). Trypsin treatment is not recommended
in enterovirus isolation. That enzyme can cleave some
enterovirus capsid protein, but usually does not affect
infectivity.
The high probability of enteroviruses’ isolation in
Caco-2 cells in our study demonstrates that sewage
testing may be very useful in epidemiological study
of enteroviruses circulating in the population. Sewage
surveillance system has been shown to be more sensitive than reporting of clinical cases of serious illness in
a community (Sinclair et al., 2008; Bosch et al., 2008).
Data regarding the occurrence of viruses in raw sewage may provide an overview of the epidemiology of
virus infections circulating in the community, and at
the same time may reveal the occurrence of asymptomatic infections (Pinto et al., 2007; Lodder et al., 2012).
The usefulness of community sewage testing to monitor
the presence of polioviruses in the face of the circulation of wild-type poliovirus in the community has
been demonstrated in the Netherlands (Van der Avoort
et al., 1995) and Finland (Poyry et al., 1988), and similar
testing of sewage may be useful for the monitoring of
echoviruses and coxsackieviruses.
In conclusion, using Caco-2 cells for virus isolation
in sewage seems to be very promising for environmental surveillance of enterovirus circulation and epidemiology, with all the significant effects that this may
have on public health. Therefore, it is always important
to consider the limitations imposed by the toxicity of
environmental samples when selecting cells for viral
isolation. Also, the isolation of enterovirus strains from
clinical material (e.g. cerebrospinal fluids) with the use
of Caco-2 cells seems to be very promising.
Acknowledgments
This study was supported by Ministry of Science and Higher
Education of Poland grant NN 404 113 839.
Literature
Bosch A., S. Guix, D. Sano and R.M. Pinto. 2008. New tools for
the study and direct surveillance of viral pathogens in water. Curr.
Opin. Biotechnol. 19: 295–301.
Buck G.E., M. Wiesemann and L. Stewart. 2002. Comparison of
mixed cell culture containing genetically engineered BGMK and
CaCo-2 cells (Super E-Mix) with RT-PCR and conventional cell
culture for the diagnosis of enterovirus meningitis. J. Clin. Virol.
25: S13–S18.
Buxbaum S., A. Berger, W. Preiser, H.F. Rabenau and H.W. Doerr.
2001. Enterovirus infections in Germany: comparative evaluation
of different laboratory diagnostic methods. Infection. 29: 138–142.
Hamza I.A., L. Jurzik, K. Uberla and M. Wilhelm. 2011. Methods
to detect infectious human enteric viruses in environmental water
samples. Int. J. Hyg. Environ. Health. 214: 424–436.
Kok T.W., T. Pryor and L. Payne. 1998. Comparison of rhabdomyosarcoma, buffalo green monkey kidney epithelial, A549 (human lung
epithelial) cells and human embryonic lung fibroblasts for isolation
of enteroviruses from clinical samples. J. Clin. Virol. 11: 61–65.
Lipson S.M., R. Walderman, P. Costello and K. Szabo. 1988. Sensitivity of rhabdomyosarcoma and guinea pig embryo cell cultures
to field isolates of difficult-to-cultivate group A coxsackieviruses.
J. Clin. Microbiol. 26: 1298–1303.
Lodder W.J., A.M. Buisman, S.A. Rutjes, J.C. Heijne, P.F. Teunis
and A.M. de Roda Husman. 2012. Feasibility of quantitative environmental surveillance in poliovirus eradication strategies. Appl.
Environ. Microbiol. 78: 3800–3805.
Murrin K. and J. Slade. 1997. Rapid detection of viable enteroviruses in water by tissue culture and semi-nested polymerase chain
reaction. Water Sci. Technol. 35: 429–432
Otero J.R., L. Folgueira, G. Trallero, C. Prieto, S. Maldonado,
M.J. Babiano and I. Martinez-Alonso. 2001. A-549 is a suitable
cell line for primary isolation of coxsackie B viruses. J. Med. Virol.
65: 534– 536.
1
The utility of Caco-2 cells in isolation of enteroviruses
Pinto R.M., D. Alegre, A. Dominguez, W.M. El-Senousy, G. Sanchez, C. Villena, M.I. Costafreda, L. Aragones and A. Bosch. 2007.
Hepatitis A virus in urban sewage from two Mediterranean countries. Epidemiol. Infect. 135: 270–273.
Pinto R.M., R. Gajardo, F.X. Abad, and A. Bosch. 1995. Detection of fastidious infectious enteric viruses in water. Environ. Sci.
Technol. 29: 2636–2638.
Poyry T., M. Stenvik and T. Hovi. 1988. Viruses in sewage waters
during and after a poliomyelitis outbreak and subsequent nationwide oral poliovirus vaccination campaign in Finland. Appl. Envi
ron. Microbiol. 54: 371–374.
Reigel F. 1985. Isolation of human pathogenic viruses from clinical
material on CaCo2 cells. J. Virol. Methods. 12: 323–327.
Reynolds K.A., C.P. Gerba and I.L. Pepper. 1996. Detection of
infectious enteroviruses by an integrated cell culture-PCR procedure. Appl. Environ. Microbiol. 62: 1424–1427.
Roth B., M. Enders, A. Arents, A. Pfitzner and E. TerletskaiaLadwig. 2007. Epidemiologic aspects and laboratory features of
enterovirus infections in Western Germany, 2000–2005. J. Med.
Virol. 79: 956–962.
Rutjes S.A., W.J. Lodder, A.D. van Leeuwen and A.M. de Roda
Husman. 2009. Detection of infectious rotavirus in naturally contaminated source waters for drinking water production. J. Appl.
Microbiol. 107: 97–105.
Schmidt N.J., H.H. Ho and E.H. Lennette. 1975. Propagation and
isolation of group A coxsackieviruses in RD cells. J. Clin. Microbiol.
2: 183–185.
Sedmak G., D. Bina, J. Macdonald and L. Couillard. 2005.
Nine-year study of the occurrence of culturable viruses in source
73
water for two drinking water treatment plants and the influent and
effluent of a Wastewater Treatment Plant in Milwaukee, Wisconsin (August 1994 through July 2003). Appl. Environ. Microbiol. 71:
1042–1050.
Sinclair R.G., C.Y. Choi, M.R. Riley and C.P. Gerba. 2008. Pathogen surveillance through monitoring of sewer systems. Adv. Appl.
Microbiol. 65: 249–269.
Tapparel C., F. Siegrist, T.J. Petty and L. Kaiser. 2013. Picornavirus
and enterovirus diversity with associated human diseases. Infect.
Genet. Evol. 14: 282–293.
Terletskaia-Ladwig E., S. Meier, R. Hahn, M. Leinmuller,
F. Scheider, and M. Enders. 2008. A convenient rapid culture assay
for the detection of enteroviruses in clinical samples: comparison
with conventional cell culture and RT-PCR. J. Med. Microbiol. 57:
1000–1006.
Van der Avoort H., J. Reimerink, A. Ras, M. Muldres and
A. van Loon. 1995. Isolation of epidemic poliovirus from sewage
during the 1992–3 type 3 outbreak in The Netherlands. Epidemiol.
Infect. 114: 481–491.
WHO. 2004. Polio laboratory manual. WHO/IVB/04.10. World
Health Organization, Geneva, Switzerland.
Witek A., M. Brzóstkowska, A. Diuwe and M. Wieczorek. 2011.
Identification of infection agent in diagnostic material from patients
with suspicion of enteroviral meningitis (in Polish). Przegl. Epide
miol. 65:557–560.
Zurbriggen S., K. Tobler, C. Abril, S. Diedrich, M. Ackermann,
M.A. Pallansch and A. Metzler. 2008. Isolation of sabin-like polioviruses from wastewater in a country using inactivated polio vaccine. Appl. Environ. Microbiol. 74: 5608–5614.
2014, Vol. 63, No 1, 75–82
ORIGINAL PAPER
Psychrotrophic Lipase Producers from Arctic Soil and Sediment Samples
R. RASOL1, 2, A.R. RASHIDAH1*, R. SITI NUR NAZUHA1, J. SMYKLA3,
W.O. WAN MAZNAH1 and S.A. ALIAS4
School of Biological Sciences, Universiti Sains Malaysia, 11800 Penang, Malaysia
Faculty of Applied Sciences, Universiti Teknologi MARA, 40450 Shah Alam, Malaysia
3
Department of Biodiversity, Institute of Nature Conservation, Polish Academy of Sciences, Krakow, Poland
Present address: Department of Biology and Marine Biology, University of North Carolina Wilmington,
01 S. College Rd., Wilmington, NC 28403, USA
4
National Antarctic Research Center, Institute of Graduate Studies, University of Malaya, 50603 Kuala Lumpur, Malaysia
1
2
Submitted 12 March 2013, revised 27 September 2013, acepted 16 November 2013
Abstract
Culturable microorganisms were successfully isolated from soil and sediment samples collected in 2011 on the northern coast of Hornsund,
West Spitsbergen. A total of 63 single colony isolates from three sampling sites obtained were subjected to temperature dependence study
to assess whether they are obligate psychrophilic or psychrotrophic strains. From initial temperature screening, only 53 psychrotrophic
isolates were selected that are capable of growing between 4–28°C. The rest that were capable of tolerating higher temperatures up to 37°C
were not included in this study. These isolates were chosen for lipase enzyme screening confirmation with the standard plate assay of
olive oil and fluorescent dye Rhodamine B. Six lipase positive isolates were also subjected for subsequent lipase enzyme plate screening on
tributyrin, triolein, olive oil and palm oil agar. Lipase production by these six isolates was further assayed by using colorimetric method
with palm oil and olive oil as the substrate. These isolates with promising lipase activity ranging from 20 U/ml up to 160 U/ml on palm oil
and olive oil substrate were successfully identified. Molecular identification by using 16S rRNA revealed that five out of six isolates were
Gram-negative Proteobacteria and the other one was a Gram-positive Actinobacteria.
K e y w o r d s: Arctic soil, lipase, psychrotroph
Introduction
Polar ecosystems are extensively prospected for
obligate psychrophilic and psychrotrophic microbes
in order to discover the unique adaptabilities of their
enzymes (de Pascale et al., 2012). It is evident that these
ongoing research have yield fruitful discoveries of varieties of microbial communities capable of producing
cold-active enzymes. In the Arctic region, several bioprospecting studies had led to the findings of a diverse
range of bacteria capable of producing cold-active
enzymes. A study of bacterial diversity from sediment
samples along a transect from the snout of the Arctic
Midtre Lovenbreen glacier up to the melt water streams
uncovered 32 groups of bacteria, with 14 exhibiting
cold-active enzyme activities (Reddy et al., 2009). Sea
ice that provides a large pool of organic matters housed
several bacterial communities capable of producing
cold-active hydrolytic enzymes. Arctic sea ice samples
from Canada Basin yield 338 bacterial strains having
diverse enzyme producing capabilities, with lipase being
the highest (Yu et al. 2009). Sea ice and seawater sampled from Spitzbergen fjords, possessed 116 psychrophilic and psychrotrophic strains; with protease enzyme
producers accounted for more than half of the isolated
bacteria (Groudieva et al., 2004). A total of 103 bacterial isolates from 47 phylotypes were isolated from eight
sediment and one soil samples of two Arctic fjords of
Kongsfjorden and Ny-Ålesund, Svalbard with 56%
showing either amylase or lipase or both activities (Srinivas et al., 2009). The Finnish Lapland exhibited large
annual temperature variations and freeze/thaw events
as compared to other Arctic areas. Various ecosystems
of Finnish Lapland sampled in Männistö and Häggblom
(2006) revealed 331 bacterial strains with protease and
lipase producers detected in 59 and 66 isolates.
Extensive research on cold-loving microorganism was carried out because there is a growing prospect of cold-adapted enzymes in the industries. These
enzymes were functional at varied and demanding
* Corresponding author: A.R. Rashidah, School of Biological Sciences, Universiti Sains Malaysia, 11800 Penang, Malaysia; phone/fax:
604 - 6534006 / 604 - 6565125; e-mail: [email protected]; [email protected]
76
1
Rasol R. et al.
industrial conditions. Cold adapted enzymes are in
favor because of their ability to save energy, reduce
mesophilic microbial contamination and the ease of
mild heat-inactivation to terminate the cold-adapted
enzymes catalysis (Groudieva et al., 2004). Lipase catalyze both the hydrolysis and synthesis of ester bonds
in long-chain acylglycerol (C ≥ 10) (Jaeger and Reetz,
1998) resulting in the formation of an alcohol and a carboxylic acid (de Pascale et al., 2008). Most of microbial
lipase showed high activity between 30°C and 50°C,
while alternatively cold active lipase showed high specific activity at lower temperatures. This caused them
to become a preferable choice to suit diverse industrial
processes (Mayordomo et al., 2000). Due to their interesting property of high activity at low temperatures,
production of frail compounds such as synthesis of
chiral intermediates would make cold-active lipase as
their prime choice. Structural modification in coldactive lipase by an increased flexibility of the polypeptide chain due to higher proportion of amino acids
(de Pascale et al., 2012) ease substrate accommodation
at low temperatures (Joseph et al., 2008). Cold-active
lipase is also reported to work under low water condition due to its high flexibility. In the industry, reverse
hydrolysis of substrates in low water conditions are preferable because they are able to lower down water activity
besides having improved yields (Tutino et al., 2009).
Besides the need of finding novel cold-active lipase
that possess industrial applications, based on protein
database from (http://www.ncbi.nlm.nih.gov/protein),
least numbers of cold-active lipase structures have been
solved. Structure-function and catalytic activity studies
of cold-active lipase will be able to help the scientific
community in understanding cold adaptation. This will
also lead to steps in designing and engineering lipase
for specific applications in the future. Therefore, in this
study, we attempt to search and identify the lipase producing ability of bacterial isolates from Arctic that are
capable of producing cold-active lipase enzyme.
Experimental
Study area and sample collection. The field survey and sampling for this study took place during the
2011 boreal summer (August 2011) on the northern coast of Hornsund, Wedel Jarlsberg Land, West
Spitsbergen in the vicinity of the Polish Polar Station
“Hornsund” (77°00'04"N, 15°33'37"E). Climate of this
area is strongly affected by oceanic influence. However,
climatic conditions are very variable and characterized
by low temperature, low precipitation and strong foehn
winds. The average annual air temperature is – 4.4°C,
with average monthly temperatures ranging between
– 11.3°C in January and + 4.4°C in July, and average
annual precipitation reaches only ca. 300–400 mm
(Marsz and Styszyńska 2007).
A total of twelve sampling locations representing
a range of habitats with a diversity of soil physical
and chemical characteristics were sampled (data not
shown). In this preliminary study, only three sample
sites described in Table I were analyzed for this work.
Isolates were named according to sites where they were
sampled; isolate from soil sample collected at the site
A were named ARA(I), isolates from sediment sample collected at the site A were named as ARA(II), and
isolates from soil samples collected at the site B and C
were named ARB and ARC respectively.
At each sampling location, 10 g of soil or sediment
was obtained covering the surface to 10 cm depth using
a sterile spatula. As for site C, soil from the bottom
of the pond was sampled. The samples were collected
with using a sterile spatula and placed into sealed sterile
Falcon tubes. Then the samples were refrigerated at 4°C,
and subsequently transported at this temperature, taking 6 days in transit to the National Antarctic Research
Center, Kuala Lumpur, Malaysia, where they were stored
at –20°C until further analysis (Ali et al., 2013).
Table I
Details of sampling locations in the Hornsund area where soil and sediment samples were collected (after Ali et al., 2013).
Designation
Air temperature (°C)
Air
Soil
pH
Water
Altitude
m asl
4.55
7.00
5.98
11
Site B (soil) ARB
Skjerstranda at the foothill Dried
runnel of Trulsenfjellet
77°01’28.50” N
15°12’52.74” E
7.30
9.55
–
23
Site C (soil) ARC
Ralstranda (southern part), at the foot Pond
of Rotjesfjellet, near Revelva river
77°00’24.12” N
15°20’36.54” E
5.85 8.50 5.2416
Sites
Site A (soil) ARA(I)
Site A
ARA(II)
(sediment)
Location
Fugleberrgsletta, neighbourhood
of the Hornsund Station
77°00’06.00” N
15°31’54.60” E
Habitat
Vertebrate-influenced pond 1
77
Psychrotrophic lipase producers
Isolation of culturable bacterial strains. An amount
of 1 g of soil and sediment were inoculated into 100 ml
of nutrient broth medium and grown at 15°C, 150 rpm
for 15 days (Leonov, 2010). After the incubation period,
the samples were serially diluted 10–6 in sterile cold distilled water and isolated on nutrient agar plates. Single
colonies obtained with obviously different macroscopic
characteristics were subcultured on fresh nutrient agar
plates three times to produce pure colony isolates.
Temperature dependence study. In order to differentiate an obligate psychrophilic and psychrotrophic
strain growth, isolates obtained that were in pure colony
forms were screened by growing on nutrient agar plates
and incubated at three different temperatures which
were 4°C (in the refrigerator), 28°C ± 2°C (at room
temperature) and 37C (in the incubator). Room temperature fluctuates at ± 2°C during day and night time.
Plate screening for lipase. Confirmation of lipase
activity via plate screening was done by using the standard Rhodamine B fluorescent assay. Isolates were grown
on Rhodamine B agar (1% v/v olive oil and 10 ml of
Rhodamine B stock 0.01% w/v). Lipase production
on Rhodamine B medium was monitored by orange
fluorescence as seen with UV light at 350 nm. Subsequently, lipase activities on lipase positive isolates
were also screened using olive oil (1% v/v) agar, palm
oil (0.5% v/v) agar, tributyrin (1% v/v) agar and triolein (1% v/v agar). Halo zones seen were considered
as positive for lipase production. Tween 20 (0.1% v/v)
was added as inducers to all plates except the ones that
used tributyrin as substrate. This is due to the fact that
initial plate screening without any inducers’ addition
failed to detect halo zones in all substrates of triolein,
olive oil and palm oil.
Standard curve of free fatty acids. A series of oleic
acid mixture with isooctane ranging from 0–1000 µmol
was prepared in test tubes. The standard curve of free
oleic acids vs. absorbance at 715 nm was determined
according to Kwon and Rhee (1986). Standard curve
of oleic acid was constructed to determine the lipase
activity of each isolate during lipase assay.
Lipase assay. Fatty acids released by six lipase positive isolates as confirmed by plate screening were measured by colorimetric method according to Eltaweel
et al. (2005) with modification. Cultures that had been
grown for 5 days at 15°C with olive oil (1% v/v) or
palm oil (0.5% v/v) as the substrate were centrifuged
at 4,000 rpm to separate the cells and the extracellular enzymes. An amount of 1 ml of crude extracellular enzymes from the supernatant was mixed with
1.48 ml of 100 mM phosphate buffer pH 7, 0.02 ml of
20 mM CaCl2 . 2H20 and 2.5 ml of olive oil emulsion in
1% poly(vinyl alcohol)(1:3 v/v). The mixture was incubated for 30 minutes at 15°C with the agitation rate
of 180rpm. An amount of 1 ml of 6 N HCl and 5 ml
isooctane was added to terminate the reaction. The
mixture was hand shaken and allowed to separate for
10 minutes. Finally, 4 ml of the upper isooctane layer
which contained liberated fatty acids were transferred
to a fresh tube containing 0.2 ml of cupric acetate-pyridine reagent and further mixed by vortexing vigorously
until foamed. After half an hour at room temperature,
absorbance at 715 nm was determined on the isooctane
that contained dissolved free fatty acids. One unit of
lipase activity was equivalent to 1 µmole of fatty acid
released per ml/min at 15°C.
Morphology and molecular identification. Morphology of the six lipase positive isolates was identified
through Gram staining and molecular identification by
using 16S rRNA analysis. DNA from each isolate was
extracted using modified CTAB method (Sambrook
and Russell, 2001). The genomic DNA of each isolate
was subjected to amplification of the 16S rRNA gene
using 27F and 1492R primer pairs. Sequences obtained
were aligned using ClustalW (MEGA 5.10) and subjected to BLAST analysis for species identification.
Results
Isolation of culturable bacteria. A total of 63 single
colony isolates were obtained from the three sample
sites (Table II), comprising 21 soil isolates from site A
(named as ARA(I) isolates), 8 sediment isolates from
site A (named as ARA(II) isolates), 27 soil isolates from
site B (named as ARB isolates) and finally 7 soil isolates
from site C (named as ARC isolates).
Temperature dependence study. All isolates were
subjected to temperature dependence study to differentiate whether they are obligate psychrophiles or psychrotrophs. Based on growth temperatures used which
was 4°C, 28°C ± 2°C and 37°C, each isolate was grouped
to three different groups. Isolates that only grew at 4°C
were most probably obligate psychrophiles that cannot tolerate growth temperatures higher than 20°C.
Isolates capable of growth at both 4°C and 28°C ± 2°C
can be grouped as facultative psychrophiles or psychrotroph that tolerated growing temperatures up to 30°C.
However, those that also grew at 37°C tolerated such
a huge range of temperatures were not included in this
study as the aim was to isolate bacteria that adapt to low
temperatures. The isolates designation, growing ability
at three different incubation temperatures and colony
color were given in Table II.
From Site A, three soil isolates, ARA (I) 6, 15 and 19
were capable of growing at 37°C (in addition to 4°C and
28°C ± 2°C). These isolates were removed from further
analyses. This left only 18 soil isolates for further lipase
screening process. For some of the isolates, the growth
medium turned brown/black during the isolates incubation. However, this characteristic was only recorded
78
Table II
List of isolates, their temperature dependence and macroscopic
characteristics. For details on sampling sites location
and characteristics see Table I.
Sampling site
and substratum
1
Rasol R. et al.
Isolate
Incubation temperature
4°C
28°C ± 2°C
37°C
Site A (soil)
ARA(I) 1
/
/*
–
ARA(I) 2
/
/*
–
ARA(I) 3
/
/*
–
ARA(I) 4
/
/*
–
ARA(I) 5
/
/
–
ARA(I) 6
/
/*
/*
ARA(I) 7
/
/
–
ARA(I) 8
/
/
–
ARA(I) 9
/
/*
–
ARA(I) 10
/
/
–
ARA(I) 11
/
/
–
ARA(I) 12
/
/*
–
ARA(I) 13
/
/
–
ARA(I) 14
/
/*
–
ARA(I) 15
/
/*
/*
ARA(I) 16
/
/
–
ARA(I) 17
/
/
–
ARA(I) 18
/
/
–
ARA(I) 19
/
/*
/*
ARA(I) 20
/
/
–
ARA(I) 21
/
/
–
Site A (sediment) ARA(II) 1
/
/
/
ARA(II) 2
/
/
–
ARA(II) 3
/
/
–
ARA(II) 4
/
/
–
ARA(II) 5
/
/
/
ARA(II) 6
/
/
/
ARA(II) 7
/
/
–
ARA(II) 8
/
/
–
Site B(soil)
ARB 1
/
/
–
ARB 2
/
/
–
ARB 3
/
/
–
ARB 4
–
–
–
ARB 5
/
/
–
ARB 6
/
/
–
ARB 7
/
/
–
ARB 8
/
/
–
ARB 9
/
/
–
ARB 10
/
/
–
ARB 11
/
/
–
ARB 12
/
–
–
ARB 13
/
/
–
ARB 14
/
/
–
ARB 15
/
/
–
ARB 16
/
/
/
Table II continued
Sampling site
and substratum
Isolate
Incubation temperature
4°C
28°C ± 2°C
37°C
Site B(soil)
ARB 17
/
/
/
ARB 18
/
/
–
ARB 19
/
/
–
ARB 20
/
/
–
ARB 21
/
/
–
ARB 22
/
/
–
ARB 23
/
/
–
ARB 24
/
/
–
ARB 25
/
/
–
ARB 26
/
/
–
ARB 27
/
/
/
Site C (soil)
ARC 1
/
/
–
ARC 2
/
/
–
ARC 3
/
/
–
ARC 4
/
/
–
ARC 5
/
/
–
ARC 6
/
/
–
ARC 7
/
/
–
/ Presence of growth – Absence of growth
* Blackening of the agar medium
in soil isolates from ARA (I), but not in the sediment
samples of ARA (II). The secretion of the brownish
pigment into the liquid and solid medium was analyzed through UV-Vis Spectrophotometer (UV-1800
Shimazdu) within the wavelength range of 300–800 nm
with acetone as the blank. The maximum absorbance
of light was measured at wavelength 320 nm, which is
the wavelength absorbance for UV-B region. This high
absorbance in UV-B region as well as the dark color of
pigment produced (brown) was similar with the characteristics property of melanin pigment (Sajjan et al.,
2010; Dastager et al., 2009). In case of sediment isolates
from Site A, three pigmented sediment isolates, namely
ARA(II) 1, ARA(II) 5 and ARA(II) 6, were capable
of good growth at 37°C (see Table II). They were not
included in the lipase screening process as well leaving
only five sediment isolates for further analyses.
In site B, three isolates (ARB 16, 17 and 27) were
eliminated because of their excellent growth at 37C (see
Table II). All three isolates were orange pigmented. Isolate ARB 4 failed to grow after subsequent subculturing.
Therefore only 23 isolates were subjected to subsequent
screening steps. All isolates from site C were subjected
for further lipase screening studies.
Plate screening for lipase. All 53 isolates selected
through temperature dependence study underwent
plate screening for lipase on olive oil agar plates that
used Rhodamine B as the fluorescent dye. Only six iso-
1
Table III
Lipase plate screening of positive isolates
Plate screening
Isolate
Tributyrin
agar
(1% v/v)
Triolein
agar
(1% v/v) +
Tween 20
(0.1% v/v)
Olive oil
agar
(1% v/v) +
Tween 20
(0.1% v/v)
Olive oil
agar
(1% v/v) +
Tween 20
(0.1% v/v)
ARA(I) 5
+
+
+
+
+
+
+
ARA(II)8+
ARB1+ + + –
ARB2+ + + –
ARB10+ +
+ –
ARC1+ + + +
+ Presence of halo zones – Absence of halo zones
lates were tested positive for lipase production which
were ARA(I) 5 from Site A, sediment isolate ARA(II)8
from Site A, isolate ARB1, ARB2, ARB10 from Site B,
and isolate ARC1 from Site C. Pictures of all the positive plates can be seen in Fig. 1. Their morphology
obtained through Gram staining is also given in Fig. 1.
Besides, the 16S rRNA blast results were also included.
Based on 16S rRNA analysis, lipase positive isolates
were dominated by Gram-negative bacteria and only
one Gram-positive (ARB1) was detected to produce
lipase. Isolate ARA(I)5, ARB2, ARB10 and ARC1 belong
to the Gammaproteobacteria group. Isolate ARA(II)8
which was also a Gram-negative bacterium belongs to
the Betaproteobacteria group. Isolate ARB1 was the only
Gram-positive isolate belonging to the Actinobacteria
phylum, which is a high G+C content bacterium. Low
percentage of similarities in some of the isolates suggested that some of the isolates might be new species.
In the plate screening method that was done using
tributyrin, triolein, olive oil and palm oil substrates,
some of the plates (refer Table III) includes addition of
Tween 20 that acted as inducers. Isolate ARB1, ARB2
and ARB10 failed to show the presence of halo zones
on palm oil agar plates.
Lipase assay. Lipase production was assayed by
using palm oil and olive oil. The results are given in
Fig. 2. Fig. 2 shows that four isolates – ARA (I) 5, ARA
(II) 8, ARB2 and ARB10 prefer olive oil rather than
palm oil as their substrate. ARB1 and ARC1 did not
follow this pattern, and these isolates utilize palm oil
better than olive oil up to 40% better in ARC1.
Discussion
Temperature dependence study. In the present
study, all of obtained isolates were psychrotrophs.
According to Markúsdóttir et al. (2013), psychrotrophs
can support growth at 0°C, but have an optimal growth
79
between 20°C to 30°C. In the present study, most of
the isolates grew faster at incubation temperature
28°C ± 2°C. However, the colonies that grew at 4°C
looked healthier. Isolates that are capable of withstanding a wider range of growth temperature are found in
environments that experience high seasonal and/or
diurnal temperature fluctuations, e.g. the sub-Arctic
regions (Markúsdóttir et al., 2013). On the contrary,
there are also cases of isolates from permanently cold
environments that have high proportion of psychrotrophs. For instance, a study on the diversity of culturable bacteria in Arctic sea ice from Spitzbergen fjords
revealed that most of the isolates were psychrotrophic
rather than obligate psychrophiles (Groudieva et al.,
2004). Sampling of the present study was conducted in
summer; therefore the thawed layer of soil/sediment
would select fast growing organisms capable of exploiting the moderate temperatures and higher nutrient
availability (de Pascale et al., 2012).
Plate screening for lipase. Tributyrin was a common substrate to confirm lipase activity in most studies.
However, in the present study, other longer chain fatty
acids substrates were incorporated for plate screening
besides the initial step that used fluorescent dye Rhodamine B to confirm lipase activities. This is due to the
fact that shorter chain tributyrin can also be a target of
the esterase enzyme. Lipase that possesses a broader
substrate range will not only hydrolyze tributyrin, but
other longer chain fatty acid substrates such as triolein, palm oil and olive oil. Unlike esterases, lipases
are known to attack emulsified form of insoluble longchain fatty acids substrate (Fojan et al., 2000). This characteristic is a consequence of the ‘interfacial activation’
phenomenon, where emulsions form caused enhancement of lipase activity (Tutino et al., 2009). Henne et al.
(2000) also reported that tributyrin positive clones were
unable to hydrolyze p-nitrophenyl esters during lipase
assay. This is a common attribute of the esterase enzyme.
Initially, all isolates screened with olive oil, palm
oil agar and triolein agar showed negative results.
Therefore, there is a need for inducers presence in the
medium. Tweens (polyoxyethylene esters) were found to
induce lipase production effectively in Candida rugosa,
but Tweens themselves do not act as carbon sources
(Zhang et al., 2003). Therefore Tween 20 was added
as inducers in plate screening with olive oil and palm
oil carbon sources in subsequent experiments and this
resulted in appearance of halo zones.
Lipase assay. Lipase activity is affected by the carbon length of the fatty acid and the number and position of the double bonds (Long, 2009). Olive oil with
the main component of unsaturated oleic acid possess
double bonds that can be broken and used easier than
palm oil with higher content of saturated palmitic acid
that might be harder to break. However, ARB1 and
80
Rasol R. et al.
1
1
81
Fig. 1. Lipase positive identified isolates on Olive oil + Rhodamine B agar
Fig. 2. Lipase activity on palm oil (light shade) and olive oil (dark shade)
ARC1, which grow better on palm oil, probably have
some properties that allow easy assimilation of saturated lipids. The nature of that process is unknown and
requires further investigations.
Morphology and molecular identification. Most
of the work done on bioprospecting at Arctic habitats
discovered higher numbers of Gram-negative strains
as compared to Gram-positive strains. Srinivas et al.
(2009) reported the isolation of 38 Gram-negative
strains and 9 Gram-positive strains. The low abundance
of Gram-positive was due to the fact that low temperature slowed down growth of Gram-positive isolates.
The Gram-negative strains in the present study were
dominated by pseudomonads. Männistö and Häggblom
(2006) also hypothesized that Pseudomonas sp. inhibits
the growth of certain Gram-negative bacteria.
The resulting isolates group of this present study as
determined by 16S rRNA analysis was in agreement
with most of bioprospecting work on Arctic environments, where Proteobacteria, CFB (Cytophaga-Flavobacterium-Bacteroidetes) group, low and high G + C
Gram-positive genera (Srinivas et al., 2009, Reddy et al.,
2009, Groudieva et al., 2004) predominates. In the present study, lipase producing isolates were dominated
by Proteobacteria; particularly Gammaproteobacteria
where four of the isolates were pseudomonads. Pseudomonads are well known for their metabolic versatility,
simple nutrient requirements and genetic adaptability
(Markúsdóttir et al., 2013). Most of the pseudomonads from this group bear closest similarities with Pseu
domonas fluorescens species group, a common isolate
found in cold habitats. Meyer et al. (2004) reported the
isolation of high numbers of Pseudomonas sensu stricto
genus in the cold alpine Colorado soil, in which P. fluo
rescens group falls into the main cluster.
In the present study, another group of betaproteobacteria, Janthinobacterium agaricidamnosum was also
found to produce lipase. Tindall et al. (2000) isolated
two strains of Janthinobacterium lividum (clusters 1a
and 1b) from a mat in Dry Valleys, Antarctica. Janthino
bacterium agaricidamnosum isolated from the present
study was related to Janthinobacterium lividum. These
are two well known species in the genus Janthinobacte
rium (Tindall 2004).
Psychrotrophic Arthrobacter strains were usually
found in the Arctic soils, different Antarctic environments and on various glaciers. They were also abundant
in subterranean cave slits (Margesin et al., 2004). Juck
et al. (2000) reported high G+C Gram-positive coldadapted microorganisms especially from the genera
Arthrobacter dominating hydrocarbon contaminated
soils; believed to play a role in hydrocarbon degradation.
Strong research interest in cold-active lipase has led
to efforts in cloning and expression of respective lipase
82
Rasol R. et al.
genes in the lab currently. Besides that, ecological significance of the lipase enzyme that was present in these
six isolates needs further investigation especially on the
soil composition of the sampling sites. This is due to the
need to discover the source and types of lipids used by
these isolates.
Acknowledgements
The authors wish to express their gratitude to Universiti Sains
Malaysia for financial support (grant no. 304/PBIOLOGI/6311118),
Universiti Teknologi MARA, Ministry of Science, Technology and
Innovation Malaysia and Ministry of Higher Education Malaysia
as well as to Mr Muhammad Adlan Abdul Halim for sampling aid.
We also thank the Department of Polar Research of the Institute of
Geophysics Polish Academy of Sciences for providing logistical support during the fieldwork, and the team at the Polish Polar Station
“Hornsund” for their hospitality and assistance. Funding for this
work was provided by the Polish Ministry of science and Higher
Education (within the program “Supporting International Mobility
of Scientists” and grant no. NN305376438 to JS), the Malaysia Antarctica Research Program (MARP) and University of Malaya (UM)
(OCAR TNC(P&I) 2011 Account No. (A-55001-DA000-B21520).
Literature
Ali S.H., S.A. Alias, H.Y. Siang, J. Smykla, K.-L. Pang, S.-Y. Guo
and P. Convey. 2013. Studies on diversity of soil microfungi in the
Hornsund area, Spitsbergen. Polish Polar Research 34(1): 39–54
Dastager S., W.-J. Li, A. Dayanand, S.-K. Tang, X.-P. Tian,
X.-Y. Zhi, L.-H. Xu and C.-L. Jiang. 2009. Seperation, identification and analysis of pigment (melanin) production in Streptomyces.
African Journal of Biotechnology 5(11).
de Pascale D., A.M. Cusano, F. Autore, E. Parrilli, G. di Prisco,
G. Marino and M.L. Tutino. 2008. The cold-active Lip1 lipase from
the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125 is
a member of a new bacterial lipolytic enzyme family. Extremophiles
12: 311–323
de Pascale D., C. de Santi, J. Fu and B. Landfald. 2012. The
microbial diversity of Polar environments is a fertile ground for
bioprospecting. Marine Genomics 8: 15–22
Eltaweel M.A., R.N.Z.R.A. Rahman, A.B. Salleh and M. Basri.
2005. An organic solvent-stable lipase from Bacillus sp. strain 42.
Annals of Microbiology 55(3): 187–192
Fojan P., P.H. Jonson, M.T.N. Peterson and S.B. Peterson. 2000.
What distinguishes an esterase from a lipase: a novel structural
approach. Biochimie 82: 1033–1041
Grouediva T., M. Kambourova, H. Yusef, M. Royter, R. Grote,
H. Trinks and G. Antranikian. 2004. Diversity and cold-active
hydrolytic enzymes of culturable bacteria associated with Arctic
sea ice, Spitzbergen. Extremophiles 8: 475–488.
Henne A., R.A. Schmitz, M. Bömeke, G. Gottschalk and
R. Daniel. 2000. Screening of Environmental DNA Libraries for the
Presence of Genes Conferring Lipolytic Activity on Escherichia coli.
Applied and Environmental Microbiology 66(7): 3113–3116
Jaeger K. and M.T. Reetz. 1998. Microbial lipases form versatile
tools for biotechnology. TibTech 16 : 396–403
Joseph B., P.W. Ramteke and G. Thomas. 2008. Cold active microbial lipases: Some hot issues and recent developments. Biotechnology
advances 26: 457–470
Juck D., T. Charles, L.G. Whyte and C.W. Greer. 2000. Polyphasic
microbial community analysis of petroleum hydrocarbon-contaminated soils from two northern Canadian communities. FEMS Micro
biology Ecology 33: 241–249
1
Kwon D.Y. and J.S. Rhee. 1986. A simple and rapid colorimetric
method for determination of free fatty acids for lipase assay. JAOCS
63: 89–92.
Leonov S.L. 2010. Screening for Novel Cold-active Lipases from
Wild Type Bacteria Isolates. Innovative Romanian Food Biotechno
logy 6 : 12–17.
Long K. 2009. Unlocking the miracle of lipases. Research Inaugural Lecture at Auditorium Mardi Serdang on the 22 October 2009.
Assessed on the 24 September 2012 from http://www.mardi.gov.
my/c/document_library/get_file?uuid=71e0d6b4-3661-4301-a994dff8272d8d56&groupId=10138.
Männistö M.K. and M.M. Häggblom. 2006. Characterization of
psychrotolerant heterotrophic bacteria from Finnish Lapland. Sys
tematic and Applied Microbiology 29: 229–243.
Margesin R., P. Schumann, C. Sproer and A.M. Gounot. 2004.
Arthrobacter psychrophenolicus sp. nov., isolated from an alpine ice
cave. International Journal of Systematic and Evolutionary Microbio
logy, 54: 2067–2072
Markúsdóttir M., S. Heiðmarsson, A. Eyþórsdóttir, K.P. Magnússon and O. Vilhelmsson. 2013. The natural and anthropogenic
microbiota of Glerá, a sub-arctic river in northeastern Iceland. Inter
national Biodeterioration and Biodegradation 84: 192–203.
Marsz A. and A. Styszyńska. 2007. Klimat rejonu Polskiej Stacji
Polarnej w Hornsundzie – stan, zmiany i przyczyny (Climate of
the Polish Polar Stadion in Hornsund – the state, changes and reasons). Wydawnictwo Akademii Morskiej w Gdyni, Gdynia: pp. 376
(in Polish)
Mayordomo I., F. Randez-Gil and J.A. Prieto. 2000. Isolation,
Purification, and Characterization of a Cold-Active Lipase from
Aspergillus nidulans. J. Agric. Food Chem. 48: 105–109.
Meyer A.F., D.A. Lipson, A.P. Martin, C.W. Schadt and
S.K. Schmidt. 2004. Molecular and metabolic characterization of
cold-tolerant alpine soil Pseudomonas sensu stricto. Applied Envi
ronmental Microbiology 70: 483–489.
Reddy P.V.V., S.S.S.N. Rao, M.S. Pratibha, B. Sailaja, B. Kavya,
R.R. Manorama, S.M. Singh, T.N.R. Srinivas and S. Shivaji. 2009.
Bacterial diversity and bioprospecting for cold-active enzymes from
culturable bacteria associated with sediment from a melt water
stream of Midtre Lovenbreen glacier, an Arctic glacier. Research in
Microbiology 160: 538–546.
Sajjan S., V. Yaligara and T. Karegoudar. 2010. Purification and
Physiochemical Characterization of Melanin Pigment from Klebsiella sp. GSK. Journal of Microbiology and Biotechnology 20(11),
1513–1520.
Sambrook J. and D.W. Russell. 2001. Molecular cloning: in laboratory manual. 3rd edition; Cold Spring Harbor Laboratory; New York.
Srinivas, T.N.R., S.S.S.N. Rao, P.V.V. Reddy, M.S. Pratibha,
B. Sailaja, B. Kavya, K. Hara Kishore, Z. Begum, S.M. Singh and
S. Shivaji. 2009. Bacterial Diversity and Bioprospecting for ColdActive Lipases, Amylases and Proteases, from Culturable Bacteria of
Kongsfjorden and Ny-Ålesund, Svalbard, Arctic. Current Microbio
logy 59: 537–547
Tindall B.J. 2004. Prokaryotic Diversity in the Antarctic: The Tip
of the Iceberg Microbial Ecology 47: 271–283
Tindall B.J., E. Brambilla, M. Steffen, R. Neumann, R. Pukall,
M.R. Kroppenstedt and E. Stackebrandt. 2000. Cultivatable micro
bial biodiversity: gnawing at the Gordian knot. Environmental Micro
biology 2(3): 310–318
Tutino M.L., G. Prisco, G. Marino and D. Pascale. 2009. Coldadapted esterases and lipases : From fundamentals to application.
Protein and Peptide Letters 16: 1172–1180.
Yu Y., H. Li, Y. Zeng and B. Chen. 2009. Extracellular enzymes
of cold-adapted bacteria from Arctic sea ice, Canada Basin. Polar
Biology 32:1539–1547
Zhang L.Y., D.Z. Wei and W.Y. Tong. 2003. Effective inducers for
lipase production by Candida rugosa. Annals of Microbiology 53 (4):
499–504
2014, Vol. 63, No 1, 83–88
ORIGINAL PAPER
Plant Growth Promotion Rhizobacteria in Onion Production
JOSIP ČOLO1, TIMEA I. HAJNAL-JAFARI2*, SIMONIDA ĐURIĆ2,
DRAGANA STAMENOV2 and SAUD HAMIDOVIĆ1
1
Faculty of Agricultural and Food Sciencies, Bosnia and Herzegowina
2
Faculty of Agriculture, University of Novi Sad, Novi Sad, Serbia
Submitted 18 June 13, revised 14 September 2013, accepted 16 November 2013
Abstract
The aim of the research was to examine the effect of rhizospheric bacteria Azotobacter chroococcum, Pseudomonas fluorescens (strains 1
and 2) and Bacillus subtilis on the growth and yield of onion and on the microorganisms in the rhizosphere of onion. The ability of microorganisms to produce indole-acetic acid (IAA), siderophores and to solubilize tricalcium phosphate (TCP) was also assessed. The experiment
was conducted in field conditions, in chernozem type of soil. Bacillus subtilis was the best producer of IAA, whereas Pseudomonas fluores
cens strains were better at producing siderophores and solubilizing phosphates. The longest seedling was observed with the application of
Azotobacter chroococcum. The height of the plants sixty days after sowing was greater in all the inoculated variants than in the control. The
highest onion yield was observed in Bacillus subtilis and Azotobacter chroococcum variants. The total number of bacteria and the number
of Azotobacter chroococcum were larger in all the inoculated variants then in the control. The number of fungi decreased in most of the
inoculated variants, whereas the number of actinomycetes decreased or remained the same.
K e y w o r d s: growth and yield of onion, PGP rhizobacteria, rhizospheric microorganisms
Introduction
Plant growth promoting rhizobacteria (PGPR)
affect plant growth directly or indirectly by producing growth substances such as indole-acetic acid, gibberelic acid and cytokinins (Verma et al., 2010; Garcia
de Salamone et al., 2001), fixing dinitrogen from the
atmosphere and providing the plant with this element
(Boddey and Dobereiner, 1995) and by being antagonistic towards phytopathogenic microorganisms
(Velivelli et al., 2012). In recent decades, different PGPR
have been studied, including nitrogen-fixing bacteria
from Azotobacter genus and bacteria which produce
growth substances and act as antagonists, such as Bacil
lus and Pseudomonas (McSpadden-Gardener, 2004;
Benizri et al., 1998). The interaction between rhizobacteria and plants is not always stable in nature, thus
positive results obtained in controlled conditions cannot always be replicated in field conditions (Jarak et al.,
2012). The effect of PGPR varies as a result of environmental factors, which may affect both the growth
of bacteria and the plant. The effect of the introduced
bacteria also depends on plant physiology and agronomic conditions of cultivation. In order to achieve
an optimum interaction between rhizobacteria and
the plant root, it is necessary to examine the way in
which rhizobacteria affect the plant and microorganisms in soil and whether this influence changes due to
environmental factors, including the presence of other
microorganisms, as well (Stamenov et al., 2012a).
Onion (Allium cepa) is an important vegetable plant.
Due to its high adaptability, there are numerous populations and varieties of onion grown under various environmental conditions. Onion contains a large amount
of carbohydrates and a small amount of proteins and
fats. The biological value of onion lies in its mineral
substances and vitamins. Apart from a significant
amount of mineral salts, especially potassium and sulphur salts, and different oligoelements, onion abounds
in vitamins (B1, B2, C, E, K), carotene (provitamin A),
glycosides, etheric oils, plant hormones similar to insulin, as well as bacteriostatics (Slimestad et al., 2007). The
root system of onion has low absorbing and penetrating
abilities, therefore it requires an ample amount of easily accessible nutrients in the root zone. The amount
of easily accessible nutrients which is necessary for
optimum yield is 60–140 kg N, 60–120 kg P2O5 and
60–180 kg K2O per hectare (Kumar, 2001). Recently,
* Corresponding author: T.I. Hajnal-Jafari, Department of Microbiology, Faculty of Agriculture, Dositeja Obradovica Sq. No. 8; phone:
+381 21 4853 425; e-mail: [email protected]
84
Čolo J. et al.
plant growth promoting rhizobacteria (PGPR) have
come into focus as bacteria which can provide a part
of necessary nutrients.
The aim of the study was to examine the effect
of PGPR Bacillus subtilis, Pseudomonas fluorescens
and Azotobacter chroococcum on germination, growth
and yield of onion, as well as on the microbiological
activity in the rhizosphere during the vegetation period
of onion.
Experimental
Bacterial strains. The bacteria used in the study
included Azotobacter chroococcum, Pseudomonas fluo
rescens strain 1, Pseudomonas fluorescens strain 2 and
Bacillus subtilis (from Department of Microbiology,
Faculty of Agriculture, Novi Sad, Serbia). The microorganisms were propagated in appropriate nutrient media
(Handbook of Microbiological Culture Media, 2000):
Azotobacter chroococum in nitrogen-free medium with
mannitol, Pseudomonas fluorescens in King B medium
(Himedia, India), and Bacillus subtilis in nutrient agar
(NA) (Torlak, Serbia).
Indole-acetic acid (IAA) production. IAA production was examined using Gordon and Weber method
(Gordon and Weber, 1951). Using Salkowski reagent
(1 ml 0.5 M FeCl3 in 50 ml 35% HClO4) the production
of IAA in a medium containing 0, 200 and 500 µg/ml
of L-tryptophane was determined. The volumes of
100 µl of 24 h bacterial culture (standardized to OD600
of 0.625), were introduced into 100 ml of liquid media:
Pseudomonas into King B medium, Bacillus into NA
medium and Azotobacter into nitrogen-free medium
with mannitol. After 24 h and 48 h, incubation at 28°C,
5 ml of the suspension was centrifuged at 1,957 × g
for 15 minutes. An amount of 2 ml of Salkowski reagent was added into 1 ml of supernatant. Twenty-five
minutes later, the intensity of the development of pink
colour was measured at 530 nm.
Phosphate solubilization. The ability of isolates to
solubilize tricalcium phosphate (TCP) (CaCO3(PO4)2)
was investigated in a Pikovskaya medium (amount g
l–1: KCl 0.2 g, MgSO4 × 7H2O 0.1 g, glucose 10 g, yeast
extract 0.5 g, FeSO4 × 7H2O 0.002 g, MnSO4 × H2O
0.002 g, (NH4)2 SO4 0.5 g, Ca3(PO4)2 5 g). An amount
of 1 ml bacterial culture, respectively (standardized
to OD600 of 0.625) was introduced into the cooled
medium, poured into a Petri dish and carefully mixed.
After five days of incubation at the temperature of 28°C,
transparent zones around the colonies were measured.
Siderophore production. The ability of siderophore production was determined by the method
1
of Milagres et al. (1999), using chrome azurol agar
(CAS agar). Appropriate nutrient media for Bacil
lus, Pseudomonas and Azotobacter were poured into
Petri dishes. After they had solidified, the media were
cut into halves and one half was removed. CAS agar
was poured into the empty halves of the Petri dishes.
The bacteria were introduced into the halves with the
nutrient medium. The incubation lasted five days at
the temperature of 28°C. In those strains which produce siderophores, the blue-green colour of CAS agar
turned into orange along the demarcation line between
the two media.
Field experiment. The experiment was conducted
in Backi Brestovac (Vojvodina, Serbia), in carbonate
chernozem soil. The soil was characterized by the following properties: pH in H2O : 8.06, pH in KCl: 7.19, %
CaCO3 : 4.62, % humus: 2.63, % N: 0.13, mg P2O5/100 g
soil: 22.27, mg K2O/100 g soil: 18.12. The experimental design was a randomized, complete block with four
replications. The size of the experimental plots was
10 m2 (10 m long, 1 m wide). The sowing was performed
on 12 March, 2012. The spacing in a row was 5 cm and
25 cm between the rows.
Bacterial treatments. The onion seed (Damascus
f1 hybrid, Holland) was inoculated with four bacterial
strains: 1. Azotobacter chroococcum; 2. Bacillus subtilis;
3. Pseudomonas fluorescens, strain 1; 4. Pseudomonas
fluorescens, strain 2; and with a mixture of strains Azo
tobacter chroococcum + Bacillus subtilis + Pseudomonas
fluorescens, strain 1+ Pseudomonas fluorescens, strain 2
(ratio 1 : 1 : 1 : 1). The control was not inoculated. An
amount of 50 ml of the inoculum having the density
of 108/ml was introduced into 200 g of sterile peat.
The inoculated peat was applied into rows, directly to
the onion seed. Standard agrotechnical practices were
applied during the vegetation period.
The effect of inoculation on onion growth. The
germ growth was observed five and ten days after the
inoculation. The onion seeds were washed with sterile tap water and placed on plastic trays with a moist
filter paper. The trays were covered and placed to the
incubator at 28°C. After 48 hours the shoots of equal
length were selected. The onion roots were dipped into
a bacterial suspension (108 CFU/ml) for 1.5 hours. In
the control the roots were moistened in sterile water.
Then the onion seedlings were placed on the tray with
a moist filter paper, covered and incubated at 28°C.
After five and ten days the length of the roots and the
shoots was measured.
The plant height and the dry mass were measured
three months after the sowing (the phase of 5–6 leaves).
The bulb size and the bulb weight were measured three
months after the sowing and at the end of the vegetation period (early August). The onion yield (t/ha) was
determined at the end of the vegetation period.
1
85
Onion growth promotion by rhizobacteria
The effect of inoculation on the microbial population in the rhizosphere of onion. The rhizospheric soil
was sampled for the purpose of microbial analysis 30,
90 and 150 days after sowing. The number of microorganisms was determined by the method of agar plates
in the appropriate nutrient medium: The total microbial count was performed in soil agar, (dilution 10–6),
the fungi in potato-dextrose agar (Hy media) (dilution
10–4), the number of actinomycetes in Krasiljnikov agar
(Hy media) (dilution 10–5), the total number of bacteria
in nutrient agar (NA) (Torlak, Belgrade) (dilution 10–6)
and the number of azotobacter in Fiodorov medium
(Hy media) (dilution 10–2). All microbial analyses were
performed in three replications and the average number for all three samplings was calculated per 1.0 g of
absolutely dry soil.
Data analysis. Statistical analysis was performed
by using the statistical software STATISTICA, version
12.0 (Hamburg, Germany). The significance of each
treatment was established by one way ANOVA and the
means were separated by Fisher’s test (P ≤ 0.05).
Results and Discussion
Indole-acetic acid (IAA) production. Indole-acetic acid (IAA) is the main auxin in plants, controlling
many important physiological processes including cell
enlargement and division, tissue differentiation, and
responses to light and gravity. Diverse bacterial species
(Bacillus spp, Streptomyces sp., Rhizobium sp., Azoto
bacter, Pseudomonas) possess the ability to produce IAA
(Ahmad et al., 2005). According to Loper and Schorth
(1986), 80% of bacteria isolated from the rhizosphere
are capable of producing IAA. In our research, all the
strains were producing IAA. The best production was
observed after 48 hours of incubation in the presence of
500 µg/ml of L-tryptophan (Table I). The best producer
of IAA was Bacillus subtilis.
Phosphate solubilization and siderophore production. Phosphorus is found in soil in its organic and inorganic compounds. PGPR play a role in transforming
inaccessible compounds (both organic and inorganic)
into forms accessible to plants. Bacterial strains belonging to the genera Pseudomonas, Bacillus, Rhizobium,
Azotobacter, Achromobacter, Agrobacterium, Micrococcus, Aerobacter, Flavobacterium and Erwinia are
capable of solubilizing insoluble phosphate compounds
such as tricalcium phosphate and dicalcium phosphate (Rodriguez and Fraga, 1999). Our research has
shown that both Pseudomonas fluorescens strains are
better TCP solubilizers than Bacillus and Azotobacter
(Table II). Ravindra Naik et al., (2008) tested 443 strains
of Pseudomonas. Their research showed that 80 strains
(18%) produced phosphate solubilization on Pikov
skaya’s agar medium by inducing clear zones. Fluo
rescent pseudomonad strains have also been reported
as phosphate solubilizers due to the excretion of organic
acids by many other researchers (Bano and Musarrat,
2004; Cattelan et al., 1999; Pandey and Palani, 1998).
Siderophores are high-affinity Fe3+ chelating compounds. In cases when accessible iron is lacking, plants
and microorganisms produce siderophores which take
Fe3+ out of its componds, bind it and form a Fe3+ siderophore complex. This complex is transported to the surface of a bacterial cell or root cells, transported into
the cell and reduced to Fe2. Plants are capable of binding the bacterial Fe3+ siderophore complex, thus PGPR
help in providing the plant with iron (Kalinowski et al.,
2000). It has been proved that a large number of rhizo
spheric microorganisms, including Bacillus subtilis,
Pseudomonas sp. and Azotobacter sp., produce siderophores (Jankiewicz, 2006, Jarak et al., 2012). In this
research, Pseudomonas fluorescens strains were better
siderophore producers (Table II). This is in accordance
to investigation of Djurić et al. (2011). In their work,
three siderophore-producing isolates of Pseudomonas
fluorescens were detected. Parani and Saha (2012) also
proved the existence of three siderophore producing
Pseudomonas strains.
Onion growth. As PGPR produce plant hormones,
the use of these bacteria usually enhances germination and early plant growth. In this research, the seed
inoculation affected onion germination and growth
Table I
Indole-acetic acid (IAA) production (µg IAA/ml)
Microorganisms
after 24 h
L-tryptophan µg/ml
0
200
after 48 h
L-tryptophan µg/ml
500
0
200
500
Pseudomonas fluorescens 12.42 5.39 7.07 5.32 12.82 12.93
Pseudomonas fluorescens 21.93 3.18 3.25 7.06
Bacillus subtilis
Azotobacter chroococcum
7.68 11.00
12.07 19.7520.5316.93 26.8931.71
3.73 6.238.285.56 9.3210.4
The datas are mean values of three repetitions.
86
1
Čolo J. et al.
Table II
Phosphate solubilization and siderophore production
Microorganisms
Phosphate
solubilization
(halo zonesmm/5 day)
Siderophore
production
(halo zonesmm/5 day)
Pseudomonas fluorescens 17.34
6.70
Pseudomonas fluorescens 29.55
7.50
Bacillus subtilis
5.655.20
4.503.50
Germ length (mm)
5 days
10 days
8.9011.80
Bacillus subtilis
8.408.90
Pseudomonas fluorescens 1
6.00
10.20
Pseudomonas fluorescens 2 6.20
9.60
Mixture
6.908.40
Control
4.909.10
LSD 0.05
1.22
1.25
The datas are mean values of ten repetitions.
Table IV
The effect of PGPR on the onion growth sixty days after
inoculation
Treatment
Length of Mass of
the above the above
ground
ground
part (cm) part (g)
Bulb
mass
(g)
1. Azotobacter chroococcum
44.0029.00 2.26
2. Bacillus subtilis
46.0027.56 1.86
3. Pseudomonas fluorescens 1
44.66
20.96
2.20
4. Pseudomonas fluorescens 2
45.16
15.00
2.36
5. Mixture
35.96
30.56
1.16
6.Control
32.8024.80 2.20
LSD 0.05
6.51
12.95
Treatment
Bulb
diameter
(cm)
Bulb
mass
(g)
Yield
(t/ha)*
7.33173.6634.73
Bacillus subtilis
7.00144.0028.80
7.66
111.33
22.26
6.80
121.66
24.33
Mixture
7.33130.0026.00
Control
6.33 88.0017.60
LSD 0.05
1.40
35.52
7.10
* calculated value
Table III
The effect of PGPR on the germ length of onion
Treatment
Table V
The effect of PGPR on the bulb size and onion yield
1.18
(Table III, Table IV). Five days after the inoculation, the
seedling was longer in all the inoculated variants than
in the control, whereas ten days after the inoculation,
the stimulating effect was visible in the variants with
Azotobacter chroococcum and Pseudomonas fluorescens
strains. Sixty days after the inoculation the length of the
part above the ground was greater in all the inoculated
variants than in the control. The fresh mass of the part
above the ground was smaller in the variants inocu-
lated with Pseudomonas fluorescens strains, whereas the
fresh mass of the bulb was greater in all the inoculated
variants (apart from the variant with the mixture of
strains). However, the increase was not statistically significant. This could be explained by the high variability
of the data within treatments. The effect of the treatments was not strong enough to produce a statistically
significant result.
Similar results were shown by Jarak et al. (2006) who
reported a better germ development and early growth
of alfalfa and red clover with the use of azotobacter,
rhizobia and actinomycetes. Similarly, Stamenov et al.
(2012b) reported that PGPR enhance the growth of
English ryegrass. Joo et al. (2005) inoculated the pepper
seed with Penibacillus polymyxa and Bacillus subtilis. In
all the inoculated variants, the length and the mass of
the above ground part and root significantly increased.
Onion yield. At the end of the vegetation period,
onion bulbs were taken out and their size and yield
were measured (Table V). The bulb diameter was larger
in all the inoculated variants but the increase was of no
statistical significance. The bulb weight and the yield
significantly increased in the variants with Azoto
bacter chroococcum, Bacillus subtilis and the mixture
of the inoculants. Both Azotobacter chroococcum and
Bacillus subtilis take part in other important processes
apart from promoting plant growth. Azotobacter
can fix 60–80 kg N/ha and thus partly provide the plant
with this element (Yanni and El-Fattah, 1999, Kennedy
et al., 2004), whereas Bacillus subtilis is a bioagent
against phytopathogenic fungi (Kloepper et al., 2004).
These properties certainly promote plant growth and
increase onion yield. The use of azotobacter results in
an increased yield of other plant species, too. Kumar
et al. (2001), and Hajnal Jafari et al. (2012) reported that
the use of azotobacter led to an increased yield of wheat
and maize. The research conducted in field experiments
by Mrkovacki et al. (2012) showed that inoculation of
sugar beet with Azotobacter chroococcum resulted in an
1
87
Onion growth promotion by rhizobacteria
Table VI
The effect of PGPR on the number of microorganisms in the onion rhizosphere
Treatment
Bacillus subtilis
TN 106g–1
TB 106g–1
AC 105g–1
F 104g–1
AZ 102g–1
329.00249.9011.94 3.05 168.01
1069.901227.28 26.05 24.72 153.05
63.94
1039.75
11.51
4.80
106.06
Pseudomonas fluorescens 2 439.82
995.24
29.92
10.33
115.34
Mixture
663.661029.96 24.99
Control
165.40 95.5723.79 14.34 70.20
LSD 0.05
196.55
215.80
6.08
3.61 109.50
3.50
29.42
TN – total number of microorganismas; TB – total number of bacteria;
AC–number of actinomycetes; F–number of fungi; AZ–number of azotobacter
increased root yield and amount of extractable sucrose
from the sugar beet. Nieto and Frankenberger (1991)
investigated the effect of Azotobacter chroococcum
on the morphology and growth of maize in vitro, in
a greenhouse and in the field, and concluded that the
plant growth was enhanced thanks to hormone production by azotobacter.
Microbial population in onion rhizosphere. The
microbial diversity in the rhizosphere depends on root
exudates, soil properties, agrotechnical measures and
ecological factors. In this research, the number of the
investigated groups of microorganisms was large and
typical of fertile soils such as chernozem (Table VI).
Plants exude various organic and inorganic substances through their roots into the rhizosphere. The
larger the number of monosaccharides and easily disintegrable organic acids in the rhizosphere, the larger
the number of rhizospheric microorganisms. Onion
roots exude aminoacids, sugars and organic acids
which influence positively the rhizosphere (Tawaraya
et al., 1995) creating favorable conditions for different
microorganisms. Introducing microbiological fertilizers into soil can change the number and species of the
indigenous microbial population. In this research, the
total number of microorganisms (apart from treatment
with Pseudomonas fluorescens strain 1), the total number of bacteria and the number of azotobacter increased
in all the inoculated variants (Table VI). The number
of fungi decreased in most of the inoculated variants,
whereas the number of actinomycetes decreased or
remained the same.
In conclusion, we demonstrated that the applied
microorganisms produce IAA and siderophores and
solubilize TCP. Azotobacter chroococcum is also capable of fixing atmospheric nitrogen. Bacillus subtilis has
an antagonistic effect on phytopathogenic fungi and
Pseudomonas fluorescens produces other biologically
active substances such as hydrogen cyanide (HCN) and
gibberellins. Some Pseudomonas fluorescens strains are
used as biocontrol agents because they protect plant
roots from phytopathogenic fungi such as Fusarium
and Pythium. The introduction of these microorganisms into the rhizosphere leads to activation of useful
microbiological processes, increase in the number of
bacteria and decrease in the number of fungi. These
PGPR species are already being used in the production of wheat, maize, sugar beet, rice, pepper, tomato,
cucumber etc. The obtained results have shown that
PGPR can also be used in onion production.
Acknowledgements
This research is part of a project TD31027 financed by the Ministry of education and science, Republic of Serbia.
Literature
Ahmad F., I. Ahmad and M.S. Khan. 2005. Indole acetic acid production by the indigenous isolates of Azotobacter and fluorescent
Pseudomonas in the presence and absence of tryptophan. Turk.
J. Biol. 29: 29–34.
Bano N. and J. Musarrat. 2004. Characterization of a novel carbo
furandegrading Pseudomonas sp. with collateral biocontrol and
plant growth promoting potential. FEMS Microbiol Lett. 231: 13–17.
Benizri E., A. Courtade, C. Picard and A. Gucker t. 1998. Role of
maize root exudates in the production of auxins by Pseudomonas
fluorescens M.3.1. Soil Biol. Biochem. 30: 1481–1484.
Boddey R.M. and J. Dobereiner. 1995. Nitrogen fixation associated
with grasses and cereals: recent progress and perspectives for the
future. Fert. Res. 42: 241–250.
Cattelan A.J., P.G. Hartel and F.F. Furhmann. 1999. Screening
for plant growthpromoting rhizobacteria to promote early soybean
growth. Soil Sci. Soc. Am. J. 63: 1670–1680.
Djurić S., A. Pavić, M. Jarak, S. Pavlović, M. Starović, R. Pivić and
D. Jošić. 2011. Selection of indigenous fluorescent pseudomonad
isolates from maize rhizospheric soil in Vojvodina as possible PGPR.
Romanian Biotechnol. Lett. 16 (5): 6580–6590.
García de Salamone I.E., R.K. Hynes and L.M. Nelson. 2001.
Cytokinin production by plant growth promoting rhizobacteria
and selected mutants. Can. J. Mcrobiol. 47: 404–411.
Gordon S.A. and R.P. Weber. 1951. Colorimetric estimation of
indoleacetic acid. Plant Physiol. 26: 192–197.
88
Čolo J. et al.
Hajnal-Jafari T., D. Latković, S. Djurić, N. Mrkovački and
O. Najdenovska. 2012. The use of Azotobacter in organic maize
production. Research. J. Agricultural. Sci. 44(2): 28–32.
Handbook of Microbiological Culture Media (International Ed.).
2000. Scharlau Microbiology, Barcelona, Spain.
Jankiewicz U. 2006. Syntesis of siderophores by soil bacteria of the
genus Pseudomonas under various culture conditions. Acta Sci. Pol.
Agricultura 5: 33–44.
Jarak M., D. Đukić and J. Čolo. 2006. The effect of bacterization
and liming in the production of red clover. Grassland Science in
Europe 11: 291–293.
Jarak M., N. Mrkovački, D. Bjelić, D. Jošić, T. Hajnal-Jafari and
D. Stamenov. 2012. Effects of plant growth promoting rhizobacteria
on maize in greenhouse and field trial. African J. Microbiol. Research
6: 5683–5690.
Jarak M., S.Đurić and J. Čolo. 2007. The effect of rhizobia, Azoto
bacter and Actinomycetes on the early growth of alfalfa and red
clover. Book of Abstracts Power of microbes in Idustry and Environ
ment, Zadar, Croatia p. 10.
Joo G.J., Y.M. Kin, J.T. Kim, I.K. Rhee, J. Kim and I.J. Lee. 2005.
Gibberellins producing rhizobacteria increase endogenous gibberellins content and promote growth of red peppers. J. Microbiol. 43:
510–515.
Kalinowski B.E., L.J. Liermann, S. Givens and S.L. Brantley.
2000. Rates of bacteria-promoted solubilization of Fe from minerals: a review of problems and approaches. Chemical Geology 169:
357–370.
Kennedy I.R., A.I.M.A. Choudhury and M.L. KecSkes. 2004. NonSymbiotic bacterial diazotrophs in crop-farming systems: can their
potential or plant growth promotion be better exploited? Soil Boil.
Biochem. 36: 1229–1244.
Kloepper J.W., C.M. Ryu and S. Zhang. 2004. Induced systemic
resistance and promotion of plant growth by Bacillus spp. Phytopa
thology 94: 1259–1266.
Kumar A. 2001. Influence of nitrogen and potassium application
on growth, yield and nutrient uptake by onion (Allium cepa). Indian
J. Agronomy 46: 742–746.
Kumar V., R.K. Behl and N. Narula. 2001. Establishment of
phosphate-solubilizing strains of Azotobacter chroococcum in the
rhizosphere and their effect on wheat cultivars under green house
conditions. Microbiol. Res. 156: 87–93.
Loper J.E. and M.N. Schroth. 1986. Influence of bacterial sources
of indole-3-acetic acid on root elongation of sugarbeet. Phytopatho
logy 76: 386–389.
McSpadden-Gardener B.B. 2004. The nature and application of biocontrol microbes: Bacillis spp. ecology of Bacillus and Paenibacillus
spp. in agricultural systems. Phytopathology 94: 661–664.
1
Milagres A.M.F., A. Machuca and D. Napoleao. 1999. Detection of
siderophore production from several fungi and bacteria by a modification of chrome azurol S (CAS) agar plate assay. J. Microbiol.
Methods 37: 1–6.
Mrkovacki N., S. Mezei, L. Kovacev, D. Bjelic, M. Jarak, S. Tyr
and T. Veres. 2012. Effect of Azotobacter chroococcum application
on production characteristics of sugar beet and microorganisms in
sugar beet rhizosphere. Listy cukrovarnicke a reparske 128: 50–55.
Nieto K.F. and W.T. Frankenberger Jr. 1991. Influence of adenine,
isopentylalcohol and Azotobacter chroococcum on the vegetative
growth of Zea mays. Plant Soil 135: 213–221.
Pandey A. and L.M.S. Palani. 1998. Isolation of Pseudomonas cor
rugata from Sikkim himalayas. World J. Microbiol. Biotechnol. 14:
411–413.
Parani K. and B.K. Saha. 2012. Prospects of using phosphate solubilizing Pseudomonas as Bio Fertlizer. European J. Biol. Sci. 4(2):
40–44.
Ravindra Naik P., R. Gurusamy, K.B. Narayanan and S. Natarajan.
2008. Assessment of genetic and functional diversity of phosphate
solubilizing fluorescent pseudomonads isolated from rhizospheric
soil. BMC Microbiol. 8: 230.
Rodríguez H. and R. Fraga. 1999. Phosphate solubilizing bacteria and their role in plant growth promotion. Biotechnol. Adv. 17:
319–339.
Slimestad R., T. Fossen and I.M. Vågen. 2007. Onions: a source
of unique dietary flavonoids. J. Agric. Food Chem. 55 (25):
10067–10080.
Stamenov D., M. Jarak, S. Djurić, T. Hajnal-Jafari and S. Andjel
ković. 2012a. The effect of azotobacter and actinomycetes on
the growth of english ryegrass and microbiological activity in its
rhizosphere. Research J. Agricultural. Sci. 44: 93–99.
Stamenov D., M. Jarak, S. Đurić, D. Milošev and T. Hajnal-Jafari.
2012b. Plant growth promoting rhizobacteria in the production of
English ryegrass. Plant Soil Environ. 58 (10): 477–480.
Tawaraya K., S. Watanabe, E. Yoshida and T. Wagatsum. 1995.
Effect of onion (Allium cepa) root exudates on the hyphal growth
of Gigaspora margarita. Mycorrhiza 6: 57–59.
Velivelli S., E. O’Herlihy, B. Janczura, J. Ghyselinck and P. De Vos.
2012. Efficacy of Rhizobacteria on plant growth promotion and
disease suppression in vitro. Acta Horticulturae. 961: 525–532 .
Verma P., J. Yadav, K. Nath, T. Lavakush and V. Singh. 2010.
Impact of Plant Growth Promoting Rhizobacteria on Crop Production. International J. Agricultural Research 5: 954–983.
Yanni Y.G. and F.K.A. El-Fattah. 1999. Towards integrated biofertilization management with free living and associative dinitrogen
fixers for enhancing rice performance in the Nile delta. Symbiosis
27: 319–331.
2014, Vol. 63, No 1, 89–93
ORIGINAL PAPER
The Prevalence of Anaplasma phagocytophilum in Questing Ixodes ricinus Ticks
in SW Poland
DOROTA KIEWRA1*, GRZEGORZ ZALEŚNY2 and ALEKSANDRA CZUŁOWSKA1
Department of Microbial Ecology and Environmental Protection,
Institute of Genetics and Microbiology, University of Wroclaw
2
Department of Invertebrate Systematics and Ecology, Institute of Biology,
Wroclaw University of Environmental and Life Sciences
1
Submitted 9 July 2013, revised 4 October 2013, accepted 16 November 2013
Abstract
Ticks constitute important vectors of human and animal pathogens. Besides the Lyme borreliosis and tick-borne encephalitis, other pathogens such as Babesia spp., Rickettsia spp., and Anaplasma phagocytophilum, are of increasing public health interest. In Poland, as in other
European countries, Ixodes ricinus, the most prevalent tick species responsible for the majority of tick bites in humans, is the main vector
of A. phagocytophilum. The aim of the study was to estimate the infection level of I. ricinus with A. phagocytophilum in selected districts, not
previously surveyed for the presence of this agent. Sampling of questing ticks was performed in 12 forested sites, located in four districts
(Legnica, Milicz, Lubań, and Oława) in SW Poland. Altogether, 792 ticks (151 females, 101 males, and 540 nymphs) representing I. ricinus
were checked for the presence of A. phagocytophilum. The average infection level was 4.3%, with higher rate reported for adult ticks. The
highest percentage of infected adults was observed in Milicz (17.4%) and the lowest in Oława (6.8%). The abundance of questing I. ricinus
in all examined sites as well as the infection with A. phagocytophilum indicate for the first time the risk for HGA transmission in SW Poland.
K e y w o r d s: Anaplasma phagocytophilum, Ixodes ricinus, Poland
Introduction
The geographical range of tick-borne diseases
(TBD), identification of new pathogens, as well as the
increase of TBD incidence makes TBD a serious public health problem. Besides Lyme borreliosis and tickborne encephalitis, which are monitored in Poland,
other TBD caused by Babesia spp., Rickettsia spp., and
Anaplasma phagocytophilum, are of increasing public
health interest.
Anaplasma phagocytophilum, a small gram-negative
obligate intracellular alfaproteobacteria, is a tick-borne
rickettsial bacterium that replicates in mammalian
granulocytes but also in the salivary gland and midgut
cells of ticks (Rikihisa, 2011). It causes human granulocytic anaplasmosis (HGA), previously known as human
granulocytic ehrlichiosis (HGE), but also the disease in
horses, dogs, sheep, and cats (Rar and Golovljova, 2011;
Severo et al., 2012). HGA is an emerging disease with
varying symptoms, from asymptomatic seroconversion
to non-specific symptoms like fever, malaise, myalgia
and headache, up to fatal disease (Dumler et al., 2005;
Zwoliński et al., 2007; Rar and Golovljova 2011). The
majority of confirmed HGA cases, including the first
case of HGA recorded in the early 1990s (Rikihisa,
2011), have been reported from the USA. In Europe,
the prevalence of HGA infection is significantly lower,
although human cases have been accounted for the
majority of European countries, including Poland
(Tylewska-Wierzbanowska et al., 2001; Grzeszczuk et al.,
2009; Rikihisa, 2011).
Anaplasma phagocytophilum DNA has been detected
in several species of hard ticks (Ixodes scapularis, I. paci-
ficus, I. spinipalpis, I. ricinus, I. persulcatus, I. trianguli
ceps, I. ventalloi, I. ovatus, Dermacentor silvarum) in the
United States, Europe, and Asia (Rar and Golovljova
2011; Rikihisa, 2011). In Poland, but also all over
Europe, I. ricinus, the most prevalent tick species
responsible for the majority of tick bites in humans, is
the main vector of A. phagocytophilum. I. ricinus has
a three-host live cycle: larvae and nymphs feed mostly
on small to medium-sized animals, and adults prefer large-sized mammals. Ticks (larvae, nymphs, or
adults) acquire A. phagocytophilum from infected hosts
* Corresponding author: D. Kiewra, Department of Microbial Ecology and Environmental Protection, Institute of Genetics and
Microbiology, University of Wroclaw; e-mail: [email protected]
90
1
Kiewra D. et al.
through a blood meal, and they can maintain the bacterium through subsequent moultings (transstadial passage), but not by transovarial transmission (Rikihisa,
2011). In Europe, a wide range of mammalian species is
infected with A. phagocytophilum (Rar and Golovljova,
2011). However, it is worth noting that the zoonosis
potential and host infectivity of A. phagocytophilum
depend on genetic variations of strain, due to the host
tropism of this bacterium (Severo et al., 2012). Thus,
humans are susceptible to limited strains only. The wild
host reservoir for strains that infect humans (Ap-ha)
is poorly known (Massung et al., 2002; Rikihisa, 2011;
Michalik et al., 2012).
The aim of the study was to estimate the infection
level of I. ricinus with A. phagocytophilum in selected
districts of Lower Silesia, SW Poland, not hitherto surveyed for the presence of this agent.
PCR product for nested-PCR. The positive control contained Anaplasma DNA from a diagnostic kit, whereas
the negative control contained sterile water. The amplification was performed in a BioRad T100TM Thermal
Cycler. The amplification included initial denaturation
for 2 min at 95°C, subjected to 40 cycles (for a second
reaction 30 cycles) of 30 s denaturation at 94°C, 30 s for
the annealing reaction at 55°C, 60 s extension at 72°C
and final extension for 5 min at 72°C. The separation
of the nested PCR products was carried out on a 1.5%
agarose gel with the addition of ethidium bromide
in the TBE buffer. Product of 546 bp was regarded as
a positive result.
Statistical analysis. The results were analysed using
STATISTICA v.10 software. The χ2 test, Kruskal-Wallis
ANOVA test and Mann-Witheney test were applied.
Probability at p < 0.05 was regarded as significant.
Experimental
Tick collection. Sampling of questing ticks was performed in 12 forested sites, located in four districts in
SW Poland: Lubań (sites: L1, L2, L3), Milicz (M1, M2,
M3), Legnica (Leg1, Leg2, Leg3) and Oława (O1, O2,
O3). Ticks were collected by flagging method during
spring peak of tick activity, from April to June 2011,
at least once a month in each site. Collected ticks were
placed in plastic tubes and kept in the refrigerator.
The identification of species and life instar was carried
out in stereomicroscope, based on the key provided
by Siuda (1993).
Detection of A. phagocytophilum in I. ricinus ticks.
DNA for PCR was extracted from I. ricinus by lysis in
ammonium hydroxide (Rijkpema, 1996). The isolates
from nymphs and adults were used for the detection
of A. phagocytophilum. Due to the predominance of
nymphs in the population, the PCR reactions for
nymphs were carried out in pools (5 specimens per
pool), which increased the representation of this particular instar and reduced the costs of analysis. Thus,
for the calculation of the level of infection in nymphs
minimal infection rate (MIR) was used (calculated
on the assumption that in each positive pool of tested
nymphs only one was infected). The procedure was carried out for 30 samples from each of the 12 monitored
sites. To estimate the presence of A. phagocytophilum
the diagnostic kit (PK24N DNA Gdańsk) was used. The
detection was based on amplification of 16S rDNA by
nested PCR reaction. The reaction was performed in a
reaction volume of 50 µl containing 42 µl Master Mix
PCR-OUT for first and PCR-IN for second amplification, 5 µl dNTPs mixture, 1 µl DNA polymerase
TaqNova, and 2 μl of the processed tick sample or 2 µl
Results
In total, 2507 host-seeking ticks (148 larvae, 1314
nymphs, 478 females, and 567 males) identified as
Ixodes ricinus were collected in four districts. Ticks
were present in each of 12 sites. However, the tick
density varied between districts (H = 235.2; p < 0.01)
with the highest prevalence in Lubań (Table I). Altogether, 792 I. ricinus ticks (151 females, 101 males, and
540 nymphs) were tested for the presence of A. phago
cytophilum. Infected ticks were found in all districts.
The average infection rate was 4.3%. The infection
rate in adults was higher than in nymphs (χ2 = 37.093;
p < 0.001). The minimum infection rate was 1.3% in
nymphs and 10.7% in adults (Table II). The highest
level of nymph infection was recorded in Legnica district (3.1%), while no infected nymphs were found in
Lubań district. The highest rate of infected adults was
found in Milicz (17.4%) and the lowest one in Oława
(6.8%). However, the differences beetwen districts
were not statistically significant, both for nymphs and
adults (χ2 = 4,321; p = 0,229, χ2 = 3.547; p = 0.314, respectively). A higher infection rate was observed in females
in comparison to males (15.2% and 3.9% respectively,
Table I
The average density of I. ricinus in four districts in south-western
Poland from April to June 2011.
District
The average number of I. ricinus ticks
collected by one person in 30 min
n
♀
♂
Total
Lubań 26.5 4.8 4.435.7
Milicz 10.2 4.8 7.222.2
Legnica 3.4 4.9 5.013.3
Oława 4.0 4.1 3.711.8
1
91
Infection level of I. ricinus ticks with A. phagocytophilum in SW Poland
Table II
Anaplasma phagocytophilum infected I. ricinus ticks in four districts in south-western Poland in 2011.
A. phagocytophilum infected I. ricinus ticks
District
nymphs*
number
of tested
females
positive
(%)
Lubań170
number
of tested
males
positive
(%)
number
of tested
positive
(%)
females & males
number
of tested
positive
(%)
0 37 10.8 19 5.2 56 8.9
Milicz220 1.8 23 26.1 23 8.7 46 17.4
Legnica65 3.1 47 17.0 30 3.3 77 11.7
Oława851.2 4411.4290 736.8
Total 540 1.3 151 15.2101 3.9 252 10.7
* nymphs were tested in pools consisting of five specimens
χ2 = 8.037; p = 0.004). The highest level of infection in
females was found in Milicz and in Legnica districts
(26.1% and 17.0% respevtively), and the lowest one
(10.8%) – in Lubań district. The infection level in males
varied between 0 (Oława district) and 8.7% (Milicz district). There were no statistically significant differences
between the density of adult ticks in districts, and the
level of their infection (Z = –0.282; p = 0.778)
Discussion
The occurrence of questing Ixodes ricinus ticks is
a major factor of tick-borne infection in humans. Previous studies on ticks as vectors of pathogens, carried
out in Lower Silesia, were focused mainly on the presence of spirochetes of Borrelia burgdorferi s.l., regarded
as the etiological agent of Lyme borreliosis (Kiewra,
2005; Kiewra et al., 2002, 2006). Lyme borreliosis is still
considered the most common tick-borne disease in the
Northern Hemisphere (Stanek et al., 2012). However
I. ricinus can harbour also other pathogens (including
bacteria, viruses and protozoa) (Franke et al., 2013).
Human granulocytic anaplasmosis (HGA) has been
recently recognized as a tick-borne emerging disease,
which is spread over USA, Europe and Asia. In Europe,
the first confirmed case of HGA was reported in 1997,
in Slovenia (Petrovec et al., 1997), whereas the first
cases of acute human granulocytic ehrlichiosis were
described in 2001 in Poland (Tylewska-Wierzbanowska
et al., 2001). It is worth noting, that A. phagocytophilum
infection can be asymptomatic, and many infections
can be unrecognized (Dumbler et al., 2005).
In Poland, questing I. ricinus ticks infected with
A. phagocytophilum were found in north, north-eastern, eastern and central-eastern parts of the country
(Stańczak et al., 2004; Grzeszczuk et al., 2002, 2004;
Tomasiewicz et al., 2004; Wójcik-Fatla et al., 2009;
Sytykiewicz et al., 2012). During present studies, the
observed abundance of questing ticks in all examined
localities in Lower Silesia, and also the infection of
I. ricinus with A. phagocytophilum in Legnica, Milicz,
Lubań, and Oława districts, has revealed for the first
time the risk for HGA transmission in SW Poland.
The prevalence of infected I. ricinus with A. phagocy
tophilum was 4.3%. Similar level of infections, varying between 2% and 6%, depending on the area, were
recorded in Lower Saxony, Germany (Templin et al.,
2013), whereas the one in urban areas of Kosice, Slovakia reached 2.2% (Vichova et al., 2013), and 2.6% in
Belarus (Reye et al. 2013). As many as 8.7% questing
I. ricinus were found to be infected with A. phagocy
tophilum in north-eastern Poland (Grzeszczuk et al.,
2004), 8.5% in central-eastern Poland (Sytykiewicz
et al., 2012), 13.1% in mid-eastern Poland (Tomasiewicz et al., 2004), 14% in northern Poland (Stańczak
et al., 2004). During the present studies no significant
differences in infection rates between the districts
were observed. However, the infection prevalence can
depend on a study area and it may also vary depending
on the year of study (Grzeszczuk and Stańczak, 2006a).
A. phagocytophilum has been found not only in questing
ticks but also in ticks removed from human skin. For
example, 23.7% I. ricinus ticks removed from patients
in north-eastern Poland were infected (Grzeszczuk and
Stańczak, 2006b). A high prevalence of A. phagocytophi
lum was also detected in engorged ticks from potential
reservoir hosts such as roe deer (Overzier et al., 2013).
The studies from the territory of Poland have confirmed
that roe deer are essential hosts for maintaining Ixodes
ticks and tick-borne diseases, including A. phagocyto
philum (Welc-Falęciak et al., 2013).
In our study, the percentage of infected females
(15.2%) was almost 4 times higher than in the males
(3.9%). Females were found to be more infected than
males also in other parts of Poland (Tomasiewicz
et al., 2004; Grzeszczuk, 2006; Grzeszczuk et al., 2002,
2004; Stańczak et al., 2004; Sytykiewicz et al., 2012).
A significantly lower positivity rate (1.3%) was recorded
in nymphs compared to adults. Also other authors
92
Kiewra D. et al.
(Tomasiewicz et al., 2004; Grzeszczuk, 2006; Grzesz
czuk et al., 2002, 2004; Stańczak et al., 2004; Sytykiewicz et al., 2012) have shown that the nymphs are
less infected than adult ticks. The observed tendency
may point to the limited role of small mammals in
maintaining A. phagocytophilum in examined districts, compared to large-sized mammals. In Europe,
A. phagocytophilum strains associated with rodents are
transmitted by I. trianguliceps, and not by I. ricinus ticks
(Pangracova et al., 2013). Thus, the occurrence of I. rici
nus is not sufficient to rodent infection with A. phagocy
tophilum. However, I. ricinus can acquire A. phagocyto
philum from large-sized mammals like cervids or wild
boars, which can play a role as reservoir hosts (Michalik
et al., 2009, 2012).
The obtained results confirm that I. ricinus ticks
infected with A. phagocytophilum are widespread in
Poland and capable of maintaining the A. phagocyto
philum circulation in nature. Thus, in diagnosing the
tick-borne disease in SW Poland, the possibility of
infection with A. phagocytophilum should be also taken
into account.
Acknowledgments
This work was suported by the National Science Centre (NCN),
Poland (Grant No. N N404 014 740).
Literature
Dumler J.S., K.S. Choi, J.C. Garcia-Garcia, N.S. Barat, D.G. Scorpio, J.W. Garyu, D.J. Grab and J.S. Bakken. 2005. Human granulocytic anaplasmosis and Anaplasma phagocytophilum. Emerg. Infect.
Dis. 11(12): 1828–1834.
Franke J., A. Hildebrandt and W. Dorn. 2013. Exploring gaps in
our knowledge on Lyme borreliosis spirochaetes-updates on complex heterogeneity, ecology, and pathogenicity. Ticks Tick Borne Dis.
4(1–2): 11–25.
Grzeszczuk A. 2006. Anaplasma phagocytophilum in Ixodes ricinus
ticks and human granulocytic anaplasmosis seroprevalence among
forestry rangers in Białystok region. Adv. Med. Sci. 51: 283–286.
Grzeszczuk A., B. Puzanowska and S. Zirako. 2009. Anaplasma
phagocytophilum infection in patients with early Lyme borreliosis,
erythema migrans, in north-eastern Poland. Clin. Microbiol. Infect.
15 Suppl 2: 17–8.
Grzeszczuk A. and J. Stańczak. 2006a. Highly variable year-to-year
prevalence of Anaplasma phagocytophilum in Ixodes ricinus ticks in
northeastern Poland: a 4-year follow-up. Ann. NY Acad. Sci. 1078:
309–311.
Grzeszczuk A. and J. Stańczak. 2006b. High prevalence of Ana
plasma phagocytophilum infection in ticks removed from human skin
in north-eastern Poland. Ann. Agric. Environ. Med. 13(1): 45–48.
Grzeszczuk A., J. Stańczak and B. Kubica-Biernat. 2002. Serological and molecular evidence of human granulocytic ehrlichiosis focus
in the Białowieza Primeval Forest (Puszcza Białowieska), north
eastern Poland. Eur. J. Clin. Microbiol. Infect. Dis. 21(1): 6–11.
Grzeszczuk A., J. Stańczak, B. Kubica-Biernat, M. Racewicz,
W. Kruminis-Łozowska and D. Prokopowicz. 2004. Human anaplasmosis in north-eastern Poland: seroprevalence in humans and prevalence in Ixodes ricinus ticks. Ann Agric Environ Med. 11(1): 99–103.
1
Kiewra D. 2005. Dynamics of tick populations (Ixodes ricinus L)
in Sleza massif and their role as the vectors of Lime boreliosis.
(in Polish). Wiad. Parazytol. 51 (2):171–172.
Kiewra D., E. Lonc, M. Głuszkowski and A. Malinowska. 2002.
Geoclimatic influence on the prevalence of castor bean tick – Ixodes
ricinus (L.). pp. 155–126. (in Polish). In: Buczek A., Błaszak C. (eds).
Stawonogi w medycynie. Wydawnictwo Drukarnia LIBER. Lublin:
115–126
Kiewra D., K. Rydzanicz and E. Lonc. 2006. Prevalence of Borrelia
burgdorferi s.l. in Ixodes ricinus collected from five wooded areas in
Lower Silesia (Poland). W: Buczek A, Błaszak C. (eds.): Stawonogi.
Znaczenie epidemiologiczne. Koliber. Lublin. 183–187.
Massung R.F., M.J. Mauel, J.H. Owens, N. Allan, J.W. Courtney,
K.C. Stafford III and T.N. Mather. 2002. Genetic variants of
Ehrlichia phagocytophila, Rhode Island and Connecticut. Emerg.
Infect. Dis. 8(5): 467–472.
Michalik J., J. Stańczak, S. Cieniuch, M. Racewicz, B. Sikora and
M. Dabert. 2012. Wild boars as hosts of human-pathogenic Ana
plasma phagocytophilum variants. Emerg. Infect. Dis. 18(6): 998–1001.
Michalik J., J. Stańczak, M. Racewicz, S. Cieniuch, B. Sikora,
A. Szubert-Kruszyńska and R. Grochowalska. 2009. Molecular
evidence of Anaplasma phagocytophilum infection in wild cervids
and feeding Ixodes ricinus ticks from west-central Poland. Clin.
Microbiol. Infect. 15 Suppl 2: 81–83.
Overzier E., K. Pfister, I. Herb, M. Mahling, G.Jr Böck and
C. Silaghi. 2013. Detection of tick-borne pathogens in roe deer
(Capreolus capreolus), in questing ticks (Ixodes ricinus), and in ticks
infesting roe deer in southern Germany. Ticks Tick Borne Dis. 4(4):
320–328.
Pangracova L., M. Stanko, L. Mosansky, M. Bona, J. Kraljik,
B. Vichova, B. Pet’ko and M. Derdakova. 2013. Genetic variability of Anaplasma phagocytophilum and prevalence of Neoehrlichia
mikurensis in rodents as reservoir hosts. Program and Abstracts.
XII International Jena Symposium on Tick-Borne Diseases. p. 51.
Petrovec M., S. Lotric Furlan, T.A. Zupanc , F. Strle, P. Brouqui,
V. Roux and J.S. Dumler. 1997. Human disease in Europe caused by
a granulocytic Ehrlichia species. J. Clin. Microbiol. 35(6): 1556–1559.
Rar V. and I. Golovljova. 2011. Anaplasma, Ehrlichia, and “Candida
tus Neoehrlichia” bacteria: pathogenicity, biodiversity, and molecular
genetic characteristics, a review. Infect Genet Evol. 11(8): 1842–1861.
Reye A.L., V. Stegniy, N.P. Mishaeva, S. Velhin, J.M. Hübschen,
G. Ignatyev and C.P. Muller. 2013. Prevalence of tick-borne pathogens in Ixodes ricinus and Dermacentor reticulatus ticks from different geographical locations in Belarus. PLoS One. 8(1):e54476. doi:
10.1371/journal.pone.0054476.
Rijpkema S., D. Golubic, M. Molkenboer, N. Verbreek-De Kruif
and J. Schellekens. 1996. Identification of four genomic groups
of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in
a Lyme borreliosis endemic region of northern Croatia. Exp. Appl.
Acarol. 20, 23–30.
Rikihisa Y. 2011 Mechanisms of obligatory intracellular infection
with Anaplasma phagocytophilum. Clin. Microbiol. Rev. 24: 469–489.
Severo M.S., K.D. Stephens, M. Kotsyfakis and J.H. Pedra. 2012.
Anaplasma phagocytophilum: deceptively simple or simply deceptive? Future Microbiol. 7(6): 719–731.
Siuda K. 1993. Ticks (Acari: Ixodida) of Poland. Part II. Taxonomy
and distribution. (in Polish). Warszawa. Polskie Towarzystwo Parazytologiczne.
Stanek G., G.P. Wormser, J. Gray and F. Strle. 2012. Lyme borreliosis. Lancet 379(9814): 461–473.
Stańczak J., R.M. Gabre, W. Kruminis-Łozowska, M. Racewicz
and B. Kubica-Biernat. 2004. Ixodes ricinus as a vector of Borrelia
burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia
microti in urban and suburban forests. Ann. Agric. Environ. Med.
11(1): 109–114.
1
Infection level of I. ricinus ticks with A. phagocytophilum in SW Poland
Sytykiewicz H., G. Karbowiak, J. Hapunik, A. Szpechciński,
M. Supergan-Marwicz, S. Goławska, I. Sprawka and P. Czerniewicz. 2012. Molecular evidence of Anaplasma phagocytophilum
and Babesia microti co-infections in Ixodes ricinus ticks in centraleastern region of Poland. Ann. Agric. Environ. Med. 19(1): 45–49.
Templin C., B. Marchwald, S. Olbrich and J. Dreesman. 2013.
Detection of a new endemic tick species in Lower Saxony, Germany,
in the course of a state-wide monitoring of ticks and tick-borne
diseases. Program and Abstracts. XII International Jena Symposium
on Tick-Borne Diseases: p.138.
Tomasiewicz K., R. Modrzewska, A. Buczek, J. Stańczak and
J. Maciukajć. 2004. The risk of exposure to Anaplasma phagocyto
philum infection in Mid-Eastern Poland. Ann. Agric. Environ. Med.
11(2): 261–264.
Tylewska-Wierzbanowska S., T. Chmielewski, M. Kondrusik,
T. Hermanowska-Szpakowicz, W. Sawicki and K. Sułek. 2001.
First cases of acute human granulocytic ehrlichiosis in Poland. Eur.
J. Clin. Microbiol. Infect. Dis. 20(3):.196–198.
93
Vichova B., B. Halkova, L. Pangracova, M. Stanko, M. Bona,
L. Mosansky and B. Pet’ko. 2013. Occurrence of ticks (Ixodida) and
tick-borne pathogens in urban areas of Kosice city, eastern Slovakia.
Program and Abstracts. XII International Jena Symposium on TickBorne Diseases. p.143.
Welc-Falęciak R., J. Werszko, K. Cydzik, A. Bajer, J. Michalik and
J.M. Behnke. 2013. Co-infection and genetic diversity of tick-borne
pathogens in roe deer from Poland. Vector Borne Zoonotic Dis. 13(5):
277–288.
Wójcik-Fatla A., J. Szymańska, L. Wdowiak, A. Buczek and J. Dutkiewicz. 2009. Coincidence of three pathogens (Borrelia burgdor
feri sensu lato, Anaplasma phagocytophilum and Babesia microti) in
Ixodes ricinus ticks in the Lublin macroregion. Ann. Agric. Environ.
Med. 16(1):151–158.
Zwoliński J., J. Chmielewska-Badora, A. Wójcik-Fatla, E. Cisak,
A. Buczek and J. Dutkiewicz. 2007. Human granulocytic anaplasmosis as an emerging problem of public health. Zdr. Publ. 117(2):
213–219.
2014, Vol. 63, No 1, 95–103
ORIGINAL PAPER
Biocontrol Efficacy of Different Isolates
of Trichoderma against Soil Borne Pathogen Rhizoctonia solani
SAEED AHMAD ASAD1*, NAEEM ALI2, ABDUL HAMEED2, SABAZ ALI KHAN1, RAFIQ AHMAD1,
MUHAMMAD BILAL1, MUHAMMAD SHAHZAD1 and AYESHA TABASSUM2
Department of Environmental Sciences, COMSATS University – 22060 Abbottabad, Pakistan.
2
Department of Microbiology, Quaid-i-Azam University-45320 Islamabad, Pakistan
1
Submitted 17 July 2013, revised 30 October 2013, accepted 16 November 2013
Abstract
In this study, the biocontrol abilities of water-soluble and volatile metabolites of three different isolates of Trichoderma (T. asperellum,
T. harzianum and Trichoderma spp.) against soil borne plant pathogen Rhizoctonia solani were investigated both in vitro and in vivo. The
results showed for the first time that mycelial growth inhibition of the pathogen was 74.4–67.8% with water-soluble metabolites as compared to 15.3–10.6% with volatile metabolites in vitro. In vivo antagonistic activity of Trichoderma isolates against R. solani was evaluated
on bean plants under laboratory and greenhouse conditions. We observed that T. asperellum was more effective and consistent, lowering
disease incidence up to 19.3% in laboratory and 30.5% in green house conditions. These results showed that three isolates of Trichoderma
could be used as effective biocontrol agents against R. solani.
K e y w o r d s: Rhizoctonia solani, Trichoderma, antagonistic activity, biocontrol, soil born pathogen
Introduction
Crop productivity losses due to diseases can result
in hunger and starvation especially in developing countries and soil borne fungi are the main causal agents
decreasing crop productivity. At present, 1258 different fungal species including Rhizoctonia solani have
been reported to cause these diseases or are potential
threats to crop failure (Ciesielski et al., 2009; Consolo
et al., 2012; Suwannarach et al., 2012).
R. solani is a universal fungal pathogen, causal agent
of plant roots and lower stem diseases. In Pakistan,
R. solani occurs as subterranean forms; therefore, chemical control is not a viable choice until the availability of
highly selective and efficient fungicides. Control measures of R. solani diseases are limited due to wide range
of hosts and unavailability of resistant plant varieties
(Rouf, 2002). Different strategies to control soil borne
pathogens have been hypothesized. Amongst these, biological control has got the attention of most researchers
(Benítez et al., 2004; Vinale et al., 2008; Consolo et al.,
2012; Chakraborty et al., 2013). A large number of soil
fungi have been known as potential biological control
agents and among them Trichoderma exhibits the abil-
ity to control the plant pathogens (Punja and Utkhede,
2003; Ting and Choong, 2009; Chaudhary et al., 2012).
Trichoderma are the fast growing filamentous deuteromycetes found in a variety of soils. Due to effective biocontrol abilities of Trichoderma; many of its commercial
biocontrol products are being marketed in Asia, Europe
and USA but none of these are commercially available in
developing countries like Pakistan (Consolo et al., 2012).
The mechanisms involved in the biocontrol activity
of Trichoderma spp. against plant pathogens are important in designing effective and safe biocontrol strategies
(Wolska et al., 2012). Different proposed mechanisms
include: mycoparasitism (attack and killing of pathogen) (Anees et al., 2010) and competitive inhibition
for space and nutrients (Benítez et al., 2004). Tricho
derma are also known to produce different antibiotic
substances e.g. gliotoxin, gliovirin, viridin, and trichoviridin (Vinale et al., 2008). Trichoderma have also
been known to inhibit the growth of pathogenic fungi
by modifying the rhizosphere (Harman et al., 2004).
Moreover, infestation of Trichoderma in the rhizosphere helps plant to promote nutrient/fertilizer uptake
(Yedidia et al., 2003), seed germination and photosynthetic rates (Shoresh et al., 2010).
* Corresponding author: S.A. Asad, Department of Environmental Sciences, COMSATS University-22060 Abbottabad, Pakistan;
phone: +92 (0) 992 383 591-6; fax: +92 (0) 992 383 441; e-mail: [email protected]
96
Asad S.A. et al.
To our knowledge, no work has been carried out
so far to explore the biocontrol abilities of indigenous
Trichoderma populations. The current research was
aimed at isolating the indigenous Trichoderma spp. and
gauging their biological control potential against soil
born plant pathogen R. solani. Both in vitro and in vivo
trials were carried out to investigate different mechanisms involved in antagonistic activity of Trichoderma
species. Furthermore, the suppression of disease incidence and related effects on growth were also observed
in bean plants.
Experimental
Fungal strains. Three Trichoderma strains were isolated from agricultural soils as well as obtained from the
Fungal Culture Bank of the University of the Punjab
Lahore, Pakistan. A highly virulent strain of R. solani
was isolated from infected bean plants. These fungal
strains were maintained at 4°C on Potato Dextrose Agar
(PDA) Merck, USA) with periodical sub-culturing on
the same medium at 25°C.
Molecular identification of Trichoderma strains.
The Trichoderma isolates were identified according to
the protocol of Komoń-Zelazowska et al. (2007). DNA
isolation was carried out according to Castle et al. (1998).
The extraction of DNA was done with NucleoMag 96
Plant Kit (Macherey Nagel, Switzerland) and King
Fisher technology (Thermo, UK). The primer sequences
were; EF1: 5’-ATGGGTAAGGA(A/G)GACAAGAC-3’
and EF2: 5’-GGA(G/A)GTACCAGT(G/C)ATCATGTT-3’. The DNA was quantified by using the Nano
drop 1000 (Thermo Scientific, Milan, Italy). For each
sample, 1 μl of DNA (50 ng/µl) was amplified and the
mixture (20 µl) contained 1 µl of 10 × buffer, 0.5 mM
of deoxynucleotide triphosphate each, 1 U Taq DNA
polymerase (Qiagen, USA), 0.5 mM of each primer and
1.5 mM MgCl2. The PCR program was run as: 95°C,
3 min, 95°C, 1 min; 60°C, 1 min; 72°C, 3 min, 72°C,
5 min for 35 cycles. Five µl of PCR product was run
on 1.5% agarose gel containing 1 µl DNA stain SYBR
Safe (Invitrogen, USA) in 1 × TAE buffer at 3.3 V for
30 minutes and images were obtained with Gel Doc
1000 System (Biorad Lab., USA). Purification of PCR
products was done by QIA quick PCR Purification Kit
(Qiagen, Milano, Italy) and sequencing was done by
Deoxy terminator cycle sequencing kit (Perkin-Elmer
Applied Biosystems) by BMR Genomics (Padova, Italy).
Homology of the sequences with other deposited
nucleotide sequences was checked using basic Blast
search program at NCBI and submitted to the website
for Trichoderma species identification http://www.isth.
info/tools/blast/index.php.
1
Growth profile of Trichoderma under different
pH and temperature regimes. Five mm mycelial disc
was cut from the margins of three days old colonies of
each strain by cork borer and placed in the centre of
PDA plates and incubated at 20, 25 and 30°C (Chaverri
et al., 2003). The growth was optimized at different pH
viz. 5, 5.5, 6, 6.5, 7, 7.5. The average colony diameters
were measured for 5 days at two dimensions at right
angle to each other.
Biocontrol efficacy of Trichoderma against R. solani in Dual Culture Assay. A 5 mm plug of Tricho
derma and R. solani was cut and incubated at 25°C as
described in previous section 2.3. The control plate
contained only R. solani. The mycelial growth of Tri
choderma and R. solani was recorded after every 24 h,
taking the radial growth at right angle to each other and
calculating the average (Dennis and Webster, 1971a).
Mycoparasitic activity was observed by using light
microscope (Axioskop, Germany).
Biocontrol efficacy of water-soluble metabolites
of Trichoderma against R. solani. PDA plates containing cellophane paper were inoculated with 5 mm
mycelial discs of 3 days old cultures of Trichoderma
isolates and incubated at 25°C for 3 days. After 3 days
cellophane paper was removed and a 5 mm disc of
pathogen was placed on the same PDA plate (Dennis
and Webster, 1971b). The control treatment contained
only pathogen disc grown without cellophane paper.
The cultures were further incubated at 25°C until the
colony of pathogen was spread on whole Petri plate in
control treatment. The mycelial inhibition of pathogen
by Trichoderma isolates was calculated using the Eqn. 1
(Edington et al., 1971).
Mycelial Inhibition % = [(C2 – C1)/C2] × 100 (Eqn. 1)
Where, C1 = radial mycelial growth of R. solani in the
presence of Trichoderma and
C2 = radial mycelial growth of R. solani in control.
Biocontrol efficacy of volatile metabolites of
Trichoderma against R. solani. The PDA plates were
inoculated with 5 mm mycelial discs of 3 days old growing culture of Trichoderma isolates. The lid of each plate
was replaced with the bottom of other plate inoculated
with 5 mm mycelial discs of pathogen. Both plates were
sealed together with adhesive tape and incubated at
25°C (Dennis and Webster, 1971c). Control treatment
did not contain Trichoderma isolate. The mycelial inhibition of pathogen was calculated using Eqn.1.
In vivo biocontrol activity of Trichoderma species on bean plants. The bean plants were managed in
growth chambers with 12 h photoperiod, 60% humidity and 25°C temperature. The inoculum was prepared
according to Pugliese et al., (2008). The Trichoderma
isolates and pathogen were propagated on sterilized
wheat kernel medium (75 g wheat kernel/80 ml H2O)
1
97
Biocontrol efficacy of Trichoderma sp. against R. solani
and incubated at 25°C in the dark for 10–15 days. Tri
choderma strains at 5 g/l of inoculum were added to the
plastic bags containing steam disinfected peat. Seven
days after treatment, the substrate was infested with
pathogen at 0.5 g/l and stored at 25°C in growth chambers. The soil of each bag was then transferred to one
litre volume pots (10 × 10 × 12 cm) and bean seeds were
sown at 5 seeds l–1 of peat substrate. The pots were irrigated on a daily basis with sterilized water.
Commercial formulations of Trichoderma harzia
num ICC 012 2.00% and Trichoderma viride ICC 080
2.00% (Remedier®, Isagro Italia Milan, Italy) were used
to verify the efficacy of Trichoderma isolates. A series
of samples treated with a fungicide (Tolclofos-methyl)
at the time of sowing of bean seeds were maintained as
chemical control. Samples treated only with R. solani
were used as inoculated (disease) control and noninoculated (healthy) controls were also maintained
throughout the experiment.
Germination was completed five days after sowing
and occurrence of any kind of disease was recorded.
The plants were uprooted and washed with water. The
roots were categorized using scale 0–4 where 0 = healthy
plant (no infection), 1 = 25% infected root, 2 = 50%
infected root, 3 = 75% infected root, 4 = 100% infected
or completely dead plants depending on the appearance
of elongate, sunken, red-brown lesions on roots and
stems above or below the soil. The Disease index (DI
%) was calculated according to Eqn. 2.
DI% = [(n × 0) + (n × 0.25) + (n × 0.5) + (n×0.75) +
+ (n×1)] /N ×100 (Eqn. 2)
Where, n = number of plants corresponding to each
class, N = total number of plants observed. The Tricho
derma isolates were also assessed for their effect on the
growth of bean plants.
Effect of inoculum dose on in-vivo biocontrol
activity against R. Solani. The antagonists and the
pathogen were grown on wheat kernel medium as
described in previous section. Trichoderma isolates
were applied at 5 and 1 g/l of peat soil in plastic bags
and the bags were kept at green house conditions for
one week. After one week, each bag was inoculated with
R. Solani at 0.25 g/l of soil. The soil of each bag was then
transferred to two litres volume pots (12 × 12 × 14 cm)
and seeds were sown at 10 seeds/pot. Controls were set
up along each treatment.
Experimental layout and Statistical analyses.
The experiments were set up in randomized complete
block design with four replicates for each treatment.
Statistical analysis was carried out using SPSS (version
17.0 ChicagoIL, USA). Analysis of variance (ANOVA)
was performed at 5% significance level. Duncan’s HSD
multiple range test was used as post-hoc analysis to
compare means. Pearson’s correlation coefficient was
calculated to analyze the effect of disease incidence on
fresh biomass of bean plants.
Results
Molecular identification of Trichoderma species.
Trichoderma isolates were identified on the basis of
18S RNA gene sequencing with amplification of tef1
domain at 5’ end. The sequences were compared with
other nucleotide sequences at NCBI databases using
Basic Local Alignment Search Tool (BLAST) and were
submitted to Gene Bank (Bankit) for accession numbers. The amplicon of Trichoderma TV showed a 99%
homology (808/809 and 806/808 bp) with the nucleotide sequence of T. asperellum Th021 (AB568376.1) and
T. asperellum Th016 (AB568375.1) respectively while,
Trichoderma TK showed 99% homology (738/739 and
738/739 bp) with nucleotide sequence of T. harzianum
strain CIB T127 (EU279980.1) and T. harzianum strain
DAOM 167671 (AY605783.1) respectively. The identification was confirmed by searching tef1 sequences by
Tricho BLAST.
Growth profile of Trichoderma species at different pH and temperature. At 25°C and 30°C, the
three fungal species (T. asperellum, T. harzianum and
Trichoderma spp.) showed maximum mycelial growth
while, at 20°C the growth rate was considerably reduced
and antagonists colonized 1/4th of the medium surface.
In acidic pH range i.e., 5–6, the mycelial growth was
maximum whilst, moderate growth was observed at pH
6.5 and 7.0 by antagonists. Beyond these pH limits no
growth or very little growth (0.9–1.2 cm) was recorded.
Biocontrol efficacy of Trichoderma against R. solani in dual culture assay. The results demonstrated
a strong antagonistic potential of Trichoderma against
pathogen (Fig. 1). A clear zone of interaction between
antagonist and pathogen was observed where the former inhibited the growth of later after making a physical contact. Light microscopic analysis further revealed
a typical coiling pattern of Trichoderma species around
the hyphae of R. solani (Fig. 2). This hyphal interaction
was initiated after 72 h of incubation. After seven days
of incubation, pathogen hypha started to disappear and
T. asperellum, T. harzianum and Trichoderma spp. completely overgrew the pathogen.
Biocontrol efficacy of water-soluble and volatile
metabolites of Trichoderma against R. solani. The
water-soluble metabolites of all the Trichoderma isolates proved to be considerably effective in limiting the
growth of R. solani. Growth inhibition was significantly
higher (p < 0.01) with T. asperellum (74.4%) followed
by Trichoderma spp. (70.0%) and T. harzianum (67.8%)
as compared to control treatment for water-soluble
98
Asad S.A. et al.
1
Fig. 1. Antagonistic activity (dual culture assay) of Trichoderma isolates (T) against R. solani (R) at 7th day incubated at 25°C.
A: T. asperellum; B: T. harzianum; C: Trichoderma spp.
metabolites (Table I). All Trichoderma isolates exhibited
growth inhibition of less than 20% for volatile metabolites (Table I). The values were 15.3% for T. harzianum,
11.8% for T. asperellum and 10.6% for Trichoderma spp.
compared to control treatment.
In vivo biocontrol activity of Trichoderma species
against R. solani. The results showed that T. asperellum
was the most effective biocontrol agent at all application
times as it associated with the lowest disease incidence.
The relative fresh biomass production was increased
compared to inoculated control (p < 0.01). When the
Trichoderma was applied seven days before inoculation of pathogen, all species showed an elevated (19.3
to 26.3%) biocontrol efficacy against R. solani compared
Table I
Effect of water-soluble (A) and volatile (B) metabolites
of Trichoderma on growth inhibition of R. solani.
Mycelial rowth
of R. solani (cm)*
Isolates
24 h
48 h
24 h
%
mycelial
inhibition
at 72 h
(A)
T. asperellum
0.9 ± 0.07 1.0 ± 0.14 1.2 ± 0.07
74.4**
T. harzianum
0.8 ± 0.14 1.2 ± 0.07 1.5 ± 0.07
67.8 b
Trichoderma spp.
1.0 ± 0.07 1.1 ± 0.07 1.4 ± 0.07
70.0 b
Control (R. Solani) 1.8 ± 0.14 3.1 ± 0.00 4.5 ± 0.00 0.0 c
(B)
T. asperellum
1.2 ± 0.00 2.4 ± 0.14 3.8 ± 0.07
11.8 b**
T. harzianum
1.2 ± 0.07 2.5 ± 0.21 3.6 ± 0.00
15.3 a
Trichoderma spp.
1.2 ± 0.00 2.4 ± 0.28 3.8 ± 0.00
10.6 b
Control (R. Solani) 1.3 ± 0.14 2.5 ± 0.07 4.3 ± 0.07 0.0 c
*Values are means of four replicates of two independent experiments ± SE.
** Values followed by the different letters in the column are statistically
different by Duncan’s HSD multiple range Test (p < 0.05).
to inoculated control (54.3%) (Table II). Among the
three isolates, T. asperellum showed maximum efficacy
by lowering the disease incidence up to 19.3% when
disease index was 54.3% in inoculated control (p < 0.01)
(Table II). However, the disease incidence was 23.3% by
T. harzianum and 26.3% in case of Trichoderma spp.
Commercial formulation, Remedier®, proved to be less
effective (p < 0.01) than the tested Trichoderma species
with a disease incidence of 38.3%. In addition, relative biomass (RW) was decreased as a consequence of
pathogen infection (Table II).
All isolates proved to have a positive effect on the
growth of bean plants yielding a higher biomass compared to healthy control ones. T. asperellum yielded
highest relative biomass of 127% (p < 0.01) compared
to healthy control, followed by T. harzianum providing a relative biomass of 113%. Trichoderma spp. provided lowest relative biomass (107%) among the species
(Table II).
In another experiment, where the antagonist was
applied seven days after the pathogen, the best results
were observed with T. asperellum with 19.7% disease
incidence compared to inoculated control (53.3%).
This antagonistic behavior was correlated with higher
relative biomass i.e., 168% relative weight. Similarly,
T. harzianum exhibited disease suppression of 23.2%,
while the relative biomass was enhanced up to 155%.
However, Trichoderma spp. showed a disease incidence
of 21% but the effect on relative weight of bean plants
was low (94%). The commercial formulation, Remedier® showed least biocontrol efficacy (27.7%) and
lowest relative biomass (74%) compared to all tested
isolates (Table II). When the Trichoderma species were
evaluated for growth promoting ability, a positive effect
on the relative biomass of bean plants was observed.
Among the species, T. harzianum yielded a highest
1
99
Fig. 2. Hyphal interaction of T. asperellum and R. solani (light microscope).
A: interaction of T. asperellum and R. solani; B: growing hypha of T. asperellum; C: hypha of R. solani (magnification 150 ×: bar = 40 µm);
D: a; lying hypha side by side, b; attachment, c; coiling of hypha (magnification 150 ×: bar = 40 µm); E: coiling of hypha
(magnification 150 ×: bar = 40 µm); F: coiling of hypha at higher magnification (600 ×: bar = 10 µm); G: pathogen hypha after contact,
a; thicker septa, b; fragmented hypha/cell (magnification 150 ×: bar = 40 µm).
relative biomass of 126% while, T. asperellum helped in
providing 114% of relative biomass. Trichoderma spp.
did not show any improvement producing 100% relative biomass (Table II).
Effect of inoculum dose of Trichoderma species
on in vivo biocontrol activity against R. Solani. All
the Trichoderma species showed a higher control efficacy both at high and low dosages, compared to inoculated control. T. asperellum was more effective in both
trials and showed a decrease in disease incidence with
increase in concentration of antagonist, providing
a control efficacy of 29.1 and 35.3% (p < 0.01), when
applied at a dose of 5 and 1 g/l in first trial respectively.
However, Trichoderma spp. and T. harzianum did not
show significant differences among the treatments
with high and low doses in first trial. In second trial,
T. asperellum provided the lowest disease incidence
but no statistical differences among treatments with
dosages (p < 0.01), while Trichoderma spp. was more
effective at a dose of 5 g/l with an efficacy of 35.1%
(p < 0.01), compared to 39.0% disease incidence with
1 g/l dosage. The T. harzianum did not show significant
difference in the disease incidence in both trials applied
at both dosages. Remedier®, showed a disease index of
100
1
Asad S.A. et al.
Table II
In vivo antagonistic activity of Trichoderma species against R. solani on bean plants under laboratory conditions (12 h photoperiod,
25°C, 60% relative humidity) expressed as disease incidence % and bean plant fresh biomass.
Trichoderma application
Pathogen
(0.5 g/l)
Isolate
Seven days before pathogen
DI% Plant f. wt. (g) RW
Seven days after pathogen
DI% Plant f. wt. (g) RW
T. harzianum
+
23.3 bc*
23.8 ab
156
23.7 c
23.2 bc
155
T. asperellum
+
19.3 bc
24.0 ab
161
19.7 b
23.7 ab
168
Trichoderma spp.
+
26.3 c
22.0 bc
118
21.0bc
20.7 cd
94
Remedier®
+
38.3 d
17.3 de
19
27.7d
19.9 de
76
T. harzianum
– 0.0 a
23.8 ab
113 0.0 a
26.3 a
126
T. asperellum
– 0.0 a
26.8 a
127 0.0 a
23.9 a
114
Trichoderma spp.
– 0.0 a
22.5 bc
107 0.0 a
20.b cd
100
Remedier®
– 0.0 a
19.4 cde
92 0.0 a
18.8 def
90
Chemical control (Tolclofos methyl)
+
16.7 b
23.2 abc
24.4 ab
185
Inoculated control (Only R. solani)
+
54.3 e
16.4 e
Health control (No inoculation)
– 0.0 a
21.1 bcd
145
17.7 b
0
52.0 e
100 0.0 a
16.8 f
17.7 ef
0
100
* Values followed by the letters are statistically different by Duncan’s HSD multiple range Test (p < 0.05).
Table III
In vivo antagonistic activity of Trichoderma species against R. solani on bean plants under greenhouse conditions
expressed as disease incidence % and fresh biomass.
Dosage
(g/l)
Pathogen
(0.25 g/l)
Plant f. wt.
(g)
RW
T. asperellum
5
+
30.5 bc*
47.6 e
89
T. asperellum
1
Trichoderma spp.
5
+
34.5 cd
42.3 gh
75
+
35.3 cd
47.4 e
81
Trichoderma spp.
T. harzianum
1
+
38.5 de
43.3 fgh
62
5
+
37.1 de
42.8 fgh
59
T. harzianum
1
+
37.3 de
46.7 ef
83
Remedier®
3
+
41.8 e
39.9 h
41
T. asperellum
5
– 0 a
57.4 ab
116
T. asperellum
1
– 0 a
53.2 cd
108
Trichoderma spp.
5
– 0 a
58.5 a
118
Trichoderma spp.
1
– 0 a
54.6 abc
111
T. harzianum
5
– 0 a
52.9 cd
107
T. harzianum
1
– 0 a
54.3 bc
110
Isolate
DI
%
Remedier®
3
– 0 a
48.5 e
98
Chemical control (Tolclofos methyl)
–
+
27.2 b
46.1 efg
80
Inoculated control (Only R. solani)
–
+
60.4 f
33.2 i
Health control (no inoculation)
–
– 0 a
49.4 de
0
100
* Values followed by letters are statistically different by Duncan’s HSD multiple range Test (p < 0.05).
48.8 and 34.8% in first and second trial respectively
(Table III). Chemical treatment was effective in controlling the disease with an efficacy of 34.4 and 20.0%
(p < 0.01) in the first and second trial respectively. All
the treatments without pathogen showed a high biomass than health control (p < 0.01). The T. asperellum
showed maximum biomass production of 61.2 g in first
trial when 5 g/L dose was applied while in second trial
the Trichoderma spp. yielded a maximum biomass of
60.5 g with same dose. In the treatments with pathogen,
the above ground biomass was reduced compared to
health control due to consequence of disease (Table III).
The chemical treatment with tolclofos-methyl
showed the highest disease suppression and was more
effective than the tested fungal strains. The chemical
treatment showed 16.7–17.7% disease incidence with
1
101
Table IV
Correlation between disease incidence and corresponding biomass of bean plant in different experiments.
Pearson’s
coefficient (r)
Significance
1. Trichoderma applied seven days before pathogen (laboratory)
–0.538
p = 0.01
2. Trichoderma applied seven days after pathogen (laboratory)
–0.308
p = 0.08
3. Effect of concentration on biocontrol efficacy of Trichoderma (greenhouse) –0.843
p = 0.00
Experiment
both types of experimental setup. A weak negative
correlation was observed for the relative biomass production and disease incidence on bean plants when
infested with both pathogen and Trichoderma species
(r = –0.308). Moreover, the fresh biomass production of
bean plants was negatively correlated (r = –0.538) with
disease incidence (Table IV).
Discussion
The present study evaluated the biocontrol efficacy
of three indigenous strains of Trichoderma isolated
from agricultural land in Pakistan against soil born
plant pathogen R. solani.
Two Trichoderma isolates out of three used in the
present study were identified on the basis of 18S rRNA
and they were identified as T. asperellum and T. har
zianum. Both species were previously identified as
efficient biocontrol agents against several plant pathogens (Schuster and Schmoll, 2010). Likewise, these isolates showed considerable biocontrol efficacy against
R. solani in in vitro and in vivo experimental conditions.
Trichoderma species are distributed worldwide in
the rhizospheric regions of plants and around decaying dead biomass (Kubicek et al., 2008). They are
extraordinarily able to adjust to the surrounding environmental conditions by regulating their metabolism,
growth and reproduction (sporulation). The pH and
temperature proved to be major limiting factors affecting the growth profile of Trichoderma (Schmoll et al.,
2010). The isolates in the present study showed maximum growth at 25°C under acidic pH ranging from
5–6 which establishes their mesophilic nature. These
findings are in agreement with Hajieghrari et al. (2008);
where optimum pH varied from 5–8 and temperature
from 25–30°C among different species of Trichoderma.
For the control of plant pathogenesis, Trichoderma
species (mycoparasitism) (Vinale et al., 2006) and/or
their extracellular metabolites can be exploited as biocontrol agents or biological fungicides. These metabolites include; volatile and water-soluble metabolites
(Eziashi et al., 2006) and secondary metabolites of
low molecular weight (Schuster and Schmoll, 2010).
The Trichoderma isolates studied were not only able
to inhibit the growth of pathogen in in vitro experi-
ments (Fig. 2, Table I) but also capable of suppressing
the disease incidence by the pathogen in in vivo trials (Table II, III) confirming their versatile defensive
mechanisms. In this context T. asperellum proved to be
the most effective among the tested isolates. T. asperel
lum has been identified as a potential biocontrol agent
in other studies (Osorio-Hernandez et al., 2011) where
it showed in-vitro inhibition of pathogen in the range
of 11–16%. Viterbo et al. (2005) characterized a protein kinase TmkA from T. asperellum, which had a key
role in the regulatory pathways involved in biocontrol
activity. In vitro studies revealed that Trichoderma had
comparatively higher growth rates which provide them
competitive advantage over the pathogen in availing
space and nutrients in the medium. These species also
inhibited the growth of the pathogen by secreting certain mycotoxins (Cúndom et al., 2003).
Mycoparasitism is one of the major activities occurring in the antagonist-pathogen interaction, expressed
in different steps in a sequence. The detection, attachment, direct penetration, and secretion of fungitoxic
enzymes which leads to death of pathogen are major
actions in their interface (Harman et al., 2004). The
interactions of Trichoderma and pathogen in dual culture were observed under light microscope and the
hyphal contact between Trichoderma and pathogen
started after 48–72 h of incubation. Once the contact
was established, dense hyphal coiling of Trichoderma
around R. solani hypha, a characteristic response of
antagonists was prominent. Similar observations were
previously noted against R. solani by Almeida et al.
(2007). The antagonists showed an affinity for the host
cell wall which suggests that this may involve chemical bonding between functional sites of carbohydrates
present on the cell wall of Trichoderma and pathogen
which triggers the events leading to host wall penetration (Eziashi et al., 2007).
The production of antifungal compounds also play
important role in antagonistic activity of Trichoderma
species. These include; antibiotics, mycotoxins and
low-molecular weight secondary compounds (Schuster
and Schmoll, 2010). Our results indicated that all three
isolates were able to produce water-soluble metabolites
that inhibited the mycelia growth of R. solani. T. asperel
lum proved to be the highest producer of these metabolites, while the production of non-volatile metabolites
102
1
Asad S.A. et al.
was not obvious. Therefore, the principle mechanism of
antagonistic activity against pathogen was speculated
as mycoparasitism (Eziashi et al., 2007) and antibiosis
or due to the production of secondary metabolites as
suggested by Howell (2003). These speculations were
supported by the suppression of disease incidence by all
Trichoderma isolates in in vivo trials on bean plants. An
increased biocontrol efficacy compared to other isolates
and control treatments was provided by T. asperellum
in terms of application of antagonists before and after
the incorporation of pathogen in the soil.
Results in the present study also indicated that the
inoculation of antagonist seven days before the pathogen was more effective. These results are in line with
De Figueiredo et al. (2010) who studied the actions of
Trichoderma against Sclerotinia sclerotiorum in bean
plants. The pathogenicity was found to be reduced to
37.04% when antagonist was applied eight days before
the pathogen. This approach was also recommended by
Lewis and Lumsden (2001).
Interestingly, Trichoderma isolates proved to be
more effective in controlling the R. solani than the commercial formulation Remedier®. This indicates that it is
not necessary to apply Trichoderma species in complex
formulations (Harman, 2000). Additionally, the single
strain of Trichoderma can be considerably capable of
controlling diverse pathogens. Perhaps it would not
be possible to commercialize the mixture of biocontrol strains unless there is highly significant success in
biological control.
Trichoderma species are well known for their abilities to promote plant growth by colonizing the roots
of plants. Their interactions of antagonists with plants
enhance the root proliferation and yield production by
increasing uptake of nutrients (Harman et al., 2008).
The fresh biomass of the bean plants was increased up
to 118% when treated with the Trichoderma isolates
in greenhouse trials as compared to health control
(Table III), which significantly proved the ability of Tri
choderma as a plant growth promoter. These findings
are similar to those reported by Pugliese et al. (2008)
where Trichoderma isolates controlled R. solani and
increased the biomass of bean plants up to 163%. Likewise antagonists prevented 100% mortality of tomato
plants coupled with an increase in plant fresh and
dry weight (Montealegre et al., 2010). Shaban and ElBramawy (2011) investigated the biocontrol of damping-off and root rot diseases by combining Trichoderma
spp. and Rhizobium species. They reported an overall
improvement in plant growth, seed and fruit production.
In the present study, the different isolates of Tricho
derma showed as an effective biocontrol agents against
R. solani though their efficacy varied among isolates
and it was highest with T. asperellum. The biocontrol
efficacy of all Trichoderma isolates was even higher
than commercial formulation Remedier® in in vivo
trials. Apart from suppressing the disease profile of
bean plants, these isolates showed a considerable effect
in promoting their general growth.
Acknowledgements
The authors thank the University of Torino, Italy for partial
financial support to complete this project. The assistance of Massimo Pugliese, Maria Lodovica Gullino AGROINNOVA-Centre
of competence for the Innovation in the Agro-Environmental
Sector, University of Torino, Italy in sample analysis is gratefully
acknowledged.
Literature
Almeida F., F. Cerqueira, R. Silva, C. Ulhoa and A. Lima. 2007.
Mycoparasitism studies of Trichoderma harzianum strains against
Rhizoctonia solani: Evaluation of coiling and hydrolytic enzyme
production. Biotechnol. Lett. 29: 1189–193.
Anees M., A. Tronsmo, V. Edel-Hermann, L.G. Hjeljord,
C. Héraud and C. Steinberg. 2010. Characterization of field isolates
of Trichoderma antagonistic against Rhizoctonia solani. Fungal. Biol.
114: 691–701.
Benítez T., A.M. Rincón, M.C. Limón and A.C. Codón. 2004.
Biocontrol mechanisms of Trichoderma strains. Intl. Microbiol. 7:
249–260.
Castle A., D. Speranzini, N. Rghei, G. Alm, D. Rinker and J. Bissett. 1998. Morphological and molecular identification of Tricho
derma isolates on North American mushroom farms. Appl. Environ.
Microbiol. 64: 133–137.
Chakraborty U., B.N. Chakraborty, A.P. Chakraborty and
P.L. Dey. 2013. Water stress amelioration and plant growth promotion in wheat plants by osmotic stress tolerant bacteria. World.
J. Microbiol. Biotechnol. 29: 789–803.
Chaudhary V., R. Prasanna, L. Nain, S.C. Dubey, V. Gupta,
R. Singh, S. Jaggi and A.K. Bhatnagar. 2012. Bioefficacy of novel
cyanobacteria-amended formulations in suppressing damping off
disease in tomato seedlings. World. J. Microbiol. Biotechnol. 28:
3301–3310.
Chaverri P., L.A. Castlebury, G.J. Samuels and D.M. Geiser. 2003.
Multilocus phylogenetic structure within the Trichoderma harzia
num/Hypocrea lixii complex. Mol. Phylogenet. Evol. 27: 302–313.
Ciesielski S., E. Klimiuk, J. Możejko, E. Nowakowska and T. Pokój.
2009. Changes in microbial community structure during adaptation
towards polyhydroxyalkanoates production. Pol. J. Microbiol. 58:
131–139.
Consolo V.F., C.I. Mónaco, C.A. Cordo and G.L. Salerno. 2012.
Characterization of novel Trichoderma spp. isolates as a search for
effective biocontrollers of fungal diseases of economically important
crops in Argentina. World. J. Microbiol. Biotechnol. 28: 1389–1398.
Cúndom M.A., S.M. Mazza and S.A. Gutiérrez. 2003. Selection of
Trichoderma spp. isolates against Rhizoctonia solani. Spanish. J. Agr.
Res. 1: 79–82.
De Figueirédo G.S., L.C. De Figueirédo, F.C.N. Cavalcanti,
A.C. Dos Santos, A.F. Da Costa and N.T. De Oliveira. 2010. Biological and chemical control of Sclerotinia sclerotiorum using Tricho
derma spp. and Ulocladium atrum and pathogenicity to bean plants.
Braz. Arch. Biol. Technol. 53: 1–9.
Dennis C. and J. Webster. 1971a. Antagonistic properties of speciesgroups of Trichoderma: III. Hyphae interaction. Trans. Brit. Mycol.
Soc. 57: 363–369.
1
Dennis C. and J. Webster. 1971b. Antagonistic properties of species-groups of Trichoderma: I. Production of non-volatile antibiotics.
Trans. Brit. Mycol. Soc. 57: 25–39.
Dennis C. and J. Webster. 1971c. Antagonistic properties of species
groups of Trichoderma: II. Production of volatile antibiotics. Trans.
Brit. Mycol. Soc. 57: 41–47.
Edington L.V., K.L. Khew and G.L. Barron. 1971. Fungitoxic spectrum of benzimidazole compounds. Phytopathol. 61: 42–44.
Eziashi E.I., I.B. Omamor and E.E. Odigie. 2007. Antagonism of
Trichoderma viride and effects of extracted water soluble compounds
form Trichoderma species and benlate solution on Ceratocystis para
doxa. Afr. J. Biotechnol. 6: 388–392.
Eziashi E.I., N.U. Uma, A.A. Adekunle and C.E. Airede. 2006.
Effect of metabolites produced by Trichoderma species against Ceratocystis paradoxa in culture medium. Afr. J. Biotechnol. 5: 703–706.
Hajieghrari B., M. Torabi-Giglou, M.R. Mohammadi and M.
Davari. 2008. Biological potential of some Iranian Trichoderma
isolates in the control of soil borne plant pathogenic fungi. Afr.
J. Biotechnol. 7: 967–972.
Harman G.E. 2000. Myths and dogmas of biocontrol: changes in
perceptions derived from research on Trichoderma harzianum T-22.
Plant Dis. 84: 377–393.
Harman G.E., C.R. Howell, A. Viterbo, I. Chet and M. Lorito.
2004. Trichoderma species- opportunistic, avirulent plant symbionts.
Nat. Rev. Microbiol. 2: 43–56.
Harman G.E., T. Bjorkman, K. Ondik and M. Shoresh. 2008.
Changing paradigms on the mode of action and uses of Trichoderma
spp. for biocontrol. Outlooks Pest Manage. 19: 24–29.
Howell C.R. 2003. Mechanisms employed by Trichoderma species
in the biological control of plant diseases: the history and evolution
of current concepts. Plant Dis. 87: 4–10.
Komoń-Zelazowska M., J. Bissett, D. Zafari, L. Hatvani, L. Manczinger, S. Woo, M. Lorito, L. Kredics, C.P. Kubicek and I.S. Druzhinina. 2007. Genetically closely related but phenotypically divergent Trichoderma species cause green mold disease in oyster mushroom farms worldwide. Appl. Environ. Microbiol. 73: 7415–7426.
Kubicek, C.P., M. Komoń-Zelazowska and I.S. Druzhinina. 2008.
Fungal genus Hypocrea/Trichoderma: from barcodes to biodiversity. J. Zhejiang. Univ. Sci. 9: 753–763.
Lewis J.A. and R.D. Lumsden. 2001. Biocontrol of damping-off of
greenhouse-grown crops caused by Rhizoctonia solani with a formulation of Trichoderma spp. Crop Prot. 20:49–56.
Montealegre J., L. Valderrama, S. Sánchez, R. Herrera, X. Besoain
and L.M. Pérez. 2010. Biological control of Rhizoctonia solani in
tomatoes with Trichoderma harzianum mutants. Electron. J. Bio
technol. 13: 1–11.
Osorio-Hernández E., F.D. Hernández-Castillo, G. GallegosMorales, R. Rodriguez-Herrera and F. Castillo-Reyes. 2011. In
103
vitro behavior of Trichoderma spp. against Phytophthora capsici
Leonian. Afr. J. Agr. Res. 6: 4594–4600.
Pugliese M., B.P. Liu, M.L. Gullino and A. Garibaldi. 2008. Selection of antagonists from compost to control soil-borne pathogens.
J. Plant Dis. Prot. 115: 220–228.
Punja Z.K. and R.S. Utkhede. 2003. Using fungi and yeasts to manage vegetable crop diseases. Trends Biotechnol. 21: 400–407.
Rouf C.A. 2002. Biology and management of black scurf of potato.
PhD Thesis Quaid-I-Azam University Islamabad, Pakistan.
Schmoll M., E.U. Esquivel-Naranjo and A. Herrera-Estrella. 2010.
Trichoderma in the light of day-physiology and development. Fun
gal. Genet. Biol. 47: 909–916.
Schuster A. and M. Schmoll. 2010. Biology and biotechnology of
Trichoderma. Appl. Microbiol. Biotechnol. 87: 787–799.
Shaban W.I. and M.A. El-Bramawy. 2011. Impact of dual inoculation with Rhizobium and Trichoderma on damping off, root rot
diseases and plant growth parameters of some legumes field crop
under greenhouse conditions. Int. Res. J. Agr. Sci. Soil Sci. 1: 98–108.
Shoresh M., G.E. Harman and F. Mastouri. 2010. Induced systemic
resistance and plant responses to fungal biocontrol agents. Ann. Rev.
Phytopathol. 48: 21–43.
Suwannarach N., J. Kumla B. Bussaban and S. Lumyong. 2012.
Biocontrol of Rhizoctonia solani AG-2, the causal agent of dampingoff by Muscodor cinnamomi CMU-Cib 461. World. J. Microbiol. Bio
technol. 28: 3171–3177.
Ting A.Y. and C.C. Choong. 2009. Bioaccumulation and biosorption efficacy of Trichoderma isolate, SP2F1 in removing copper
(Cu(II)) from aqueous solutions. World J. Microbiol. Biotechnol. 25:
1431–1437.
Vinale F., K. Sivasithamparam, E.L. Ghisalberti, R. Marra,
S.L. Woo and M. Lorito. 2008. Trichoderma-plant-pathogen interactions. Soil Biol. Biochem. 40: 1–10.
Vinale F., R. Marra, F. Scala, E.L. Ghisalberti, M. Lorito and
K. Sivasithamparam. 2006. Major secondary metabolites produced
by two commercial Trichoderma strains active against different
phytopathogens. Lett. Appl. Microbiol. 43: 143–148.
Viterbo A., M. Harel, B.A. Horwitz, I. Chet and P.K. Mukherjee.
2005. Trichoderma Mitogen-Activated Protein kinase signaling is
involved in induction of plant systemic resistance. Appl. Environ.
Microbiol. 71: 6241–6246.
Wolska K.I., K. Grześ and A. Kurek. 2012. Synergy between novel
antimicrobials and conventional antibiotics or bacteriocines. Pol.
J. Microbiol. 61: 95–104.
Yedidia I., M. Shoresh, Z. Kerem, N. Benhamou, Y. Kapulnik
and I. Chet. 2003. Concomitant induction of systemic resistance to
Pseudomonas syringae pv. lachrymans in cucumber by Trichoderma
asperellum (T-203) and accumulation of phytoalexins. Appl. Environ.
Microbiol. 69: 7343–7353.
2014, Vol. 63, No 1, 105–109
ORIGINAL PAPER
Prevalence of EBV Genotypes in Polish, Taiwanese and Arabic Healthy Students
and Association Between Genotypes and 30-bp Deletion in the LMP-1 Gene
Phylogenetic Analysis
DOROTA POLZ*, ŁUKASZ PODSIADŁO, AGNIESZKA STEC
and MAŁGORZATA POLZ-DACEWICZ
Department of Virology, Medical University, Lublin, Poland
Submitted 10 May 2013, revised 1 June 2013, accepted 16 November 2013
Abstract
The aim of this study was to compare the prevalence of EBV genotype and del-LMP-1 in saliva from Polish, Taiwanese and Arabic healthy
students. The study group consisted of 56 healthy students; 24 of them Polish, 25 Taiwanese, and 7 Arabic. Typing was carried out using
PCR with EBNA-2 primers. A detection of LMP-1 variants was also performed using PCR. EBV DNA was detected in 22 investigated
samples (39.3%). Type 1 of the virus was dominant in both Polish and Taiwanese group. Among 62.5% Tai wanese with EBV 1 and 55.6%
Polish detected EBV with 30-bp deletion in LMP-1 gene.
K e y w o r d s: EBV, saliva, LMP-1
Introduction
Epstein-Barr virus belongs to the Herpesviridae family, Gammaherpesviridae subfamily, Lymphocryptovi
rus genus and is also known as human herpesvirus 4
(HHV-4). Herpesviruses have double-stranded DNA
genome (Peh et al., 2003). EBV is an enveloped virus
with an icosahedral capsids symmetry. The genome
takes on a linear form in mature virions and a circular episomal form during the period of latency in the
infected cells. Epstein-Barr virus express six nuclear
proteins: EBNA (EBV nuclear antigens) which include
EBNA-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C
and EBNA-LP (leader protein), next are three latent
membrane proteins LMP-1, LMP-2A, LMP-2B and
two untranslated RNAs termed EBV-encoded RNA
(EBER-1 and EBER-2). LMP-1 is a transmembrane
protein, it is a major oncogenic protein of EpsteinBarr virus and EBV strain are categorized due to
nucleotide base-pair (bp) changes in the LMP-1
gene. Del-LMP-1 (variant with deletion) has a greater
tumorigenic potential thus being responsible for an
increased risk of nasopharyngeal carcinoma (NPC),
and is less immunogenic (Perera et al., 2010). This is
one of the most common viruses in humans (Alipov
et al., 2005). EBV was the first human virus to which
oncogenic potential was attributed, and is classified
as a group 1 carcinogen by the World Health Organization’s International Agency for Research on Cancer
(IARC working group 1997). EBV is correlated with
nasopharyngeal and gastric carcinoma, squamous cell
carcinoma, Hodgkin’s lymphoma, and Burkitt’s lymphoma (Slots 2005, Slots et al., 2006, Peh et al., 2003,
Chen 2011, Tiwawech 2008, Perera 2010). Nasopharyngeal carcinoma is the most common head and neck
cancer in southwestern China and Taiwan (Lin et al.,
2001). This virus has the ability to replicate and enter
a latency phase in B cells, which can lead to a development of viral types of cancer (Chen 2011). So far, two
types of EBV (EBV-1 and EBV-2) have been distingu
ished, with the significant differences in the EBNA-2,
EBNA-3A, EBNA-3B and EBNA-3C gene sequences
(Peh et al., 2003, Correra et al., 2007, Tiwawech et al.,
2008). Type 1 is found primarily in Europe, North
and South America and Asia, while type 2 is mainly
dominant in Africa(Peh et al., 2003). EBNA-2 protein
plays a key role in initiation of carcinogenesis by disrupting mitotic checkpoints and causing chromosomal
instability (Pan et al., 2009). EBV is an etiological agent
of infectious mononucleosis also known as ‘the kissing disease’, because the virus spreads through direct
mouth-to-mouth contact with saliva being the main
* Corresponding author: D. Polz, Department of Virology, Medical University, Lublin, Poland; e-mail: [email protected]
106
1
Polz D. et al.
vehicle for EBV transmission from human to human.
Current investigations suggest that EBV is correlated
with many diseases localized in the oral cavity such as
gingivitis, periodontitis, pulpitis, periapical inflammations and periodontal abscesses (Slots 2005, Slots et al.,
2006, Grinde and Olsen 2010).
Experimental
Sample collection. The investigated material was
saliva. Samples were obtained from healthy students
of the Medical University of Lublin, Poland. The study
group consisted of 56 healthy volunteers: 24 Polish,
25 Taiwanese, and 7 Arabic students. In the study
group there were 26 female and 30 male in 18–37 years
of age (22.2 average). Saliva samples were collected
anonymously, and all volunteers were healthy; there
was also an a survey containing clinical about general
and infectious diseases data attached. The research
received approval from the Ethics Committee number
KE-0254/150/2010.
DNA extraction. DNA from 200 µl of saliva samples
was extracted using QIAamp DNA Mini Kit (Qiagen,
Germany) according to the manufacturer’s instructions.
PCR. All PCR reactions were carried out in final
volume of 25 µl using HotStartTaq DNA Polymerase
(Qiagen, Germany). Concentrations of PCR reaction
components were prepared as follows: 2.0 mM MgCl2,
0.2 mM dNTPs, 0.5 µM each forward and reverse primers and 0.5 U of HotStart Taq polymerase. During each
run samples were tested together with one negative and
positive control.
Amplification of EBNA-2 gene. The nested PCR
was carried out for amplification of EBNA-2. The
sequence of primers used for PCR was as follows:
outer pair 5’-TTT CAC CAA TAC ATG ACC C-3’,
5’-TGG CAA AGT GCT GAG AGC AA-3’ and inner
pair 5’-CAA TAC ATG AAC CRG AGT CC-3’, 5’-AAG
TGC TGA GAG CAA GGC MC-3’, (R = A/G, M = A/C).
2 µl of extracted DNA was subjected to the PCR mixture with the concentration as described above. The
first-round amplification consisted of activation of
polymerase 95°C for 15 minutes, 35 cycles of 94°C for
1minute, 55°C for 1minute, 72°C for 2 minutes and
the final extension at 72°C for 5 minutes. The secondround amplification was performed with 1 µl of first
round PCR product in 30 cycles with an annealing
temperature at 60°C.The amplicons 368 bp, 473 bp in
length (depending on the EBV type EBV-1 and EBV-2,
respectively) were separated on 2% agarose gel and
purified using Gel-Out kit (A&A Biotechnology,
Poland) for further analysis. Purified PCR products
were send to Genomed Warsaw, a company dealing
with the field of genomics.
Amplification of LMP-1 gene. Primers used for the
amplification were 5’-AGCGACTCTGCTGGAAATGAT-3’ and 5’-TGATTAGCTAAGGCATTCCCA-3’.
The reaction mixture containing 3 µl of extracted DNA
was amplified under following conditions: 95°C for
15 minutes of initial hot start activation, then 40 cycles
of 94°C for 1 minute, 57°C for 1 minute, 72°C for
1 minute with the final extension at 72°C for 10 minutes. The PCR products were subjected to 3% agarose
gel and LMP-1 variants (316 bp – wild type or type with
30-bp deletion) were analyzed.
Phylogenesis of EBV (phylogenetic analysis). The
results of sequencing were analyzed using the following computer programs: Chromas Lite 2.0.0.0, ClustalX
2.1.0.0, GeneDoc 2.7.0.0 and BioEdit 7.0.9.1. Typing
was performed using the BLAST algorithm (basic Local
Alignment Search Tool; http://blast.ncbi.nlm.gov/Blast.
cgi). EBNA-2 gene sequence were used in order to
construct phylogenetic tree. Phylogeny was based on
the maximum likelihood method (ML). This method
requires the use of computer programs such as PAUP
4.0, ModelTest 3.7, PhyML 2.4.4 and MEGA 4.1. In
order to choose the appropriate model of molecular
evolution hLRTs (hierarchical Likelihood-Ratio Test)
and AIC (Akaike Information Criterion) test were used.
The reference strains sequences used in the study was
taken from the public database GenBank (http://www.
ncbi.nlm.nih.gov/genbank/).
Statistical analysis. PQ Stat 1.4.6. program was
used for the statistical analysis, and the relationship
between investigated parameters was verified by means
of V-Cramer test. Statistical significance was defined
as P < 0.05.
Results
EBV DNA was detected in 39.3% (22) investigated
samples, EBV type 1 was detected in 18 cases (81.8%)
and EBV type 2 was detected in 4 cases (18.2%). The
findings revealed that more Taiwanese students was
EBV-positive compared to Polish and Arabic students
(44%, 37.5% and 28.6% respectively). Type 1 of the
virus was dominant in both Polish and Taiwanese group
(100% and 72.7% respectively). The phylogenetic tree
and percentage similarity of EBNA-2 gene sequences
are shown in Figure 1 and in Table I. In the group of
Arabic students EBV was detected in 2 cases out of seven
respondents, amounting to 26.8 %. The low number of
EBV-positive representatives enables an interpretation
of this result (1 case of EBV1 and EBV2 was detected).
Among 54.5% Taiwanese and 55.6% Polish students
EBV with 30-bp deletion in LMP-1 gene was detected.
1
Prevalence of EBV genotypes and del-LMP-1 in different groups of students
107
Table I
Percentage similarity of EBNA-2 gene sequences.
Among Taiwanese students with EBV 1 group deletion in LMP-1 gene was detected in 62.5% (5 samples),
so deletion in EBV 1 was more often detected among
Taiwanese than among Polish students.
Fig. 1. Phylogenetic
tree of EBV constructed based on the
maximum likelihood
method (ML).
Discussion
Saliva is a very interesting diagnostic material,
sometimes described as the “mirror of the body”.
The undeniable benefit of this material is the way of
obtaining samples; non-invasive nor stressful for the
patient (especially when compared to collecting blood
samples), the risk of needle stick is eliminated and at
the same the risk of infection reduced. What is more,
if blood is not visible in the saliva, the sample is not
considered a class II biohazard (according to the US
Centre for Disease Control) which also provides safety
benefits for researchers. It is a painless method, which
is of particular importance especially in the diagnosis of children. In addition, because of the way of
collecting samples, it is inexpensive and the medical
personnel does not require specialized training. Also
the method of storing and preparing the material for
further research is less complicated than in the case
of serum (blood) (Shirtcliff et al., 2001). Saliva is used
in the diagnosis of hormonal disorders (determination of cortisol concentration), it is considered to be
good material for detecting oral cancer markers and
monitoring the course of disease: the main biomarker
is the tumour-suppressor protein TP53. Mutations in
the p53 gene are considered to be the most common
changes found in cancer, including squamous cell cancer of the oral cavity. Another cancer marker detected
in saliva is CA125, used to diagnose ovarian cancer.
Saliva as a diagnostic material has its application in
virology: it is possible to detect anti-HIV IgM antibodies, using techniques of molecular biology (PCR) it is
also possible to detect HSV, EBV, measles, and mumps
(Farnaud et al., 2010).
EBV infection is transmitted from host to host via
saliva, and the virus passes through the oropharyngeal epithelium to B lymphocytes (Thompson and
Kurzrock 2004).
The Epstein-Barr virus belongs to a group of oncogenic viruses. The spectrum of diseases associated with
being infected with this virus is very broad and the virus
itself is common in the population. In our studies, the
EBV DNA was detected in 39.3% of the students. Type
1 was detected in all of the Polish students (100%) while
in the Taiwanese the detection of type 1 amounted to
108
1
Polz D. et al.
72.7%. 30-bp deletion in the LMP-1 gene was detected
in 54.5% of Taiwanese and 55.6% Polish students.
The results of our studies are consistent with the
experiences of other authors e.g. higher incidence of
EBV-1 in the healthy population is also confirmed by
Correa et al. (2007).
LMP-1 EBV is a viral oncoprotein, which has an
in vitro confirmation of the ability to transform cells
and of inducing tumor growth (in vivo), it can disturb
the growth and maturation of human keratinocytes and
induce the expression of epidermal growth factor receptor connected to the nasopharyngeal carcinoma (NPC),
and is probably associated with the tumor being more
aggressive. Some researchers (Tiwawech et al., 2008 and
Peh et al., 2003) report that the variant with deletion
(del-LMP-1) is connected to changes which induce the
protein’s oncogenic properties, Sandvej et al. (1994)
combine the EBV-2 and del-LPM-1, suggesting the
genotype transforming ability. There is little information on prevalence of del-LMP-1 in healthy individuals. In Brazil and Mexico this deletion was detected in
59% (Chen et al., 1996 , Dirnhofer et al., 1999), among
healthy Italian blood donors in 44% (Dolcetti et al.,
1997), in Argentina only in 7.4% (Correa et al., 2004).
Tiwawech et al. (2008) present studies where EBV-1 is
dominant (86.5–96%) in nasopharyngeal carcinoma
(NPC) among Asians, and EBV-2 is less frequently
detected (4–13%). They also confirm a strong correlation between a virus with deletion in LMP-1 and NPC
in comparison to the wild-type gene (without deletion)
and NPC. An increasingly interesting and still valid is
the question why EBV causes NPC only in some populations and maybe the answer lies within the genetic
differences between the strains. Tiwawech et al. (2008)
indicate that type 1 (A) of the virus has a greater potential of transforming B-lymphocytes than type II (B).
The result of studies of Tse et al. (2009) and Bei et al.
(2010) (genome-wild association study) indicate that
the increased incidence of NPC among the Taiwanese
and eastern China population are an outcome of genetic
differences in the human leukocyte antigen (HLA) and
multiple loci (HLA-A, HLA-F, GABBR1) within chromosome 6 p 21.3 is associated with this type of cancer.
Also Perera et al. (2010) indicate that the genetic differences between populations may influence the degree
of risk of NPC occurrence, they provide the example of
HLA-A11 restricted cytotoxic T-lymphocyte response
is directed toward a specific epitope of the EBNA-4
EBV protein. They also confirm the reports on the
influence of genetic alterations in virus strains, which
determine the active infections in humans. Available
literature does not provide studies comparing nationalities studied by us, it is worth to underline however that
the study was conducted among healthy young people.
Perhaps this is related to the significant differences in
the incidence of this cancer. Significant differences in
NPC incidence depending on the geographical location were observed; in south-east Asia (an area covering
southern China, Hong Kong, Taiwan), the annual incidence rate is about 25 times higher than in the western
world (Tse et al., 2009). It is believed that NPC in South
East Asia is endemic, while the annual incidence rate
for the rest of the world amounts to less than 1/100 000
(Ruan et al., 2013). The incidence rate of NPC in the
Guandong province (China) is 30.94/100 000 for men
and 13/100 000 for women, in Taiwan it is estimated at
6/100 000, being eighth among cancers leading to death.
Mortality is 4/100 000 and mainly concerns middle
aged patients (Lin et al., 2001, Ruan et al., 2013). Hong
Kong recorded some of the highest rates of incidence:
4.8/100 000 for women and 15.0/100 000 for men (Pow
et al., 2011). In Poland, this type of cancer is rare among
both men and women. In 2010, the absolute number
of men affected with nasopharyngeal carcinoma was
119, crude rate 0.6, standardized rate 0.4, percentage
0.2. and is in place 49 in sequence number with regards
to the location of particular organs. In the same years
there were 50 cases of women suffering from the nasopharyngeal carcinoma, crude rate 0.3, standardized rate
0.2, percentage 0.1, and is 67 in sequence number. NPC
is so uncommon in Poland that there are no available
data apart from those provided above (Wojciechowska
et al., 2010).
EBV DNA is detected in the majority of cases of
NPC among Asians and about 75% of case among
Caucasians (Pow et al., 2011).
Conclusions. As with other cancers, early detection
is most significant for the prognosis. If the cancer is
detected at an early stage , the patient’s chances of survival increase. In case of cancers with a viral pathogenesis it is worth to consider the possibility of virological
testing. Although in the Polish population NPC is rare,
nevertheless it is recorded and one should remember
about the correlation NPC/EBV DNA. What is more,
in the age of globalization, the number of patients from
the most remote parts of the world is likely to increase,
and thus the number of rarely recorded diseases may
also increase.
In conclusion, the knowledge on EBV prevalence
in healthy population of Polish students will be useful
in analyzing the role of EBV and regional factors in the
pathogenesis of EBV-associated cancers.
Literature
Alipov G., T. Nakayama, M. Nakashima, C.Y. Wen, D. Niino,
H. Kondo, Y. Pruglo and I. Sekine. 2005. Epstein-Barr virus-associated gastric carcinoma in Kazakhstan. World J. Gastroenterol. 11:
27–30.
1
Prevalence of EBV genotypes and del-LMP-1 in different groups of students
Bei J.X., Y. Li, W.H. Jia, B.J. Feng, G. Zhou, L.Z. Chen, O.S. Feng,
HQ Low, H. Zhang, F. He and others. 2010. A genome-wide association study of nasopharyngeal carcinoma identifies three new
susceptibility loci. Nat. Genet. 42: 599–603.
Chen W.G., Y.Y. Chen, M.M. Bacchi, C.E. Bacchi CE., M. Alvarenga and L.M. Weiss. 1996. Genotyping of Epstein-Barr virus in
Brazilian Burkitt’s lymphoma and reactive lymphoid tissue. Type A
with a high prevalence of deletions within the latent membrane protein gene. Am. J. Pathol. 148: 17–23.
Chen M.R. 2011. Epstein-Barr virus, the immune system, and associated diseases. Front Microbiol. 2: 5.
Correa R.M., M.D. Fellner, L.V. Alonio, K. Durand, A.R. Teyssié,
and M.A. Picconi. 2004. Epstein-Barr virus (EBV) in healthy carriers: Distribution of genotypes and 30 bp deletion in latent membrane protein-1 (LMP-1) oncogene. J. Med. Virol. 73: 583–588.
Correa R.M., M.D. Fellner, K. Durand, L. Redini, V. Alonio,
C. Yampolsky, A. Colobraro, G. Sevlever, A. Teyssié and others.
2007. Epstein Barr virus genotypes and LMP-1 variants in HIVinfected patients. J. Med. Virol. 79: 401–407.
Dirnhofer S., Angeles-Angeles A., Ortiz-Hidalgo C., Reyes E.,
Gredler E., J. Krugmann, F. Fend and L. Quintanilla-Martinez.
1999. High prevalence of a 30-base pair deletion in the Epstein-Barr
virus (EBV) latent membrane protein 1 gene and of strain type B
EBV in Mexican classical Hodgkin’s disease and reactive lymphoid
tissue. Hum. Pathol. 30: 781–787.
Dolcetti R., P. Zancai, V. De Re, A. Gloghini, B. Bigoni, B. Pivetta,
S. De Vita, A. Carbone and M. Boiocchi. 1997. Epstein-Barr virus
strains with latent membrane protein-1 deletions: prevalence in the
Italian population and high association with human immunodeficiency virus-related Hodgkin’s disease. Blood. 89: 1723–1731.
Farnaud S.J., O. Kosti, S.J. Getting and D. Renshaw. 2010. Saliva:
Physiology and Diagnostic Potential in Health and Disease. Scien
tific World Journal 10: 434–456.
Grinde B. and I. Olsen. 2010. The role of viruses in oral disease.
J. Oral. Microbiol. 12: 2.
Lin SY., N.M. Tsang, S.C. Kao, Y.L. Hsieh, Y.P. Chen, C.S. Ksai,
T.T. Kuo, S.P. Hao, I.H. Chen and J.H. Hong. 2001. Presence of
Epstein-Barr virus latent membrane protein 1 gene in the nasopharyngeal swabs from patients with nasopharyngeal carcinoma. Head
Neck. 23: 194–200.
Pan S.H., C.C. Tai, C.S. Lin, W.B. Hsu, S.F. Chou, C.C. Lai,
J.Y. Chen, H.F. Tien, F.Y. Lee and W.B. Wang. 2009. Epstein-Barr
virus nuclear antigen 2 disrupts mitotic checkpoint and causes chromosomal instability. Carcinogenesis 30: 366–375.
109
Peh S.C., L.H. Kim, K.S. Mun, E.L. Tan, C.K. Sam and S. Poppema.
2003. Epstein-Barr virus (EBV) subtypes and variants in malignant tissue from Malaysian patients. J. Clin. Exp. Hematopathol. 43:
61–69.
Perera RA., L.P. Samaranayake and C.S. Tsang. 2010. Shedding
dynamics of Epstein-Barr virus: A type 1 carcinogen. Arch. Oral.
Biol. 55: 639–647.
Pow E.H., M.Y. Law, P.C. Tsang, R.A. Perera and D.L. Kwong. 2011
Salivary Epstein-Barr virus DNA level in patients with nasopharyngeal carcinoma following radiotherapy. Oral. Oncol. 9: 879–882.
Proceedings of the IARC working group on the evaluation of carcinogenic risks to tumors. Epstein-Barr virus and Kaposi’s sarcoma
Herpesvirus/Human herpesvirus 8. Lyon, France, 17–24 June 1997.
IARC Monogr Eval Cacinog Risks Hum. 1997; 70: 1–492
Shirtcliff E.A., D.A. Granger, E. Schwartz and M.J. Curran. 2001.
Use of salivary biomarkers in biobehavioral research: cotton-based
sample collection methods can interfere with salivary immunoassay
results. Psychoneuroendocrinology 26: 165–73
Slots J. 2005. Herpesviruses in periodontal diseases. Periodontol
2000. 38: 33–62.
Slots J., I. Saygun, M. Sabeti and A. Kubar. 2006. Epstein-Barr
virus in oral diseases. J. Periodontal. Res. 41: 235–244.
Ruan H.L., H.D. Qin, Y.Y. Shugart, J.X. Bei, F.T. Luo, Y.X. Zeng
and W.H. Jia. 2013. Developing genetic epidemiological models to
predict risk for nasopharyngeal carcinoma in high-risk population
of China. PLoS One. 82:e56128. doi: 10.1371/journal.pone.0056128
Sandvej K., S.C. Peh, B.S. Andresen and G. Pallesen. 1994. Identification of potential host spots in the carboxy-terminal part of
Epstein-Barr virus (EBV) BNLF-1 gene in both malignant and
benign EBV-associated diseases; High frequency of a 39-bp deletion
in Malaysian and Danish peripheral T-cell lymphomas. Blood. 84:
4053–4060
Thompson M.P. and R. Kurzrock. 2004. Epstein-Barr virus and
cancer. Clin. Cancer. Res. 10: 803–821
Tiwawech D., P. Srivatanakul, A. Karalak and T. Ishida. 2008. Association between EBNA2 and LMP1 subtypes of Epstein-Barr virus
and nasopharyngeal carcinoma in Thais. J. Clin. Virol. 42: 1–6.
Tse KP., W.H. Su, K.P. Chang, N.M. Tsang, C.J. Yu, P. Tang,
L.C. See, C. Hsueh, M.L. Yang, S.P. Hao and others. 2009.
Genome-wide association study reveals multiple nasopharyngeal
carcinoma-associated loci within the HLA region at chromosome
6p21.3. Am. J. Hum. Genet. 852: 194–203
Wojciechowska U., J. Didkowska and W. Zatoński. 2012. Cancer in
Poland in 2010, http://www.onkologia.org.pl/doc/Nowotw2010.pdf
2014, Vol. 63, No 1, 111–114
SHORT COMMUNICATION
Microbial Transformations of 3-methoxyflavone by Strains
of Aspergillus niger
EDYTA KOSTRZEWA-SUSŁOW*, MONIKA DYMARSKA and TOMASZ JANECZKO
Department of Chemistry, Wrocław University of Environmental and Life Sciences
Submitted 15 July 2013, revised 13 November 2013, accepted 16 November 2013
Abstract
Microbial transformation of 3-methoxyflavone into 3’-hydroxyflavon-3-yloxymethyl myristate was presented. Six filamentous fungi were
used as biocatalysts: a wild strain of Aspergillus niger KB, its four UV mutants (A. niger MB, SBP, SBJ, 13/5) and the strain of Penicillium
chermesinum 113. The highest yields were observed for the strains of A. niger KB and A. niger SBP (69.8% and 63.1%, respectively).
K e y w o r d s: Aspergillus niger, Penicillium chermesinum, biotransformation, 3-methoxyflavone, myristic acid
Microbial transformation of flavonoid compounds
is a natural method which may be a green alternative
to chemical synthesis. Using biotransformation we can
modify structures of compounds in order to improve
their biological properties and to increase their hydrophilicity or bioaccessibility (Das and Rosazza, 2006;
Wang et al., 2010).
Regioselective O-demethylation of tangeretin and
3-hydroxytangeretin by Aspergillus niger gave 4’-O-demethylated biotransformation products (Buisson et al.,
2007) while transformations of 7,8-dimethoxyflavone
by Mucor ramannianus gave five biotransformation
products involving hydroxylation at C-3’ and C-4’ with
the methoxyl groups retained and products of hydro
xylation in the B-ring along with demethylation at C-7
or/and C-8 (Herath et al., 2009).
This manuscript reports the microbial demethylation of 3-methoxyflavone by strains of Aspergillus and
Penicillium, followed by non-typical esterification with
a fatty acid and hydroxylation in the B-ring.
The analytical procedures were as described previously (Kostrzewa-Susłow and Janeczko, 2012a; 2012b).
The substrate for biotransformation – 3-metho
xyflavone was purchased from Sigma-Aldrich, Poznań,
Poland.
3-Methoxyflavone (C30H38O6): M.p. 114–115°C. Rt
19.35 min (HPLC).
1
H NMR (DMSO-d6) δ: 3.81 (3H, s, -OCH3), 7.49 (1H, t,
J6.5 = 8.0, J6.7 = 7,0 Hz, H-6), 7.58 (3H, m, H-3’, H-4’, H-5’),
7.75 (1H, d, J8.7 = 8.2 Hz, H-8), 7.82 (1H, ddd, J7.5 = 1.5,
J7.6 = 7.0, J7.8 = 8.2 Hz, H-7), 8.05 (2H, m, H-2’, H-6’),
8.10 (1H, dd, J5.6 = 8.0, and J5.7 = 1.5 Hz, H-5); 13C NMR
(DMSO-d6) δ: 60.2 (-OCH3), 119.0 (C-8), 124.1 (C-10),
125.4 (C-6), 125.6 (C-5), 128.8 (C-2’, C-6’), 129.2 (C-3’,
C-5’), 131.0 (C-4’ ), 131.4 (C-1’), 134.6 (C-7), 141.3
(C-3), 155.3 (C-2 ), 155.5 (C-9), and 174.4 (C-4).
In this research we used a wild strain of A. niger
KB and four UV mutants of A. niger (13/5, SBJ, SBP,
MB). The KB strain comes from the collection of the
Department of Biotechnology and Food Microbiology
of Wrocław University of Environmental and Life Sciences (Poland), strain 13/5 comes from the University
of Life Sciences in Lublin (Poland) and strains SBJ,
SBP and MB come from Wrocław University of Economics (Poland). Microorganisms were maintained
on sterilized potato slants at 5°C. The wild strain of
P. chermesinum 113 was obtained from the collection
of the Department of Chemistry of Wrocław University of Environmental and Life Sciences (Poland). The
microorganism was maintained on Sabouraud 4% dextrose-agar slopes and freshly subcultured before use in
the transformation experiments.
Screening tests and preparative-scale biotransformations were carried out according to the procedure
described earlier (Kostrzewa-Susłow and Janecz
ko,
2012a; 2012b). The spectral data of the product obtained
are presented below.
3’-Hydroxyflavon-3-yloxymethyl myristate (C30H38O6):
Yellow oily liquid. Rt 17.06 min (HPLC). Purity
97% (HPLC). HRESI-MS: m/z = 495.1032 [M+H+];
found 495.1026. 1H NMR (DMSO-d6) δ: 0.86 (3H, t,
J = 7.0 Hz, 13”-CH3), 1.229–1.231 (14H, m, H-4”-H-10”),
* Corresponding author: E. Kostrzewa-Susłow, Department of Chemistry, Wrocław University of Environmental and Life Sciences,
Norwida 25, 50-375 Wrocław, Poland, fax: +48-71-3284124; e-mail: [email protected]
112
1
Kostrzewa-Susłow E. et al.
1.239–1.261 (6H, m, H-3”,11”,12”), 1.55 (2H, tt, J = 7.67
Hz, H-2”), 2.25 (2H, t, J=7.4 Hz, H-1”), 5.22 (2H, s,
O-CH2-O), 7.30 (1H, m, H-4’), 7.39 (1H, ddd, J6.5 = 7.9,
J6.7 = 7,1 Hz, J6.8 = 1,1 Hz, H-6), 7.49 (3H, m, H-8, 2’,
5’), 7.66 (1H, ddd, J7.8 = 8.4 Hz, J7.6 = 7.1 Hz, J7.5 = 1.7
Hz, H-7), 7.85 (1H, m, H-6’), 7.91 (1H, s, -OH), and
8.19 (1H, dd, J5.6=8.0, J5.7 = 1.7 Hz, H-5). 13C NMR
(DMSO-d6) δ: 14.3 (C-13”), 25.7 (C-2”), 29.1 (C-10”),
29.3 (C-8”), 29.3 (C-9”), 29.4 (C-7”), 29.5 (C-6”), 29.6
(C-5”), 29.7 (C-4”), 29.8 (C-3”), 30.1 (C-11”), 31.8
(C-12”), 34.1 (C-1”), 83.0 (O-CH2-O), 111.5 (C-2’),
116.9 (C-4’), 117.3 (C-6’), 119.4 (C-8), 124.2 (C-10),
125.6 (C-6), 125.7 (C-5), 130.0 (C-5’), 132.6 (C-1’),
134.7 (C-7), 149.2 (C-3), 151.0 (C-3’), 155.5 (C-2),
155.7 (C-9), 175.1 (C-4), and 180.8 (O-C = O).
Screening tests revealed six strains of filamentous
fungi capable of biotransformation of 3-methoxyfla-
vone: a wild strain of A. niger KB, its four UV-mutants
(A. niger MB, SBP, SBJ, 13/5) and the strain of P. cherme
sinum 113. The initial study was performed according
to two procedures: in the first the substrate was added
to the cultivation media at the time of inoculation with
the microorganism, whereas in the second, it was added
72 hours after the inoculation. After 3, 6 and 9 days
samples were analyzed for product and unreacted substrate (Table I, II). All of the tested strains of Aspergillus
transformed 3-methoxyflavone into 3’-hydroxyflavon3-yloxymethyl myristate, using either cultivation procedure. P. chermesinum 113 was also capable of this
transformation, but only when the substrate was added
to the cultivation media in the last phase of logarithmic
growth of the mycelium (Table II). For all of the tested
Aspergillus strains the biotransformation was more efficient when the substrate was added to the cultivation
Table I
Biotransformation of 3-methoxyflavone (substrate added at the time of inoculation)
– yield (%) of product determined by HPLC
Time of incubation (days) →
Microorganism
3
6
Product
9
Yield (%)
A. niger KB
3’-hydroxyflavon-3-yloxymethyl myristate53.764.869.8
Unreacted substrate
A. niger MB
Unreacted substrate
38.224.115.5
73.263.253.0
A. niger SBP 3’-hydroxyflavon-3-yloxymethyl myristate38.750.463.1
Unreacted substrate
A. niger SBJ
Unreacted substrate
60.046.327.3
75.970.959.8
A. niger 13/5 3’-hydroxyflavon-3-yloxymethyl myristate10.120.320.5
Unreacted substrate
87.873.270.0
Table II
Biotransformation of 3-methoxyflavone (substrate added 72 hours after inoculation)
– yield (%) of product determined by HPLC
Microorganism
Time of incubation (days) →
3
Product
6
9
Yield (%)
A. niger KB
3’-hydroxyflavon-3-yloxymethyl myristate
13.7
16.2
18.4
Unreacted substrate
81.2
70.7
65.0
A. niger MB
16.3
16.2
16.2
Unreacted substrate
80.1
80.0
78.2
A. niger SBP
26.2
26.9
27.3
Unreacted substrate
72.1
69.7
65.1
A. niger SBJ
13.3
15.6
17.2
Unreacted substrate
80.4
75.1
70.1
A. niger 13/5
12.7
13.5
14.1
Unreacted substrate
80.3
77.0
70.2
P. chermesinum 113
16.7
19.2
23.8
Unreacted substrate
80.1
73.3
65.1
1
Short communication
113
Scheme 1. Biotransformation of 3-methoxyflavone in the culture of A. niger (KB, MB, SBP, SBJ, 13/5) and P. chermesinum 113.
Scheme 2. Mechanism of demethylation.
Scheme 3. Probable course of biotransformation of 3-methoxyflavone.
media at the time of inoculation with the microorganism. A. niger KB and A. niger SBP gave the highest yields
of the product after 9 days, i.e. 69.8% and 63.1%, respectively. The least efficient strain for this biotransformation was A. niger 13/5 (Table I, II).
The preparative scale biotransformation of 3-metho
xyflavone was carried out using the strain of A. niger KB
in a 9-day reaction. 3’-Hydroxyflavon-3-yloxymethyl
myristate was isolated in 65% yield (Scheme 1) and
identified by 1H NMR and 13C NMR. In the 1H NMR
spectrum the signal of the substrate methoxyl group at
C-3 (δ = 3.81 ppm) disappeared and a two proton singlet at δ = 5.22 ppm attributed to a –O-CH2-O- group
appeared. Seven new signals integrating for a total of
24 protons and a singlet of 3H at δ = 0.86 ppm indicate the presence of a 13-carbon alkyl chain of a saturated fatty acid (myristic acid) bonded at C-3 of the
flavone by means of the ester bond. The ester carbonyl
group is confirmed by the signal at δ = 180.8 ppm in
the 13C NMR. The presence of a hydroxyl group in the
B-ring was proved by the new one-proton singlet at
δ = 7.91 ppm which was not present in the spectrum of
the substrate. The location of the hydroxyl group was
determined by analyzing the shape and chemical shift
of the B-ring protons. The 2’ and 6’ protons and the
4’ and 5’ protons are nonequivalent in the 1H NMR of
the product. In the 13C NMR the C-3’ signal is shifted
from δ = 129.2 ppm for the substrate to δ = 151.0 ppm
for the product.
The mechanism of oxidative O-demethylation of
methyl ethers by cytochrome P450 proposed by Watanabe is presented in Scheme 2 (Watanabe et al., 1982).
In the biotransformation of 3-methoxyflavone catalyzed by the strains of Aspergillus and Penicillium the
intermediate hemiacetal is presumably esterified with
myristic acid present in the cultivation mixture. Miristic
acid is produced by the strains of Aspergillus. The pre
sence of considerable myristic acid has been observed
114
1
Kostrzewa-Susłow E. et al.
in conidiophores of A. flavus (Budínská et al., 1981) in
the cells of A. ochraceus (Chavant and Sandolle, 1977)
and in the cells of A. niger (Parang et al., 1996).
The first step of enzymatic oxidation of 3-methoxyflavone resembles metabolism of methoxy derivatives
in mammals. The reaction is probably catalyzed by the
fungal monooxygenases of cytochrome P-450. The proposed mechanism of the biotransformation is presented
in Scheme 3. Earlier research on microbial transformations of monosubstituted flavones with methoxyl
groups in the A-ring (Kostrzewa-Susłow et al., 2012)
indicate that the strains of Aspergillus and P. chermes
inum used for this study perform non-typical demethylation which ends with introduction of myristic acid
in the favourable C-3 flavone position.
Conclusions. Transformation of 3-methoxyflavone
in the cultures of A. niger (KB, MB, SBP, SBJ, 13/5)
and P. chermesinum 113 is a two-step process involving enzymatic oxidation of both the methoxyl group
and the B-ring of the flavone and then esterification of
the –O-CH2-OH group with myristic acid. The highest yield of transformation was achieved for the strain
A. niger KB, when the substrate was added at the time
of inoculation.
Acknowledgements
This work was financed by the project “Biotransformations for
pharmaceutical and cosmetics industry” No. POIG.01.03.01-00158/09, which is partly-financed by the European Union within the
European Regional Development Fund for the Innovative Economy”
Literature
Budínská O., V. Kubin, J. Franĕk, J. Julák and J.A. Panos. 1981.
A lipopolysaccharide from Aspergillus flavus conidia. Folia Micro
biol. 26: 212–216.
Buisson D., J. Quintin and G. Lewin. 2007. Biotransformation
of polymethoxylated flavonoids: access to their 4-O-demethylated
metabolites. J. Nat. Prod. 70: 1035–1038.
Chavant L. and M. Sandolle. 1977. Les lipids de deux moisissures:
Mucor mucedo et Aspergillus ochraceus se dèveloppant sur meme
milieu. Physiol. Vèg. 15: 209–213.
Das S. and J.P.N. Rosazza. 2006. Microbial and enzymatic transformations of flavonoids. J. Nat. Prod. 69: 499–508.
Herath W., J.R. Mikell and I.A. Khan. 2009. Microbial metabolism.
Part 10. Metabolites of 7,8-dimethoxyflavone and 5-methoxyflavone.
Nat. Prod. Res. 23: 1231–1239.
Kostrzewa-Susłow E., J. Dmochowska-Gładysz, T. Janeczko,
K. Środa, K. Michalak and A. Palko. 2012. Microbial transformations of 6- and 7-methoxyflavone in Aspergillus niger and Penicillium
chermesinum cultures. Z. Naturforsch. 67c: 411–417.
Kostrzewa-Susłow E. and T. Janeczko. 2012a. Microbial transformations of 7-hydroxyflavanone. The Scientific World Journal.
2012:1-8. doi: 10.1100/2012/254929.
Kostrzewa-Susłow E. and T. Janeczko. 2012b. Microbial transformations of 7-methoxyflavanone. Molecules. 17: 14810–14820.
Parang K., E.E. Knaus, L.I. Wiebe, S. Sardari, M. Daneshtalab and
F. Csizmadia. 1996. Synthesis and antifungal activities of myristic
acid analogs. Archiv der Pharmazie. 329: 475–482.
Wang A., F. Zhang, L. Huang, X. Yin, H. Li, Q. Wang, Z. Zeng and
T. Xie. 2010. New progress in biocatalysis and biotransformation of
flavonoids. J. Med. Plants Res. 4: 847–856.
Watanabe Y., S. Oae and T. Iyanagi. 1982. Mechanisms of enzymatic S-oxygenation of thioanisole derivatives and O-demethylation
of anisole derivatives promoted by both microsomes and a reconstituted system with purified cytochrome P-450. Bull. Chem. Soc.
Jpn. 55: 188–195.
2014, Vol. 63, No 1, 115–119
SHORT COMMUNICATION
Zeaxanthin Biosynthesis by Members of the Genus Muricauda
SUDHARSHAN PRABHU, P.D. REKHA and A.B. ARUN*
Yenepoya Research Centre, Yenepoya University, Deralakatte, Mangalore, Karnataka State, India
Submitted 3 March 2013, revised 3 May 2013, accepted 16 November 2013
Abstract
Zeaxanthin, a C40 xanthophyll carotenoid, has potential biological applications in nutrition and human health. In this study we characterized
carotenoid composition in 5 taxonomically related marine bacterial isolates from the genus Muricauda. The pigment was characterized
using high performance liquid chromatography (HPLC) and mass spectrometry, which confirmed the presence of all-trans-zeaxanthin.
Muricauda strains produced zeaxanthin as a predominant carotenoid. M. flavescens JCM 11812T produced highest yield (4.4 ± 0.2 mg L–1)
when cultured on marine broth at 32°C for 72 h. This is the first report on the presence of zeaxanthin among the majority of species from
the genus Muricauda.
K e y w o r d s: Flavobacteriaceae, Muricauda, marine bacteria, zeaxanthin
Zeaxanthin is a potential biomolecule having antioxidant, anticancer properties and is known to prevent
age related macular degeneration (Krinsky et al., 2003).
Apart from plant sources, microbes have been found as
an important source of carotenoids particularly zeaxanthin (Hameed et al., 2011). Though many bacteria are
known to produce zeaxanthin, the major limitation for
their use in large scale commercial exploitation is that
they often produce mixed carotenoids similar to plant
source. Separation of zeaxanthin from total carotenoids
involves multiple purification steps and turns out to
be expensive. Selection of strains that grow faster and
accumulate high amount of zeaxanthin can facilitate
efficient extraction and purification processes. Isolation
of bacteria producing biocompatible natural zeaxanthin
as the major carotenoid in higher concentration will be
vital for meeting large scale demand. Most important
members that were reported earlier for the production
of zeaxanthin are Flavobactrium multivorum, Meso
falvibacter zeaxanthinfaciens, Zeaxanthinibacter enoshi
mensis, Muricauda lutaonensis and recently described
Siansivirga zeaxanthinfaciens (Asker et al., 2007a; b;
Hameed et al., 2011; 2012). However, zeaxanthin production dynamics in closely related strains or species
have not been studied.
Muricauda is a genus under the family Flavobac
teriaceae (Bruns et al., 2001) of marine origin. It currently encompasses seven type strains known to pro-
duce characteristic orange-yellow pigmented colonies
(Lee et al., 2012; Arun et al., 2009; Hwang et al., 2009;
Lee et al., 2012). M. lutaonensis CC-HSB-11T isolated
from a coastal hot-spring was first reported to produce
high amounts of zeaxanthin (Hameed et al., 2011).
However, no other details are available for zeaxanthin
production pertaining to other species in this genus.
Hence, this study was undertaken to investigate the
production of zeaxanthin by other members of the
genus Muricauda.
Four type strains of the genus Muricauda, namely,
M. aquimarina JCM 11811T, M. flavescens JCM 11812T,
M. lutimaris KCTC 22173T and M. lutaonensis KCTC
22339T and two environmental isolates, YUAB-SO-11
and YUAB-SO-45 isolated from Ullal and Cochin
beaches, South-West coast of India respectively were
used. All strains otherwise indicated were sub-cultured on marine agar 2216 (Difco) at 32°C, whereas,
M. lutaonensis at 42°C and stored in 30% glycerol at
–80°C. The two environmental isolates YUAB-SO-11
and YUAB-SO-45 were identified using 16S rRNA gene
sequencing according to the method described earlier
(Kämpfer et al., 2003). Sequence data was analyzed after
multiple sequence alignment. Sequences were submitted to GenBank (GenBank Accession Number:
YUAB-SO-11, JQ257008 and YUAB-SO-45, JQ346699).
Optimum growth and carotenoid production of the
strains was determined. Approximately 108 CFU mL–1
* Corresponding author: A.B. Arun, Deputy Director, Yenepoya Research Center Yenepoya University, Deralakatte, Mangalore- 575018,
Karnataka State, India; phone: +91 824 2204668/969/70 ext. 302; mobile: +91 9980856605; fax: +91 824 2204673, e-mail: bhagwatharun@
hotmail.com; [email protected]
116
Prabhu S. et al.
were inoculated into 100 mL flask containing 20 mL
marine broth 2216 (MB) and incubated at 32°C, in
the case of M. lutaonensis at 40°C, under shaking at
150 rpm for 120 h. Cell density was determined at 24 h
intervals by reading OD600 using an UV-Visible spectrophotometer (Shimadzu 1800). Cell dry weight (CDW)
was determined by centrifuging 1 mL of the broth culture at 7500 rpm in a pre-weighed vial and the pellet
was washed twice in sterile water and dried at 80°C to
constant weight. Characterization and quantification
of the carotenoid was carried out as outlined by (Asker
et al., 2007c; Hameed et al., 2011; Sanusi and Adebiyi,
2009). 10 mg of the lyophilized biomass was suspended
in 10 mL ethanol and incubated overnight at 50°C in
dark with agitation for carotenoid extraction. The
carotenoid in solution was separated from the biomass
by centrifugation (12000 rpm for 10 minutes at 4°C).
This step was repeated until complete extraction. The
solvent was evaporated under nitrogen gas in the dark
and re-dissolved in 1 mL of ethanol and subjected to
a full-wavelength scan (250–700 nm) using a UV-Visible
spectrophotometer (UV-Vis 1800, Shimadzu, Japan).
The peak obtained was plotted against calibration curve
constructed using standard zeaxanthin.
Purification and identification of the carotenoid was
carried out according to the methods outlined earlier
using HPLC (Asker et al., 2007). The HPLC system with
a diode array detector (L-2455, Hitachi) attached to RP
column (CAPCELL PAK C18 MG S-5, 35 × 4.6 mm,
5 µm particle size) maintained at 35°C, coupled to
a HPLC pump (L-2130, Hitachi) was used. Identification of the HPLC purified carotenoid was carried out
using mass spectrometry consisting of a linear ion trap
mass spectrometer (Thermo LTQ XL, USA) attached
to a LC plus system (Thermo Scientific). Conditions
(ion source, atmospheric pressure chemical ionization (APcI) source, operated in the positive ion mode;
sheath gas flow (N2), 50 arbitrary units; auxiliary gas
flow (N2), 10 arbitrary units; source voltage, 6 kV; capillary temperature, 300°C) were maintained. Full mass
scan was selected with a separation width of 2 m/z unit
for collision-induced dissociation with the collision
energy of 25 eV for detection. The carotenoids were
identified and confirmed using standard zeaxanthin.
All the strains used in this study showed the presence
of zeaxanthin exclusively.
The phylogenetic analysis of the Muricauda type
strains and two environmental isolates along with the
type strains of the genus Muricauda is given in Figure 1. The 16S rRNA gene sequence similarity in the
genus Muricauda ranged between 95.4–99.2%. Identification of the two isolates based on 16S rRNA gene
sequences revealed that both the isolates YUAB-SO-11
and YUAB-SO-45 (Fig. 1) belonged to the genus Muri
cauda. Strain Muricauda sp. YUAB-SO-11 was closely
1
Fig. 1. Phylogenetic analyses based on 16S rRNA gene sequences
showing the relationship between two recently isolated environmental strains, Muricauda sp. YUAB-SO-11 (Accession Number:
JQ257008) and Muricauda olearia YUAB-SO-45 (Accession Number: JQ346699) to other members of genus Muricauda. Distances
and clustering with the neighbor joining method were determined
by using the software package MEGA version 5. Bar, 0.01 substitutions per nucleotide.
related to M. aquimarina JCM 11811T (98.9% similarity) but could be distinguished clearly from the type
strain M. aquimarina JCM 11911T in the phylogenetic
analysis indicating that strain YUAB-SO-11 might
represent a novel species in the genus Muricauda. The
strain Muricauda sp. YUAB-SO-45 was closely related
to M. olearia (JCM 15563T) (99.2% similarity). Physiological and biochemical characterization of the Muri
cauda strains is provided in the Table I. Strain Muri
cauda sp. YUAB-SO-11 utilized only glucose and could
not utilize other carbon sources. The maximum biomass produced by different strains is listed in Table II.
Among the strains, M. flavescens JCM 11812T showed
the highest cell biomass yield (2.9 ± 0.1 g L–1) in marine
broth, whereas, strain M. lutaonensis KCTC 22339T
showed comparatively lower biomass (1.9 ± 0.1 g L–1) at
72 h of incubation in marine broth. Optimum growth
and carotenoid production for all the strains was at
pH 7–8 and 2–3% salinity (NaCl) and temperature
30–35°C except for the strain M. lutaonensis KCTC
22339T, which was 40°C. Preliminary spectrophotometric analysis of the ethanol-diluted crude carotenoid
from all the Muricauda strains showed typical absorption spectra with a λmax at 448 nm with shoulder peaks
identical to those of the standard all-trans-zeaxanthin.
1
117
Short communication
Table I
Differential physiological and biochemical characterstics of the genus Muricauda
Characteristics
Growth temperature (°C) Range
1
2
3
4
1
1
30–38
25–38
10–44
25–35
30–55
30–39
Optimum 32
32 30–37 30–32 37–4530–35
Growth pH
Range
Optimum
7–8 7–8 7.6 6.8–7.77.8 7–8
Growth with NaCl (%)
Range
2–10
Optimum2
5–9 5–9 5–9 5.2–9.46–9 5–9
2–10
2
2–9
2
2–6
2–6
1–10
2–3 3–5 2–3
Gliding motility
– –– –––
Spore formation
– –– –––
Enzyme activity Oxidase
+ ++ +++
Catalase
+ ++ +++
Nitrate reduction
– –– –––
Carbohydrate utilization
Glucose
+ ++ ++
ND
Fructose
– –+ –+–
Lactose
– ++ ++–
Raffinose
– –– ––+
Arabinose–
Melobiose
– ++ ++
Cellobiose–
Rhamnose
– –– –––
Hydrolysis of Casein
Gelatin
– –– ––+
–
–
–
–
+
–
–
+
ND
ND
–
–
+
ND
+
Strain 1, Muricauda sp.YUAB-SO-11; Strain 2; M. olearia YUAB-SO-45; Strain 3, M. aquimarina JCM 11811T, Strain 4,
M. olearia JCM 15563T, Strain 5, M. lutaonensis, KCTC 22339T, Strain 6, M. lutimaris KCTC 22173T, Data from Arun et al.,
2010, Hwang et al., 2009; Yoon et al., 2005 and this study. All the strains are negative for agar and starch hydrolysis. They do
not produce urease and H2S. All strains require NaCl for growth.
+, Positive; –, Negative; ND, no data available; w, weakly positive.
Table II
Total biomass and zeaxanthin yield produced by Muricauda strains cultured in marine broth
at 32°C or for M. lutaonensis at 42°C at 150 rpm.
Parameters
Growth time (h)
CDW (g/mL)
Zeaxanthin (mg/L)
Muricauda sp. YUAB-SO-11
48
2.6 ± 0.2
3.14 ± 0.2
Muricauda olearia YUAB-SO-45
72
2.1 ± 0.2
2.16 ± 0.1
Muricauda aquimarina (JCM 11811T)
72
2.3 ± 0.2
3.5 ± 0.1
Muricauda flavescens (JCM 11812T)
72
2.9 ± 0.1
4.4 ± 0.2
Muricauda lutaonensis (KCTC 22339T)
72
1.9 ± 0.1
3.1 ± 0.1
Muricauda lutimaris (KCTC 22173T)
72
2.3 ± 0.1
0.7 ± 0.1
Further investigation of the pigment by HPLC analysis resolved the zeaxanthin with a prominent peak
(RT, 10.8) comparable to standard zeaxanthin. This
fraction was subjected to mass analysis which exhibited a parent ion at m/z 569 and collusion-induced
disassociation fragments of m/z 551 and 419 which
were identical to that of standard all-trans-zeaxanthin
(Fig. 2). The compounds corresponding to peak-2
(RT, 13.87) and peak-3 (RT, 14.65) were predicted to be
other minor carotenoids respectively. The zeaxanthin
produced by M. flavescens JCM 11812T (4.4 ± 0.2 mg L–1)
was highest while by M. lutimaris KCTC 22173T was
the lowest (0.7 ± 0.1 mg L–1) (Table II). These results
indicate that zeaxanthin is the major pigment in the
genus Muricauda.
Zeaxanthin biosynthesis occurs via the mevalonate
pathway (MVA) or 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway by enzymatic reaction of β-caro
tene hydroxylase (CrtZ) which modifies the β-ring
(β-caro
tene) to zeaxanthin (Misawa 2011). Whole
genome sequencing of the strain M. rustringenesis DSM
13258T (Huntemann et al., 2012) showed the presence
of CrtZ gene. Accumulation of high concentration of
zeaxanthin in marine microorganisms including strains
Fig. 2. LC-MS/MS analysis of the crude ethanol extract of five Muricauda strains (A, Muricauda sp. YUAB-SO-11; B, M. olearia YUAB-SO-45; C, M. flavescens JCM 11812T; D, M. aquimarina
JCM 11811T; E, M. lutimaris KCTC 22173T). Chromatogram shows a peak at 10.92 minutes compared with the zeaxanthin standard. (B) MS/MS spectrum of carotenoid from all the strains
of Muricauda showed a parent peak at m/z 569, and subsequent fragments at m/z 551 and m/z 416.
118
Prabhu S. et al.
1
1
Short communication
from genus Muricauda might have an evolutionary role
in survival, in membrane stabilization, UV tolerance,
and as antioxidant protecting cell from oxidative stress
(Asker et al., 2012). Combining the information from
this study and available published data on zeaxanthin,
particularly from microbial source, it is evident that
zeaxanthin production is an important phylogenetic
trait of this genus. Increasing demand for zeaxanthin,
particularly from microbial source has gained significant interest due to its identical stereochemistry to
natural zeaxanthin which has lead researchers to identify potential zeaxanthin producing strains. Sphingob
acterium multivorum produced high zeaxanthin yield
(Bhosale et al., 2004), whereas Muricauda species produce zeaxanthin as a single predominant carotenoid
in higher quantities indicating strains from this genus
likely be potential candidates for large scale production
of zeaxanthin. Comparison of carotenoid distribution
in Muricauda strains with their 16S rRNA gene phylogeny indicates that the carotenoid distribution and composition is highly conserved between the species. In the
genus Muricauda, the uniform distribution of zeaxanthin strongly suggests that the carotenoid biosynthetic
pathway may be less evolutionary elastic resulting in
only certain structural types existing without giving
further scope for the diversification of carotenoids
within the genus (Klassen 2009; 2010).
The result of this study further enhances our current limited knowledge regarding the distribution and
diversity of carotenoid in family Flavobacteriaceae.
There is further scope for investigating the evolution
of carotenoids in these species within the concept of
biotechnology and exploiting their metabolic diversity.
This research work was kindly supported by a grant from Board
Research of Nuclear Science BRNS 28/34/2009.
Literature
Arun A.B., W.M. Chen, W.A. Lai, J.H. Chao, P.D. Rekha,
F.T. Shen, S. Singh and C.C. Young. 2009. Muricauda lutaonensis
sp. nov., a moderate thermophile isolated from a coastal hot spring.
Int. J. Syst. Evol. Microbiol. 59: 2738–2742.
Asker D., T.S. Awad, T. Beppu and K. Ueda. 2012. Novel zeaxanthin-producing bacteria isolated from radioactive hot spring water.
Methods Mol. Biol. 892: 99–131.
Asker D., T. Beppu and K. Ueda. 2007(a). Mesoflavibacter zeaxan
thinifaciens gen. nov., sp. nov., a novel zeaxanthin-producing marine
119
bacterium of the family Flavobacteriaceae. Syst. Appl. Microbiol. 30:
291–296.
Asker D., T. Beppu and K. Ueda. 2007(b). Zeaxanthinibacter enoshi
mensis gen. nov., sp. nov., a novel zeaxanthin-producing marine bacterium of the family Flavobacteriaceae, isolated from seawater off
Enoshima Island, Japan. Int. J. Syst. Evol. Microbiol. 57: 837–843.
Asker D., T. Beppu and K. Ueda. 2007(c). Sphingomonas jaspsi sp.
nov., a novel carotenoid-producing bacterium isolated from Misasa,
Tottori, Japan. Int. J. Syst. Evol. Microbiol. 57: 1435–1441.
Bhosale P. and P.S. Bernstein. 2004. Beta-carotene production by
Flavobacterium multivorum in the presence of inorganic salts and
urea. J. Ind. Microbiol. Biotechnol. 31: 565–571.
Bruns A., M. Rohde and L. Berthe-Corti. 2001. Muricauda ruestrin
gensis gen. nov., sp. nov., a facultatively anaerobic, appendaged bacterium from German north sea intertidal sediment. Int. J. Syst. Evol.
Microbiol. 51: 1997–2006.
Hameed A., A.B. Arun, H.P. Ho, C.M. Chang, P.D. Rekha,
M.R. Lee, S. Singh and C.C. Young. 2011. Supercritical carbon
dioxide micronization of zeaxanthin from moderately thermophilic
bacteria Muricauda lutaonensis CC-HSB-11T. J. Agric. Food. Chem.
59: 4119–4124.
Hameed A., M. Shahina, S.Y. Lin, K.R. Sridhar, L.S. Young,
M.R. Lee, W.M. Chen, J.H. Chou and C.C. Young. 2012. Siansivirga
zeaxanthinifaciens gen. nov., sp. nov., a novel zeaxanthin-producing
member of the family Flavobacteriaceae isolated from coastal seawater of Taiwan. FEMS Microbiol. Lett. 333: 37–45.
Huntemann M., H. Teshima, A. Lapidus, M. Nolan, S. Lucas,
N. Hammon, S. Deshpande, J.F. Cheng, R. Tapia, L.A. Goodwin
and others. 2012. Complete genome sequence of the facultatively
anaerobic, appendaged bacterium Muricauda ruestringensis type
strain B1T. Stand. Genomic. Sci. 6: 185–193.
Hwang C.Y., M.H. Kim, G.D. Bae, G.I. Zhang, Y.H. Kim and
B.C. Cho. 2009. Muricauda olearia sp. nov., isolated from crudeoil-contaminated seawater, and emended description of the genus
Muricauda. Int. J. Syst. Evol. Microbiol. 59: 1856–1861.
Kämpfer P., U. Dreyer, A. Neef, W. Dott and H.J. Busse. 2003.
Chryseobacterium defluvii sp. nov., isolated from wastewater. Int.
J. Syst. Evol. Microbiol. 53: 93–97.
Klassen J.L. 2009 Pathway evolution by horizontal transfer and positive selection is accommodated by relaxed negative selection upon
upstream pathway genes in purple bacterial carotenoid biosynthesis.
J. Bacteriol. 191: 7500–7508.
Klassen J.L. 2010. Phylogenetic and evolutionary patterns in microbial carotenoid biosynthesis are revealed by comparative genomics.
PLoS ONE 5: 11257.
Krinsky N.I., J.T. Landrum and R.A. Bone. 2003. Biological mecha
nisms of the protective role of lutein and zeaxanthin in the eye.
Annu. Rev. Nutr. 23: 171–201.
Lee S.Y., S. Park, T.K. Oh and J.H. Yoon. 2012. Muricauda beolgyo
nensis sp. nov., isolated from a tidal flat. Int. J. Syst. Evol. Microbiol.
62: 1134–1139.
Misawa N. 2011. Carotenoid β-ring hydroxylase and ketolase from
marine bacteria promiscuous enzymes for synthesizing functional
xanthophylls. Mar. Drugs 9: 757–771.
Sanusi R.A. and A.E. Adebiyi. 2009. Beta carotene content of
commonly consumed foods and soups in Nigeria. Pak. J. Nutr. 8:
1512–1516.
2014, Vol. 63
Instruction for Authors
Submission of manuscripts: http://pjm.indexcopernicus.com/
Instructions for authors:
http://www.pjm.microbiology.pl/ and http://pjm.indexcopernicus.com/
Scope
Polish Journal of Microbiology publishes descriptions
of all aspects of basic and applied research that focus on
topics of practical value in microbiology. Topics that are
considered include microbiology in the area of basic bio
logical properties of bacteria and archaea, viruses, and simple eukaryotic microorganisms, genetics and molecular bio
logy, microbial ecology, medical bacteriology, public health
as well as food microbiology, industrial microbiology and
bacterial biotechnology. A manuscript of the original paper
(full length paper and short communication) submitted to
Pol. J. Microbiol must present reports of original research
that have not been previously published and are not being
considered for publication elsewhere. All authors of manuscripts are responsible for their content and it is assumed
that they all have contributed substantially to the presented
research, read and approved the manuscript.
Minireviews in areas of particular interests and importance in microbiology are also published. They are usually
invited, but authors wishing to submit a mini-review should
contact the Editor in Chief directly for further information
How to Submit Manuscripts
Manuscripts should be submitted at http://pjm.indexcopernicus.com/. The system requires one-time registration. The selected login and password allow future submission of new articles as well as checking the status of the
editorial processing of a manuscript already submitted.
A hort instruction for authors on how to use the system is
given below. To ensure best cooperation with the editorial
office submitted manuscripts should meet the following
requirements:
– Manuscript files (text and tables) should be in Word 7
format (old version with extension .doc). Initial versions
of figures and photos should be prepared as single jpg or
pdf files
–After receiving a Letter of Acceptance, please submit
illustrations at their intended publication size in tiff format (with LZW compression) at the correct resolution:
300 dpi for greyscale and colour, 600 dpi for combination
art (lettering and images) and 1200 dpi for line art. Halftone images (those with various densities or shades) must
be prepared in tiff, not bitmap or jpg. For instructions on
creating acceptable tiff files, refer to the Cadmus digital
art website.
– The manuscript should be accompanied by a cover letter
stating the postal address, phone and fax numbers and
e-mail of the corresponding author who is responsible
for all correspondence regarding the submitted paper.
Receipt of each manuscript will be automatically confirmed by e-mail to the corresponding author. The manuscript will be assigned a PJM number which the corresponding author is asked to refer to in all correspondence
with the editors. Correspondence is mainly by e-mail.
– The manuscript should contain a “running title”, about
50 characters in length, including spaces.
– Before writing a manuscript the authors are advised to
consult a current issue of the Polish Journal of Microbio
logy and carefully read the Instructions for Authors
(available at www.pjm.microbiology.pl and printed in the
first issue of every volume) in order to be familiar with
the general form of papers published.
– The manuscript should be written in English. Grammar,
syntax and spelling must be carefully checked before submission of the paper. Authors who are unsure of proper
English usage should have their manuscript checked by
someone proficient in both the English language and biological terminology. Manuscripts may be rejected on the
basis of poor English or lack of conformity to accepted
standards of style before the review process.
– After submission of the manuscript, only internal messaging system available through http://pjm.indexcopernicus.
com web page after login should be used.
There is no page charge for publication in PJM, except
for colour illustrations. If you encounter problems with electronic submission of the manuscript, please contact us at:
[email protected]
The Review Process
All manuscripts are subjected to pre-screening by the
Editor in Chief and can be rejected at this stage or returned
for corrections before evaluation (if they do not meet the
criteria given in the Instruction to Authors, including language quality or are out of the scope of PJM). After passing
the pre-screening stage the manuscripts are processed by
one of the editors and sent to at least one qualified outside
referee, but the editors themselves may also act as reviewers.
122
4
Authors may suggest, in the cover letter, the names (together
with contact details) of up to 5 potential referees which may
be used at the discretion of the editor. When a manuscript is
returned to the authors for revision, it should be sent back
to the editorial office within 3 months; otherwise it may be
considered withdrawn.
When the manuscript is accepted for publication the
transfer of copyright to the Publisher takes effect. The articles are generally printed in no more than three months
after returning the corrected version and obtaining its final
acceptance.
The entire process of review and manuscript preparation is carried out electronically. All messages to the editor
must be sent via internal messaging system available on
the http://pjm.indexcopernicus.com/ web page after login.
The author can also track the status of the manuscript using
journal submission system http://pjm.indexcopernicus.com/
Preparation of Manuscripts
Regular paper
The manuscript of the full length original paper in general should not exceed 20 typed pages (up to 1800 characters
per page) including tables and figures. Type every portion
of the manuscript double-spaced using 12 points Times
New Roman. Do not use bolded fonts except for subtitles
or italics except for microorganism names (Escherichia coli),
genetic loci (repA) or Latin words like: in vivo, et al., etc.,
journal title abbreviations (J. Bacteriol.) and book titles (not
titles of the chapters). No part of the manuscript should be
underlined and written using CAPITAL letters). Number
all pages in sequence, including abstract, tables, figures and
figure legends.
The full length paper should be divided into the following sections written in sequence: Title, Abstract, Introduction, Experimental: Materials and Methods, Results, Discussion, Acknowledgments, Literature.
Key words
Up to five keywords or short phrases should be given
below the abstract. If names of microorganisms are used,
they should precede the key words, and be followed by the
latter in alphabetical order. All keywords should be relevantly connected with the subject matter (avoid common
terms like: bacteria, medium, soil, temperature etc.) as they
will be used for indexing purposes.
Introduction
The introduction should provide background information to allow the reader to understand and evaluate the
results of the present study and describe the purpose of the
undertaken research. However, broad “academic lectures”
on the subject and extensive literature reviews should be
avoided.
Experimental
The title should describe the contents of the paper in
a concise but attractive for readers way. Below the title
of the manuscript include: full name (including first name
and middle initial) of each author, name of the institution(s)
at which the work was performed, or each co-author’s
affiliation if different. Street address, telephone/fax number and e-mail address should be given only for the corresponding author and placed in the footnote at the bottom of
the first page.
This section should contain description of materials (biological and others) used and sufficient technical information
so that the experiments can be repeated. For commonly used
materials and methods (e.g. commonly used media, protein
determination) a simple reference is sufficient. Novel or
modified procedures should be described in detail.
When a large number of microbial strains or mutants
were used in a study, include strain tables identifying the
sources and properties of the strains, mutants, bacteriophages, plasmids, etc. For names of microorganisms, follow the guidelines of the International Nomenclature
Committee (up to date names available as validation list
of International Journal of Systematic and Evolutionary
Microbiology). Species names are written in full the first
time the name appears in text; subsequently, only use the
first letter of the genus name followed by the species epithet
(e.g. Escherichia coli, then E. coli). Genetic loci are italicized
(repA), protein products of the loci are not italicized (RepA).
The source of materials (media or chemicals) should be
indicated if critical for the validity of experimental results.
For centrifugation conditions preferably give the centrifuge
forces in “g” (10 000 x g) rather than rpm.
Units of measurement should be used in SI system,
but for practical reasons, some exceptions to SI units are
allowed; e.g. for litre use “l” not “L” (1 l not 1 L, 20 mg/ml
not 20 mg/mL). Always include a space between the number
and the unit (2 mM not 2 mM).
Abstract
Results
Limit the abstract to 250 words or fewer. Because the
abstract will be published separately by abstracting services,
it must be complete and understandable without reference
to the text. It should be written in an impersonal form.
Abbreviations, diagrams and references are not allowed.
In the “Results” section, include only the results of the
experiments; reserve extensive interpretation of the results
for the “Discussion” section. When justified by the nature
of the paper the ,,Results” and ,,Discussion” sections may be
combined (e.g. “Results and Discussion”). Present the results
Title
4
123
as concisely as possible and illustrate them with tables or
figures if applicable (presentation of the same results in both
tables and figures is not acceptable). Avoid the use of graphs
to present data that might be more concisely presented in
the text. Limit illustrative materials to those that are absolutely necessary to demonstrate the original experimental
findings. Number figures (Arabic numerals) and tables
(Roman numerals) in the order in which they are cited in
the text, and be sure to cite all figures and tables.
Tables. Each table must be typed on a separate page
and numbered with a Roman numeral (Table I., etc.) in the
order it is cited in the text. The headings should be sufficiently clear so that the data will be understandable without
reference to the text. Explanatory footnotes are acceptable.
Prepare your tables as simple as possible in Word, not in
Excel. No “decorative” frames should be made.
Figures (graphs, diagrams etc.) should be submitted
ready for reproduction, each on a separate sheet. The preferred graphic application is Photoshop or CorelDraw saved
in tiff format (with LZW compression). Figures should be
numbered as in the text (Arabic numerals, Fig. 1., etc.) and
marked with the name of the first author. Figures should
be understandable without referring to the text. Original
recorder tracing (outprints) of NMR, IR, ESR spectra etc.
are not acceptable for reproduction; they should be redrawn.
Figure titles and legends must be listed on a separate page.
Photographs need to be in good quality with proper resolution used (minimal resolution are 300 for halftones and
600 dpi for combination of photos with lettering). Colour
illustrations can be made only at the author’s expense (further details are available at the Editorial Office).
New nucleotide sequences must be accompanied by
the accession number obtained from proper databases and
should be included in the text.
Discussion
The “Discussion” should provide an interpretation of the
obtained results in relation to previously published work and
to the experimental system at hand and should not contain
extensive repetition of the ,,Results” section or reiteration of
the introduction. In some papers the Results and Discussion
can be combined into one section as mentioned above.
Acknowledgements
Acknowledgements for financial support and for a personal assistance (with the permission of person named) are
given in two separate paragraphs below the main text.
tions of “historical” papers except if absolutely necessary.
In the text references should be cited by the names of
the authors and the year of publication, e.g. Nowak and
Kowalski (1999) stated that...; as previously described
(Nowak and Kowalski, 2000; Nowak, 2005). When a paper
has more than two authors, the first author’s name should be
followed with et al. and the year of publication, e.g. Nowak
et al., 2002. While references occur that are not identified
by the authors’ names and year, use a, b etc. after the year
(Nowak et al., 2002a; 2002b).
The list of the papers cited (Literature) must be arranged
alphabetically according to the last name of the first author
and not numbered. Papers with one only author are listed
in chronological order (the earliest first); papers with two
authors are listed alphabetically according to the last name
of the first author and by the last name of the second author;
paper with three or more authors appear as those with two
authors and are listed chronologically. When the paper
has more than ten authors, give the names of the first ten,
followed by .. ..and others. For citations of books, books
chapters, thesis, printed conference proceedings etc. see
examples given below.
Please follow the punctuations, brackets, capital letters etc. exactly as shown. Put “and”, not “&” before the last
author’s name. Use the proper journal title abbreviations
(ISO) as indicated in the PubMed Journal Database.
Examples of literature citations
Books and book chapters:
Sambrook J., E.F. Fritsch and T. Maniatis. 1989. Molecular
Cloning; a Laboratory Manual, 2nd ed. Cold Spring Harbor,
NY: Cold Spring Harbor Laboratory.
Snyder L. and W. Champness. 2003. Molecular Gene
tics of Bacteria. 2nd ed. ASM Press, Washington, D.C.
Funnel B.E. and G.J. Phillips (eds). 2004. Plasmid Biology.
ASM Press, Washington, D.C.
Belfort M., V. Derbyshire, M.M. Parker, B. Cousineau and
A.M. Lambowitz. 2004. Mobile introns: pathways and proteins, pp. 761–783. In: Funnel B.E. and G.J. Philips (eds).
Plasmid Biology. ASM Press, Washington, D.C.
Journal articles:
1 author:
Eckhardt T. 1978. A rapid method for identification of plasmid desoxyribonucleic acid in bacteria. Plasmid 1: 584–588.
Literature
2 authors:
Sołyga A. and D. Bartosik. 2004. Entrapment vectors – how
to capture a functional transposable element. Pol. J. Micro
biol 53: 139–144.
It is the responsibility of the authors to verify each reference against the original article as well as make sure that
each paper cited in the text is included in the list. Keep
the number of citations reasonable, avoid exhaustive cita-
3 to 10 authors:
Bartosik D., M. Szymanik and J. Baj. 2004. Identification
and distribution of insertion sequences of Paracoccus sol
ventivorans. Appl. Environ. Microbiol. 69: 7002–7008.
124
4
More than 10 authors:
Roberts R.J., M. Belford, T. Bestor, A.S. Bgagwat, T.A. Bickle,
J. Bitinaite, R.M. Blumenthal, S.K. Degtyarey, D.T. Dry den,
K. Dybyig and others. 2003. A nomenclature for restriction
enzymes. DNA methyl-transferases, homing endonucleases
and their genes. Nucleic Acids Res. 31: 1805–1812.
Papers in a language different than English – the title
should be translated into English and the original language
should be stated in parenthesis.
Bartosik D. 2001. Bacterial plasmids stability (in Polish).
Post. Biochem. 47: 138–145.
Ph.D. Thesis:
Szymanik M. 2006. Ph.D. Thesis, (title optional). Warsaw
University. Warsaw. Poland.
Conference materials (exceptionally):
Dziewit L., M. Jazurek, L. Drewniak, J. Baj and D. Bartosik.
2006. Identification of a novel family of addiction systems.
Abstracts of International Plasmid Biology Conference. Plas
mid Biology 2006. Fallen Leaf Lake, South Lake Tahoe California. USA. p. 163.
Papers in press or personal communication and unpublished results should not be included in the Literature citation list.
Short communications
A short communication is intended for the presentation of brief observations that do not warrant a full-length
paper. Submit it in the same way as a full-length paper. Each
Short communication must have an abstract of no more
than 100 words. Do not use sections heading in the body of
the text. All the required formation (introduction, methods,
results and discussion) except for the Literature must be
given in single section. Total length cannot exceed 8 double printed pages including illustrative material (in total no
more than 3 figures and tables). They undergo the same
review process as full length papers and are not printed
more quickly.
Minireviews
Minireviews are published in areas of particular interest
and importance. They are usually invited, but all authors
wishing to submit a minireview are welcome. Authors need
to be experts on the topic reviewed documented with published achievements in the field.
Proofs
The text for proofreading will be e-mailed (as a .pdf
file) to the corresponding author. It should be printed out
and after introducing necessary corrections, all corrections
should be returned by e-mail to the editorial office as soon
as possible.
Reprints
Beginning 2007 the Journal will not provide free
reprints. The corresponding author will be provided with
a pdf of his or her article by the Editorial Office. If printed
copies of the article are required they can be ordered (in
multiples of 20) together with return of the corrected proof.
The reprints will be mailed after receiving payment (conditions of payment may be obtained at [email protected],
Ms Beata Mazinska).
Copyrights
Submission of the manuscript implies that the research
presented has not been published before (except in the form
of a conference abstract or a part of PhD thesis). Transfer of
copyrights to the publisher becomes effective if and when
the article is accepted for publication. All articles published
in Polish Journal of Microbiology are protected by copyrights which cover the exclusive rights to reproduce and
distribute the article as well as the translation. No part of
the published material can be reproduced without obtaining
written permission from the publisher.

from microbiology.pl - Polish Journal of Microbiology

Transkrypt

Podobne dokumenty

impact of trichoderma isolates on the mycelium development of wild

ORIGINAL PAPERS

Load PDF - Protistology

International Journal of Pharmaceutics The interaction between