Pobierz PDF (Full Text)

Komentarze

Transkrypt

Pobierz PDF (Full Text)
ISSN 1895 - 4421
EPISTEME
CZASOPISMO NAUKOWO-KULTURALNE
KRAKÓW
Nr 22/2014, t. III
EPISTEME
CZASOPISMO NAUKOWO-KULTURALNE
Redakcja:
Zdzisław Szczepanik (red. naczelny)
Katarzyna Daraż-Duda (sekretarz redakcji)
Piotr Walecki
Grzegorz Chajko
Krzysztof Duda
Roman Turowski (red. techniczny)
Rada Naukowa:
Prof. dr hab. Dariusz Rott
Prof. dr hab. Włodzimierz Sady
Prof. dr hab. Michał Śliwa
Prof. dr hab. inż. Ryszard Tadeusiewicz
Prof. dr hab. Bogdan Zemanek
Ks. Prof. dr hab. Władysław Zuziak
Prof. nadzw. dr hab. Wiesław Alejziak
Prof. Ignatianum i UJ, dr hab. Józef Bremer SJ
Prof. dr przew. kwal. II Paweł Taranczewski
Prof. UP dr hab. Andrzej Kornaś
Prof. dr Olga E. Kosheleva
Prof. dr Marko Jacov
Prof. dr Aleksandr Lokshin
Prof. dr Hans Jørgen Jensen
Prof. dr Oleksandr Chyrkov
Prof. dr Iryna Diachuk
Prof. dr Luiza Arutinov
Prof. dr hab. Michaił Pawłowicz Odesskij
Prof. dr hab., dr. phil. Andrzej Wiercinski
Prof. dr eng. Elena Horska
Wydawca:
Stowarzyszenie Twórców Nauki i Kultury „Episteme”
ul. Okólna 28/87
30-669 Kraków
www.episteme-nauka.pl
© Stowarzyszenie Twórców Nauki i Kultury „Episteme” i Autorzy
Pierwotną wersją czasopisma jest wersja papierowa
SPIS TREŚCI
Ogrodnictwo i zielarstwo
Dorota Blatsios, Eliza Antkowiak, Honorata Bryłkowska, Anna Adamek
Marlena Banaś, Dominika Buchert, Renata Galek
Wpływ 6-(γ, γ-dimetyloalkiloamino) puryny
na mikrorozmnażanie rosiczki łyżeczkowatej
(Drosera spatulata Labill.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
Joanna Bonio, Klaudia Duda
ZANIECZYSZCZENIA MYKOLOGICZNE POWIETRZA W OGRODZIE
BOTANICZNYM UNIWERSYTETU JAGIELLOŃSKIEGO W KRAKOWIE
I ARBORETUM SZKOŁY GŁÓWNEJ GOSPODARSTWA WIEJSKIEGO
W ROGOWIE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Monika Czaja, Anna Kołton, Piotr Muras, Ewa Muszyńska
Dynamics of nitrogen compounds changes in the leaves
of selected urban trees during the growing season . . . . . . . . . . . 25
Maja Dobińska, Anna Witek, Elżbieta Wojciechowicz-Żytko
WPŁYW WARUNKÓW MIEJSKICH NA WYSTĘPOWANIE MSZYCY BZOWEJ
(APHIS SAMBUCI L.) ORAZ OWADÓW DRAPIEŻNYCH NA BZIE CZARNYM
(SAMBUCUS NIGRA L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
Klaudia Duda, Joanna Bonio
GRZYBY BYTUJĄCE NA MAGNOLII SOULANGE’A
(MAGNOLIA X SOULANGEANA SOUL.-BOD.) W OGRODZIE BOTANICZNYM
UNIWERSYTETU JAGIELLOŃSKIEGO W KRAKOWIE . . . . . . . . . . . . . . . . . . . . . . 41
Marta Izajasz-Parchańska, Monika Białobrzeska
Możliwość uprawy winorośli w okolicach Krakowa
na podstawie wybranych wskaźników agroklimatycznych . . . . 49
Katarzyna Jagiełło-Kubiec, Agnieszka Ilczuk, Paweł Petelewicz
Effect of selected factors on rooting of ninebark
microcuttings (Physocarpus opulifolius (L.) Maxim.)
DIABLE D’OR ‘Mindia’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
Spis treści
Aleksandra Koźmińska, Ewa Muszyńska
WPŁYW JONÓW OŁOWIU NA ALYSSUM MONTANUM
W KULTURZE IN VITRO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67
Anna Konieczny, Iwona Kowalska
Wpływ mikoryzy arbuSkularnej na zawartość składników
pokarmowych w środowisku korzeniowym pomidora . . . . . . . . . . 75
Anna Krawczyk, Agnieszka Lis-Krzyścin
ODCZYN GLEB MIEJSKICH ORAZ ZAWARTOŚĆ METALI CIĘŻKICH
W ALEJACH TRZECH WIESZCZÓW W KRAKOWIE . . . . . . . . . . . . . . . . . . . . . . . . 83
Ewelina Kwaśniewska
Inicjacja i stabilizacja kultur in vitro wybranych
róż historycznych . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
Marta Leśniak, Maria Pobożniak, Michał Pniak
WPŁYW OLEJKU POMARAŃCZOWEGO ORAZ SYNTETYCZNEGO
POMARAŃCZOWEGO AROMATU NA TETRANYCHUS URTICAE (KOCH.),
APHIS PHOMI (DEG.) I ERIOSOMA LANIGERUM (HASM.) . . . . . . . . . . . . . . . . . 101
Gabriela Machaj
MAPOWANIE REJONU GENOMU MARCHWI ISTOTNEGO
DLA PROCESU UDOMOWIENIA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
Magdalena Malinowska, Elżbieta Sikora, Jan Ogonowski
ANALYTICAL METHODS IN THE IDENTIFICATION
OF TRITERPENES ISOLATED FROM BIRCH BARK . . . . . . . . . . . . . . . . . . . . . . . 117
Ewa Muszyńska, Barbara Piwowarczyk, Anna Kołton, Monika Czaja
Effect of nitric oxide and hydrogen peroxide
on seed germination and enzymes activity in Avena fatua
seedlings under cadmium stress . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123
Adriana Nowicka-Połeć, Katarzyna Kałużny, Anna Magdalena Ambroszczyk
WPŁYW PREPARATÓW EMFARMA™ i LIGNOHUMAT®
NA PLONOWANIE I SKŁAD CHEMICZNY NASION I LIŚCI BOBU
(VICIA FABA VAR. MAJOR) W OPÓŹNIONEJ UPRAWIE POLOWEJ . . . . . . . . . 131
Beata Ochał, Jan Błaszczyk
WPŁYW PREPARATÓW ORGANICZNO-MINERALNYCH
NA PLONOWANIE I JAKOŚĆ JABŁEK ODMIANY LIGOL . . . . . . . . . . . . . . . . . . 139
Agnieszka Ilczuk, Paweł Petelewicz, Katarzyna Jagiełło-Kubiec
Effect of Beta-Chikol on acclimatization to ex vitro
conditions of common ninebark (Physocarpus
opulifolius (L.) Maxim.) ‘Red Baron’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
4
Spis treści
Julia Rochala, Diana Anna Musiał, Ewa Skutnik, Agata Jędrzejuk
SENESCENCE IN CUT COSMOS BIPINNATUS FLOWERS:
WATER RELATIONS AND MEMBRANE PERMEABILITY . . . . . . . . . . . . . . . . . . 155
Joanna Śniegowska, Anita Biesiada
Związki biologicznie czynne i aktywność antyoksydacyjna w
wybranych gatunkach warzyw z rodziny Brassicaceae
i Asteraceae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163
Karolina Wietnik, Piotr Muras, Anna Kołton, Monika Czaja
OCENA STANU FIZJOLOGICZNEGO APARATU FOTOSYNTETYCZNEGO
TRZECH GATUNKÓW RÓŻANECZNIKÓW (RHODODENDRON SP.)
W OKRESIE SPOCZYNKU . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
Anna Witek, Maja Dobińska, Elżbieta Wojciechowicz-Żytko
ZALEŻNOŚCI POMIĘDZY CZYNNIKAMI SIEDLISKOWYMI
A LICZEBNOŚCIĄ I BOGACTWEM SKŁADU GATUNKOWEGO
MUCHÓWEK NALEŻĄCYCH DO RODZINY SYRPHIDAE
W OKOLICY OJCOWSKIEGO PARKU NARODOWEGO . . . . . . . . . . . . . . . . . . . . 179
uprawa roli i roślin
Marcin Andrzejewski, Anna Krzepiłko, Iwona Zych-Wężyk
Zużycie oraz ceny nawozów mineralnych
w Polsce w latach 2008 – 2012 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
Ada Biela, Aleksander Owczarek
WPŁYW WYBRANYCH CZYNNIKÓW INDUKUJĄCYCH STRES SUSZY
NA WZROST KALUSA PSZENICY JAREJ (Triticum L.) . . . . . . . . . . . . . . . . . . . 195
Barbara Biniaś, Janina Gospodarek, Milena Rusin
WPŁYW WYBRANYCH WYCIĄGÓW ROŚLINNYCH NA ŻEROWANIE
PCHEŁKI CHRZANOWEJ (PHYLLOTRETA ARMORACIAE KOCH)
NA CHRZANIE (ARMORACIA RUSTICANA GAERTN) . . . . . . . . . . . . . . . . . . . . . . 203
Roman Bezus, Anastasiia Cherniavska, Maciej Chowaniak,
Dorota Gala, Andrzej Joniec, Marcin Niemiec
WPŁYW NACHYLENIA STOKU, SYSTEMU UPRAWY I OKRYWY
ROŚLINNEJ NA WYBRANE WŁAŚCIWOŚCI FIZYCZNE GLEBY . . . . . . . . . . . . . 211
Roman Bezus, Iuliia Amelina, Maciej Chowaniak
INFORMATIZATION OF SOCIETY AS A GUARANTEE
OF CONSUMPTION OF ORGANIC PRODUCTS . . . . . . . . . . . . . . . . . . . . . . . . . . 221
5
Spis treści
Iwona Florczak, Sylwia Andrusiewicz, Jacek Słoma, Marek Klimkiewicz
Wpływu procesu prasowania obierek ziemniaczanych
na właściwości powstałych materiałów . . . . . . . . . . . . . . . . . . . . . . . 231
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Maciej Chowaniak
WPŁYW NAWOŻENIA AZOTEM I APLIKACJI EFEKTYWNYCH
MIKROORGANIZMÓW NA WYSTĘPOWANIE CHORÓB PODSUSZKOWYCH I CHORÓB LIŚCI W UPRAWIE PSZENICY JAREJ . . . . . . . . . . . 239
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Andrzej Joniec
WPŁYW NAWOŻENIA AZOTOWEGO NA WYSTĘPOWANIE
SZKODNIKÓW W UPRAWIE PSZENICY JAREJ . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
Andrzej Joniec, Dorota Gala, Maciej Chowaniak
WYBRANE PARAMETRY FIZYCZNE GLEBY
W TRADYCYJNEJ I UPROSZCZONEJ UPRAWIE BOBIKU . . . . . . . . . . . . . . . . . . 259
Agnieszka Kalandyk, Piotr Waligórski, Franciszek Dubert
ZASTOSOWANIE BIOSTYMULATORÓW
W ŁAGODZENIU SKUTKÓW SUSZY I INNYCH STRESÓW
ŚRODOWISKOWYCH U SOI ZWYCZAJNEJ (Glycine max L. Merr.) . . . . . . 267
Anna Lehmann, Wiesław Wojciechowski, Adam Zych,
Elżbieta Pytlarz, Martyna Szałata
ROLA MIĘDZYPLONÓW ŚCIERNISKOWYCH
W REGULACJI ZACHWASZCZENIA ŻYTA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275
Rafał Ogórek, Agnieszka Lejman
ODDZIAŁYWANIA biotyczne między wybranymi izolatami
Epicoccum nigrum a grzybami z rodzaju Fusarium . . . . . . . . . . . . . . 281
Kalina Orłowska, Monika Mierzwa-Hersztek, Agnieszka Baran
WPŁYW PRZEKOMPOSTOWANYCH ODPADÓW
Z UBOJU I HODOWLI DROBIU NA WŁAŚCIWOŚCI
WODNO-POWIETRZNE GLEBY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 291
Elżbieta Pytlarz, Danuta Parylak,
Martyna Szałata, Anna Lehmann, Adam Zych
Choroby podstawy źdźbła pszenicy jarej w monokulturze
po zastosowaniu międzyplonu i biostymulatora . . . . . . . . . . . . . . . 299
Piotr Rezka, Wojciech Balcerzak
BADANIA WSTĘPNE NAD PRODUKCJĄ K2SO4
Z ODPADOWEGO ROZTWORU Z PRZEMYSŁU CYNKU . . . . . . . . . . . . . . . . . . . 307
6
Spis treści
Anna Romanowicz, Roman Prażak
OCENA TOLERANCYJNOŚCI LINII MIESZAŃCOWYCH AEGILOPS
KOTSCHYI BOISS. Z TRITICUM AESTIVUM L. NA STRES SOLNY . . . . . . . . . . . . 315
Milena Rusin, Janina Gospodarek. Barbara Biniaś
WPŁYW ZWIĄZKÓW ROPOPOCHODNYCH NA ENERGIĘ
I ZDOLNOŚĆ KIEŁKOWANIA NASION BOBU ORAZ
NA WYBRANE CECHY MORFOLOGICZNE ROŚLIN . . . . . . . . . . . . . . . . . . . . . . . 323
Ilona Świtajska, Sławomir Szymczyk, Angela Potasznik,
Żaneta Banaszek, Cristina Timofte, Ireneusz Cymes
WPŁYW UPRAWY WIERZBY NA CELE ENERGETYCZNEJ W WARUNKACH
POLSKI PÓŁNOCNO-WSCHODNIEJ NA JAKOŚĆ WÓD GRUNTOWYCH . . . . 331
Martyna Szałata, Wiesław Wojciechowski,
Anna Lehmann, Elżbieta Pytlarz, Adam Zych
Wpływ międzyplonów ścierniskowych
na zachwaszczenie łanu owsa jarego i żyta ozimego . . . . . . . . . . 343
Paulina Topolińska, Magdalena Haak, Joanna Marć-Pieńkowska
WPŁYW DAWEK NAWOZÓW AZOTOWYCH NA WYDAJNOŚĆ
POKOSU ŁĄKOWEGO ORAZ PRODUKCJĘ BIOGAZU . . . . . . . . . . . . . . . . . . . . . 351
Karolina Trzyniec, Karolina Wietnik, Maria Szczuka, Andrzej Ochrem
ROZMIESZCZENIE I OZNAKOWANIE URZĄDZEŃ
SYGNALIZACYJNYCH I STEROWNICZYCH NA
CIĄGNIKACH ROLNICZYCH, A ZALECENIA NORM EUROPEJSKICH . . . . . . . 361
Katarzyna Wajdzik
ANALIZA KARIOLOGICZNA FESTUCA DURIUSCULA L. ZE SKOROCIC . . . . . . 369
Katarzyna Wolny-Koładka
Występowanie alternariozy ziemniaka w Małopolsce
i rola chrząszczy stonki ziemniaczanej
w jej rozprzestrzenianiu – badania wstępne . . . . . . . . . . . . . . . . . . . 379
Adam Zych, Anna Lehmann, Martyna Szałata,
Elżbieta Pytlarz, Bartłomiej Glina
Plonowanie buraka cukrowego
w różnych systemach uprawy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 387
7
Dorota Blatsios, Eliza Antkowiak
Honorata Bryłkowska, Anna Adamek
Marlena Banaś, Dominika Buchert
Renata Galek
EPISTEME
22/2014, t. III
s. 9–16
ISSN 1895-2241
Wpływ 6-(γ, γ-dimetyloalkiloamino)
puryny na mikrorozmnażanie rosiczki
łyżeczkowatej (Drosera spatulata Labill.)
Influence of 6-(γ, γ-dimethylallylamino)
purine on micropropagation spoon-leaved
sundew (Drosera spatulata Labill.)
Abstrakt. Rosiczka łyżeczkowta (Drosera spatulata Labill.) jest zaliczana do
rodziny rosiczkowatych (Droseraceae Salisb.). Należą one do coraz popularniejszych roślin uprawianych metodami kultur in vitro ze względu na duże
wykorzystanie w medycynie, a także walory ozdobne. Celem badań było
określenie wpływu 6-(γ, γ-dimetyloalkiloamino) puryny (2iP) na efektywność mikrorozmnażania tego gatunku. Eksplantaty wtórne rosiczki łyżeczkowatej zostały wyłożone na pożywkę Murashige i Skoog (MS) zawierającą
3% sacharozy, 0,8% agaru o pH 5,7. Zastosowano dawki 2iP: 0,5 m mg•l-1,
1,0 mg•l-1, 10 mg•l-1 oraz kombinację 15 mg•l-1 2iP + 0,5 mg•l-1 IAA. Doświadczenie założono w pięciu powtórzeniach, w każdym po 3 rośliny. Najlepszy
rozwój zaobserwowano na pożywce z dodatkiem 1,0 mg•l-1 2iP. Eksplantaty
charakteryzowały się dobrze rozwiniętymi roślinami przybyszowymi, a także systemem korzeniowym.
Słowa kluczowe: mikrorozmnażanie, roślina mięsożerna, pożywka MS, Drosera spatulata, 6-(γ, γ-dimethylallylamino) puryna (2iP)
Summary. Spoon-leaved sundew (Drosera spatulata Labill.) belongs to the family Droseraceae Salisb. Planta of this species are wildly micropropagat by tissue
culture because of the great importance in medicine and ornamental value. The
aim of the study was to determine the effect of 6-(γ, γ-dimetyloalkiloamino) purine (2iP) on the efficiency of micropropagation of this species. The secondary
explants were placed on a Murashige and Skoog medium (MS) containing 3% sucrose, 0.8% agar, pH 5.7. Applied doses of 2iP ware 0.5 mg•l-1 2iP, 1.0 mg•l-1 2iP,
10 mg•l-1 2iP and a combination of 15 mg•l-1 2iP + 0.5 mg•l-1 IAA. The experiment
was established in five replications 3 plants each. Best growth was observed on
medium supplemented with 1.0 mg•l-1 2iP. The explants were characterized by
well-developed adventitious plants and highly developed root system.
Key words: micropropagation, carnivorous plant, MS medium, Drosera spatulata, 6-(γ, γ-dimethylallylamino) purine (2iP)
9
Dorota Blatsios, Eliza Antkowiak, Honorata Bryłkowska, Anna Adamek...
WSTĘP
Rosiczka łyżeczkowata (Drosera spatulata Labill.) należy do rodziny
rosiczkowatych (Droseraceae Salisb.). Jest to grupa obejmująca około
150 gatunków roślin owadożernych jednorocznych oraz wieloletnich.
Najliczniej występują one w rejonie Oceanii i Nowej Zelandii [Grevenstuk 2010], południowo-wschodniej Azji aż do obszaru Japonii i Indii
[Kottapalli i Prasad 2007] oraz na obszarach południowej Afryki [Kawiak i in. 2003]. Rosną przede wszystkim w klimacie tropikalnym na
glebach ubogich, kwaśnych, piaszczystych oraz bagiennych [Kottapalli
i Prasad 2007]. W Europie większość naturalnych siedlisk to bagna
i torfowiska. Niestety, wiele z nich uległo zniszczeniu, co doprowadziło do objęcia rosiczek ochroną [Wawrosch 2009]. Ostatnio wzrosło
znaczenie rosiczki łyżeczkowatej w uprawie amatorskiej, a szczególnie
zaczęto zwracać uwagę na jej walory dekoracyjne. Rośliny te mają
także duże znaczenie w medycynie ze względu na zawartość wtórnych
metabolitów, jakimi są flawonoidy oraz związki naftochinonowe,
głównie plumbagina oraz ramentaceon [Juniper i in. 1989]. Cechuje je
działania przeciwutleniające, przeciwnowotworowe, przeciwwirusowe,
przeciwzapalne, przeciwbakteryjne, są także z powodzeniem stosowane m.in. przy leczeniu przedwczesnego starzenia, utraty pamięci,
a także niepłodności [Asirvatham i in. 2013, Jayaram i Prasad 2005].
Chociaż istnieje możliwość rozmnażania rosiczek za pomocą
nasion lub wegetatywnie przez sadzonki z liści, to jest to czaso- i pracochłonne [Lecoufle 1990]. Natomiast uprawa w warunkach in vitro
pozwala na przezwyciężenie wielu barier, a także na uzyskanie większej ilości roślin z dużą zawartością flawonoidów i/lub związków naftochinonowych w krótszym czasie, co jest istotne przy pozyskiwaniu
roślin do celów medycznych oraz w uprawie amatorskiej [Wawrosch
i in. 2009]. Istotnym elementem uprawy rosiczek w warunkach in
vitro stała się optymalizacja składu podłoży hodowlanych, w tym
określenie wpływu regulatorów wzrostu roślin z uwzględnieniem efektywności mikrorozmnażania [Perica i Berljak 1996, Anthony 1992,
Bobák i in.1995, Kawiak 2003, Kämäräinen 2003, Kukulczanka 1991].
Celem doświadczenia było określenie wpływu 6-(g,g-dimetyloalkiloamino) puryny (2iP) na rozwój rosiczki łyżeczkowatej (Drosera
spatulata Labill.) w kulturze in vitro, gdyż w dotychczasowych protokołach nie ma na ten temat informacji,
10
Wpływ 6-(γ, γ-dimetyloalkiloamino) puryny na mikrorozmnażanie rosiczki łyżeczkowatej...
MATERIAŁ I METODY
Materiałem do doświadczeń były eksplantaty rosiczki łyżeczkowatej
pobrane z kolekcji in vitro Katedry Genetyki, Hodowli Roślin i Nasiennictwa na Uniwersytecie Przyrodniczym we Wrocławiu.
Doświadczenie zostało założone w pięciu powtórzeniach (jako
powtórzenie traktowano jedno naczynie hodowlane), w każdym
z nich umieszczono po 3 eksplantaty. Jako eksplantat wyjściowy potraktowano pojedynczą rozetę liściową zawierającą kilkanaście liści.
Doświadczenie założono na standardowej pożywce Murashige i Skoog
[Murashige i Skoog 1962] (MS) zawierającej 3% sacharozy i zestalonej
0,8% agarem o pH 5,7. Zastosowano regulator wzrostu z grupy cytokinin 2iP w dawkach: 0,5; 1,0; 10,0 mg•l-1 2iP, a także w kombinacji
z auksyną – kwasem indolilo-3-octowym 15 mg•l-1 2iP + 0,5 mg•l-1 IAA.
Kultury prowadzono przez dwanaście tygodni przy fotoperiodzie
16/8 dzień/noc oraz natężeniu światła 3000 [µmol kwantów•m-2•s-1]
zmierzonym za pomocą luxomierza. Po tym czasie wykonano pomiary: wielkość uzyskanej wieloroślinki (wysokość, szerokość i długość)
(cm), ilość (szt.) i wysokość (cm) roślin przybyszowych, liczbę korzeni
przybyszowych (szt.), długość najdłuższego korzenia przybyszowego
(cm) oraz określono średnicę rozety eksplantatu wyjściowego (cm)
wraz z podaniem ilości korzeni (szt.) i długości najdłuższego korzenia
przy tej rozecie (cm). Określono również świeżą (g) i suchą (g) masę,
procentową zawartość suchej masy (%) oraz procentową zawartość
wody (%) z poszczególnych powtórzeń (tj. jedno powtórzenie to trzy
całe rośliny) wraz z pędami przybyszowymi. Suchą masę oznaczono
poprzez zważenie materiału roślinnego po 24 godzinach suszenia
każdego powtórzenia w temperaturze 105°C.
W celu zweryfikowania hipotezy zerowej o braku wpływu 6-(γ, γdimetyloalkiloamino) puryny (2iP) na mikrorozmnażanie rosiczki
przeprowadzono jednoczynnikową analizę wariancji za pomocą programu Statistica 10.0. W przypadku wystąpienia istotnych różnic
wartości średnie pogrupowano testem Tukeya (P = 0,95, α = 0,05).
WYNIKI I DYSKUSJA
Przeprowadzona analiza wariancji wykazała istotny wpływ 2iP na
rozwój dwunastotygodniowych eksplantatów rosiczki łyżeczkowatej
11
Dorota Blatsios, Eliza Antkowiak, Honorata Bryłkowska, Anna Adamek...
w przypadku wszystkich analizowanych cech z wyjątkiem długości
korzeni przybyszowych, średnicy rozety wyjściowej oraz długości korzeni przy tej rozecie. W tabeli 1a i 1b zamieszczono wyniki dotyczące
rozwoju eksplantatów rosiczki po dwunastu tygodniach prowadzenia
kultury.
Pożywka i regulatory wzrostu
[mg•l-1]:
Świeża masa [g]
Sucha masa [g]
Procentowa
zawartość suchej
masy [%]
Procentowa
zawartość wody
[%]
Tabela 1a. Średnie wartości analizowanych cech eksplantatów po dwunastu
tygodniach kultury na pożywce MS z dodatkiem różnych dawek 2iP oraz IAA
MS
MS+0,5 2iP
MS+1,0 2iP
MS+10 2iP
MS+15
2iP+0,5 IAA
Średnia ogólna
6,03 ab
8,45 b
10,44 b
0,66 a
5,04 ab
8,00 b
9,54 b
0,31 a
81,2 bc
95,01 d
91,1 cd
47,7 a
18,8 bc 3,21 bc 2,52 ab
4,99 a 3,78 bc 2,79 b
8,9 ab 3,9 c 3,03 b
52,3 d 2,77 ab 2,12 ab
0,56 a
0,41 a 73,62 b 26,38 c 1,81 a
5,23
4,66
77,73
22,27
3,09
Wysokość
[cm]
Szerokość
[cm]
Długość
[cm]
Wieloroślinki
1,85 b
2,51 bc
2,87 c
0,98 a
1,6 a
0,94 a
2,41
1,83
a, b, c... grupy jednorodne na podstawie testu Tukeya, błąd P = 0,95, α = 0,05
MS
9,67 ab
MS+0,5 2iP 21,0 b
MS+1,0 2iP 43,4 c
MS+10 2iP 5,54 a
MS+15
4,93 a
2iP+0,5 IAA
Średnia ogólna 16,91
1,15 b 6,56 a 2,72 a
1,69 c 12,07 ab 2,47 a
1,22 bc 18,87 b 2,48 a
0,3 a
0,0
0,0
0,26 a
0,92
0,0
12,5
0,0
2,56
2,3 a
1,81 a
2,09 a
0,0
0,0
2,07
Liczba korzeni [szt.]
Długość korzeni [cm]
Rozeta wyjściowa
Średnica [cm]
Długość korzeni
przyby-szowych
[cm]
Liczba korzeni
przyby-szowych
[szt.]
Wysokość roślin
przyby-szowych
[cm]
Liczba roślin
przyby-szowych
[szt.]
Pożywka i
regulatory wzrostu
[mg•l-1]:
Tabela 1b. Średnie wartości analizowanych cech eksplantatów po dwunastu
tygodniach kultury na pożywce MS z dodatkiem różnych dawek 2iP oraz IAA
3,93 a 2,57 a
2,54 a 3,93 ab
2,76 a 6,0 b
0,0
0,0
0,0
3,08
0,0
4,17
a, b, c... grupy jednorodne na podstawie testu Tukeya, błąd P = 0,95, α = 0,05
12
Wpływ 6-(γ, γ-dimetyloalkiloamino) puryny na mikrorozmnażanie rosiczki łyżeczkowatej...
Najwyższe średnie wartości masy świeżej i suchej masy (Tabela
1a) zaobserwowano u eksplantatów rosiczki rosnących na pożywce MS
+ 1,0 mg•l-1 2iP. Natomiast największą procentową zawartość suchej
masy odnotowano na pożywkach MS + 0,5 mg•l-1 2iP i 1,0 mg•l-1 2iP,
a największą procentową zawartość wody zaobserwowano na pożywce
MS + 10 mg•l-1 2iP (Tabela 1a). Wysokie wartości tych cech odnotowano też na pożywce podstawowej MS. Podobne rezultaty stwierdzili
Kim i Jang [2004], analizując mikrorozmnażanie Drosera peltata na
pożywce bez dodatku regulatorów wzrostu.
Analizując wielkość wieloroślinki (wszystkich roślin przybyszowych wraz z rozetą wyjściową), zaobserwowano, że największe rozmiary osiągnęły rośliny rosiczki na pożywce MS + 1,0 mg•l-1 2iP (Tabela 1a). Test Tukeya pozwolił na zakwalifikowanie uzyskanych średnich
wartości eksplantatów rosnących na pożywce MS oraz MS + 0,5 mg•l-1
2iP do tej samej grupy jednorodnej (Tabela 1a). Wraz ze wzrostem
wielkości wieloroślinki zwiększała się liczba roślin przybyszowych
formujących się na rozecie wyjściowej (Tabela 1b). Można zauważyć,
że wzrost zawartości 2iP w pożywce (>1,0 mg•l-1 2iP) przyczynił się
do rozwoju mniejszej liczby pędów przybyszowych, a co za tym idzie
mniejszych wieloroślinek. Podobny efekt można zauważyć w doświadczeniu dotyczącym mikrorozmnażania Drosera rotundifolia L.,
w którym zaobserwowano, że wraz ze wzrostem zawartości zeatyny
w pożywce maleje liczba nowych roślin przybyszowych [Wawrosch
i in. 2009]. Na wysokość roślin przybyszowych w niniejszym doświadczeniu korzystnie wpłynęła zarówno pożywka MS + 1,0 mg•l-1 2iP, jak
i MS + 0,5 mg•l-1 2iP (Tabela 1b). Zwiększenie zawartości 2iP w pożywce (>1,0 mg•l-1 2iP) spowodowało słabszy wzrost.
Istotnym parametrem w produkcji roślin in vitro jest uzyskanie
rozbudowanego systemu korzeniowego ułatwiającego roślinom aklimatyzację w warunkach szklarniowych [Czekalski 2010]. U roślin
rosiczki zaobserwowano najkorzystniejszy wpływ pożywki MS + 0,5
mg•l-1 2iP i MS + 1,0 mg•l-1 2iP na powstawanie i wzrost korzeni (Tabela 1b). Na pożywce podstawowej MS również zaobserwowano korzystny rozwój korzeni. Jednak zwiększone stężenia 2iP (>1,0 mg•l-1 2iP)
czy też dodatek IAA przyczynił się do zahamowania wzrostu korzeni.
Badania dotyczące mikrorozmnażania Drosera indica L. pokazują również, że najintensywniejszy rozwój systemu korzeniowego obserwuje
13
Dorota Blatsios, Eliza Antkowiak, Honorata Bryłkowska, Anna Adamek...
się na podstawowej pożywce MS bez dodatku regulatorów [Kottapalli
i Prasad 2007]. Natomiast wyniki uzyskane w badaniu nad mikrorozmnażaniem Drosera intermedia pokazują, iż nie jest wymagany
dodatek auksyn w celu zaindukowania ukorzeniania eksplantatów
[Grevenstuk i in. 2010]. W przytoczonym doświadczeniu wysokie
dawki 2iP w połączeniu z IAA spowodowały brak ukorzeniania się
pędów przybyszowych i rozety wyjściowej. Średnica rozety wyjściowej
wyniosła 2,07 cm, natomiast długość wykształconych korzeni 3,08 cm
(Tabela 1b). Istotne statystycznie różnice zaobserwowano przy liczbie
korzeni wyrastających z rozety wyjściowej. Najwięcej korzeni zauważono na pożywce MS + 0,5 mg•l-1 2iP i MS + 1,0 mg•l-1 2iP (Tabela 1b).
Kim i Jang [2004] analizując mikrorozmnażanie Drosera peltasta,
wykazali negatywny wpływ stężeń cytokinin (kinetyna i benzyloaminopuryna-BA) na rozety analizowanych roślin. Wraz ze wzrostem
stężenia kinetyny i BA, rośliny wytwarzały mniej nowych pędów.
Interesującym faktem w trakcie doświadczenia było zaobserwowanie tworzenia się pędów kwiatostanowych o barwie różowej
na pożywce podstawowej MS. Uzyskane wyniki są porównywalne
z badaniami dotyczącymi mikrorozmnażania innych gatunków rosiczek. Zaobserwowano, że Drosera rotundifolia i Drosera capensis
również rozwijają najwięcej pędów kwiatostanowych na podłożu pozbawionym regulatorów wzrostu. W przypadku doświadczeń nad Drosera binata zauważono istotny wpływ benzyloaminopuryny (BA) i kwasu
naftylo-1-octowego (NAA) na zainicjowanie kwitnienia [Anthony 1992].
WNIOSKI
• Uzyskane wyniki pokazują, że rośliny rosiczki łyżeczkowatej
najlepiej rozwijały się na pożywce MS + 1,0 mg•l-1 2iP, ponieważ takie
stężenie 2iP spowodowało istotną stymulację rozwoju roślin przybyszowych i systemu korzeniowego.
• Zwiększenie stężenia 2iP (>1,0 mg•l-1 2iP) i dodatek IAA
w pożywkach wpłynęło hamująco na rozwój rozet wyjściowych użytych do doświadczenia, a także formowanie nowych roślin przybyszowych uzyskanych eksplantatów.
• Dodatek IAA w pożywce z 2iP przyczynił się do zahamowania
wytwarzania korzeni u roślin rosiczki łyżeczkowatej.
14
Wpływ 6-(γ, γ-dimetyloalkiloamino) puryny na mikrorozmnażanie rosiczki łyżeczkowatej...
Bibliografia:
1. Anthony J. L. 1992 In Vitro propagation of Drosera spp. HortScience
27 (7): 850.
2. Asirvatham R. Josphin A. M. C. Murali A. 2013 In Vitro antioxidant
and anticancer activity studies on Drosera Indica L. (Droseraceae).
Advanced Pharmaceutical Bulletin 3 (1): 115-120.
3. Bobák M, Blehová A, Krištín J, Oveck AM, Šamaj J.1995 Direct plant
regeneration from leaf explants of Drosera rotundifolia cultured in vitro. Plant Cell, Tissue Organ Culture 43: 43–49.
4. Czekalski M. 2010. Ogólna uprawa roślin ozdobnych. Wydawnictwo
Uniwersytetu Przyrodniczego we Wrocławiu. Wrocław.
5. Grevenstuk T. Coelho N. Goncalves S. Romano A. 2010 In vitro propagation of Drosera intermedia in a single step. Bologia Plantarum 54
(2): 391-394.
6.Jayaram K. Prasad M.N. V. 2005 Rapidly in vitro multiplied Drosera
as reliable source for plumbagin bioprospection. Current Science 89
(3,10): 447-448.
7.Juniper B.E. Robins R.J. Joel D.M. 1989 Phytochemical aspects. Carnivorous plants. Harcourt Brace Jovanovich, Academic Press, London
229-240.
8. Kawiak A. Królicka A. Lojkowska E. 2003 Direct regeneration of Drosera from leaf explants and shoot tips. Plant Cell, Tissue and Organ
Culture 75: 175–178.
9. Kämäräinen T, Laine K, Hohtola A, Jalonen J. 2003 Production of
7-methyljuglone in Drosera rotundifolia in vitro and ex vitro. Acta
Horticuturae 616: 507–510.
10. Kim K.S. Jang G.W. 2004 Micropropagation of Drosera peltata, a tuberous sundew, by shoot tip culture. Plant Cell, Tissue and Organ Culture
77: 211–214.
11. Kottapalli J. Prasad M. N. V. 2007 Rapid in vitro multiplication of Drosera indica L.: a vulnerable, medicinally important insectivorous plant.
Plant Biotechnol Rep 1: 79-84.
12. Kukulczanka K. 1991 Micropropagation and in vitro germplasm storage of Droseraceae. Botanic Gardens Micropropagation News 1: 38–42.
13.Lecoufle M. 1990 Carnivorous plants: care and cultivation. London,
Blandford Press.
14.Murashige T. Skoog F. 1962. A revised medium for rapid growth and
bio‐assays with tobacco tissue cultures. Physiologia Plantarum. 15: 473–97.
15. Perica M. C. Berljak J. 1996 In Vitro Growth and regeneration of Drosera spatulata Labill. on various media. HortScience 31 (6):1033–1034.
15
Dorota Blatsios, Eliza Antkowiak, Honorata Bryłkowska, Anna Adamek...
16. Wawrosch Ch. Benda E. Kopp B. 2009 An improved 2-step liquid culture system for efficient in vitro shoot proliferation of sundew (Drosera
rotundifolia L.) Scientia Pharmaceutica 77: 827–835.
Adres do korespondencji:
mgr inż. Dorota Blatsios
e-mail: [email protected]
dr inż. hab. Renata Galek
e-mail: [email protected]
Uniwersytet Przyrodniczy we Wrocławiu
Wydział Przyrodniczo – Technologiczny,
pl. Grunwaldzki 24 A, 50-363 Wrocław
Eliza Antkowiak
e-mail: [email protected]
Honorata Bryłkowska
e-mail: [email protected]
Anna Adamek
[email protected]
Marlena Banaś
e-mail: [email protected]
Dominika Buchert
e-mail: [email protected]
Uniwersytet Przyrodniczy we Wrocławiu
Wydział Biologii i Hodowli Zwierząt
ul. Chełmońskiego 38C, 51-630 Wrocław
Opiekun naukowy: dr hab. inż. Renata Galek
16
Joanna Bonio
Klaudia Duda
EPISTEME
22/2014, t. II
s. 17–24
ISSN 1895-2241
ZANIECZYSZCZENIA MYKOLOGICZNE POWIETRZA
W OGRODZIE BOTANICZNYM UNIWERSYTETU
JAGIELLOŃSKIEGO W KRAKOWIE I ARBORETUM
SZKOŁY GŁÓWNEJ GOSPODARSTWA WIEJSKIEGO
W ROGOWIE
MYCOLOGICAL AIR POLLUTION IN THE
JAGIELLONIAN BOTANICAL GARDEN IN KRAKOW
AND THE ROGOW ARBORETUM OF THE WARSAW
UNIVERSITY OF LIFE SCIENCES
Abstrakt. Celem badań było przedstawienie i porównanie wyników
analiz mykologicznych powietrza w Ogrodzie Botanicznym UJ i Arboretum SGGW w Rogowie. Badania prowadzono w maju, lipcu i wrześniu
2012 r. Badania wykonano metodą sedymentacyjną Kocha na płytkę Petriego z pożywką PDA. Na terenie ogrodu i arboretum wyznaczono po
4 stanowiska badawcze. Oceny stopnia zanieczyszczenia powietrza zarodnikami grzybów dokonano poprzez określenie liczebności i składu
gatunkowego grzybów. Grzyby występujące w powietrzu w postaci bioaerozoli należały do 39 gatunków, z których największą liczebność miały:
Alternaria alternata, Epicoccum nigrum oraz grzyby rodzajów: Trichoderma (T. aureoviride, T. hamatum, T. harzianum, T. viride), Phoma (Ph. exigua,
Ph. leveillei), Penicillium (P. citrinum, P. expansum), Gibberella (G. avenacea, G.
pulicaris). Grzyby te mogą być przyczyną alergii. Stwierdzono porównywalny stopień zanieczyszczenia powietrza zarodnikami grzybów w ogrodzie
botanicznym i arboretum.
Słowa kluczowe: zanieczyszczenia mykologiczne, powietrze atmosferyczne,
Arboretum SGGW, Ogród Botaniczny UJ
Abstrakt. The aim of this study was the presentation and comparison of
mycological analysis results of the air in the Jagiellonian University Botanical Garden and the Rogow Arboretum of the Warsaw University of Life Sci17
Joanna Bonio, Klaudia Duda
ences. The investigations were conducted in May, July and September in
2012. Analyses were carried out by sedimentation of the Koch method on
a Petri dish with a PDA medium. Four research stands were located in the
botanical garden and arboretum. They were identified by the abundance and
species composition of fungi and an assessment of the degree of air pollution
by fungal spores. Fungi in the atmospheric air in the bioaerosols form contained 39 species with the following dominants: Alternaria alternata, Epicoccum nigrum and genus: Trichoderma (T. aureoviride, T. hamatum, T. harzianum,
T. viride), Phoma (Ph. exigua, Ph. leveillei), Penicillium (P. citrinum, P. expansum), Gibberella (G. avenacea, G. pulicaris). These fungi may cause allergies.
The atmospheric air in the botanical garden and arboretum was comparatively polluted by fungal spores.
Key words: mycological pollution, atmospheric air, Rogow Arboretum SGGW,
UJ Botanical Garden
Wstęp
Powietrze atmosferyczne jest jednym z elementów środowiska decydującym o procesach życiowych ludzi, zwierząt i roślin, a także o ich
jakości życia. W powietrzu atmosferycznym znajdują się różnorakie
zanieczyszczenia, w tym mykologiczne [Ogórek i wsp. 2012]. Znaczną
część bioaerozolu powietrznego stanowią jednostki koloniotwórcze
grzybów. Są nimi głównie zarodniki, przetrwalniki, pojedyncze strzępki lub fragmenty grzybni [Ejdys 2009]. Mykobiota zanieczyszczające powietrze mogą wydzielać metabolity wtórne w postaci toksyn,
które mogą być szkodliwe dla ludzi i zwierząt. Duża koncentracja
zarodników w powietrzu atmosferycznym może być przyczyną wielu
chorób skórnych i układu oddechowego [Pląskowska i wsp. 2011].
Ocena stopnia czystości mykologicznej powietrza obrazuje sezonowe
wahania koncentracji zarodników grzybów w powietrzu w różnych
warunkach geograficznych, klimatycznych i siedliskowych [Kasprzyk
2006, Frączek i Grzyb 2010, Pusz i Kita 2013].
Celem pracy była ocena stopnia zanieczyszczenia powietrza zarodnikami grzybów strzępkowych, dokonana poprzez określenie ich liczebności i składu gatunkowego w powietrzu atmosferycznym Ogrodu
Botanicznego Uniwersytetu Jagiellońskiego w Krakowie i Arboretum
Szkoły Głównej Gospodarstwa Wiejskiego w Rogowie.
18
Zanieczyszczenia mykologiczne powietrza w ogrodzie botanicznym uniwersytetu...
Materiał i metody
Badania dotyczące stopnia zanieczyszczenia mykologicznego powietrza przeprowadzono na terenie Ogrodu Botanicznego UJ w Krakowie i Arboretum SGGW w Rogowie. Ogród Botaniczny UJ zajmuje
powierzchnię 9,6 ha, znajduje się na wysokości 220 m n.p.m. Arboretum SGGW położone jest na terenie woj. łódzkiego, w gminie Rogów.
Zajmuje powierzchnię 53,76 ha, położone jest na wysokości od 146
do 223 m n.p.m.
Monitoring mikrobiologiczny powietrza wykonano w cyklu rocznym w 2012r., w trzech terminach: 25.05., 25.07. i 25.09. Badania
wykonano metodą sedymentacyjną Kocha polegającą na wykorzystaniu
zjawiska swobodnego opadania drobnoustrojów na płytkę Petriego
z 2% pożywką PDA. Na terenie ogrodu i arboretum wyznaczono po
4 stanowiska badawcze, znajdujące się w pobliżu roślin wrzosowatych
Ericaceae. Na każdym stanowisku umieszczono po 1 płytce Petriego.
Płytki umieszczono na wysokości 1 m. Czas ekspozycji otwartych płytek
wynosił 10’. Prace laboratoryjne wykonano wg standardowych metod
stosowanych w mykologii. Grzyby oznaczono wg kluczy mykologicznych: Rifai [1969], Booth [1971]) oraz Domsch i współautorzy [1980].
Wyniki i dyskusja
W przeprowadzonych badaniach mykologicznych powietrza atmosferycznego w Ogrodzie Botanicznym UJ w Krakowie i Arboretum
SGGW w Rogowie wykryto jednostki koloniotwórcze, które wytworzyły na pożywce PDA 543 kolonie grzybów strzępkowych, należących
do 39 gatunków (tab. 1). Wśród nich dominowały grzyby z rodzajów:
Trichoderma (stanowiące 25,6% całości zbiorowiska grzybów), Alternaria (17,31%), Phoma (6,45%) oraz Penicillium (6,07%).
W powietrzu atmosferycznym ogrodu i arboretum wykazano
zróżnicowanie ilościowe i gatunkowe grzybów. Grzybem dominującym w powietrzu obydwu obiektów, w trzech terminach analiz był
Alternaria alternata.
W pierwszym terminie (25 maja) w powietrzu atmosferycznym
ogrodu botanicznego dominowały zarodniki: Trichoderma hamatum,
T. aureoviride, Paraconiothyrium sporulosum i Paraphoma chrysanthemicola, a w powietrzu arboretum: A. alternata, Trichoderma harzianum,
Epicoccum nigrum i Isaria fumosorosea.
19
Joanna Bonio, Klaudia Duda
W drugim terminie (25 lipiec) zarówno w arboretum, jak i w ogrodzie botanicznym dominującymi mykobiota były: A. alternata, Gibberella avenacea i T. aureoviride.
W terminie trzecim (25 wrzesień) w ogrodzie botanicznym nastąpił spadek koncentracji zarodników A. alternata, natomiast wzrosła
koncentracja spor grzybów z rodzajów: Penicillium, Mucor i Trichoderma. W powietrzu arboretum dominowały zarodniki A. alternata,
Ph. leveillei, Boeremia exigua, E. nigrum i Penicillium citrinum. W tym
terminie odnotowano znaczną koncentrację grzybów Cladosporium
cladosporioides i Davidiella macrocarpa.
Jak podają Stępalska i wsp. [1999], Ogórek i wsp. [2011] oraz
Pusz i Kita [2013], A. alternata jest grzybem wszechobecnym w powietrzu. Grzyb ten ma z reguły największy udział procentowy pośród
mykobiota znajdujących się w powietrzu (na stanowiskach zlokalizowanych w miastach i poza nimi, w obiektach budowlanych), a jego zarodniki osiągają najwyższe stężenie w okresie letnim [Nabrdalik 2007,
Frączek i Grzyb 2010]. O roli A. alternata, powszechnie występującego
aeroalergena piszą Ogórek i wsp. [2011], podając, że stwarza on duże
zagrożenie dla zdrowia człowieka. Podczas monitoringu mikrobiologicznego grzyb ten dominował w powietrzu, a w lipcu stwierdzono
jego największą koncentrację.
Wielu autorów [Domsch i wsp. 1980, Kasprzyk 2006, Wang
i wsp. 2010, Ogórek i Lejman 2013, Pusz i Kita 2013] podaje, że grzyby
z rodzaju Cladosporium i Davidiella występują w powietrzu atmosferycznym w różnych rejonach świata, a ich koncentracja wzrasta pod
koniec okresu wegetacji, czym tłumaczyć można wysokie stężenie
zarodników C. cladosporioides i D. macrocarpa we wrześniu. W tym
terminie odnotowano także znaczną koncentrację zarodników z rodzaju Penicillium i Phoma. O dużej koncentracji w powietrzu zarodników grzybów z rodzajów: Aspergillus, Penicillium i Cladosporium piszą
Wiejak [2011] oraz Stępalska i wsp. [1999], upatrując w tym zjawisku
przyczynę zanieczyszczeń powietrza atmosferycznego w naturalnym
środowisku i wewnątrz budowli.
W pracach poświęconych wpływom bioaerozoli na zdrowie ludzi
Kalogerakis i wsp. [2005] oraz Pląskowska [2010] wykazali, że obecność w powietrzu atmosferycznym grzybów wytwarzających mykotoksyny, szczególnie gatunków należących do rodzajów: Aspergillus, Penicillium, Cladosporium, Fusarium, Gibberella i Trichoderma, może skut20
Zanieczyszczenia mykologiczne powietrza w ogrodzie botanicznym uniwersytetu...
Tab. 1. Grzyby w powietrzu atmosferycznym Ogrodu Botanicznego UJ
w Krakowie i Arboretum SGGW w Rogowie
arboretum
ogród botaniczny
arboretum
Ogród botaniczny
Suma kolonii
% udział
25.09.2012
ogród botaniczny
25.07.2012
arboretum
25.05.2012
2
3
4
5
6
7
8
9
12
6
29
21
16
8
92
16,94
2
2
0,37
2
2
0,37
10
1
1,84
0,18
20
3,68
14
2,58
10
1,84
28
7
10
5,16
1,29
1,84
4
0,74
3
23
8
16
14
7
9
4,24
1,47
2,95
2,58
1,29
1,66
Mortierella parvispora
3
3
0,55
Mucor circinelloides
Paraconiothyrium
sporulosum
12
12
2,21
10
1,84
Grzyb
1
Alternaria alternata
Aspergillus brasiliensis
Aspergillus neoniveus
10
1
Boeremia exigua
Chaetomium globosum
Cladosporium cladosporioides
Coleophoma rhododendri
10
10
4
10
Davidiella macrocarpa
Epicoccum nigrum
Fusarium culmorum
Fusarium oxysporum
Fusarium sporotrichioides
Gibberella avenacea
Gibberella pulicaris
Humicola fuscoatra
Humicola grisea
Isaria fumosorosea
Mortierella horticola
10
7
6
4
10
7
1
10
4
10
13
3
8
13
8
6
7
6
10
21
Joanna Bonio, Klaudia Duda
1
2
Paraphoma chrysanthemicola
Penicillium citrinum
4
5
6
7
8
9
9
1,66
20
3,68
7
1,29
6
1,10
6
6
1,10
3
3
0,55
5
0,92
5
20
11
4
1
3,68
2,03
0,74
0,18
4
65
11,97
17
3,13
16
2,95
12
12
2,21
12
12
2,21
9
10
10
7
Penicillium expansum
Penicillium verrucosum
Pestalotiopsis sydowiana
Phialophora asteris
Phialophora cyclaminis
Phoma exigua
Phoma leveillei
Phoma medicaginis
Sordaria fimicola
Trichoderma aureoviride
Trichoderma hamatum
Trichoderma harzianum
Trichoderma polysporum
Trichoderma pseudokoningii
Trichoderma viride
Umbelopsis isabellina
Ogółem
3
6
5
6
9
11
4
1
14
22
25
17
11
3
2
4
53
82
10
106
108 114
13
80
17 3,13
10 1,84
543 100,00
kować wystąpieniem chorób u osób z obniżoną odpornością immunologiczną oraz infekcjami skórnymi. Badania przeprowadzone przez
Pląskowską [2010] dowodzą, że grzyby z rodzaju Fusarium i Gibberella
najliczniej występują w okresie letnim, w szczególności w lata ciepłe
i wilgotne. W niniejszych badaniach stwierdzono największą liczebność G. avenacea i F. oxysporum w lipcu. Gatunki te są patogenami
roślin wrzosowatych, co podają publikacje z zakresu fitopatologii.
Stwierdzono, że na zanieczyszczenia powietrza atmosferycznego
22
Zanieczyszczenia mykologiczne powietrza w ogrodzie botanicznym uniwersytetu...
w ogrodzie botanicznym w dużej mierze składały się grzyby z rodzaju
Trichoderma (T. aureoviride, T. hamatum, T. harzianum, T. polysporum,
T. pseudokoningi i T. viride), natomiast obecności grzybów tego rodzaju
nie stwierdzono w arboretum. Zanieczyszczenia mykologiczne powietrza stanowiły także zarodniki grzybów występujące sporadycznie
w jednym z terminów i z marginalnym udziałem procentowym, jak:
Aspergillus niger, Chaetomium globosum, Aspergillus brasiliensis, A. neoniveus i Sordaria fimicola. W zdecydowanej większości są to nekrotrofy
powodujące zamieranie tkanek wielu roślin uprawnych.
O wysokiej koncentracji nekrotrofa E. nigrum, pisze Kasprzyk
[2006], różnicując stężenie zarodników w cyklu dobowym, pomiędzy
miastem a terenem wiejskim.
Oceniając zanieczyszczenia mykologiczne powietrza w Ogrodzie
Botanicznym UJ i Arboretum SGGW w Rogowie daje się zauważyć
różnice dotyczące liczebności i składu gatunkowego grzybów.
Wnioski
Analiza mykologiczna powietrza atmosferycznego w Ogrodzie Botanicznym Uniwersytetu Jagiellońskiego w Krakowie i Arboretum
Szkoły Głównej Gospodarstwa Wiejskiego w Rogowie wskazała na
bioróżnorodność występujących w nim gatunków grzybów oraz na
znaczną liczebność jednostek tworzących kolonie.
Grzybem o największej koncentracji zarodników w powietrzu
był A. alternata, nieco niższą koncentrację stwierdzono dla E. nigrum
oraz grzybów z rodzajów: Trichoderma, Phoma, Penicillium, Gibberella,
Humicola i Fusarium, określanych jako alergeny grzybowe, co wiąże się
z możliwością wywoływania chorób u ludzi.
Stwierdzono porównywalny stopień zanieczyszczenia powietrza
atmosferycznego w ogrodzie botanicznym i arboretum, z tym, że
najwięcej jednostek tworzących kolonie grzybów odnotowano we
wrześniu w arboretum w Rogowie.
Bibliografia
Booth C. 1971. The genus Fusarium. Comm. Mycol. Inst. Kew Surrey.
Domsch K.H. Games W. Anderson T.H. 1980. Compendium of Soil Fungi.
Academic Press London.
23
Joanna Bonio, Klaudia Duda
Ejdys E. 2009. Wpływ powietrza atmosferycznego na jakość bioaerozolu pomieszczeń szkolnych w okresie wiosennym i jesiennym – ocena mykologiczna. Ochrona Środowiska i Zasobów Naturalnych 41:142-150.
Frączek K., Grzyb J. 2010. Badania nad rozprzestrzenianiem się aerozolu
grzybowego na terenie Krakowa. Nauka Przyroda Technologie 4 (6): 1-3.
Kalogerakis N. Paschali D. Lekadis V. Pantidu A. Elefheriadis K. Lazaridis
M. 2005. Indoor air quality bioaerosol measurements in domestic and
office premises. Aerosol Science 36: 751-761.
Kasprzyk I. 2006. Dobowe wahania koncentracji zarodników grzybów
w powietrzu miasta i wsi. Acta Agrob. 59: 395-404.
Nabrdalik M. 2007. Grzyby strzępkowe w obiektach budowlanych. Procedings of ECOpole 1 (1/2): 187-190.
Ogórek R. Pląskowska E. Kalinowska K. 2011. Charakterystyka i taksonomia grzybów z rodzaju Alternaria. Mikologia Lekarska 18 (3): 143-148.
Ogórek R. Lejman A. Pląsowska E. Bartnicki M. 2012. Fungi in the mountain trails of the Śnieżnik Massif. Mikologia Lekarska 19 (2): 57-62.
Ogórek R. Lejman A. 2013. Analiza mikologiczna powietrza Jaskini
Niedźwiedziej w Kletnie. Episteme 18: 121-130.
Pląskowska E. 2010. Charakterystyka i taksonomia grzybów z rodzaju Fusarium. Mikologia Lekarska 17 (3): 172-176.
Pląskowska E. Korol M. Ogórek R. 2011. Grzyby występujące w pomieszczeniach klimatyzowanych. Część 1. Miologia Lekarska 18 (4): 178-186.
Pusz W. Kita W. 2013. The aeromycological studies on the occurrence of
pathogenic fungal spores for plants in subalpine Karkonosze National
Park. Prog. Plant. Prot. / Post. Ochr. Roślin 53(1): 142-145.
Rifai M. A. 1969. A revision of the genus Trichoderma. Mycol. Papers 116: 1-56.
Stępalska D. Harmata K. Kasprzyk I. Myszkowska D. Stach A. 1999. Occurrence of airborne Cladosporium and Alternaria spores in Southern and
Central Poland in 1995-1996. Aerobiologia 15: 39-47.
Wang W. Ma X. Ma Y. Mao L. Wu F. Ma X., An L. Feng H. 2010. Seasonal dynamice of airborne fungi in different caves of the Mogao Grottoes, Dunhuang,
China. International Biodeterioration & Biodegradation 64: 461-466.
Wiejak A. 2011. Ocena stopnia skażenia powietrza zarodnikami grzybów
pleśniowych jako istotny czynnik ekspertyzy mikologicznej. Prace ITB
3 (159): 3-12.
Adres do korespondencji:
mgr inż. Joanna Bonio
Katedra Ochrony Roślin
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. inż. Maria Kowalik
24
Monika Czaja
Anna Kołton
Piotr Muras
Ewa Muszyńska
EPISTEME
22/2014, t. III
s. 25–32
ISSN 1895-2241
Dynamics of nitrogen compounds changes
in the leaves of selected urban trees
during the growing season
Dynamika przemian związków azotowych
zachodzących w liściach wybranych
drzew miejskich na przestrzeni sezonu
wegetacyjnego
Abstract. Nitrogen plays a key role in many physiological processes. It is
a component of many cellular structures being a part of amino acids, peptides, proteins, nucleotides, chlorophylls and other. In the vacuole also inorganic form like NO3- ions may be found. Due to the multitude of forms and
processes in which the nitrogen is involved, it is a subject to many dynamic
changes as reduction, transport etc. The aim of the experiment was to study
the dynamics of nitrogen compounds changes in the leaves of urban trees
over the entire growing season. Leaves of Acer platanoides ‘Globosum’ and Robinia pseudoacacia ‘Umbraculifera’ were collected every four weeks from April
to November. The content of NO3- ions, free amino acids, proteins, and the
amount of chlorophylls were analyzed. Concentration of free amino acids was
high at the beginning of the growing season and increased at the end of season compared to the other terms, for both of the investigated species.
Key words: Acer platanoides, Robinia pseudoacacia, nitrates, chlorophyll, aminoacids, proteins
Abstrakt. Azot pełni kluczową rolę w wielu procesach fizjologicznych. Stanowi składnik wielu struktur komórkowych budując aminokwasy, peptydy,
białka, nukleotydy, chlorofile i inne. W wakuoli spotykane są także nieorganiczne formy azotu jak jony NO3-. Ze względu na mnogość form i procesów,
w które zaangażowany jest azot, podlega on wielu dynamicznym zmianom
jak redukcja, transport etc. Celem doświadczenia było zbadanie dynamiki
przemian związków azotowych w liściach drzew miejskich na przestrzeni
całego sezonu wegetacyjnego. Liście klonu pospolitego ‘Globosum’ i robinii
25
Monika Czaja, Anna Kołton, Piotr Muras, Ewa Muszyńska
akacjowej ‘Umbraculifera’ pobierane były co cztery tygodnie od kwietnia do
listopada. Zbadano zawartość jonów NO3-, wolnych aminokwasów, białek
i chlorofili. Ilość wolnych aminokwasów była wyższa na początku i na końcu
sezonu wegetacyjnego w porównaniu do pozostałych terminów, u obu badanych gatunków.
Key words: klon pospolity, robinia akacjowa, azotany, chlorofil, aminokwasy,
białka
MATERIAL AND METHODS
The plant material was collected from the trees growing in the area of
the Cracow University of Technology, along the Szlak street. Leaves
for the analysis were collected from 9 trees of the Robinia pseudoacacia
‘Umbraculifera ‘ and 9 trees of Acer platanoides ‘Globosum’. The material
was collected once in a month from April to November 2011, two times
in July. Leaves were obtained in the morning hours, from North-facing
part of the crown, every time about 80-100 from every species.
Nitrate was extracted from plant material using a 0.02 M
Al2(SO4)3. Determination of nitrate ions were carried out on ion selective pH meter Orion 920A+. Protein content was determined with
Bradford reagent, the absorbance was measured on a spectrophotometer at a wavelength of 595 nm [Bradford 1976]. A calibration curve
was performed using albumin. The content of free amino acids was
determined using ninhydrin reagent [Sun et al. 2006, Wang 2012].
The calibration curve was made using glycine. The results were calculated into nitrogen content in glycine. The test samples content of
chlorophylls in acetone extracts were also determined using models
presented by Wellburn [1994]. All analysis were performed in four
replications. The results were statistically analyzed, and tested parameters were compared for each specimen separately. Analysis of
variance and Fisher LSD test were used to determine the difference
between terms. Data were analyzed using Statistica (StatSoft) at
26
Dynamics of nitrogen compounds changes in the leaves of selected urban trees during...
a given level of significance α=0.05. Means marked at the figures and
tables with the same letters did not differ significantly.
At the beginning of the growing season in April and beginning
of May, the average weekly air temperature did not exceed 15°C, but
did not lower below 7°C (Fig. 1). There had been a gradual increase
in temperature from the beginning of May, and the highest values
were recorded in August, July and June. From the end of August the
temperature gradually decreased until November, when it reached the
average weekly temperature close to 0°C. The values for solar radiation
during the season showed a similar trend as the air temperature. After
the decrease in the radiation intensity at the end of July, the values
increased to similar level as achieved in May, but since then gradually
decreased until November.
Fig. 1. Distribution of air temperature and solar radiation, averaged
for each week, measured from April to November.
RESULTS
A gradual, significant increase in the NO3- ions content was noted in
the leaves of Acer platanoides, along the growing season (Fig.2). Lower
values were recorded in April and early July, and higher in, September, October and August. The concentration of the tested ions in the
leaves of R.pseudoacacia showed large fluctuations. In July, there was
more than threefold decrease in the content of nitrate ions, and then
four-fold increase in August in compare to previous months respectively. The lowest values were recorded in both terms of the July and
October, and the highest in August. It should be emphasized that the
NO3- ions content in the leaves of a Acer platanoides ranged from 81,83
to 153,30 mg·kg-1 f.w., while in the leaves of Robinia pseudoacacia from
232,87 to 1111,06 mg·kg-1 f.w.
27
Monika Czaja, Anna Kołton, Piotr Muras, Ewa Muszyńska
Fig. 2. The content of NO3- ions in each term of analysis, in the leaves of
Acer platanoides ‘Globosum’ and Robinia pseudoacacia ‘Umbraculifera’.
An increase of protein content in the leaves of Acer platanoides
during the growing season was observed (Fig. 3). Lower values were
recorded in April and May, and from June to October significantly
higher values were observed. There was not observed a similar trend
in the case of R.pseudoacacia leaves. The protein content at the beginning and at the end of the growing season did not differ significantly.
Lower values were recorded in June and November, and the highest
in July. The protein content in leaves of A.platanoides ranged from
5,76 – 10,69 mg·g-1 f.w., when in R.pseudoacacia leaves it ranged from
0,34 – 1,05 mg·g-1 f.w.
Fig. 3. Protein content in each term of analysis, in the leaves of Acer platanoides ‘Globosum’ and Robinia pseudoacacia ‘Umbraculifera’.
In both of the tested species higher content of free amino acids
was observed in the first and last term of the material collection,
during the other months significantly lower values were found
(Fig. 4). The lowest values were approximately 11 mg N·100g-1 f.w.
for A.platanoides and for the R.pseudoacacia about 40 mg N·100g-1
f.w.
28
Dynamics of nitrogen compounds changes in the leaves of selected urban trees during...
Fig. 4. Free amino acids content in each term of analysis, in the leaves of
Acer platanoides ‘Globosum’ and Robinia pseudoacacia ‘Umbraculifera’.
Higher concentration of the chlorophyll sum in the A.platanoides
leaves were observed during the first two months of the experiment,
in July II and in August (Fig. 5). The lowest content of this pigments
was determined in October, the last period of analysis. Content of
this group of pigments was the lowest in June, while the highest value
was recorded in September in the case of Robinia pseudoacacia leaves.
Fig. 5. Chlorophyll sum content in each term of analysis, in the leaves
of Acer platanoides ‘Globosum’ and Robinia pseudoacacia ‘Umbraculifera’.
DISCUSSION AND CONCLUSIONS
Nitrates are one of the nitrogen sources for plants. It is assumed that
the increase in the nitrate content has an impact on the regulation
of genes involved in the nutrient remobilization processes [Igarashi
et al., 2009]. As reported by Jongebloed et al. [2004] during aging
activity of nitrate reductase is decreasing. This would explain the high
content of nitrates in the leaves of A.platanoides in the last terms of
analysis. In the case of R.pseudoacacia much larger fluctuations in the
29
Monika Czaja, Anna Kołton, Piotr Muras, Ewa Muszyńska
content of nitrate ions were recorded. At the beginning of July when
high air temperatures and radiation were noted, there was observed
a low concentration of NO3- ions. High radiation can stimulate nitrate reductase activity which cause change of nitrates into organic
compounds. High air temperatures and drought could also limit the
nitrates uptake [Lillo 2004]. In July II there was still low concentration of nitrates as a consequence of previous weather conditions, but
during this time the weather change was observed. Air temperature
decreased, radiation was limited with precipitation and then the
uptake of nitrates increased which could be caused by those changes
[Kaiser et al. 2004]. The nitrates concentration was the highest in
August. It has been shown that an abiotic stress may influence the
reduction of nitrate ion concentration in leaves [Debouba et al. 2007].
When the senescence is initiated, the degradation of chlorophylls,
proteins, lipids, nucleic acids and others begins. The collapse of these
structures results in the availability of particles which can be more
easily transported and stored [Guo 2012]. The experiment showed
a decrease in protein content in the leaves of Robinia psudoacacia in
November, and in the same time an increase in the free amino acids
content. This phenomenon was caused by the protein hydrolysis and
loss of activity of enzymes involved in leaf metabolism [Hörtensteiner
and Feller, 2002].
The experiment demonstrated the dynamics of nitrogen transformation during the growing season. Course of the dynamics depends
both on changes in weather conditions as well as the test species.
ACKNOWLEDGMENTS
Authors are grateful to Grażyna Sierant for excellent technical support.
FUNDING
This study was supported by the Ministry of Science and Higher Education - DS3500.
30
Dynamics of nitrogen compounds changes in the leaves of selected urban trees during...
REFERENCES
Bradford M.M. 1976. A rapid and sensitive method for the quantification of
microgram quantities of protein utilizing the principle of protein – dye
binding. Analytical Biochemistry 72(1-2): 248-254.
Debouba M. Maâroufi-Dghmi H. Suzuki A. Habib Ghorbel M. Gouia H.
2007. Changes in Growth Activity of Enzymes Involved in Nitrate Reduction and Ammonium Assimilation in Tomato Seedlings in Response to NaCl Stress. Annals of Botany 99: 1143-1151.
Guo Y. 2012. Towards Systems Biological Understanding of Leaf Senescence. Plant molecular biology 82(6): 519–28.
Hörtensteiner S. Feller U. 2002. Nitrogen metabolism and remobilization
during senescence. Journal of Experimental Botany, Vol. 53, No. 370,
pp. 927-937.
Igarashi D. Izumi Y. Dokiya Y. Totsuka K. Fukusaki E. Ohsumi C. 2009. Reproductive organs regulate leaf nitrogen metabolism mediated by cytokinin signal. Planta 229:633-644.
Jongebloed U. Szederkényi J. Hartig K. Schobert C. and Komor E. 2004.
Sequence of Morphological and Physiological Events During Natural
Ageing and Senescence of a Castor Bean Leaf: Sieve Tube Occlusion
and Carbohydrate Back-up Precede Chlorophyll Degradation. Physiologia plantarum 120(2): 338–46.
Kaiser W.M. Planchet E. Stoimenova M. Sonoda M. 2004. Modulation of
nitrate reduction – environmental and internal factors involved in Nitrogen Acquisition and Assimilation in Higher Plants Eds: Sara Amâncio
and Ineke Stulen. Kluwer Academic Publishers: 185-205.
Lillo C. 2004. Light regulation of nitrate uptake, assimilation and metabolism in Nitrogen Acquisition and Assimilation in Higher Plants Eds: Sara
Amâncio and Ineke Stulen. Kluwer Academic Publishers: 149-184.
Liu J. Wu Y.H. Jang J.J. Liu Y.D. Shen F.F. 2008. Protein Degradation and
Nitrogen Remobilization during Leaf Senescence. Journal of Plant Biology 51(1): 11-19.
Pallardy S.G. 2007. Nitrogen Metabolism in Physiology of Woody Plants.
Elsevier: 233-253.
Sun S.W., Lin Y.C. Weng Y.M. Chen M.J. 2006. Efficiency improvements on
ninhydrin method for amino acid quantification. J Food Comp. Anal.
19: 112–117.
Wang N.S. 2012. Amino acid assay by ninhydrin colorimetric method. Available on http:// www.eng.umd.edu/~nsw/ench485/lab3a.htm; Cite on
17 Oct 2012.
31
Monika Czaja, Anna Kołton, Piotr Muras, Ewa Muszyńska
Wellburn A. R. 1994. The spectral determination of chlorophylls a and b, as
well as total carotenoids, using various solvents with spectrophotometers of different resolution. Journal of Plant Physiology, 144: 307-313.
Address for correspondence:
M.Sc. Monika Czaja
D.Sc. Piotr Muras
Department of Dendrology and Landscape Architecture
Ph.D. Anna Kołton
M.Sc. Ewa Muszyńska
Institute of Plant Biology and Biotechnology
Department of Botany and Plant Physiology
Faculty of Horticulture
University of Agriculture in Krakow
Al. 29 Listopada 54, 31-425 Krakow
e-mail: [email protected]
Supervisor: D.Sc. Piotr Muras
32
Maja Dobińska
Anna Witek
Elżbieta Wojciechowicz-Żytko
EPISTEME
22/2014, t. III
s. 33–40
ISSN 1895-2241
WPŁYW WARUNKÓW MIEJSKICH NA
WYSTĘPOWANIE MSZYCY BZOWEJ (APHIS
SAMBUCI L.) ORAZ OWADÓW DRAPIEŻNYCH
NA BZIE CZARNYM (SAMBUCUS NIGRA L.)
THE IMPACT OF URBAN CONDITIONS
ON THE OCCURRENCE OF APHIS SAMBUCI L.
AND PREDATORY INSECTS ON SAMBUCUS NIGRA L.
Abstrakt. Obserwacje nad określeniem wpływu warunków miejskich na
dynamikę populacji mszycy bzowej Aphis sambuci oraz ustalenie roli owadów drapieżnych (bzygowatych, biedronkowatych, złotooków) w ograniczeniu populacji tej mszycy prowadzono w Krakowie na 5 stanowiskach zróżnicowanych pod względem natężenia ruchu ulicznego oraz nasłonecznienia.
Najliczniejsze kolonie mszyc, liczące od 200 do 300 osobników, stwierdzono
w trzeciej dekadzie maja na stanowiskach przy ruchliwych ciągach komunikacyjnych. W koloniach mszycy bzowej stwierdzono 7 gatunków bzygowatych, wśród których dominowały Syrphus virtipennis (Meig.) i Episrophe eligans (Harris). Skład gatunkowy i udział procentowy zebranych bzygowatych
był podobny na wszystkich stanowiskach. Odnotowano występowania tylko
jednego gatunku biedronek (Adalia bipunctata) w koloniach A. sambuci, co
wskazuje na niekorzystny wpływ tej mszycy, jako pokarmu dla niektórych
gatunków Coccinellidae.
Słowa kluczowe: bez czarny, mszyca bzowa, bzygowate, biedronkowate, klimat miasta
Summary. Observations on the influence of urban conditions on population
dynamics of the Aphis sambuci and the role of predators (Syrphidae, Coccineliidae, Chrysopidae) in reducing the aphid population was carried out in Krakow on 5 different locations diverse by the intensity of traffic and insolation.
The most abundant aphid colonies from 200 to 300 specimens were found in
the third decade of May in locations by busy traffic routes. In the colonies of
Aphis sambuci 7 species of hoverflies were found, among which Syrphus virti33
Maja Dobińska, Anna Witek, Elżbieta Wojciechowicz-Żytko
pennis (Meig.) and Episrophe eligans (Harris) were dominated. Species composition and percentage presence of collected hoverflies was similar at all locations. The presence of only one species of ladybird (Adalia bipunctata) in the
colonies A. sambuci have been noted and that indicate the negative impact of
those aphids as a food for certain species of Coccinellidae.
Key words: Sambucus nigra, Aphis sambuci, Syrphidae, Coccinellidae, urban
conditions
Wstęp
Klimat miasta charakteryzuje wiele czynników, które mają negatywny wpływ na organizmy żyjące w środowisku miejskim. Należą
do nich głównie: przesuszenie powietrza, wzrost temperatury, silne
zanieczyszczenie powietrza toksycznymi gazami oraz metalami
ciężkimi, alkalizacja lub zakwaszenie podłoża i zasolenie gleby. Dlatego też warunki do egzystencji, jakie stawia miasto dla organizmów
roślinnych i zwierzęcych są często za trudne do przeżycia. Istnieją
jednak gatunki, które w większym lub mniejszym stopniu przystosowały się do specyfiki środowiska miejskiego. Wśród nich znajduje
się bez czarny, który, według Łukasiewicza [2011], zaliczany jest do
grupy drzew i krzewów najmniej wrażliwych na niekorzystne warunki
środowiska [Frazik–Adamczyk 2006, Łukasiewicz 2011].
Bez czarny występuje na terenie całej Europy, w Polsce jest pospolity. Jest gatunkiem ekspansywnym, często występuje w zbiorowiskach ruderalnych, w lasach, zaroślach i na zrębach. Preferuje gleby
bogate w wapń i azot [Dolatowski i Seneta 2009].
Warunki miejskie sprzyjają rozwojowi niektórych grup owadów,
dotyczy to głównie owadów o kłująco-ssącym aparacie gębowym [Cichocka i Goszczyński 2008]. Wśród nich znajduje się mszyca bzowa
Aphis sambuci Linnaeus będąca ważnym szkodnikiem bzu czarnego.
Jest to gatunek dwudomny, żerujący na bzie od końca kwietnia do
lipca. Mszyce występują w górnych partiach krzewów zasiedlając
głównie młode pędy i kwiatostany. Ich żerowanie prowadzi do osłabienia wzrostu krzewu i zmniejszenie jego walorów dekoracyjnych.
W lipcu uskrzydlone formy przelatują na rośliny zielne, takie jak:
goździk Dianthus, firletka Lychnis, lepnica Silene, bniec Melandrium,
34
Wpływ warunków miejskich na występowanie mszycy bzowej (aphis sambuci l.)...
skalnica Saxifraga, szczaw Rumex [Goszczyński i Osak 2007, Depa
2010, Alford 2012].
Bytujące w koloniach mszyc owady drapieżne (bzygowate, biedronkowate, złotookowate i pryszczarkowate), parazytoidy oraz organizmy chorobotwórcze są sprzymierzeńcami człowieka w walce
ze szkodnikami roślin. Niejednokrotnie zależności troficzne między
organizmami wykorzystywane są w biologicznej ochronie roślin [Lipa
1978, Wiech 1997, Olszak i in. 2009].
Celem pracy było określenie wpływu warunków miejskich na
dynamikę populacji mszycy bzowej Aphis sambuci oraz ustalenie roli
owadów drapieżnych (bzygowatych, biedronkowatych, złotooków)
w ograniczeniu populacji tej mszycy.
Materiał i metody
Obserwacje prowadzono od kwietnia do czerwca 2012 r. na pięciu
stanowiskach bzu czarnego w Krakowie, w dzielnicy Zwierzyniec.
Stanowiska zlokalizowane były w sąsiedztwie ruchliwych ulic bądź
też w osiedlowych enklawach; zarówno w miejscach nasłonecznionych jak i zacienionych. Dwa stanowiska charakteryzowały się dużym
natężeniem ruchu oraz silnym nasłonecznieniem – oznaczono je numerami 1 i 2. Dwa inne stanowiska zlokalizowane były w miejscach
zacienionych, o średnim natężeniu ruchu (nr 3 i 4) i ostatnie słabo
nasłonecznione, o dużym natężeniu ruchu (nr 5).
Na każdym z krzewów wyznaczono po pięć pędów, na których
w odstępach tygodniowych szacowano liczbę mszyc, a także notowano
występowanie drapieżnych bzygowatych (Syrphidae), biedronkowatych
(Coccinellidae), złotooków (Chrysopidae) (postaci dorosłe i larwy).
W celu ustalenia składu gatunkowego bzygowatych, larwy i poczwarki zbierano i hodowano w szalkach Petriego do uzyskania postaci
dorosłych, a następnie oznaczano do gatunku według kluczy Bańkowskiej [1963] i Van Veena [2004].
Wyniki i dyskusja
Pierwsze kolonie mszyc liczące 20-25 osobników na pęd obserwowano
na bzie czarnym pod koniec kwietnia na stanowisku nr 1 i 2 (nasło35
Maja Dobińska, Anna Witek, Elżbieta Wojciechowicz-Żytko
necznione i o dużym natężeniu ruchu ulicznego). Na pozostałych
stanowiskach mszyce pojawiły się w drugiej połowie maja (Ryc. 1).
Podobne informacje można znaleźć w pracy Alforda [2012], który notował występowanie mszycy bzowej na bzie czarnym od końca kwietnia do lipca. Według tego samego autora mszyca bzowa jest najczęściej
spotykana na terenach podmiejskich. Goszczyński i Osak [2007]
notowali pierwsze kolonie A. sambuci w trzeciej dekadzie kwietnia.
W okresie maksymalnej liczebności, w trzeciej dekadzie maja,
mszyce występowały na wszystkich stanowiskach, a ich kolonie liczyły od 200 do 300 osobników na pęd (Ryc 1). Podczas całego okresu
obserwacji największą liczbę mszyc odnotowano na stanowiskach
słonecznych (nr 1, 2), przy ruchliwych ulicach. Cichocka i Goszczyński
[2008] zauważają, iż w terenach miejskich zwiększa się liczebność
owadów o kłująco-ssącym aparacie gębowym, natomiast na terenach
z mniejszym zanieczyszczeniem powietrza i z większą liczbą różnych
gatunków roślin, owady te występują rzadziej. Wyniki te świadczą
o przystosowaniu się mszyc do życia w warunkach miejskich. Można
również wnioskować, iż Aphis sambuci w warunkach miejskich wykorzystuje osłabienie rośliny do liczniejszego jej zasiedlenia.
Ryc. 1. Dynamika populacji mszycy Aphis sambuci, na poszczególnych
stanowiskach
W pierwszej dekadzie czerwca, na wszystkich stanowiskach, zaobserwowano stopniowy spadek liczebności mszyc, co było związane
z działalnością drapieżców i przelotami mszyc na żywicieli letnich.
Owady drapieżne, pojawiały się najliczniej na stanowiskach nasłonecznionych, przy ruchliwych ulicach (nr 1, 2), czyli tam, gdzie kolonie
36
Wpływ warunków miejskich na występowanie mszycy bzowej (aphis sambuci l.)...
mszyc były najliczniejsze. Wyniki te są zgodne z informacjami, jakie
podaje Lipa [1978]. Autor stwierdza, że liczebność drapieżców wzrasta
proporcjonalnie do zagęszczenia populacji szkodników, a najintensywniejszy wzrost występuje w okresie masowych pojawów szkodników.
W przypadku niniejszych badań dane te dotyczą głównie drapieżnych
bzygowatych oraz biedronkowatych, gdyż były one najczęściej spotykanymi drapieżcami mszycy bzowej.
Owady drapieżne pojawiały się w koloniach mszycy bzowej z pewnym opóźnieniem względem ich ofiar. W miarę wzrostu liczebności
kolonii mszyc, wzrastała również liczba drapieżców i zwiększała się
ich efektywność.
Z kolonii A. sambuci zebrano larwy bzygowatych należące do 7 gatunków. Dorosłe bzygowate oraz ich larwy wystąpiły najliczniej pod
koniec maja na stanowiskach 1 i 2 (silnie nasłonecznione i o dużym
natężeniu ruchu). W koloniach mszycy bzowej najczęściej spotykane
były gatunki: Syrphus vitripennis i Epistrophe eligans, które stanowiły
46% ogółu wyhodowanych bzygów. Skład gatunkowy i udział procentowy zebranych bzygowatych był podobny na wszystkich stanowiskach (Tab. 1, Ryc. 2). Bańkowska [1980], zauważa, iż środowisko
miejskie wpływa niekorzystnie na liczebność bzygów, oraz powoduje
wyodrębnienie się kilku dominujących gatunków.
Ryc. 2. Skład gatunkowy bzygowatych występujących
w koloniach A. sambuci
Porównując liczbę żerujących w koloniach mszyc larw bzygów do
liczby mszyc stwierdzono maksimum liczebności larw w okresie wy37
Maja Dobińska, Anna Witek, Elżbieta Wojciechowicz-Żytko
stępowania najliczniejszych kolonii mszyc. Według Jaśkiewicz [1997]
bzygowate są bardzo płodne, co skutkuje ich wysoką efektywnością
jako drapieżców mszyc. Ponadto, w przypadku dużej ilości pokarmu
larwy bzygów tylko częściowo wysysają mszyce, a następnie atakują
inne osobniki, dzięki czemu skuteczniej niszczą populacje szkodnika
[Wojciechowicz–Żytko 2007].
Biedronki najliczniej wystąpiły na stanowisku 1 - silnie nasłonecznionym i o dużym natężeniu ruchu - największą liczbę jaj odnotowano w połowie maja, larwy natomiast najliczniej występowały na
początku czerwca, wówczas, gdy liczba mszyc spadała. Stwierdzono
występowanie tylko jednego gatunku biedronek - Adalia bipunctata
(Tab. 1). Według wielu autorów [Nielsen i in. 2002; Nedvĕd, Salvucci
2008] substancje kumulujące się w mszycach podczas ich żerowania
na bzie czarnym (np. sambunigryna) są toksyczne dla biedronek,
zwłaszcza dla biedronki siedmiokropki (Coccinella septempunctata).
Tab. 1. Występowanie owadów drapieżnych
na poszczególnych stanowiskach
Owad drapieżny/
stanowisko
1
2
3
4
5
Syrphidae
7
6
2
4
4
Coccinellidae
33
7
2
4
9
Inne
2
-
1
-
-
Podczas obserwacji, w trzeciej dekadzie maja odnotowano liczne
mumie mszyc, które świadczą o występowaniu parazytoidów. Natomiast
nieliczne złotooki obserwowano dopiero w drugiej dekadzie czerwca.
W tym okresie liczba mszyc na krzewach była stosunkowo mała.
Wnioski
Mszyca bzowa (Aphis sambuci L.) częściej atakowała krzewy znajdujące się na stanowiskach nasłonecznionych, o dużym natężeniu
ruchu ulicznego. Można stwierdzić, że mszyce przystosowały się do
miejskich warunków i wykorzystują ogólne osłabienie mechanizmów
obronnych rośliny, będące wynikiem trudnych warunków wzrostu
w rejonie miasta.
38
Wpływ warunków miejskich na występowanie mszycy bzowej (aphis sambuci l.)...
W koloniach mszycy bzowej Aphis sambuci na bzie czarnym występowały drapieżne bzygowate ograniczające liczebność tej mszycy.
Może to świadczyć o tym, że tolerują one warunki miejskie. Jednocześnie, skład gatunkowy bzygowatych zebranych podczas obserwacji
był niezróżnicowany, co może być wynikiem negatywnego wpływ warunków miejskich na różnorodność gatunkową owadów z tej rodziny,
jednak aby to potwierdzić konieczne są kolejne badania.
Odnotowanie występowania tylko jednego gatunku biedronek
(Adalia bipunctata) w koloniach A. sambuci wskazuje na niekorzystny
wpływ tej mszycy, jako pokarmu dla niektórych gatunków Coccinellidae.
Literatura:
Alford D.V. 2012. Pests of ornamental trees, shrubs and flowers. Manson
Publishing Ltd. London: 54-55.
Bańkowska R. 1963. Syrphidae, W: Klucze do oznaczania owadów Polski,
Państwowe Wydawnictwo Naukowe: 236ss
Bańkowska R. 1980. Fly communities of the family Syrphidae in natural and
anthropogenic habitats of Poland. Polish Academy of Sciences, Istitut
of Zoology. Memorabilia Zoologica, 33.
Cichocka E., Goszczyński W. 2008. The impact of urban pressure of species composition and number of Arthropoda on trees in city on the
ex ample of Warsaw. Aphid and Other Hemipterous Insect, 14: 63-69.
Depa Ł., 2010. Possibility of overwintering of Aphis sambuci Linnaeus, 1758
(Hemiptera, Aphididae) on secondary host in climate conditions of Poland. Aphids and Other Hemipterous Insects, 16: 21-25.
Dolatowski J., Seneta W. 2009. Dendrologia. Państwowe Wydawnictwo Naukowe. Warszawa: 471-473.
Frazik–Adamczyk M. 2006. Charakterystyka zagrożeń zieleni miejskiej,
ze szczególnym uwzględnieniem zieleni w ciągach komunikacyjnych.
Opracowanie wykonane dla Urzędu miasta Krakowa, Wydział Gospodarki Komunalnej i Ochrony Środowiska. Kraków: 3-4.
Goszczyński W., Osak M., 2007. Sambucus nigra L. in Lublin area landscape and
its aphid fauna. Aphids and Other Hemipterous Insects, 13: 107-113.
Jaśkiewicz B. 1997. Skład gatunkowy i dynamika pojawu mszyc na wybranych
krzewach ozdobnych w latach 1973 – 1993. Seria Wydawnicza – Rozprawy Naukowe. Wydawnictwo Akademii Rolniczej. Lublin: 8-10.
Lipa J.J. 1978. Ekologiczne podstawy zwalczania szkodników [w]: Biologiczne metody walki ze szkodnikami roślin. Państwowe Wydawnictwo Naukowe. Warszawa: 11-19.
39
Maja Dobińska, Anna Witek, Elżbieta Wojciechowicz-Żytko
Łukasiewicz S. 2011. Drzewa i krzewy polecane do obsadzeń ulicznych
w miastach. [w:] Rośliny do zadań specjalnych. Wydawnictw
Państwowej Wyższej Szkoły Zawodowej. Sulechów: 313-324.
Nedvĕd O., Salvucci S., 2008. Ladybird Coccinella septempunctata (Coleoptera: Coccinellidae) prefers a toxic prey in laboratory choice experiment. Eur. J. Entomol. 105: 431-436.
Nielsen F.H., Hauge M.S., Toft S., 2002. The influence of mixed aphid diets
on larval performance of Coccinella septempunctata (Col., Coccinellidae). Journal of Applied Entomology, 126, 4: 194-197.
Olszak R., Sobiczewski P., Cieślińska M. 2009. Ekologiczne „wzmocnienie
odporności” upraw sadowniczych przeciwko szkodnikom. Progress in
Plant Protection/Postępy w Ochronie Roślin, 49 (3): 1075-1078.
van Veen M.P. 2004. Hoverflies of Northwest Europe. Identyfication keys of
to the Syrphidae. KNNV Publishing. Utrecht: 247ss.
Wiech K. 1997. Pożyteczne owady i inne zwierzęta. Wydawnictwo Medix
Plus Kraków.
Wojciechowicz – Żytko E. 2007. Rola bzygowatych (Diptera, Syrphidae) i innych drapieżców w regulacji populacji mszycy wiśniowej – Myzus cerasi
(Homoptera, Aphidodea). Zeszyty Naukowe Akademii Rolniczej im.
Hugona Kołłątaja w Krakowie, 443, (321).
Adres do korespondencji:
mgr inż. Maja Dobińska
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Ogrodniczy
e-mail: [email protected]
mgr inż. Anna Witek
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Ogrodniczy
e-mail: [email protected]
dr hab. inż. Elzbieta Wojciechowicz-Żytko
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Ogrodniczy
e-mail: [email protected]
40
Klaudia Duda
Joanna Bonio
EPISTEME
22/2014, t. III
s. 41–47
ISSN 1895-2241
GRZYBY BYTUJĄCE NA MAGNOLII SOULANGE’A
(MAGNOLIA X SOULANGEANA SOUL.-BOD.)
W OGRODZIE BOTANICZNYM UNIWERSYTETU
JAGIELLOŃSKIEGO W KRAKOWIE
FUNGI INHABITING SAUCER MAGNOLIA (MAGNOLIA
X SOULANGEANA SOUL.-BOD.) IN JAGIELLONIAN
UNIWERSITY BOTANICAL GARDEN IN KRAKOW
Abstrakt. Badania przeprowadzono w Ogrodzie Botanicznym Uniwersytetu Jagiellońskiego w Krakowie na trzech odmianach magnolii Soulange’a:
‘Alexandrina’, ‘Amabilis’ oraz ‘Rustica Rubra’. Materiałem do badań mykologicznych były łuski, płatki kwiatowe oraz liście magnolii z widocznymi przebarwieniami, plamistościami i nekrozą. Z zebranych organów roślinnych
wyodrębniono liczne kolonie grzybów strzępkowych, a wśród nich: Alternaria alternata, Phomopsis archeri, Boeremia exigua i Coleophoma rhododendri.
Najwięcej kolonii i gatunków grzybów wyizolowano z porażonych tkanek
odmiany ‘Amabilis’. Grzyby zasiedlały badane rośliny z różną częstością,
wywołując symptomy chorób w niejednakowym nasileniu, co sugerowałoby odmienną podatność badanych odmian na patogeny. Objawy porażenia
przez grzyby bytujące na magnoliach, widoczne na kwiatach, łuskach i liściach znacznie obniżały ich walory dekoracyjne.
Słowa kluczowe: magnolia Soulange’a, Ogród Botaniczny UJ, grzyby, kwiaty,
liście
Summary. The study were carried out on three different saucer magnolia
cultivars: ‘Alexandrina’, ‘Amabilis’ and ‘Rustica Rubra’, in the Jagiellonian
University Botanical Garden. The sources of the research material were
magnolias bud scales, petals and leaves with visible discoloration, spots and
necrosis. Many filamentous fungi colonies, including: Alternaria alternata,
Phomopsis archeri, Boeremia exigua and Coleophoma rhododendri were isolated
from collected plant organs. The most numerous fungi colonies and species were isolated from the ‘Amabilis’ cultivar. Fungi inhabiting test plants
with different frequencies induced symptoms of disease in a non-uniform
intensity, which would suggest a different susceptibility test of cultivars for
pathogens. Symptoms of fungi infection visible on magnolia flowers, scales
and leaves considerably decreased the decorative values of the plants.
Key words: saucer magnolia, UJ Botanical Garden, fungi, flowers, leaves
41
Klaudia Duda, Joanna Bonio
Wstęp
Magnolia Soulange’a jest jedną z najpiękniejszych i najczęściej uprawianych w Polsce, a niezwykłą dekoracyjnością cechują się krzewy
i drzewa odmian: ‘Alexandrina’, ‘Amabilis’ oraz ‘Rustica Rubra’. Oprócz
kolekcji w ogrodach botanicznych i arboretach, magnolie są także
popularne w ogrodach przydomowych i w terenach zieleni miejskiej
[Czekalski 2007, Latocha 2010]. Magnolie narażone są na choroby
infekcyjne, w tym na mykozy, które powodują obniżenie ich walorów
dekoracyjnych. Objawy porażenia widoczne są w największym nasileniu na pąkach kwiatowych, płatkach kwiatowych oraz na liściach
[Przybył 2002, Czekalski 2007, Pląskowska 2010].
Celem badań było określenie składu gatunkowego grzybów, bytujących na pąkach, kwiatach i liściach trzech odmian magnolii Soulange’a, powodujących pogorszenie kondycji zdrowotnej tych roślin.
Materiał i metody
Badania mykologiczne przeprowadzono w roku 2013 w kolekcji Ogrodu Botanicznego Uniwersytetu Jagiellońskiego w Krakowie. Źródłem
materiału badawczego były krzewy magnolii Soulange’a odmiany
‘Alexandrina’, ‘Amabilis’ i ‘Rustica Rubra’. Reprezentatywny materiał
badawczy stanowiły łuski pąków kwiatowych zebrane w kwietniu,
płatki kwiatowe zebrane w maju oraz liście zebrane we wrześniu. Na
materiale roślinnym widoczne były plamistości i nekroza. Do badań
laboratoryjnych przeznaczono po 40 fragmentów łusek, płatków i liści
z każdej odmiany, co dało ogółem 360 fragmentów. Fragmenty tkanek
pobrano z pogranicza tkanki zdrowej i z symptomami chorób. Izolację
i hodowlę grzybów przeprowadzono zgodnie ze standardowymi metodami stosowanymi w mykologii. Grzyby oznaczono w oparciu o klucze
mykologiczne: Domsch i in. [1980], Sutton [1980] oraz Ellis i Ellis
[1987]. W zestawieniach tabelarycznych uwzględniono ich aktualny
status taksonomiczny wg Index Fungorum [2014].
Wyniki
Z porażonego materiału roślinnego z objawami plamistości i nekrozy
wyizolowano 295 kolonii grzybów należących do 25 gatunków, w ob42
Grzyby butujące na magnolii soulange’a (magnolia x soulangeana soul.-Bod.)...
rębie 19 rodzajów. Najwięcej kolonii grzybów bytowało na odmianie
‘Amabilis’, z której wyodrębniono 123 kolonie (tab. 1), o 40 więcej niż z
odmiany ‘Alexandrina’ (tab. 2) i o 34 więcej od ‘Rustica Rubra’ (tab. 3).
Dominującym grzybem na łuskach pąków kwiatowych, płatkach kwiaTab. 1. Grzyby wyizolowane z organów Magnolia x soulangeana ‘Amabilis’
Grzyb
Alternaria alternata
Aspergillus brasiliensis
Boeremia exigua
Chaetomium globosum
Coleophoma rhododendri
Davidiella macrocarpa
Elsinoë magnoliae
Epicoccum nigrum
Fusarium sporotrichioides
Gyrothrix circinata
Mortierella alpina
Passalora magnoliae
Penicillium expansum
Phomopsis archeri
Phomopsis magnoliicola
Rhizomucor pusillus
Ogółem
łuski
1
2
1
3
1
3
2
2
15
Liczba kolonii
płatki
liście
10
27
3
9
3
6
2
6
18
1
5
18
63
45
Suma
kolonii
38
5
9
3
6
2
6
18
2
5
3
1
3
18
2
2
123
%
udział
30,89
4,06
7,32
2,44
4,88
1,63
4,88
14,63
1,63
4,06
2,44
0,81
2,44
14,63
1,63
1,63
100,00
Tab. 2. Grzyby wyizolowane z organów Magnolia x soulangeana ‘Alexandrina’
Grzyb
Alternaria alternata
Aspergillus brasiliensis
Chaetomium bostrychodes
Coleophoma rhododendri
Epicoccum nigrum
Mortierella parvispora
Penicillium citrinum
Penicillium expansum
Penicillium hirsutum
Penicillium jensenii
Phoma medicaginis
Phyllosticta magnoliae
Ogółem
łuski
5
1
1
2
1
2
12
Liczba kolonii
płatki
liście
4
29
3
4
3
22
1
3
2
32
39
Suma
kolonii
38
1
1
3
4
2
3
23
3
1
2
2
83
% udział
46,00
1,20
1,20
3,61
4,82
2,41
3,61
27,71
3,61
1,20
2,41
2,41
100,00
43
Klaudia Duda, Joanna Bonio
Tab. 3. Grzyby wyizolowane z organów Magnolia x soulangeana ‘Rustica Rubra’
Grzyb
Alternaria alternata
Cladosporium herbarum
Elsinoë magnoliae
Epicoccum nigrum
Mortierella parvispora
Passalora magnoliae
Penicillium citrinum
Penicillium expansum
Phomopsis magnoliicola
Phyllosticta magnoliae
Tetracoccosporium paxianum
Ogółem
Liczba kolonii
łuski płatki
liście
2
10
37
2
1
5
19
3
1
1
3
1
1
3
9
21
59
Suma
kolonii
49
2
1
24
3
1
1
3
1
1
3
89
%
udział
55,06
2,25
1,12
26,97
3,37
1,12
1,12
3,37
1,12
1,12
3,37
100,00
towych i liściach trzech odmian magnolii był Alternaria alternata. Dużą
liczebnością charakteryzowały się także: Boeremia exigua, Coleophoma
rhododendri, Epicoccum nigrum i Phomopsis archeri.
Na płatkach kwiatowych bytowało 15 gatunków grzybów, nieco
mniej na łuskach (13 gat.), a najmniej na liściach (6 gat.). Z łusek
i płatków odmiany ‘Rustica Rubra’ wyizolowano najmniej kolonii
grzybów, jednocześnie na liściach tej odmiany bytowało najwięcej
kolonii grzybów.
Porównując liczbę kolonii grzybów bytujących na porażonych organach stwierdzono, że liście magnolii były najczęściej zasiedlane. Wyodrębnione z nich kolonie grzybów stanowiły 48,5% ogółu zbiorowiska
grzybów bytujących na magnolii. Nieco mniej kolonii grzybów bytowało
na płatkach kwiatowych (39,3%), a najmniej na łuskach (ryc. 1).
Ryc. 1. Procentowy udział grzybów wyizolowanych
z porażonych organów magnolii
44
Grzyby butujące na magnolii soulange’a (magnolia x soulangeana soul.-Bod.)...
Dyskusja
Według Czekalskiego [2007] i Latochy [2010] magnolie rzadko są
porażane przez grzyby. Autorzy uważają, że najgroźniejszą chorobą
magnolii jest bakteryjna plamistość liści powodowana przez Pseudomonas syringae. Narastający problem utraty dekoracyjności magnolii
powodowanej przez choroby grzybowe stwierdziła Pląskowska [2010],
jednocześnie wskazując na częste błędy diagnostyczne.
W literaturze wymieniane są takie choroby magnolii, jak: zgnilizna sadzonek, szara pleśń, zamieranie pędów, plamistości liści,
antraknoza, parch i rak pędów [Łabanowski i in. 2000, Łabanowski i
Wojdyła 2003, Czekalski 2007, Łabanowski i in. 2009, Latocha 2010,
Pląskowska 2010]. Jako sprawcy tych chorób podawane są grzyby:
A. alternata, Cercospora magnoliae (syn. Passalora magnoliae) Botrytis
cinerea, Phyllosticta cookei, Elsinoë magnoliae, Nectria cinnabarina, Glomerella cingulata (syn. Colletotrichum gloeosporioides), Fusarium spp.
oraz organizm grzybopodobny Pythium ultimum.
W wyniku analizy mykologicznej przeprowadzonej na łuskach pąków kwiatowych, płatkach kwiatowych i liściach magnolii Soulange’a
określono gatunki grzybów bytujących na tych organach i wywołujących plamistości oraz nekrozę. Z porażonego materiału wyodrębniono
25 gatunków grzybów potencjalnie patogenicznych i saprotroficznych,
w tym podawanych w literaturze jako sprawcy chorób: A. alternata,
P. magnoliae, E. magnoliae, Phomopsis magnoliicola oraz Phyllosticta magnoliae. Wykazano, że magnolie są najczęściej zasiedlane przez Alternaria alternata, co jest potwierdzeniem wyników Pląskowskiej [2010].
Wyodrębnienie z płatków i liści magnolii Epicoccum nigrum świadczy, że grzyb ten zasiedla tkanki wielu roślin ozdobnych [Domsch i in.
1980, Kowalik i Duda 2014], natomiast brak groźnego dla magnolii
polifaga B. cinerea, wywołującego szarą pleśń na wielu roślinach ozdobnych [Łabanowski i in. 2009, Pląskowska 2010] sugeruje, że grzyb
ten w warunkach klimatycznych panujących w okresie wegetacyjnym
w 2013 roku w Ogrodzie Botanicznym UJ nie znalazł korzystnych
warunków rozwoju.
Wyizolowanie monofagów bytujących na magnolii Soulange’a,
takich, jak: E. magnoliae, P. magnoliae, Ph. magnoliicola i Ph. magnoliae
wskazuje na zagrożenie chorobotwórcze wobec innych gatunków
magnolii.
45
Klaudia Duda, Joanna Bonio
Porównując liczebność grzybów bytujących na magnoliach: ‘Alexandrina’, ‘Amabilis’ i ‘Rustica Rubra’, stwierdzono, że grzyby zasiedlały badane odmiany z różną częstością, wywołując symptomy chorób
w niejednakowym nasileniu, co sugerowałoby odmienną podatność
badanych odmian na patogeny.
Wnioski
Dominującym grzybem zasiedlającym kwiaty i liście trzech odmian
magnolii Soulange’a był A. alternata. Grzyb ten bytował w nieznacznej
liczbie kolonii na łuskach pąków kwiatowych, przerastał na płatki kwiatowe, a następnie na liście powodując symptomy przebarwień i nekrozę.
Najwięcej kolonii i gatunków grzybów bytowało na odmianie
‘Amabilis’ wywołując symptomy nekrozy, co wskazuje na jej znaczną
podatność na porażenie przez grzyby.
Objawy porażenia przez grzyby bytujące na magnoliach, widoczne
na kwiatach, łuskach i liściach znacznie obniżały ich walory dekoracyjne.
Bibliografia
Czekalski M. 2007. Magnolie. Plantpress. Kraków.
Domsch K.H., Gams W., Anderson T.H. 1980. Compendium of Soil Fungi.
Academic Press. London, New York, Toronto, Sydney, San Francisco.
Ellis M.B., Ellis J.P. 1987. Microfungi on Land Plants: An Identification
Handbook. Croom Helm, London & Sydney.
Kowalik M., Duda K. 2014. Przyczyny zamierania liści powojnika (Clematis
L.). Prog. Plant Prot./Post. Ochr. Roślin [w druku].
Latocha P. 2010. Magnolie. Działkowiec. Warszawa: 4, 59-61.
Łabanowski G., Orlikowski L., Soika G. 2009. Vademecum ochrony drzew
i krzewów ozdobnych. Plantpress. Kraków: 88.
Łabanowski G., Orlikowski L., Soika G., Wojdyła A. 2000. Ochrona ozdobnych krzewów liściastych. Plantpress. Kraków: 138-144.
Łabanowski G., Wojdyła G. 2003. Ochrona roślin ozdobnych. Działkowiec.
Warszawa: 172-175.
Pląskowska E. (red.) 2010. Zagrożenia spowodowane przez Colletotrichum
spp. i inne grzyby występujące na roślinach z rodziny Magnoliaceae
[w:] Miejskie tereny zielone – zagrożenia. Monografia CV. UP we Wrocławiu: 32-38.
46
Grzyby butujące na magnolii soulange’a (magnolia x soulangeana soul.-Bod.)...
Przybył K. 2002. Ważniejsze choroby grzybowe i bakteryjne niektórych
drzew i krzewów parkowych. Biuletyn Ogrodów Botanicznych 11: 9-20.
Sutton B.C. 1980. The Coelomycetes. Fungi Imperfect with Pycnidia, Acervuli and Stroma. Common. Mycol. Instit. Kew, Surrey, England.
Index Fungorum. 2014. Internet: www.indexfungorum.org, [dostęp
10.01.2014]
Adres do korespondencji:
mgr inż. Klaudia Duda, mgr inż. Joanna Bonio
Katedra Ochrony Roślin
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. inż. Maria Kowalik
47
Marta Izajasz-Parchańska
Monika Białobrzeska
EPISTEME
22/2014, t. III
s. 49–57
ISSN 1895-2241
Możliwość uprawy winorośli w okolicach
Krakowa na podstawie wybranych
wskaźników agroklimatycznych
The possibility of wine-growing
in the vicinity of Kraków according
to selected agro-climatic indicators
Abstrakt. Celem badań była charakterystyka okolic Krakowa, pod kątem
ogólnej przydatności regionu do uprawy winorośli i doboru odpowiednich
odmian, przy pomocy wybranych wskaźników agroklimatycznych (SAT,
GDD, LTI). Analizę wykonano dla okresu 10 lat (2003-2012). Dane dla stacji
synoptycznej w Krakowie-Balicach pozyskano z ogólnodostępnej bazy Ogimet. Wykorzystano również dane ze stacji meteorologicznej zlokalizowanej
na terenie Winnicy Srebrna Góra w Krakowie (2012). W badanym okresie
średnia wartość SAT w Krakowie wyniosła 2858°C, GDD 1146°C a LTI 196.
Na terenie winnicy wskaźnik SAT kształtował się na poziomie 3162oC i był
wyższy o 160°C, niż w tym samym okresie w Krakowie-Balicach. Wybrane
wskaźniki agroklimatyczne, zgodnie z przyjętą klasyfikacją, pokazały, że
w kolejnych latach warunki dla rozwoju winorośli w okolicach Krakowa były
w zakresie od umiarkowanie dogodnych do dobrych, dla winorośli dojrzewających w porze od średnio-wczesnej do późnej oraz wskazały na prawidłowy
dobór odmian w badanej winnicy.
Słowa kluczowe: SAT, GDD, LTI , winorośl, strefa A uprawy winorośli
Summary. The aim of the study was to characterize the Kraków area, in
terms of the overall suitability for the wine-growing and the selection of
grapevine cultivars according to selected agro-climatic indices (SAT, GDD,
LTI) calculated for 10 years (2003-2012). Data for the synoptic station in
Kraków-Balice obtained from a public database Ogimet was used as well
as from weather station located inside Silver Mountain Vineyard in Kraków (for year 2012). In the analysed period, the average value of the SAT
in Kraków was 2858°C, GDD 1146°C and LTI 196. SAT from the vineyard
with value of 3162°C was higher than in the same period in Kraków-Balice
(160°C). Selected agro-climatic indices pointed to a moderately good and
49
Marta Izajasz-Parchańska, Monika Białobrzeska
good conditions for the development of the vines in the vicinity of Kraków,
in analyzed period, from medium-early to late season fruit ripening and the
proper selection of grapevine cultivars in the test vineyard.
Key words: SAT, GDD, LTI, vine, zone A for wine-growing
WSTĘP
W ostatnich kilkunastu latach obserwujemy znaczny wzrost zainteresowania uprawą winorośli w Polsce, co związane jest m.in. ze zmianami klimatycznymi i możliwością uprawy lepiej przystosowanych do
polskich warunków odmian winorośli, tzw. mieszańców złożonych.
W Polsce przyrost temperatury od początku XX wieku szacuje się na
0,6 – 0,8°C na 100 lat, przy czym najwyższe tempo wzrostu wykazuje
temperatura minimalna. Wyraźny wzrost średniej rocznej temperatury
powietrza zaobserwowano pod koniec XX wieku wynoszący ok. 0,3°C
na dekadę. Lata 1998 i 2000 były najcieplejszymi rocznikami, a XXI
wiek zaczął się również bardzo ciepłym rokiem 2002 [Lorenc 2005]. Ponadto obserwuje się wydłużanie i wcześniejsze rozpoczynanie ciepłych
pór roku oraz łagodniejszy przebieg okresów zimowych, co stwarza
możliwość ponownego wprowadzenia upraw winorośli, szczególnie
w najcieplejszych regionach Polski [Żmudzka 2001, Myśliwiec 2006].
Warunki atmosferyczne (szczególnie temperatura powietrza) w bardzo
silny sposób determinują tempo dojrzewania oraz jakość owoców winorośli. Optimum w tym kluczowym dla winiarstwa okresie mieści się
w zakresie 20-25°C [Jackson 2008]. Zakładanie winnicy jest opłacalne,
jeśli średnia roczna temperatura powietrza przekracza 8°C, w okresie
wegetacyjnym (przyjętym od 01 kwietnia do 30 października) wynosi
minimum 14°C, a w najcieplejszym miesiącu kształtuje się na poziomie
ok. 17°C [Myśliwiec 2006]. Należy również brać pod uwagę szereg innych czynników mających wpływ na plonowanie, wzrost i dojrzewanie
owoców winorośli, m. in. minimalne temperatury w okresie zimowym,
miąższość lub brak pokrywy śnieżnej, długość okresu bezprzymrozkowego, daty pojawiania się ostatnich wiosennych przymrozków i inne;
jednak te czynniki nie były brane pod uwagę w niniejszym opracowaniu.
W okresie letnim tereny położone między Krakowem a Tarnowem
stanowią obok Dolnego Śląska jeden z najcieplejszych regionów Polski.
Tradycje upraw winorośli i wytwarzania wina w Krakowie i okolicach
sięgają X wieku. W 2008 roku u stóp klasztoru O.O. Kamedułów na
Bielanach, w dolinie rzeki Wisły, powstała Winnica Srebrna Góra Sp.
50
Możliwość uprawy winorośli w okolicach Krakowa...
z o.o. (12 ha), położona na wzgórzu (230-280 m n.p.m) o ekspozycji
pd-zach i nachyleniu zbocza w zakresie 10-15%. Celem opracowania,
oprócz oceny okolic Krakowa pod względem przydatności do uprawy
winorośli, przy pomocy wskaźników agroklimatycznych takich jak SAT
(suma aktywnych temperatur), GDD (suma efektywnych temperatur)
oraz LTI (latitude temperature index), było porównanie warunków
i ocena prawidłowości doboru odmian winorośli w przykładowej winnicy.
MATERIAŁ I METODY
Dane dla stacji synoptycznej w Krakowie-Balicach (reprezentującej okolice Krakowa) pozyskano poprzez ogólnodostępną bazę OGIMET [www.
ogimet.com]. Na podstawie dobowych zapisów temperatury powietrza
(minimum, maksimum, średnia) obliczono średnie miesięczne, a następnie wartości dla sezonu wegetacji winorośli (przyjętego od 01 kwietnia do 31 października) w poszczególnych latach oraz dla całej dekady
(2003-2012). Dane dla Winnicy Srebrna Góra otrzymano przy pomocy
zamontowanej na jej terenie stacji meteorologicznej DAVIS Vanatage
Pro2 i oprogramowaniu WeatherLink 5.9.3. Pomiary rejestrowane przez
stację z częstotliwością co 10 minut, były pozyskiwane celem obliczenia
dobowych temperatur powietrza (minimum, maksimum i średnia),
a następnie średnich miesięcznych oraz dla sezonu wegetacji 2012. Na
podstawie danych cząstkowych dokonano obliczeń: SAT, GDD i LTI dla
Krakowa Balic (2003-2012) oraz w winnicy (2012). Wskaźniki obliczono
zgodnie ze wzorami [Winkler i in. 1974, Jackson i Cherry 1988, Jones
i Davis 2000, Gustafsson i Martensson 2005,]
, dla
°C
, dla
LTI = MTWM *(60- φ), gdzie MTWM – średnia temperatura najcieplejszego miesiąca
φ – stopień szerokości geograficznej
Oceny warunków w okolicy Krakowa i na terenie winnicy oraz
prawidłowości doboru odmian winorośli, dokonano według klasyfikacji ujętych w tab. 1, 2 i 3.
51
Marta Izajasz-Parchańska, Monika Białobrzeska
Tab. 1. Wielkości SAT i możliwości dojrzewania grup odmian winorośli
(opracowano na podstawie, Myśliwiec 2006, Lisek 2011).
* Odmiany uprawiane w Winnicy Srebrna Góra.
SAT [°C]
Klasyfikacja
Przykładowe odmiany uprawiane w Polsce
2000-2200
Bardzo
wczesne
Solaris*, Milia, Siegerrebe*
2200-2500
Wczesne
Rondo*, Aurora, Cascade, Jutrzenka*, Acolon*, Pinot
Noir Precoce*
2500-2700
Średnio
wczesne
Regent*, Cabernet Cortis*, Bacchus, Dornfelder,
Marechal Foch, Leon Millot, Muskat Odeski, Müller
Thurgau, Bianca
2700-2900
Średnio
późne
Hibernal*, Seyval Blanc*, Johanniter*, Sibera, Traminer*, Silvaner, Pinot Gris*, Auxerrois*
> 2900
Późne
Pinot Noir*, Zweigelt*, Riesling*, Chardonnay*, Pinot
Blanc
Tab. 2. Zmodyfikowana skala Winklera - GDD dla chłodnych regionów
winiarskich [Report Agriculture Canada 1984]
Klasa
GDD [°C]
Warunki
1
> 1390
2
1165-1389
Dogodne (dobre)
3
945-1164
Umiarkowanie dogodne (wystarczające)
4
< 945
Najbardziej dogodne (bardzo dobre)
Wątpliwe
Tab. 3. Sugerowane odmiany Vitis vinifera w związku z przynależnością do
grup wg LTI [Gustafsson i Martensson 2005]
Grupa / LTI
A / LTI < 190
Odmiany winorośli
Auxerrois Blanc (green), Bacchus (green), Blauer
Zweigelt (blue), Chardonnay (green), Chasselas,
Faber, Gewürztraminer, Kerner, Madeleine Angevine
(blue), Müller Thurgau (green), Perle, Pinot Blanc,
Pinot Gris, Pinot Meunier, Reichensteiner, Riesling,
Scheurebe, Schönburger, Triomphe d`Alsace
B / LTI 190 - 270 Pinot Noir, Riesling
C / LTI 270 - 380
D / LTI > 380
52
Cabernet Sauvignon, Cabernet Franc, Malbec, Merlot,
Sauvignon Blanc, Semillon
Carignan, Cinsaut, Grenache, Shiraz, Zinfandel
Możliwość uprawy winorośli w okolicach Krakowa...
WYNIKI I DYSKUSJA
W celu dokonania wyboru konkretnej odmiany winorośli do uprawy na
danym terenie potrzebna jest znajomość wartości SAT - sum średnich
dobowych temperatur równych lub powyżej 10°C w okresie intensywnej
wegetacji winorośli. Aby zapewnić regularne dojrzewanie winogron
należy przyjąć, że wieloletnia, średnia wartość tego wskaźnika powinna
być o 100°C wyższa od wymaganej dla konkretnej odmiany. W latach
2003-2012 średnia wartość sumy aktywnych temperatur w Krakowie-Balicach kształtowała się na poziomie 2858°C i była o 208°C wyższa,
w porównaniu do wyliczeń wykonanych przez Bosaka [2006] dla lat
1961-2000. Inne badania tego wskaźnika dla Krakowa, wskazują na
wartość 2341°C w wieloleciu 1971-2000 i 2440°C w korzystniejszej termicznie dekadzie 1991-2000 [Kopeć 2009]. Dla porównania, wieloletnia
średnia wartość SAT dla Skierniewic (centralna Polska), w latach 19812000, była na poziomie niespełna 2500oC, w roku 2003 przekroczyła
2700oC, a w rekordowo ciepłym 2006 roku wynosiła aż 2900oC [Lisek
2008]. Analizując warunki na terenie winnicy, w roku 2012 badany
wskaźnik osiągnął wartość 3162°C, czyli był o 160°C wyższy, niż w tym
samym okresie w Krakowie-Balicach. Wpływ na to mogło mieć korzystne usytuowanie winnicy na pd i pd-zach stoku, ograniczenie ze strony
Lasu Wolskiego, będącego naturalną zaporą zimnego powietrza, a także
warunki glebowe. Na podstawie dokonanych obliczeń, biorąc pod uwagę
wartość 2500°C jako minimalną dla rejonów intensywnej uprawy winorośli i posługując się przy tym klasyfikacją (tab. 1), stwierdza się, że
w obrębie Krakowa, w chłodniejszych termicznie okresach można było
uprawiać odmiany winorośli o średnio wczesnej porze dojrzewania,
a w cieplejszych sezonach, z osiągnięciem pełnej dojrzałości nie powinny były mieć problemu odmiany późne.
Wskaźnik GDD zwany sumą temperatur efektywnych lub stopniodniami okresu wegetacji, pozwala na charakterystykę określonych
obszarów pod kątem uprawy winorośli (Jones i Davis 2000). Winkler
(1974) w badaniach nad francuskimi i niemieckimi odmianami, uznał
zgromadzone 1390°C za najbardziej dogodne do uprawy winorośli
na większą skalę, podając przy tym 945°C za najniższą akceptowalną
wartość w dolinie Renu w Niemczech. Według klasyfikacji stworzonej
specjalnie dla krajów należących do tzw. strefy „cool climate” uprawy
winorośli, Kraków ze średnią 1146°C wykazywał w ostatnich latach
53
Marta Izajasz-Parchańska, Monika Białobrzeska
umiarkowanie dogodne warunki do jej rozwoju (klasa 3), a w niektórych, cieplejszych okresach (2003, 2006 i 2012) nawet dobre (klasa 2).
W podobnym okresie (1996-2005) aż 85% obszaru Dolnego Śląska,
pod względem SAT i GDD znajdowało się w tym samym zakresie, co
okolice Krakowa (umiarkowanie dogodne warunki do uprawy odmian
od średnio wczesnej do późnej pory dojrzewania) [Szymanowski i in.
2007]. Warto zaznaczyć, że wg badań Białobrzeskiej i in. [2010], nawet w chłodniejszym 2004 roku wg parametru GDD, rejon Krakowa
stwarza wystarczająco dogodne warunki do uprawy, nawet późno dojrzewających odmian winorośli, a w najcieplejszym roku 2006 plasuje
się o jedną klasę wyżej.
Inny parametr, LTI to wartość ukazująca potencjał dojrzewania winogron z uwzględnieniem specyfiki położenia danego regionu
względem równika oraz średniej temperatury najcieplejszego miesiąca
w okresie wegetacji. Przy porównaniu regionów położonych na różnych szerokościach geograficznych, wartość SAT często zawodzi, gdyż
w miejscach położonych bliżej równika winogrona lepiej dojrzewają, nawet jeżeli nie wiąże się to ze wzrostem temperatury i wyższą wartością
SAT. Przykładowo regiony Cantenburry (43° 30 szer. pd.) i Wilamette
Valley (44° 20 szer. pn.) wykazują SAT rzędu 2800°C, porównywalnie z terenami nad dolną Wisłoką (ok. 50°szer. pn.), a pomimo tego,
w regionach tych z powodzeniem uprawia się tak późne i wymagające
względem warunków termicznych odmiany jak Cabernet Sauvignon,
Merlot czy Semillon [Jackson i Cherry 1988]. W Krakowie średnia wartość LTI z badanego 10-lecia wynosi 194, przy czym w 70% przewyższa
wartość graniczną - 190. W porównaniu do badań Kopeć (2009), średnia
wartość tego wskaźnika jest wyższa, niż w wieloleciu 1991-2000 (187)
i tym bardziej we wcześniejszych latach 1971-2000 (178). W Winnicy
Srebrna Góra zdecydowano się posadzić odmiany Pinot Noir i Riesling
charakterystyczne dla grupy B, zgodnie z przyjętą klasyfikacją, co przy
ciągłym wzroście LTI potwierdza słuszność tego wyboru.
Jak wykazują obliczenia (tab. 4), w analizowanej dekadzie najcieplejszym sezonem w uprawie winorośli był rok 2012, a miesiącem lipiec
19,4°C. Analizując dla Krakowa 20-letnią termiczną klasyfikację tego
miesiąca, od roku 1991-2012, aż 15 lat określono jako lekko do ekstremalnie ciepłych, gdy tymczasem w latach 1966-1990 przeważały lata
normalne i aż 10 od lekko do bardzo chłodnych [IMGW-PIB]. W niniej54
Możliwość uprawy winorośli w okolicach Krakowa...
szych badaniach w każdym roku (oprócz 2010), średnia temp. z całego
okresu wegetacyjnego, a także najcieplejszego miesiąca, przekracza
minimalną wartość (14°C i 17°C). Na terenie winnicy wszystkie średnie
wartości w poszczególnych miesiącach i wskaźniki agroklimatyczne były
wyższe, niż obliczone w analogicznym okresie, dla oddalonej o ok. 5 km
stacji synoptycznej w Krakowie-Balicach. W winnicy szczególnie ważne
są, co wykazały szczegółowe obliczenia, wyższe minimalne temperatury
dobowe (81% przypadków), średnio o 1,5°C.
WSG 2012
2003-2012
2012
2011
2010
2009
2008
2007
2006
2005
2004
2003
Wskaźnik
Tab. 4. Wyniki dla Kraków-Balice (2003-2012) i WSG Winnica Srebrna Góra (2012)
Kraków - Balice
SAT
2988 2793 2866 3034 2789 2741 2976 2498 2898 3002 2858 3162
GDD 1288 1073 1136 1184 1139 1131 1126 1018 1158 1212 1146 1322
LTI
198
187
195
214
192 186
197
202 187 200 196 201
IV
7,8
9,5
9,6
9,1
V
16,4 12,7 14,3 13,1 15,2 13,6 13,5 12,6 13,5 15,0 14,0 15,3
VI
19,0 16,8 16,3 17,3 18,4 18,4 15,9 17,2 18,1 17,7 17,5 18,1
VII
19,3 18,2 19,6 21,5 19,3 18,7 19,8 20,3 17,5 20,1 19,4 20,5
VIII
19,9 18,8 17,5 16,9 19,0 18,1 18,6 18,2 18,8 18,7 18,5 19,5
IX
14,1 13,6 14,2 15,4 12,3 12,6 15,1 12,0 15,1 14,4 13,9 15,3
Średnie temperatury [°C]
10,2
9,0
10,2
9,5
7,3
9,0
9,8
11,3
7,7
8,7 10,3 9,6
5,2
8,1
8,5
9,4 10,5
X
5,9
IV-X
14,6 14,3 14,4 14,8 14,4 14,3 14,6 13,5 14,5 14,9 14,4 15,6
8,2
9,7
WNIOSKI
Obliczone wskaźniki agroklimatyczne: SAT, GDD i LTI wykazały, że
w okolicach Krakowa, w analizowanym przedziale czasowym, warunki
do uprawy winorośli były w zakresie od umiarkowanie dogodnych do
dobrych i pozwalały osiągnąć dojrzałość odmianą od średnio-wczesnej
do późnej pory dojrzewania.
55
Marta Izajasz-Parchańska, Monika Białobrzeska
Wartości wskaźników i średnich temperatur w badanej winnicy,
potwierdzają prawidłowy dobór odmian winorośli na jej terenie.
BIBLIOGRAFIA
Białobrzeska M., Kryzia M., Szymanowski M., 2010. Thermal suitability of
Poland for wine-growing in extreme years in comparison to other central European countries. Acta Agrophys. Agrometeorology Research,
6, 34-44.
Bosak W., 2006. Winorośl i wino w małym gospodarstwie w Małopolsce.
Wyd. MARR, Kraków.
Gustafsson J.G., Martensson A., 2005. Potential for extending Scandinavian wine cultivation. Acta Agr. Scan. B-S P, 55,82-97.
IMGW-PIB, dane ze strony internetowej Instytutu Meteorologii i Gospodarki Wodnej, 08. 2012.
Jackson D.I., Cherry N.J., 1988. Prediction of a district’s grape-ripening capacity using a latitude-temperature index (LTI), Am. J. Enol. Viticult.,
39, 1, 19-26.
Jackson R.S., 2008. Wine Science. Elsevier Inc. Academic Press, Netherlands, Amsterdam.
Jones G.V., Davis R.E., 2000. Climate influences on grapevine phenology,
grape composition and wine production and quality for Bordeaux,
France. Am. J. Enol. Viticult., 51, 3, 249-261.
Kopeć B., 2009. Uwarunkowania termiczne wegetacji winorośli na obszarze południowo-wschodniej Polski. Infrastruktura i Ekologia Terenów
Wiejskich, 4, 251-262.
Lisek J., 2008. Climatic Factors Affecting Development and Yielding of
Grapevine in Central Poland. J. Fruit Ornam. Plant Res. Vol. 16, 285293.
Lisek J., 2011. Winorośl w uprawie przydomowej i towarowej. Wyd. Hortpress, Warszawa.
Lorenc H., 2005. Atlas klimatu Polski. Instytut Meteorologii i Gospodarki
Wodnej, Warszawa.
Myśliwiec R., 2006, Winorośl i wino, PWRiL, Warszawa.
Report Agliculture Canada, 1984. Atlas of suitable grape growing location in
the Okanagen and Similkameen Valleys of British Columbia. Kelowna.
Szymanowski M., Kryza M., Smaza M., 2007. A GIS approach to spatialize
selected climatological parameters for wine-growing in Lower Silesia,
Poland, Proc. Bioclimatology and Natural Hazards, Zvolen-Polana, 1720 IX 2007.
56
Możliwość uprawy winorośli w okolicach Krakowa...
Winkler A.J., Cook J., Kliewer W., Lider L., 1974. General viticulture. University of California Press, Berkeley.
Żmudzka E., 2004. Tło klimatyczne produkcji rolniczej w drugiej połowie
XX w. Acta Agrophys., 3(2), 399-408.
http://www.ogimet.com/gsynres.phtml (03.11.2012)
Adres do korespondencji:
mgr inż. Marta Izajasz-Parchańska
Katedra Technologii Fermentacji i Mikrobiologii Technicznej
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
mgr Monika Białobrzeska
Instytut Geografii i Rozwoju Regionalnego
Zakład Klimatologii i Ochrony Atmosfery
Uniwersytet Wrocławski
e-mail: [email protected]
57
Katarzyna Jagiełło-Kubiec
Agnieszka Ilczuk
Paweł Petelewicz
EPISTEME
22/2014, t. III
s. 59–66
ISSN 1895-2241
Effect of selected factors on rooting
of ninebark microcuttings (Physocarpus
opulifolius (L.) Maxim.) DIABLE D’OR ‘Mindia’
Wpływ wybranych czynników na ukorzenianie
pęcherznicy kalinolistnej (Physocarpus
opulifolius (L.) Maxim.) DIABLE D’OR ‘Mindia’
Abstract. Common ninebark is an ornamental deciduous shrub tolerant to
harsh environmental conditions, often planted in urban areas. Conventional methods of its propagation are not always successful as the species has
low rooting abilities. Micropropagation seems to be a good alternative, as it
is commonly used to propagate woody plants. Rooting is a pivotal moment
that determines its success. The effects of medium composition, water type,
auxin type and its concentration and etiolation of microcuttings on rhizogenesis in vitro of common ninebark were evaluated. The best rooting was
observed on the MS medium with ¼ and ½ composition of macronutrients,
enriched with 1 mg·dm-3 IBA. The best for rooting was water coming from
the reverse osmosis filter. Etiolation of microcuttings had a positive impact
on the degree of their root proliferation.
Key words: etiolation, IBA, macronutrients, NAA, rhizogenesis, water type,
woody plants.
Introduction. Woody plants are a very important group of ornamental plants.
They are essential components of the natural landscape and for public and private recreation areas. Common ninebark is an ornamental shrub that is often
used due to its tolerance for adverse environmental conditions, decorative foliage color [Kimberley 2010] as well as the phytoremediation abilities [Popek et
al. 2011]. Colorful cultivars of common ninebark are traditionally propagated
by cuttings. This method, however, not always gives desired results, because
cuttings of Physocarpus sp. are considered as a difficult-to-root in conventional
softwood or hardwood cutting propagation [Pacholczak and Szydło 2008]. For
this reason, producers are looking for alternative ways of propagation. There has been an increased interest in the in vitro culture method, due to which
59
Katarzyna Jagiełło-Kubiec, Agnieszka Ilczuk, Petelewicz Paweł
a large quantity of homogeneous material can be obtained. The success and
profitability of micropropagation process is largely based on a percentage
of rooted cuttings and their acclimatization to the field conditions [Martin
2003]. Therefore, the rooting of plant material in vitro is a very important
step. The quality of the root system is determined by the number of roots on
microcutting, their length and lack of callus [Sharma et al. 2005]. Different
factors may have important impact on rhizogenesis, therefore scientists try
experimentally to establish the best conditions for rooting. The aim of this
study was to examine factors such as auxin type and its concentration, composition of macronutrients, type of water in the medium and etiolation of
microcuttings on the process of rhizogenesis in ninebark.
Materials and methods
Plant material and culture conditions
The starting material were 2 cm long stem parts taken from plantlets
of P. opulifolius DIABLE D’OR cultured in vitro on the MS medium [Murashige and Skoog 1962] supplemented with 1 mg·dm-3 benzyladenine
(BA) and 0.1 mg·dm-3 naphtyl-1-acetic acid (NAA). All media, except
for experiment 3, were made on the basis of distilled water. To test the
effect of auxin on rooting, the explants were placed on the MS medium
with 0; 0.1; 0.5; 1; 2; or 3 mg dm-3 IBA or NAA. The best concentration
of auxin was used to further experiments. For determining the influence of medium composition on rooting, microcuttings were placed on
media with different concentration of MS macronutrients: ¼, ½ and full
concentration. In experiment examining the effect of water type in the
MS media distilled water and water from the reverse osmosis filter were
used. To test the influence of etiolation of microcuttings on rooting,
plantlets were placed in the dark for the first 7 days of culture, and after
that period they were transferred to growth chamber.
All media were supplemented with 30 g·dm-3 sorbitol, solidified
with 8 g·dm-3 Bacto-Agar. The media were autoclaved at 121˚C under
0.1 MPa for 20 minutes. Their pH was established as 5.8 before sterilization. The culture was conducted in a growth chamber at 24°C with a 16hour day provided by light with a quantum irradiance of 24 µmol·m-2·s-1.
Each treatment consisted of 75 plants (25 in single repetition;
3 repetitions were provided).
Percentages of rooted microcuttings and the degree of rooting
were determined after 8 weeks from the establishment of the expe60
Effect of selected factors on rooting of ninebark microcuttings...
riment. The degree of rooting was evaluated on a 5-point scale rating
the development of the root ball (tab. 1).
Tab. 1. Evaluation scale of the root development
Score
Root characteristics
1
No visible roots on a cutting
2
A few (1-3) short roots
3
4-5 roots, some of them branched, no root ball formed
4
Medium sized root system composed of 6-10 branched roots
forming a root ball
5
Well formed, branched root system forming a root ball (over 10
roots)
Statistical analysis
The results were statistically analyzed in IBM SPSS Statistics 21,
using a one- factorial analysis of variance. Means given as a percentage
were transformed according to Bliss. For means comparison Duncan’s
test was used at significance level α = 0.05 [Wójcik and Landański 1989].
Results and discussion
Rhizogenesis in vitro depends on the type and concentration of auxins.
They stimulate growth and cell division, and are responsible for the formation of adventitious roots. The most common auxins are: NAA, IBA
and IAA. Studies have shown that the IBA is the appropriate regulator
of growth in Syringa vulgaris L. culture at a concentration of 5 mg·dm-3
[Nesterowicz et al. 2005], and Prunus salicyna Lindl. - 0.2-0.5 mg·dm-3
[Zou 2010]. In contrast, microplantlets of Morus alba L. formed more
roots on a medium supplemented with 1 mg·dm-3 NAA (80% of microplantlets formed approximately 5 roots per explant) [Anis et al. 2003].
Also in case of Cornus mas L. ‘Macrocarpa’ a much higher percentage
of rooted microplantlets were obtained on medium with addition of
NAA than IBA. This is due to species differences and different nutritional requirements [Ďurkovič 2008]. This studies have shown that the
highest percentage and degree of root proliferation of microcuttings
was obtained on medium supplemented with 1 mg·dm-3 of IBA (tab. 2).
61
Katarzyna Jagiełło-Kubiec, Agnieszka Ilczuk, Petelewicz Paweł
Tab. 2. Influence of concentration and type of auxin on rooting
of microcuttings of Physocarpus opulifolius DIABLE D’OR ‘Mindia’
The concentration of
auxin [mg·dm-3]
0
0.1
0.5
1
2
3
*
% of rooted microcuttings*
Degree of rooting
IBA
NAA
IBA
NAA
16 a**
16 a
36 ab
88 d
64 bc
20 a
16 a
20 a
40 ab
72 c
48 b
28 ab
1.16 a
1.16 a
2.44 ab
4.0 c
2.36 ab
1.2 a
1.16 a
1.2 a
2.56 b
2.2 b
2.48 ab
1.36 ab
100% = 75 microcuttings
Means followed by the same letter do not differ significantly at α = 0.05
**
Other factor that stimulates root growth is the content of
macronutrients in the medium. Swietania macrophylla grown on
medium with 2 mg·dm-3 IBA produced more roots when the concentration of mineral salts in the medium was reduced by half
[Mona and Amin 2012]. Microplantlets of Acacia nilotica rooted
the best on MS medium with the full content of macronutrients
[Abbas et al. 2010]. In the case of common ninebark DIABLE
D’OR percentage of rooted shoots was unrelated to the content
of macronutrients, but better developed root system was formed
by microplantlets on medium with ¼ and ½ MS (tab. 3). Roots on
this media were stiffer and thicker than those from the full MS
medium. Growth of the root system in media with reduced mineral
salt content can probably be explained by the search for nutrients
by the roots in the medium.
Tab. 3. Influence of MS concentration on rooting of microcuttings
of Physocarpus opulifolius DIABLE D’OR ‘Mindia’
Treatment
% of rooted microcuttings*
Degree of rooting
1/4 MS
1/2 MS
MS
92 ab**
92 ab
88 a
4.12 b
4.16 b
3.84 a
100% = 75 microcuttings
Means followed by the same letter do not differ significantly at α = 0.05
*
**
62
Effect of selected factors on rooting of ninebark microcuttings...
Distillation is the most popular method of water purification.
Thus obtained water is extremely pure and it is also virtually mineral
free. This is a good method when water is needed in small amounts.
When large quantities of water are required then reverse osmosis is
used for purification. This method reduces the levels of inorganic and
organic contaminants, but do not remove all low molecular weight
chemicals. It may affect the growth of plants [Bonga and von Aderkas
1992]. Results show that for in vitro rooting of Physocarpus opulifolius
DIABLE D’OR ‘Mindia’ more suitable source of water in the medium
was that from the reverse osmosis filter. All plants grown on medium
based on this water formed significantly better root balls in comparison to the plants from medium with distilled water (tab. 4).
Tab. 4. Influence of type of water on rooting of microcuttings of Physocarpus opulifolius DIABLE D’OR ‘Mindia’
Treatment
Distilled water
Water from reverse osmosis
filter
% of rooted microcuttings*
Degree of root proliferation
92 a
3.44 a
100 b
4.16 b
100% = 75 microcuttings
Means followed by the same letter do not differ significantly at α = 0.05
*
**
Etiolation of microcuttings has a positive impact on their rooting.
Short etiolation at the beginning of rooting process improved rooting
of pedunculate oak (Quercus robur) [Chalupa 2000] and northern red
oak (Q. rubra) [Vengadesan and Pijut 2009]. Similar results were obtained by Sanchez et al. [1996]: a five-day period of etiolation improved
rooting, but also resulted in the quality deterioration of micropropagated oaks. Studies on rooting of common ninebark did not confirm
this data. There was no effect of etiolation on the percentage of rooted
microcuttings (tab. 5), but significant differences were observed in
the development of the root system between treatments. A 7-day
period of darkness significantly improved the degree of rooting, both
on medium lacking growth regulators and in the presence of IBA.
Shoots propagated in the presence of IBA and subjected to etiolation
developed significantly better root system (4.8 degree) than other
treatments (3.0-4.2 degree).
63
Katarzyna Jagiełło-Kubiec, Agnieszka Ilczuk, Petelewicz Paweł
Tab. 5. Influence of etiolation on rooting of microcuttings
of Physocarpus opulifolius DIABLE D’OR ‘Mindia’
% of rooted microcuttings*
Treatment
*
Degree of rooting
Without etiolation
Etiolation
Without
etiolation
Control
76 a**
88 ab
3.0 a
3.6 b
IBA
92 b
96 b
4.2 b
4.8 c
Etiolation
100% = 75 microcuttings
Means followed by the same letter do not differ significantly at α = 0.05
**
Conclusions
Medium supplemented with 1 mg·dm-3 of IBA is the best for rooting
microcuttings of Physocarpus opulifolius DIABLE D’OR ‘Mindia’.
Lower concentrations of macronutrients in the medium contribute to improving rooting of microcuttings.
Water from reverse osmosis filter is significantly better for rotting of common ninebark DIABLE D’OR ‘Mindia’ than distilled water.
Etiolation of microcuttings has a positive impact on a degree of
rooting of common ninebark but not for % of rooted microcuttings.
Bibliography
Abbas H. Quaiser M. Naqvi B. 2010. Rapid in vitro multiplication of Acacaia nilotica subsp. hemisperica, a critically endangered endemic taxon.
Pakistan Journal of Botany 42 (6): 4087-4093.
Anis M. Mohammad Faisal M. Singh S. K. 2003. Micropropagation of mulberry (Morus alba L.) through in vitro culture of shoot tip and nodal
explants. Plant Tissue Culture 13 (1): 47-51.
Bonga J.M. von Aderkas P. 1992. In vitro culture of trees. Kluwer Academic
Publishers: 6-7.
Chalupa V. 2000. In vitro propagation of mature trees of pedunculate oak
(Quercus robur L.). Journal of Forest Science 46: 537-542.
Ďurkovič J. 2008. Micropropagation of mature Cornus mas ‘Macrocarpa’.
Trees 22: 597–602.
Kimberley M. 2010. Physocarpus. Horticulture Week, 18 June: 18-19.
64
Effect of selected factors on rooting of ninebark microcuttings...
Martin K.P. 2003. Rapid in vitro multiplication and ex vitro rooting of Rotula
aquatica Lour., a rare rhoeophytic woody medicinal plant. Plant Cell
Reports. 21: 415–420.
Mona Amin A. 2012. In vitro propagation of Swietenia macrophylla King. Research Journal of Agriculture and Biological Sciences 8(2): 282-287.
Murashige T. Skoog F. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiologia Plantarum 15: 473-497.
Nesterowicz S. Kulpa D. Moder K., Kurek J. 2005. Micropropagation of an
old specimen of common lilac (Syringa vulgaris L.) from the dendrological garden at Przelewice. Acta Scientiarum Polonorum. Hortorum
Cultus 5(1): 27-35.
Pacholczak A. Szydło W. 2008. Effect of ammonium zinc acetate on rooting
of stem cuttings in Physocarpus opulifolius. Annals of Warsaw University of Life Sciences – SGGW. Horticulture and Landscape Architecture
No 29: 59–64.
Popek R. Gawrońska H. Gawroński S.W. 2011. Zdolność krzewów do akumulacji mikropyłów z powietrza. Nauka Przyroda Technologie p. 5, 6,
124.
Sanchez M.C. San-Jose M.C. Ballester A. Vieitez A.M. 1996. Requirements
for in vitro rooting of Quercus robur and Q. rubra shoots derived from
mature trees. Tree Physiology 16: 673-680.
Sharma A.R. Trigiano R.N. White W.T. Schwar O.J. 2005. In vitro adventitious rooting of Cornus florida microshoots. Scientia Horticulturae
103, 381-385.
Vengadesan G. Pijut P. 2009. In vitro propagation of northern red oak (Quercus rubra). In Vitro Cellular & Developmental Biology – Plant 45: 474482.
Wójcik A.R. Landański Z. 1989. Planowanie i wnioskowanie statystyczne
w doświadczalnictwie [Statistical planning and concluding in experimental works]. PWN. Warszawa: 130. (in Polish)
Zou Y.N. 2010. Micropropagation of chinese plum (Prunus salicina Lindl.)
using mature stem segments. Notulae Botanicae Horti Agrobotanici.
Cluj-Napoca 38 (3): 214-218.
65
Katarzyna Jagiełło-Kubiec, Agnieszka Ilczuk, Petelewicz Paweł
Adres do korespondencji:
mgr inż. Katarzyna Jagiełło-Kubiec
Department of Ornamental Plants
Warsaw University of Life Sciences
e-mail: [email protected], [email protected]
dr inż. Agnieszka Ilczuk
Department of Ornamental Plants
Warsaw University of Life Sciences,
e-mail: [email protected]
mgr inż. Paweł Petelewicz
Department of Ornamental Plants
Warsaw University of Life Sciences
e-mail: paweł[email protected], [email protected]
Faculty of Horticulture
Biotechnology and Landscape Architecture
Department of Ornamental Plants
ul. Nowoursynowska 166, 02-787 Warszawa
Research supervisor: prof. dr hab. inż. Aleksandra Łukaszewska
66
Aleksandra Koźmińska
Ewa Muszyńska
EPISTEME
22/2014, t. III
s. 67–74
ISSN 1895-2241
WPŁYW JONÓW OŁOWIU NA ALYSSUM
MONTANUM W KULTURZE IN VITRO
THE EFFECT OF LEAD IONS ON ALYSSUM
MONTANUM CULTURED IN VITRO
Abstrakt. Celem przeprowadzonych badań było zbadanie wpływu jonów
ołowiu na galmanowy ekotyp Alyssum montanum w warunkach kultury in
vitro. Zastosowano dodatek 0,1; 0,5 i 1 µM azotanu ołowiu do pożywki namnożeniowej. W trakcie trwania kultury określono współczynnik namnażania, współczynnik powierzchni blaszki liściowej, dokonano pomiarów
biometrycznych oraz pomiarów masy zregenerowanych pędów i korzeni
przybyszowych. Badany ekotyp można efektywnie rozmnażać wegetatywnie
w obecności jonów ołowiu w podłożu hodowlanym, jednak poszczególne stężenia Pb(NO3)2 w różny sposób oddziałały na oceniane cechy morfometryczne
kultur. Wyższe wartości pomiarów uzyskano w kulturach prowadzonych na
pożywkach wzbogaconych w azotan ołowiu, aniżeli na pożywkach kontrolnych bez dodatku Pb(NO3)2. Największą masę pędów wynoszącą ponad 8 mg
uzyskano w trakcie kultywacji badanego gatunku na zmodyfikowanej pożywce WPM wzbogaconej w 0,1µM Pb(NO3)2, natomiast największą liczbę pędów
potomnych na pożywce wzbogaconej w 0,5µM tej soli.
Słowa kluczowe: smagliczka, ołów, ekotyp galmanowy, test in vitro
Summary. The aim of this study was determine lead ions impact on calamine ecotype of Alyssum montanum using in vitro culture. The following concentrations 0,1; 05 and 1 µM of lead nitrate were applied to the propagation
medium. During cultivation propagation coefficient, leaf blade surface coefficient, biometric features, and mass measurements were evaluated. Studied ecotype can be propagated in vitro on media supplemented with lead
ions, however individual Pb(NO3)2 concentrations differentially affected on
evaluated morphometric traits. Higher values were obtained on media supplemented with lead nitrate in comparison to control media without any addition of Pb(NO3)2. The highest shoot mass was, above 8 mg, was obtained
on modified WPM medium supplemented with 0,1µM Pb(NO3)2, whereas
the highest number of regenerated shoots was obtained on the same medium supplemented with 0,5µM of this salt.
Key words: alysson, lead, calamine ecotype, test in vitro
67
Aleksandra Koźmińska, Ewa Muszyńska
Wstęp
Badania dotyczące wpływu poszczególnych substancji wywołujących
zanieczyszczenie środowiska na materiał roślinny umożliwiają poszerzenie doboru gatunków przydatnych do praktycznego wykorzystania
w oczyszczaniu środowiska z wszelakich zanieczyszczeń, w tym z metali ciężkich [Mengoni i in. 2009; Mierek-Adamska i in. 2009; Hanus-Fajerska i in. 2011, 2013]. W prezentowanej pracy określano wpływ
jonów ołowiu na Alyssum montanum, gatunek należący do rodzaju
znanego z licznych hiperakumulatorów metali ciężkich [Mengoni i in.
2009; Abou-Shanab i in. 2010; Hanus-Fajerska i in. 2012]. Kultury pędowe naturalnej populacji galmanowej A. montanum pobranej z terenu
posłużyły jako materiał wyjściowy do przeprowadzenia w warunkach
in vitro oceny reakcji na zróżnicowaną zawartość pierwiastka balastowego w podłożu. Z tego względu w pożywce zastosowano wzrastające
dawki jonów ołowiu, aplikowanych w formie azotanu ołowiu, gdyż
perspektywicznym celem podjętych badań jest wyselekcjonowanie
linii o wysokim stopniu odporności na ołów.
Materiał i metody
Materiał roślinny stanowił jeden z gatunków należący do rodzaju Alyssum, klasyfikowany do rodziny kapustowatych (Brassicaceae Burnett,
synon. krzyżowe, Cruciferae Juss.). Do badań wybrano smagliczkę
pagórkową (Alyssum montanum L). Zajmowano się ekotypem galmanowym tego gatunku. Próby nasion pozyskano ze stanowisk zlokalizowanych w okolicy Olkusza. Pilotażowy etap podjętych prac stanowiło
uzyskanie sterylnej kultury w celu namnażania roślin w warunkach
in vitro. Uzyskane ze sterylnych siewek, apikalne fragmenty pędów
umieszczono pionowo w pożywce inicjacyjnej [E. Muszyńska, dane nie
publikowane]. W celu założenia doświadczenia zdrowe, witalne pędy
o długości 15 – 20 mm przeniesiono na zestaloną pożywkę o pH 5,8,
opartą na składzie WPM [Lloyd and McCown. 1980] z modyfikacją
podaną w tab. 1. W trakcie sporządzania pożywek do poszczególnych
objętości dodano odpowiednie stężenie azotanu ołowiu (0,1; 0,5 bądź
1 µM,) co oznaczono w zestawieniu tabelarycznym I, II, III (tab. 1).
Pożywka kontrolna o analogicznym składzie nie zawierała Pb(NO3)2.
Naczynia do wzrostu kultur stanowiły kolby Erlenmayera o pojem68
0,1 tiamina
0,5 pirydoksyna
0,5 kwas nikotynowy
100 mezoinozytol
1 glicyna
2,5 2iP; 1 NAA
27,8 FeSO4·7H2O
37,3 Na2EDTA·2H2O
6,2 H3BO3
29,43 MnSO4 4H2O
8,6 ZnSO4 7H2O
0,25 NaMoO4 2H2O
0,25 CuSO4 5H2O
400 NH4NO3
96 CaCl2 2H2O
370 MgSO4 7H20
170 KH2PO4
556 Ca(NO3)2·4H20
990 K2SO4
400 NH4NO3
96 CaCl2 2H2O
370 MgSO4 7H20
170 KH2PO4
556 Ca(NO3)2·4H20
990 K2SO4
400 NH4NO3
96 CaCl2 2H2O
370 MgSO4 7H20
170 KH2PO4
556 Ca(NO3)2·4H20
990 K2SO4
kontrolna
I
II
III
0,1 tiamina
0,5 pirydoksyna
0,5 kwas nikotynowy
100 mezoinozytol
1 glicyna
2,5 2iP; 1 NAA
0,1 tiamina
0,5 pirydoksyna
0,5 kwas nikotynowy
100 mezoinozytol
1 glicyna
2,5 2iP; 1 NAA
0,1 tiamina
0,5 pirydoksyna
0,5 kwas nikotynowy
100 mezoinozytol
1,0 glicyna
2,5 2iP; 1 NAA
27,8 FeSO4·7H2O
37,3 Na2EDTA·2H2O
6,2 H3BO3
29,43 MnSO4 4H2O
8,6 ZnSO4 7H2O
0,25 NaMoO4 2H2O
0,25 CuSO4 5H2O
400 NH4NO3
96 CaCl2 2H2O
370 MgSO4 7H20
170 KH2PO4
556 Ca(NO3)2·4H20
990 K2SO4
27,8 FeSO4·7H2O
37,3 Na2EDTA·2H2O
6,2 H3BO3
29,43 MnSO4 4H2O
8,6 ZnSO4 7H2O
0,25 NaMoO4 2H2O
0,25 CuSO4 5H2O
27,8 FeSO4·7H2O
37,3 Na2EDTA·2H2O
6,2 H3BO3
29,43 MnSO4 4H2O
8,6 ZnSO4 7H2O
0,25 NaMoO4 2H2O
0,25 CuSO4 5H2O
Witaminy/reg.wzrostu [mg dm-3]
Mikroelementy [mg dm-3]
Makroelementy [mg·dm-3]
Pożywka
20 Sacharoza
8 Difco Agar
0,6 Węgiel aktywowany
0,5 PVP
0,65mg glukonian wapnia
1μM Pb(NO3)2
20 Sacharoza
8 Difco Agar
0,6 Węgiel aktywowany
0,5 PVP
0,65mg glukonian wapnia
0,5 μM Pb(NO3)2
20 Sacharoza
8 Difco Agar
0,6 Węgiel aktywowany
0,5 PVP
0,65mg glukonian wapnia
0,1 μM Pb(NO3)2
20 Sacharoza
8 Difco Agar
0,6 Węgiel aktywowany
0,5 PVP
0,65mg glukonian wapnia
Inne składniki [g dm-3]
Tab. 1. Skład pożywek namnożeniowych zastosowanych w kulturze Alyssum montanum
Wpływ jonów ołowiu na alyssum montanum w kulturze in vitro
69
Aleksandra Koźmińska, Ewa Muszyńska
ności 250 cm3, zawierające 20 cm3 pożywki. Kultury prowadzone były
w komorze wegetacyjnej z regulowaną temperaturą i wilgotnością
powietrza, naświetlanej światłem białym z zachowaniem fotoperiodu
16/8h. Wszystkie etapy eksperymentu prowadzono w temperaturze
24°C ± 2°C, przy użyciu światła białego o natężeniu promieniowania kwantowego 80 µmol m-2s-1 (PAR). Eksperyment prowadzono
w trzech powtórzeniach dla każdego stężenia + 3 traktowania kontrolne. Za powtórzenie uznano naczynie hodowlane zawierające 10
eksplantatów, przy czym cały układ eksperymentalny przeprowadzono dwukrotnie.
Po upływie sześciu tygodni od momentu założenia doświadczenia dokonywano pomiarów biometrycznych: liczono oraz mierzono
długość zregenerowanych pędów i korzeni przybyszowych, określano
współczynnik namnażania kultur (proporcja liczby uzyskanych pędów
do liczby eksplantatów), liczbę międzywęźli, współczynnik powierzchni blaszki liściowej (iloczyn długości i szerokości), określono świeżą
i suchą masę pędów oraz korzeni metodą wagowo-suszarkową. Suchą
masę uzyskano przez ogrzewanie tkanek w temperaturze 105°C do
uzyskania stałej masy.
Dane liczbowe poddano analizie statystycznej wykorzystując
program komputerowy STATISTICA 10 firmy StatSoft. Do określenia
istotności różnic pomiędzy średnimi wartościami określonych pomiarów wyznaczono grupy jednorodne przy zastosowaniu testu Tukeya
i przy poziomie istotności α ≤ 0,05.
Wyniki
Badany ekotyp Alyssum montanum bez trudności rozmnażano wegetatywnie in vitro. Pędy tego gatunku były zdolne do wzrostu
na pożywkach z dodatkiem jonów ołowiu, jednak zastosowane
w doświadczeniu stężenia azotanu ołowiu w zróżnicowany sposób oddziałały na kultury. Uzyskana wartość współczynnika namnażania na
pożywkach wzbogaconych w jony ołowiu wynosiła w poszczególnych
przypadkach od 2,1 do 2, 4 i była wyższa w porównaniu do kontroli
gdzie wynosiła 1,9 (tab. 2). Po upływie sześciu tygodni od momentu
założenia doświadczenia długość pędów była wyraźnie zróżnicowana
i dla poszczególnych stężeń Pb2+ zawierała się w przedziale od 1,7
70
Wpływ jonów ołowiu na alyssum montanum w kulturze in vitro
do 2,5 cm (tab. 2). Najwyższą średnią liczbę 78 pędów potomnych
otrzymano na pożywce wzbogaconej o 0,5µM Pb(NO3)2, natomiast
najniższą, wynoszącą 54, na pożywce kontrolnej. Nie stwierdzono
jednoznacznej zależności pomiędzy liczbą zregenerowanych pędów
potomnych, a ich długością odnośnie grup jednorodnych. Najwyższy
współczynnik powierzchni blaszki liściowej (25,3 mm) osiągnęły
pędy kultywowane na pożywce zawierającej 0,1µM Pb(NO3)2 (tab.2).
Większość liści powstałych w trakcie kultywacji była rozwinięta
w prawidłowy sposób. Sporadycznie na blaszkach liściowych kultur
prowadzonych na pożywce z dodatkiem 1µM Pb(NO3)2 zaobserwowano brunatne bądź chlorotyczne plamki, co może być traktowane jako
objaw toksyczności jonów ołowiu. Z kolei liczba międzywęźli pędów
potomnych była stosunkowo wyrównana dla wszystkich zastosowanych stężeń azotanu ołowiu. Kolejne etapy ryzogenezy zachodziły
Tab. 2. Wartości średnie parametrów morfometrycznych kultur Alyssum montanum prowadzonych na pożywkach wzbogaconych w różne stężenia Pb2+
liczba
współliczba
liczba długość współcz
długość
stężenie
międzypędów po- czynnik
korzeni korzeni pow.
pędów
Pb(NO3)2
węźli
tomnych * namna[szt.]
[cm]
liści
[cm]
[µM]
[szt.]
żania
[szt.]
0,1
72, 8 c**
2,4 b
2,5 c
3,8 ab
17,7 a
2,5 b
25, 3 a
0,5
78, 9 d
2,6 b
1,9 a
3,9 b
18,3 ab 2,2 a
16, 7 b
1,0
63, 2 ab
2,1 a
2,2 b
4,1 b
16,6 a 2,4 ab 16, 6 b
Kontrola
57, 4 a
1,9 a
1,7 a
3, 5 a
17,4 a
1,7 a
13,9 b
*z 3 powtórzeń, n = 60; ** średnie oznaczone takimi samymi literami nie różnią się
istotnie przy a = 0,05
Tab. 3. Średnie wartości świeżej i suchej masy pędów oraz korzeni Alyssum
montanum na pożywkach wzbogaconych w różne stężenia Pb2+
świeża masa
pędów
[mg]
sucha masa
pędów
[mg]
świeża masa
korzeni
[mg]
sucha masa
korzeni
[mg]
0,1 µM Pb(NO3)2
8,1
1,0
0,6
0,1
0,5 µM Pb(NO3)2
4,0
0,5
0,6
0,1
1,0 µM Pb(NO3)2
kontrola
4,4
2,6
0,9
0,3
0,5
0,3
0,1
0,01
stężenie Pb(NO3)2
[µM]
71
Aleksandra Koźmińska, Ewa Muszyńska
analogicznie we wszystkich wariantach doświadczenia. Liczba korzeni
oraz długość korzeni były wyrównane (tab. 2). Nie zaobserwowano
także wyraźnych zależności pomiędzy liczbą uzyskanych korzeni,
a ich długością.
W odniesieniu do masy pędów i korzeni zaobserwowano zależność spadku zarówno świeżej jak i suchej masy pędów wraz ze wzrostem stężenia Pb(NO3)2. (tab. 3 ).
Dyskusja
Reakcja różnych gatunków roślin na jony ołowiu jest przedmiotem badań kilku zespołów naukowych, choć badania te zwykle prowadzono w warunkach in vivo [Porębska i Gworek 1999].
Zastosowanie technik in vitro w odniesieniu do gatunków reprezentujących florę galmanową daje możliwość uzyskania cennego
materiału roślinnego w niezwykle szybkim czasie. Mikrorozmnażanie umożliwia podwyższenie współczynnika namnażania
w porównaniu do efektu, który można uzyskać w warunkach naturalnych [Rybczyński i Mikuła 2006], co więcej opracowanie skutecznych
technik umożliwia zachowanie cennych genotypów tolerujących liczne
czynniki stresowe oraz stwarza nowe możliwości badawcze [Kopyra
i Gwóźdź 2004, Hanus-Fajerska 2011]. W chwili obecnej zalecana jest
weryfikacja w doświadczeniu polowym przydatności badanego ekotypu Alyssum montanum do fitoremediacji ołowiu. Na podstawie wyników
prezentowanych eksperymentów, a także zgodnie z danymi literaturowymi [Olko 2008] wyniki mogą być obiecujące. Tak sprecyzowany cel
przyszłych prac badawczych będzie miał aspekt aplikacyjny, bowiem
w przyszłości istnieje szansa wykorzystania wyselekcjonowanych klonów Alyssum montanum do oczyszczania terenów skażonych ołowiem
Wnioski
Galmanowy ekotyp Alyssum montanum można efektywnie rozmnażać wegetatywnie w warunkach in vitro z dodatkiem azotanu
ołowiu.
Stężenia 0,1; 0,5 i 1 µM Pb(NO3)2 zastosowane w pożywce namnożeniowej oddziałały w zróżnicowany sposób na cechy morfometryczne badanego ekotypu A.montanum.
72
Wpływ jonów ołowiu na alyssum montanum w kulturze in vitro
Ekotyp Alyssum montanum porastający hałdy galmanowe wykazał
w teście in vitro przystosowanie do podwyższonych zawartości ołowiu
w podłożu.
LITERATURA
Abou-Shanab R.A.I., van Berkum P., Angle J.S., Delorme T.A., Chaney R.L.,
Ghozlan H.A., Ghanem K., Moawad H. 2010. Characterization of Ni-resistant bacteria in the rizosphere of the hyperaccumulatorAlyssum murale
by 16S gene sequence analysis. World J. Microb. Biotechnol. 26: 101-108.
Hanus-Fajerska E., Augustynowicz J., Muszyńska E., Koźmińska A. 2011.
Organizmy przydatne w oczyszczaniu środowiska z nadmiernych
stężeń pierwiastków metalicznych. Ochr. Środ. Zas. Nat. 50: 180-192.
Hanus-Fajerska E. 2011. Opracowanie metodyki mikrorozmnażania
wybranych metalofitów w celu remediacji podłoży zanieczyszczonych
kadmem, ołowiem i cynkiem. Zesz. Naukowe UR, 471, Rozprawy, Zesz
348: ss.89.
Hanus-Fajerska E., Wiszniewska A., Muszyńska E. 2012. In vitro multiplication and acclimatization of Biscutella laevigata (Brassicaceae) to cultivation in greenhouse conditions. BioTechnologia 93(2): 97-101.
Hanus-Fajerska E., Muszyńska E., Ciarkowska K., Czech T., Gajewski Z.
2013. Wkład nauki polskiej w badanie przydatności roślin do rekultywacji terenów zanieczyszczonych metalami ciężkimi. Episteme
20(1): 99-108.
Kopyra M., Gwóźdź E.A. 2004. The role of nitric oxide in plant growth regulation and responses to abiotic stresses. Act. Physiol. Plant. 26(4): 459-472.
Lloyd, G., and B. Mc Cown. 1980. Commercially-feasible micropropagation
of mountainlaurel, Kalmia latifolia by use shoot-tip culture. Int. Plant
Prop. Soc. Proc. 30:421-427.
Mengoni A., Pini F., Huang L.N, Shu W.S., Bazzicalupo M. 2009. Plant-byplant variation of bacterial communities associated with leaves of the
nickel hyperaccumulator Alyssum bertolonii Desv. Microb. Ecol. 58:
660-667.
Mierek-Adamska A., Dąbrowska G., Goc A. 2009. Rośliny modyfikowane
genetycznie a strategie oczyszczania gleb z metali ciężkich. Post. Biol.
Kom. 36: 649-662.
Olko A. 2008. Fizjologiczne aspekty tolerancji roślin na metale ciężkie. Kosmos, Prob. Nauk Biol. 58: 221-228.
Porębska G., Gworek B. 1999. Ocena przydatności roślin w remediacji gleb
zanieczyszczonych metalami ciężkimi. Ochr. Środ. Zas. Nat. 17: 81 - 89.
73
Aleksandra Koźmińska, Ewa Muszyńska
Rybczyński J.J., Mikuła A. 2006. Engagement of biotechnology in the protection of threatened plant species in Poland. Biodiv. Res. Conserv. 3-4:
361-368.
Adres do korespondencji:
mgr inż. Aleksandra Koźmińska
mgr inż. Ewa Muszyńska
Zakład Botaniki i Fizjologii Roślin
Instytut Biologii Roślin i Biotechnologii,
Wydział Ogrodniczy,
Uniwersytet Rolniczy w Krakowie
Al. 29 Listopada 54, 31-425 Kraków
adres e-mail: [email protected]
[email protected]
Opiekun naukowy: dr hab. inż. Ewa Hanus – Fajerska
74
Anna Konieczny
Iwona Kowalska
EPISTEME
22/2014, t. III
s. 75–82
ISSN 1895-2241
Wpływ mikoryzy arbuSkularnej na
zawartość składników pokarmowych
w środowisku korzeniowym pomidora
The effect of arbuscular mycorrhiza
on content of nutrients in the root zone
of tomato plant
Abstrakt. Celem badań było określenie wpływu mikoryzacji roślin na zawartość składników pokarmowych w środowisku korzeniowym i wodach drenarskich. Rośliny uprawiano na dwóch rodzajach podłoży tj. wełnie mineralnej
i matach kokosowych. Do fertygacji stosowano pożywkę o zróżnicowanej zawartości fosforu tj. 50 i 15 mg·dm-3. Próby pożywek pobierano w dwóch terminach z kapilar, wód drenarskich oraz wyciągu z maty wełny mineralnej.
W materiale oznaczano odczyn, EC oraz zawartość makroelementów. W obu
terminach analiz wykazano zatężanie pożywek w matach uprawowych i wodach
drenarskich. Niższą zawartość makroskładników oraz wartość EC oznaczono
w wodach drenarskich pochodzących z podłoży, na których rosły rośliny zamikoryzowane i otrzymujące pożywkę o obniżonej zawartości fosforu.
Słowa kluczowe: wełna mineralna, maty kokosowe, wody drenarskie
Abstract. The objective of the study was to determine the effect of inoculation of plants with arbuscular mycorrhizal fungi on content of nutrients
in the root zone and drainage waters. Plants were grown on two types of
growing media i.e. coconut and rockwool. Nutrient solution with varying
phosphorus content i.e. 50 i 15 mg·dm-3 was used for fertigation. The samples of nutrient solution from capillaries, drainage waters and extracts from
the rockwool were collected in two terms. pH, EC and content of macroelements were estimated. In both terms of analyzes, the solution in the root
zone and drainage waters was richer in nutrients than the solution supplied
to the plants (capillary). Lower EC and content of macroelements were determined in drainage waters from growing medium with inoculated plants,
received nutrient solution with lower concentration of P.
Key words: rockwool, coconut, drainage waters
75
Anna Konieczny, Iwona Kowalska
Wstęp
W uprawach bezglebowych z otwartym systemem fertygacyjnym
dużym problemem są wody drenarskie, które w krajach bez wdrożonych systemów prawnych w tym zakresie, najczęściej uwalniane są
do środowiska naturalnego. Duże ilości wód drenarskich powstają
zwłaszcza w uprawach roślin na wełnie mineralnej, gdzie wielkość
drenażu stanowi od 20 do 40%, a w dni upalne nawet do 50% objętości
w stosunku do pożywki podawanej roślinom. Z wodami drenarskimi
do gleby wprowadzane są kationy oraz aniony, które powodują zmiany
właściwości chemicznych gleb oraz pogorszenie jakości wód gruntowych [Breś 2012].
Arbuskularne grzyby mikoryzowe (AGM) tworzą związek mikoryzowy z około 90% gatunków roślin. Symbioza ta, zlokalizowana
w korzeniach lub strukturach pełniących rolę korzeni, przyczynia się
do zwiększenia ich powierzchni chłonnej, co powoduje wzrost efektywności pobierania wody i składników pokarmowych [Głuszek i in.
2008]. Lepsze wykorzystanie składników pokarmowych przez rośliny
żyjące w symbiozie z AGM może umożliwić obniżenie ich stężenia
w pożywce, a tym samym ograniczyć obciążenie środowiska naturalnego składnikami pochodzącymi z wód drenarskich.
Celem badań było określenie wpływu inokulacji roślin szczepionką zawierającą arbuskularne grzyby mikoryzowe na zawartość
składników pokarmowych w środowisku korzeniowym roślin i wodach drenarskich w uprawie pomidora na wełnie mineralnej i matach
kokosowych oraz przy zróżnicowanym poziomie fosforu w pożywce.
Materiał i metody
Doświadczenie przeprowadzono w sezonie wiosenno – letnim 2012
roku w Uniwersytecie Rolniczym w Krakowie. Pomidora zwyczajnego
(Lycopersicon esculentum Mill.) ‘Admiro F1’ uprawiano w tunelu foliowym wyposażonym w rynny uprawowe, w systemie otwartym tj. bez
recyrkulacji pożywki, na dwóch rodzajach podłoży: matach kokosowych
i wełnie mineralnej. Czynnikami doświadczenia były: stężenie fosforu
w pożywce (15 lub 50 mg·dm-3), inokulacja arbuskularnymi grzybami
mikoryzowymi lub jej brak (+AGM lub –AGM) oraz rodzaj podłoża
(wełna mineralna lub maty kokosowe). Rośliny rosły w dwóch nieza76
Wpływ mikoryzy arbukularnej na zawartość składników pokarmowych...
leżnych zestawach uprawowych (zestaw I i II), które zarazem stanowiły
podbloki doświadczenia. Każdy z podbloków zasilano pożywką o zróżnicowanej zawartości fosforu (pierwszy czynnik). W obrębie podbloków
zastosowano dwa podłoża (drugi czynnik), które poddano inokulacji
arbuskularnymi grzybami mikoryzowymi (+AGM) lub nie (-AGM)
(trzeci czynnik). Każda kombinacja doświadczalna (8 obiektów, tj. dwa
poziomy P x dwa podłoża x inokulacja AGM lub brak) znajdowała się w
trzech powtórzeniach. Powtórzenie obejmowało 15 roślin. Inokulacji
podłoży dokonano szczepionką zawierającą grzyby z rodzaju Glomus
(m.in. G. mosseae, G. intraradices), które są gatunkami specyficznymi
dla pomidora (Tahat i in. 2008). Pierwszy zabieg inokulacji wykonano
w momencie sadzenia roślin na miejsce stałe tj. do mat uprawowych,
a następnie powtarzano go dwukrotnie w odstępach dwutygodniowych.
Zabieg inokulacji AGM wykonano poprzez wymieszanie szczepionki
z podłożem (mata kokosowa) lub rozłożenie jej w miejscu ustawienia
rozsady pomidora. Kolejne zabiegi inokulacji przeprowadzono poprzez
wprowadzenie szczepionki do położy za pomocą strzykawki. Rośliny
zasilano pożywką o tym samym odczynie i jednakowej, z wyjątkiem
fosforu, zawartości składników pokarmowych dostosowanej do fazy
wzrostu roślin (Adamicki i in. 2005). Częstotliwość podawania pożywki była regulowana automatycznie i zależała od wielkości radiacji
słonecznej i wilgotności mat. Próbki pożywek oddzielnie z kapilar, wód
drenarskich i wyciągu z maty wełny mineralnej, z każdego obiektu były
pobierane w dwóch terminach: I termin - faza dojrzałości owoców na
pierwszym gronie oraz II termin – faza dojrzałości owoców na siódmym
gronie. Nie pobierano wyciągu z mat kokosowych. Próby pobierano
z sześciu punktów w każdym obiekcie a następnie mieszano. Wyciągi
z maty pobierano strzykawką z miejsc w połowie wysokości maty oraz
w połowie odległości między roślinami. W pobranym materiale oznaczano: odczyn metodą potencjometryczną oraz przewodność elektrolityczną (EC) metodą konduktometryczną (Sady i in.1994). Zawartość
azotanów oznaczano metodą analizy przepływowej FIA [PN–EN ISO
13395:2001], natomiast makroelementów, z wyjątkiem fosforu, metodą
ICP-OES. Zawartość fosforu oznaczano metodą wanado – molibdenianową (Ostrowska i in. 1991).
Do opracowania wyników wykorzystano program Microsoft
Office Excel 2007.
77
Anna Konieczny, Iwona Kowalska
Wyniki i dyskusja
W tabelach 1 i 2 przedstawiono zawartość makroelementów oraz odczyn i przewodność elektrolityczną w próbach pobranych z kapilary,
wyciągu z maty i wód drenarskich. W obu zestawach koncentracja
makroskładników w wodach drenarskich z maty kokosowej i wełny mineralnej oraz wyciągu z maty wełny mineralnej była wyższa
w stosunku do zawartości makroskładników w pożywce dostarczanej
roślinom (kapilara). Wzrost koncentracji kationów i anionów w wodach drenarskich i podłożu jest zjawiskiem powszechnym i związany
jest zazwyczaj z pobieraniem większej ilości wody niż składników
pokarmowych przez rośliny (Breś 2009, Kleiber 2012). W zestawie
z niższą koncentracją fosforu w pożywce (15 mg P·dm-3; zestaw I),
w obu terminach analiz oznaczono niższą zawartość makroskładników
w wyciągu pobranym z mat wełny mineralnej oraz wodach drenarskich
z mat kokosowych i wełny mineralnej, na których rosły rośliny mikoryzowane (+AGM) w porównaniu do prób pochodzących z obiektów
z roślinami niemikoryzowanymi (-AGM). Natomiast w zestawie II
(50 mg P·dm-3), w I terminie analiz, zanotowano odwrotną zależność.
Niższą zawartość makroskładników oznaczono w próbkach pożywek
pobranych spod roślin uprawianych bez udziału AGM (-AGM) w porównaniu do prób pożywek pobranych spod roślin inokulowanych.
Wyjątek stanowiły potas i magnez w drenażu pobranym z wełny mineralnej. Natomiast w II terminie analiz, wyższą zawartość wszystkich
makroskładników oznaczono w próbach pobranych z wód drenarskich
pochodzących z mat kokosowych oraz N-NO3 i P w próbach pochodzących z wód drenarskich i wyciągu z maty wełny mineralnej. Koncentracja pozostałych makroskładników tj. Ca, K, Mg w próbach pobranych
z wyciągu oraz wód drenarskich z wełny mineralnej, na której uprawiano rośliny poddane mikoryzacji (+AGM), była niższa w porównaniu do prób pochodzących z obiektów niemikoryzowanych (-AGM).
Powyższe różnice mogły wynikać ze stopnia kolonizacji korzeni roślin
przez AGM, który zależy m.in. od zawartości fosforu w środowisku
korzeniowym. W przeprowadzonym doświadczeniu frekwencja mikoryzowa w zestawie roślin zasilanych pożywką z niższą zawartością
fosforu była o 23% wyższa w porównaniu do zestawu II, tj. z roślinami otrzymującymi pożywkę ze standardową zawartością P (wyniki
niepublikowane). Niejednokrotnie wykazano, że wysokie stężenie
78
171,1
554,4
483,5
N-NO3
135,4
282,7
375,0
416,1
532,0
434,6
561,7
Wyciąg mata +AGM
Miejsce pobrania pożywki
Kapilara
Drenaż kokos -AGM
Drenaż kokos +AGM
Drenaż wełna -AGM
Drenaż wełna +AGM
Wyciąg mata -AGM
Wyciąg mata +AGM
709,6
Drenaż wełna -AGM
Wyciąg mata -AGM
675,5
Drenaż wełna +AGM
21,2
703,2
Drenaż kokos -AGM
Drenaż kokos +AGM
19,1
21,2
27,1
15,4
16,8
29,5
20,5
P
15,6
16,2
6,6
13,3
14,4
12,7
144,9
Kapilara
P
N-NO3
Miejsce pobrania pożywki
401,8
407,6
165,0
486,2
399,3
503,0
123,5
Ca
184,0
193,8
46,1
200,1
175,9
253,6
33,2
Mg
530,6
393,6
161,6
419,5
620,3
368,1
229,6
K
420,6
379,7
120,9
277,0
341,2
334,1
500,7
Ca
155,3
146,2
30,8
88,7
134,2
129,0
80,5
Mg
50 mg P dm-3 (zestaw II)
I termin analiz
556,9
624,0
212,3
681,2
703,1
707,9
167,3
K
15 mg P dm-3 (zestaw I)
I termin analiz
347,9
341,7
167,3
282,8
374,9
311,0
376,2
N-NO3
282,5
313,1
239,0
461,8
337,8
369,8
147,4
N-NO3
14,4
21,4
40,7
14,2
21,2
11,6
11,9
P
450,3
558,1
225,1
656,3
504,6
542,1
234,1
K
420,2
586,7
226,4
548,1
666,5
567,9
417,0
K
Ca
195,2
306,9
129,4
286,6
273,0
265,0
177,6
Ca
278,8
371,0
164,6
503,0
288,3
268,4
133,9
II termin analiz
12,6
16,6
6,6
16,1
9,4
13,1
16,4
P
II termin analiz
69,8
132,2
39,8
101,9
105,5
101,9
59,4
Mg
84,0
115,7
45,8
175,3
89,2
114,9
40,6
Mg
Tab.1. Zawartość makroskładników (mg·dm-3) w pożywkach pobranych z kapilary, wód drenarskich z mat kokosowych
i wełny mineralnej oraz wyciągu z maty wełny mineralnej w uprawie pomidora.
Wpływ mikoryzy arbukularnej na zawartość składników pokarmowych...
79
80
2,00
3,76
3,67
3,91
3,06
4,68
3,14
6,185 1,5137 6,07
7,62
3,32
8,42
8,09
4,04
8,21
7,06 3,969 7,91
6,99 6,074 7,98
7,02 4,378 7,56
7,11
4,93
7,72
Kapilara
Drenaż kok -AGM
Drenaż kok +AGM
Drenaż weł -AGM
Drenaż weł +AGM
Wyciąg mata -AGM
Wyciąg mata +AGM
1,90
4,24
3,00
5,76
3,59
4,60
3,42
5,76
8,11
8,18
7,90
8,00
7,26
7,52
EC
pH
EC
pH
Miejsce pobrania pożywki
EC
pH
EC
pH
5,86 1,59
7,95 6,91
7,32 2,10
7,42 5,955
7,57 5,611
7,28 5,845
7,34 5,35
Kapilara
Drenaż kokos -AGM
Drenaż kokos +AGM
Drenaż wełna -AGM
Drenaż wełna +AGM
Wyciąg mata -AGM
Wyciąg mata +AGM
Miejsce pobrania pożywki
II termin analiz
50 mg P dm-3 (zestaw II)
I termin analiz
15 mg P dm-3(zestaw I)
I termin analiz II termin analiz
Tab.2. Odczyn (pH) i EC (mS·cm-1) pożywek pobranych z kapilary, wód drenarskich z mat kokosowych i wełny mineralnej oraz wyciągu z maty wełny mineralnej w uprawie pomidora.
Anna Konieczny, Iwona Kowalska
fosforu w glebie lub pożywce
ogranicza kolonizację korzeni roślin przez arbuskularne
grzyby mikoryzowe (Cwala
i in. 2010, Schmitt i in.
2010). Niski stopień kolonizacji powoduje, znaczne obniżenie korzyści z mikoryzy,
w tym zwiększonej efektywności pobierania składników
pokarmowych. W zestawie
z obniżoną zawartością fosforu w pożywce zaznaczyła
się tendencja do wyższej zawartości składników pokarmowych w drenażu z mat
kokosowych w porównaniu
do wełny mineralnej. W zestawie II wpływ podłoża na
zatężanie składników pokarmowych w wodach drenarskich był zróżnicowany.
W obu terminach analiz,
w zestawie I (15 mg·P dm-3)
EC pożywki pobranej z maty
oraz wód drenarskich z wełny
mineralnej i kokosu spod roślin inokulowanych (+AGM)
było niższe w porównaniu do
pożywki pobranej spod roślin nieinokulowanych AGM
(-AGM). Podobną zależność
wykazano w II terminie analiz w zestawie II. Natomiast
w I terminie, EC pożywek we
wszystkich obiektach nieinokulowanych (-AGM) było
Wpływ mikoryzy arbukularnej na zawartość składników pokarmowych...
niższe w porównaniu do inokulowanych (+AGM). Odmienne wyniki
uzyskali Dasgan i i in. [2008], którzy wykazali brak wpływu mikoryzy
na wielkość EC i odczyn wód drenarskich w uprawie pomidora w perlicie, w systemie bez recyrkulacji pożywki.
Wnioski
1. Bez względu na poziom fosforu w pożywce, rodzaj podłoża oraz
stosowanie inokulacji roślin szczepionką mikoryzową wykazano zatężanie pożywki w matach uprawowych i wodach drenarskich.
2. Mikoryza arbuskularna na korzeniach pomidora miała wpływ
na wielkość EC, zawartość makroskładników w wodach drenarskich
i wyciągu z mat wełny mineralnej oraz lepsze wykorzystanie przez
rośliny składników pokarmowych z pożywki.
Literatura
Adamicki F., Dyśko J., Nawrocka B., Ślusarki Cz., Wysocka – Owczarek M.
2005. Metodyka integrowanej produkcji pomidorów pod osłonami. PIORIN. Warszawa.
Breś W. 2009. Estimation of nutrient losses from open fertigation systems
to soil during horticultural plant cultivation. Polish Journal of Environmental Studies 18(3): 341 – 345.
Breś W. 2012. Uprawy bezglebowe. [w:] Komosa A. (red.) Żywienie Roślin
Ogrodniczych. Podstawy i perspektywy, PWRiL, Poznań, 283 – 324.
Cwala Y., Laubscher C.P., Ndakidemi P.A., Meyer A.H. 2010. Mycorrhizal
root colonization and the subsequent host plant response of soil less
grown tomato plants in the presence and absence of the mycorrhizal stimulant, Mycotech. African Journal of Microbiology Research
5: 414-419.
Dasgan H.Y., Kusvuran S., Ortas I. 2008. Responses on soilless grown tomato plants to arbuscular mycorrhizal fungal (Glomus fasciculatum)
colonization in re–cycling and open systems. African Journal of Biotechnology 7(20): 3606-3616.
Głuszek S., Sas - Paszt L., Sumorok B., Derkowska E. 2008. Wpływ mikoryzy
na wzrost i plonowanie roślin ogrodniczych. Postępy Nauk Rolniczych
6: 11 – 22.
Kleiber T. 2012. Pollution of the natural environment in intensive cultures
under greenhouses. Archives of environmental protection 38(2): 45-53.
81
Anna Konieczny, Iwona Kowalska
Ostrowska A., Gawaliński S., Szczubiałkowska Z. 1991. Metody analiz
i oceny właściwości gleb i podłoży – katalog. Instytut Ochrony Środowiska, Warszawa.
PN–EN ISO 13395:2001. Jakość wody. Oznaczanie azotu azotynowego
i azotanowego oraz ich sumy metodą analizy przepływowej (CFA i FIA)
z detekcją spektrofotometryczną.
Sady W., Domagała I., Kowalska I., Lis – Krzyścin A., Ostrowska J. 1994.
Przewodnik do ćwiczeń z uprawy roli i nawożenia roślin ogrodniczych.
Akademia Rolnicza im. Hugona Kołłątaja w Krakowie, Kraków.
Schmidt B., Domonkos M., Sumalan R., Biro B. 2010. Suppression of arbuscular mycorrhiza’s development by high concentrations of phosphorus
at Tagetes patula L. Research Journal of Agricultural Science 42(4):
156-162.
Tahat M.M., Kamaruzaman S., Radziach O., Kadir J., Masdek H.N. 2008.
Response of (Lycopersicon esculentum Mill.) to different arbuscular
mycorrhizal fungi species. Asian Journal of Plant Sciences 7(5): 479
– 484.
Adres do korespondencji:
mgr inż. Anna Konieczny
Zakład Żywienia Roślin
Instytut Biologii Roślin i Biotechnologii, Wydział Ogrodniczy
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
dr hab. Iwona Kowalska
Zakład Żywienia Roślin
Instytut Biologii Roślin i Biotechnologii, Wydział Ogrodniczy
Uniwersytet Rolniczy w Krakowie
Opiekun naukowy: dr hab. Iwona Kowalska
Doświadczenie zrealizowano w ramach projektu badawczego
z Narodowego Centrum Nauki - nr N N310 725040
82
Anna Krawczyk1
Agnieszka Lis-Krzyścin
EPISTEME
22/2014, t. III
s. 83–90
ISSN 1895-2241
ODCZYN GLEB MIEJSKICH ORAZ ZAWARTOŚĆ
METALI CIĘŻKICH W ALEJACH TRZECH
WIESZCZÓW W KRAKOWIE
SOIL ACIDITY AND HEAVY METALS CONTENT
IN URBAN ROADSIDE SOILS IN CRACOW
Abstrakt. Próbki gleby pobierano wiosną i jesienią w odległości 50, 100
i 150 cm od jezdni, z miejsc usytuowanych w środkowym pasie zieleni jednego z głównych ciągów komunikacyjnych Krakowa. W glebach oznaczono
odczyn oraz zawartość rozpuszczalnych form metali ciężkich w ekstrakcie
0,03 mol dm-3 kwasu octowego oraz 1 mol dm-3 HCl. Odczyn gleby był obojętny lub lekko zasadowy i utrzymywał się w zakresie pH 7,5-7,8 w okresie
wiosennym oraz pH 7,0-7,8 jesienią. Analiza zawartości rozpuszczalnych
w 0,03 mol dm-3 CH3COOH form metali ciężkich w pobranych próbkach gleb
wykazała istotnie wyższą zawartość ołowiu, niklu oraz chromu wiosną. Stężenie dostępnych form Pb rosło wraz z odległością od pasa jezdni natomiast
zawartość Ni rosła wraz z odległością ale tylko w okresie wiosny. Stężenie
kadmu było istotnie wyższe w okresie jesiennym przy dystansie 150 cm
niż w okresie wiosny. Zawartość rozpuszczalnych form metali oznaczona
w 1 mol dm-3 HCl mieściła się w zakresach: 60,3-90,3 mg Pb, 0,69-0,80 mg
Cd, 3,94-6,16 mg Ni i 2,08-3,17 mg Cr. Przydatność do ekstrakcji pierwiastków śladowych z gleb miejskich kwasu octowego jest ograniczona z uwagi
na niskie stężenia metali w glebach.
Słowa kluczowe: gleby miejskie, odczyn, metale ciężkie
Abstract. Soil samples were collected in spring and autumn at 50, 100 and
150 cm from the roadway. Samples were taken from sites situated in the
central green belt of one of the major communication route in Cracow. The
pH of the soil was determined and the content of soluble forms extract heavy metals in 0.03 mol dm-3 acetic acid and 1 mol dm- 3 HCl. Soil pH was neutral or slightly alkaline and remained in the pH range 7.5-7.8 in the spring
and pH 7.0-7.8 in autumn. Analysis of soluble in 0,03 mol dm-3 CH3COOH
forms of heavy metals in soil samples showed a significantly higher content
83
Anna Krawczyk, Agnieszka Lis-Krzyścin
of lead, nickel and chromium in the spring. The concentration of available
forms of Pb has grown with distance from the lane while the Ni content
increased with distance but only during the spring. The concentration of
cadmium was, significantly higher in the autumn at a distance of 150 cm
than in the spring. The soluble forms of metals determined in 1 mol dm-3
HCl was in the range : 60,3-90,3 mg Pb 0,69-0,80 mg Cd , Ni 3,94-6,16 mg
and 2,08-3,17 mg Cr . Suitability for the extraction of trace elements from
urban soils of acetic acid is limited due to low metal concentrations in soils.
Keywords: urban soils, soil reaction, heavy metal
Wstęp
Największy wpływ na prawidłowy wzrost i rozwój roślin w miastach
mają warunki glebowe, które wyraźnie różnią się od tych w siedliskach
naturalnych [Sady i Lis-Krzyścin 2005]. Wprowadzony przez Craula
[1985] termin gleb miejskich, obejmuje utwory nieużytkowane rolniczo, zlokalizowane w obrębie miast i przedmieść. Ich specyficzną cechą
jest antropogeniczne przekształcenie wierzchniej warstwy o miąższości minimum 50 cm. Badania przeprowadzone na Florydzie [Dobbs
2009, Hagan i in. 2010] wykazały dużą zmienność właściwości gleb
miejskich, wynikającą w dużym stopniu ze strefowości miast oraz natężenia ruchu pojazdów [Cekstere i Osvalde 2012]. Gleby miejskie w wyniku wietrzenia zalegających w nich odpadów budowlanych, gruzu, itp.
mają przeważnie odczyn zasadowy [Sady i Lis-Krzyścin 2005]. Działalność człowieka, w szczególności zanieczyszczenia przemysłowe, transport i używanie soli do odladzania ulic, wywołuje obecność w nich
szkodliwych substancji dla roślin [Cekstere i Osvalde 2012]. Czynniki
te modyfikują zarówno właściwości fizyczne, jak i chemiczne gleb
[Borowski 2008].
Stały monitoring i ochrona gleb przed wprowadzeniem substancji antropogenicznych jest niezbędna. Celem pracy było określenie
odczynu i stopnia zanieczyszczenia metalami ciężkimi gleb w jednym
z ciągów komunikacyjnych Krakowa. Ponadto porównano dwa roztwory do ekstrakcji dostępnych dla roślin form metali ciężkich: 0,03
mol dm-3 CH3COOH oraz 1 mol dm-3 HCl.
84
Odczyn gleb miejskich oraz zawartość metali ciężkich w alejach trzech wieszczów...
Materiał i metody
Ocenę właściwości chemicznych gleby przeprowadzono w środkowym pasie zieleni w Alejach Trzech Wieszczów w Krakowie. Glebę
z czterech stanowisk pobierano w latach 2011-2013: wiosną (po
rozmarznięciu podłoża i rozpoczęciu wegetacji przez rośliny) oraz
jesienią (październik). Analizowano próbki z głębokości 0-20 cm oraz
z odległości 50, 100 i 150 cm od brzegu jezdni. Oznaczono następujące właściwości chemiczne gleb: odczyn (pH – metodą potencjometryczną) w roztworze gleba:woda w stosunku 1:2, zawartość metali
ciężkich w wyciągu 0,03 mol dm-3 CH3COOH [Sady i in. 1994] oraz
w 1 mol dm-3 HCl – metoda Rinkisa [Korzeniowska i Stanisławska-Głubiak 2008]. Składniki po ekstrakcji oznaczono techniką ICP-OES
przy użyciu spektrometru Prodigy Teledyne (Leeman Labs). Względnie silny roztwór ekstrakcyjny w metodzie Rinkisa przeprowadza
rozpuszczalne, wymienne i słabo adsorbowane przez glebę formy
metali (więcej niż przyswajalne dla roślin formy składnika). W Polsce
poleca się tę procedurę, jako pierwszy poziom skanowania skażenia
gleby metalami ciężkimi [Korzeniowska i Stanisławska-Głubiak 2008].
Roztwór słabego kwasu octowego stosowany do ekstrakcji makroelementów w glebach (metoda uniwersalna) pozwala natomiast oznaczyć
pierwiastki znajdujące się w bezpośrednio roztworze glebowym, zatem
dostępne dla korzeni roślin.
Obliczenia statystyczne uzyskanych wyników wykonano przy
użyciu modułu ANOVA dla układu dwuczynnikowego w programie
Statistica 10 PL dla p<0,05. Istotność różnic pomiędzy średnimi oznaczono przy użyciu testu Fishera.
Wyniki i dyskusja
Odczyn gleby jest jednym z ważniejszych czynników wpływających na
przebieg procesów biologicznych i fizykochemicznych w glebie [Brusseau i in. 2004]. Zarówno zbyt wysokie, jak i zbyt niskie wartości pH
zaburzają procesy pobierania makro- i mikroelementów przez rośliny
[Łukasiewicz i Łukasiewicz 2006, Brusseau i in. 2004]. Odczyn gleby w
większości próbek był zasadowy, na poziomie pH 7,0–7,8, niezależnie
od terminu (tab. 1). Był on statystycznie najwyższy wiosną i jesienią
przy odległościach 50 cm od jezdni (tj. 7,5-7,8) oraz wiosną przy 100
85
Anna Krawczyk, Agnieszka Lis-Krzyścin
cm, w stosunku do jesieni przy największym oddaleniu od pasa ruchu.
Również Bach [2011] podaje, że aż 73% analizowanych próbek glebowych z Krakowa charakteryzowało się odczynem zasadowym, a 21%
odczynem obojętnym. Zbliżone wyniki uzyskały Cekstere i Osvalde
[2012] dla gleb w Rydze. Dzierżanowski i Gawroński [2011] twierdzą, że podwyższenie odczynu wynika ze zwiększającego się stężenia
kationów sodu i/lub wapnia w glebie wskutek zimowego odladzania
ulic. Odczyn zasadowy może przyczyniać się do unieruchamiania
w glebie składników (m.in. metali ciężkich) głównie poprzez powstawanie węglanów i fosforanów, co zmniejsza ich szkodliwość dla roślin
[Brusseau i in. 2004].
Tab. 1. Odczyn oraz zawartość rozpuszczalnych form (0,03 mol dm-3
CH3COOH) pierwiastków śladowych (µg∙dm-3) w pobranych w dwóch
terminach próbkach gleby z odległości 50, 100 i 150 cm od jezdni
Odległość
50
100
150
Odległość
Termin
Termin
pH
Pb
Cd
Ni
Cr
wiosna
7,8 b
1,93 b
1,15 a
10,25 bc
1,13 b
jesień
7,8 b
0a
1,60 a
6,58 ab
0a
wiosna
7,5 b
4,63 c
0,75 a
12,08 cd
1,18 b
jesień
7,4 ab
0a
1,95 ab
5,28 a
0a
wiosna
7,5 ab
6,83 d
1,10 a
16,20 d
1,10 b
jesień
7,0 a
0. a
2,27 b
6,10 ab
0a
50
7,8 A
0,96 A
1,37 A
8,41 A
0,56 A
100
7,5 A
2,31 B
1,35 A
8,68 A
0,59 A
150
7,8 A
3,41 B
1,68 A
11,15 A
0,55 A
wiosna
7,6 A
4,46 B
1,00 A
12,84 B
1,10 B
jesień
7,4 A
0A
1,94 A
5,98 A
0A
Toksyczne działanie metali ciężkich na rośliny zależy od ich zawartości w glebie i jej właściwości oraz od gatunku [Hagan i in. 2010].
Szczególnie narażone na podwyższone stężenie metali ciężkich są gleby,
które sąsiadują z ruchliwymi arteriami komunikacyjnymi. Największą
kumulację metali ciężkich odnotowuje się w poziomach przypowierzchniowych gleby, gdyż ich przemieszczanie w głąb profilu przebiega powoli
[Dzierżanowski i Gawroński 2011, Brusseau i in. 2004]. Oznaczone
86
Odczyn gleb miejskich oraz zawartość metali ciężkich w alejach trzech wieszczów...
w roztworze 0,03 mol dm-3 CH3COOH stężenie dostępnych form Pb
wzrastało wraz z odległością od pasa jezdni, natomiast zawartość Ni
zwiększała się wraz z odległością ale tylko w okresie wiosny (tab.1).
Najwyższą zawartość kadmu stwierdzono w okresie jesiennym przy dystansie 150 cm. Stężenie ołowiu i chromu w glebie w okresie jesiennym
było poniżej limitu detekcji spektrometru ICP-OES.
Duże litery oznaczają istotność różnic pomiędzy średnimi dla
efektów głównych: odległość (A), termin (B), małe litery oznaczają
istotność różnic pomiędzy średnimi dla współdziałania czynników
(AxB), 0- zawartość poniżej limitu detekcji spektrometru ICP-OES
Zawartości w glebie rozpuszczalnych form (1mol dm-3 HCl) metali ciężkich (tab.2) można uszeregować w kolejności Pb>Ni>Cr≥Cd.
Kolejność ta różni się od wyników podanych przez Cekstere i Osvalde [2012] dla gleb Rygi, gdzie koncentracja chromu jest wyższa
niż niklu. Dopuszczalna ogólna zawartość kadmu, niklu i chromu
w powierzchniowej warstwie gleby z terenów komunikacyjnych [Dz.U.
Nr 165, poz. 1359] wynosi odpowiednio 3 mg, 75 mg, oraz 150 mg
w 1 kg powietrznie suchej gleby. Stwierdzona w badaniach zawartość
rozpuszczalnych form (1 mol dm -3 HCl) tych składników wynosiła średnio odpowiednio: 0,78 mg Cd, 4,95 mg Ni i 2,63 mg Cr∙kg-1
(tab. 2). W Rozporządzeniu Ministra Środowiska [Dz.U. Nr 165, poz.
1359] za zawartość naturalną ołowiu przyjmuje się do 70 mg kg-1
gleby. Według Kabaty-Pendias [2010] w polskich warunkach gleby
niezanieczyszczone najczęściej charakteryzują się ogólną zawartością
ołowiu w zakresie od 13-21 mg Pb∙kg-1, w Europie środkowo-wschodniej 10-35 mg Pb∙kg-1. Koncentracja ołowiu w roztworze glebowym
jest relatywnie niska, tj. <1-60 µg∙dm-3 i zależy od metody ekstrakcji
[Kabata-Pendias 2010]. Oznaczone stężenie rozpuszczalnych form
ołowiu (1mol dm-3 HCl) w badanych próbach wynosiła średnio 80,5
mg Pb∙kg-1. W próbach gleb z Rygi [Cekstere i Osvalde 2012] stwierdzono 18,4-118,3 mg ołowiu ogólnego w 1 kg gleby. Wykazany stopień
zanieczyszczenia analizowanych gleb jest również zbieżny z wynikami
badań Borowskiego [2008] dla gleb terenów komunikacyjnych Warszawy. Jednakże większość polskich badań [m.in. Biernacka i in. 2006,
Kabała i in. 2009] i amerykańskich [Hagan i in. 2010] wskazują na
wysokie zanieczyszczenie gleb miejskich metalami ciężkimi.
87
Anna Krawczyk, Agnieszka Lis-Krzyścin
Tab. 2. Zawartość rozpuszczalnych form (1 mol dm-3 HCl) pierwiastków
śladowych (mg∙kg-1) w glebach pobranych z czterech stanowisk z Al. Trzech
Wieszczów
Stanowisko
Pb
Cd
Ni
Cr
1
2
3
4
85,1
86,3
60,3
90,3
0,69
0,79
0,77
0,80
3,94
6,16
4,63
5,07
2,65
2,48
2,08
3,17
Średnia
80,5
0,78
4,95
2,63
Minimum
Maksimum
odch. stand.
60,3
90,3
13,6
0,69
0,80
0,05
3,94
6,16
0,97
2,08
3,17
0,46
Wnioski
Gleby miejskie o wartości pH przekraczającej 7,0 nie są optymalne
z punktu widzenia uprawy większości roślin, dlatego istnieje konieczność dokładnego doboru gatunkowego pod kątem istniejących
warunków siedliskowych.
Oznaczone stężenia form rozpuszczalnych chromu, kadmu oraz
niklu były niskie, natomiast zawartość ołowiu była podwyższona
w stosunku do zawartości naturalnej [Dz.U. Nr 165, poz. 1359].
Przydatność do ekstrakcji pierwiastków śladowych z gleb miejskich kwasu octowego jest ograniczona z uwagi na niskie stężenia
metali w okresie jesieni, szczególnie ołowiu i chromu. Metoda Rinkisa
(1 mol dm-3 HCl) jest bardziej odpowiednia do szacowania przyswajalnych dla roślin stężeń pierwiastków śladowych w glebie.
Bibliografia
Bach A. 2011. Przeprowadzenie badań zanieczyszczenia metalami ciężkimi
gleb terenów zieleni przylegających do ciągów komunikacyjnych i ocena stopnia zasolenia. Opracowanie wg stanu na 1 X 2011 wykonane dla
Gminy Miejskiej z siedzibą w Krakowie: 13, 37.
Biernacka E., Borowski J., Małuszyńska I., Małuszyński M.J. 2006. Chrom,
nikiel, ołów w wierzchniej warstwie gleb aglomeracji warszawskiej.
Przed. Nauk. Inż. Kształt. Środ. 15, 2 (34): 41-50.
88
Odczyn gleb miejskich oraz zawartość metali ciężkich w alejach trzech wieszczów...
Borowski J. 2008. Wzrost rodzimych gatunków drzew przy ulicach
Warszawy. Rozprawy Naukowe i Monografie. Wydawnictwo SGGW,
Warszawa: 15, 115.
Brusseau M.L., Famisan G.B., Artiola J.F. 2004. Chemical contaminants.
[w:] Artiola J.F., Pepper I.L., Brusseau M.L. Environmental Monitoring
and Characterization. Elsevier Inc. 299.
Cekstere G., Osvalde A. 2012. A study of chemical characteristics of soil
in relation to street status in Riga (Latvia). Urban Forestry & Urban
Greening.12:61-68.
Craul P.J. 1985. A Description of urban Soils and Their Desires Characteristics. Journal of Arboriculture, 11: 330,339.
Dobbs C. 2009. An Index of Gainesville’s Urban Forest Ecosystem Services
and Goods. University of Florida MS Thesis.
Dz.U. Nr 165 poz. 1359. Rozporządzenie Ministra Środowiska z dnia 9 września 2002 r. w sprawie standardów jakości gleby oraz standardów
jakości ziemi.
Dzierżanowski K., Gawroński S.W. 2011. Analiza zawartości metali ciężkich
w glebie i liściach mniszka lekarskiego w sąsiedztwie ruchliwej ulicy
miejskiej przy użyciu przenośnego spektrometru XRF. Ochrona Środowiska i Zasobów Naturalnych.50:209.
Hagan D., Escobedo F., Toor G., Dobbs C., Andreu M. 2010. Key physical and
chemical properties of tampa’s urban soils. University of Florida-IFAS,
EDIS SL 324.
Kabała C., Chodak T., Szerszeń L., Karczewska A., Szopka K., Frątczak U.
2009. Factors influencing the concentration of heavy metals in soils of
allotment gardens in the city of Wroclaw, Poland. Fresenius Env. Bull.
18 (7):1118-1124.
Kabata-Pendias A. 2010. Trace Elements in Soils and Plants. Fourth Edition. USA: Taylor & Francis: 338-339.
Korzeniowska J., Stanisławska-Głubiak E. 2008. Przydatność roztworu
1 mol HCl dm-3 do oceny skażeń gleby miedzią, cynkiem i niklem.
X Sympozjum Trace Elements In the Environment, Koszalin-Mielno
11-14 maja 2008, Book of Abstracts: 191-192.
Łukasiewicz A., Łukasiewicz Sz. 2006. Rola i kształtowanie zieleni miejskiej.
Wyd. Naukowe UAM, Poznań: 66, 68.
Sady W., Domagała I., Kowalska I., Lis-Krzyścin A., Ostrowska J. 1994.
Przewodnik do ćwiczeń z Uprawy roli i nawożenia roślin ogrodniczych.
Skrypt AR, Kraków: 42, 75.
Sady W., Lis-Krzyścin A. 2005. Gleba w terenach miejskich jako miejsce rozwoju roślin. [w:] Wiech K., Śliwa P. (red.). Pielęgnacja i ochrona zieleni
miejskiej. Oficyna Wydawnicza „TEXT”, Kraków: 37-38, 40.
89
Anna Krawczyk, Agnieszka Lis-Krzyścin
Adres do korespondencji:
mgr. inż. Anna Krawczyk, dr hab. inż. Agnieszka Lis-Krzyścin
Instytut Biologii Roślin i Biotechnologii, Zakład Żywienia Roślin
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected], [email protected]
Opiekun naukowy: dr hab. inż. Iwona Domagała-Świątkiewicz
90
Ewelina Kwaśniewska
EPISTEME
22/2014, t. III
s. 91–99
ISSN 1895-2241
Inicjacja i stabilizacja kultur in vitro
wybranych róż historycznych
In vitro culture establishment
of selected historical roses
Abstrakt. Róże historyczne, które dały początek nowym odmianom, są
obecnie bardzo cenione, chętnie sadzone i odgrywają ważną rolę w kształtowaniu terenów zieleni. Ta zróżnicowana grupa roślin obejmuje odmiany
powstałe przed 1867 rokiem, a także późniejsze, jeśli mają istotne cechy
róż starych. W niniejszej pracy podjęto działania mające na celu stabilizację
kultur in vitro dwóch róż historycznych Rosa × alba ‘Maxima’ i Rosa gallica
‘Cardinal de Richelie’. Materiałem wyjściowym były pąki zimowe pobierane z jednorocznych pędów krzewów rosnących w Narodowej Kolekcji Róż
w Ogrodzie Botanicznym - Centrum Zachowania Różnorodności Biologicznej Polskiej Akademii Nauk w Powsinie (Warszawa). Po dezynfekcji powierzchniowej, z pąków izolowano merystemy, które umieszczano na pożywce o składzie podstawowym Murashige i Skoog’a (1962), zawierającej
BA (5 µM) i GA3 (0-1,5 µM). Oceniano efektywność dezynfekcji powierzchniowej oraz regenerację (formowanie kalusa i pędów).
Słowa kluczowe: róża francuska ‚Cardinal de Richelie’, róża biała ‘Maxima’,
dezynfekcja powierzchniowa, wierzchołki wzrostu
Abstract. The historical roses which have given rise to new varieties, are
now highly valued, willingly planted and have an important role in landscaping. This diverse group of plants includes varieties occurring before
1867, and later, if they have the essential characteristics of the old roses.
Among historical roses French and White roses are ones of the most important. In this study, establishing of in vitro Rosa alba ‘Maxima’ and Rosa gallica ‘Cardinal de Richelie’ cultures were obtained. Initial material was taken
from the winter buds of one-year-shoots of shrubs growing in the National
Collection of Roses in the Botanical Garden - Center for Biological Diversity
Conservation Polish Academy of Sciences in Powsin (Warsaw). After surface disinfection of buds, shoot tips were isolated and were placed on the
primary Murashige and Skoog (1962) medium containing BA (5 µM) and
91
Ewelina Kwaśniewska
GA3 (0-1.5 µM). The effectiveness of surface disinfection and regeneration
(formation of callus and shoots) were evaluated.
Key words: Rosa × alba ‘Maxima’, Rosa gallica ‘Cardinal de Richelie’, surface
disinfection, shoot tips
Wstęp
Róże są jednymi z najważniejszych roślin ozdobnych na świecie. Mają
ogromne znaczenie gospodarcze, produkowane są na kwiaty cięte, jako
rośliny doniczkowe, krzewy ogrodowe i pnącza. Róże historyczne, które
dały początek nowym odmianom, są obecnie bardzo cenione, chętnie
sadzone w ogrodach i w terenach zieleni, a także odgrywają ważną rolę
w kształtowaniu krajobrazu. Ponadto wykorzystywane są w przemyśle
spożywczym, farmaceutycznym i w medycynie. Miano róż historycznych posiadają wszystkie odmiany, które powstały przed 1867 rokiem,
a także późniejsze, jeśli mają istotne cechy róż starych. Należą do nich
m.in.: róża francuska, róża biała, róże damasceńskie, róże portlandzkie,
róże stulistne, róże piżmowe [Quest – Ritson 2003].
Jedną z najstarszych znanych róż historycznych jest Rosa × alba
‘Maxima’ (syn. ‘Great Double White’, ‘Jacobite Rose’), której odkrycie
datuje się na XV w. Przypuszczalnie róża ta była znana już w Starożytnym Rzymie, a pierwsze doniesienia na temat jej występowania w naszych rejonach przypadają na XVI w. Prawdopodobnie powstała z róży
dzikiej (R. canina) i francuskiej (R. gallica). Odmiana ta bardzo często
kojarzona jest z Matką Boską i można ją spotkać na starych religijnych
obrazach [Schultheis 2003, Quest – Ritson 2003, Monder 2008].
Rosa gallica ‘Cardinal de Richelieu’ (syn. ‘Rose van Sian’) jest różą
nieznanego pochodzenia odnalezioną w 1840 r. przez francuskiego hodowcę Laffay. Róża francuska jest jedną z najważniejszych róż historycznych, ponieważ jej geny występują u prawie wszystkich nowoczesnych
odmian. Jest też jednym z gatunków wyjściowych, dla róż stulistnych
i damasceńskich [Schultheis 2003, Popek 2002, Quest – Ritson 2003,
Monder 2008]. Z powodu intensywnej gospodarki w rejonach rolniczych wiele naturalnych stanowisk na terenie Polski dziś już nie istnieje
i gatunek ten jest silnie narażony na wyginięcie [Popek 2002].
92
In vitro culture establishment of selected historical roses
Pierwsze badania nad mikrorozmnażaniem róż były prowadzone
przez Elliota w 1970 r. [Jacobs i in. 1970], potem prowadziło je wielu badaczy m.in. Kim i in. [2003] na Rosa hybrida, Murali i Sindhu
[2011] na Rosa bourboniana. Opracowania metody somatycznej
embriogenezy dla róży chińskiej podjęli się Vergne i in. [2010]. Wyniki licznych badań nad rozmnażaniem róż techniką in vitro zebrano
w przeglądowej pracy Pati i in. [2006].
Celem przeprowadzonych badań była stabilizacja kultur in vitro
dwóch odmian róż historycznych: Rosa alba ‘Maxima’ i Rosa gallica
‘Cardinal de Richelie’.
Materiał i metody
Do założenia kultur in vitro wykorzystano dwa gatunki róż historycznych: Rosa × alba ‚Maxima’ i Rosa gallica ‚Cardinal de Richelie’
rosnące w Narodowej Kolekcji Róż w Ogrodzie Botanicznym - Centrum Zachowania Różnorodności Biologicznej Polskiej Akademii Nauk
w Warszawie - Powsinie. Eksplantatami wyjściowymi były wierzchołki wzrostu wyizolowane z zimowych pąków bocznych, pobranych
z jednorocznych pędów róż, w październiku 2013 roku. Pąki pobierano ze środkowej części pędów, odrzucając położone najwyżej oraz
te z dolnej części pędu. Przed izolacją przeprowadzono podwójną
dezynfekcję powierzchniową „oczek” z pąkami bocznymi w roztworze 15% Domestosu. Procedura odkażania przebiegała następująco:
w pierwszej kolejności „oczka” płukano pod bieżącą wodą z kilkoma
kroplami detergentu. Następnie zostały zanurzone w 96% alkoholu
na 30 sekund, po czym przełożono je do roztworu odkażającego zawierającego 15% Domestos (z dodatkiem detergentu). Dezynfekcję
prowadzono na mieszadle elektromagnetycznym przez 15 minut.
Potem trzykrotnie płukano pąki w wodzie destylowanej. Ostatnim
etapem było zanurzenie „oczek” na czas 15 sekund w 1,5% roztworze
Domestosu z kroplą detergentu. Wyizolowane merystemy wraz z 2-3
primordiami, o wielkości 0,1 – 0,2 mm, odcinano z fragmentem pędu
i umieszczano pojedynczo w probówkach na pożywkach do inicjacji
kultur, o składzie podstawowym wg Murashige i Skoog’a (1962) (MS),
zawierających sacharozę 30g · dm-3 oraz dodatkowe żelazo w formie
EDDHA 20 mg · dm-3, o pH 5,7. Testowano dwie pożywki: jedna
93
Ewelina Kwaśniewska
z nich zawierała 5 µM BA i 1,5 µM GA3, drugą wzbogacono w 5 µM
BA. Doświadczenie założono w 5 powtórzeniach, po 5 ekpslantatów
w każdym. Eksplantaty umieszczono w fitotronie, w temperaturze
23/25ºC (noc/dzień), wilgotności względnej 80%, przy 16-godzinnym
dniu, natężeniu światła PPFD 10 µmol · m-2 · s-1 na okres 8 tygodni.
W pierwszych tygodniach prowadzono obserwacje, sprawdzając skuteczność dezynfekcji powierzchniowej, a po 8 tygodniach obserwowano regenerację eksplantatów. Policzono: procent eksplantatów
żywych, procent eksplantatów na których rozwijały się pędy oraz
eksplantatów formujących kalus. Dokonano też pomiarów wysokości rozety liściowej oraz obliczono współczynnik namnażania (liczba
pędów na 1 formujący pędy eksplantat). W dalszym etapie uzyskane
pędy boczne wyłożono po 6 sztuk do słoików o pojemności 0,3 dm3 zawierających 25 ml pożywki i przeznaczono do dalszych doświadczeń.
Otrzymane wyniki obserwacji poddano analizie statystycznej
programem Statistica 9.0 (StatSoft) w oparciu o analizę wariancji
(ANOVA), określając istotność różnic testem Duncana na poziomie
istotności α = 0,05.
Wyniki i dyskusja
Wprowadzenie róż historycznych do warunków in vitro pozwala na
otrzymanie wysokiej jakości, elitarnego materiału rozmnożeniowego,
wolnego od patogenów i jednolitego genetycznie [Bach i Pawłowska
2009]. Metody in vitro dają możliwość masowego rozmnażania ginących gatunków i przywrócenia ich do środowiska naturalnego. Mają
duże znaczenie w ochronie roślin ex situ, poprzez tworzenie „banków genów” w laboratoriach dzięki zdolności do długoterminowego
przechowywania roślin w szkle [Engelmann 2011]. Ostatnie badania
Le Bras i in. [2014] prowadzone na róży chińskiej oraz Pawłowskiej
i Szewczyk-Taranek [2014] na różach dzikich potwierdzają możliwość
wykorzystania kultur in vitro do skutecznej krioprezerwacji róż, czyli
tworzenia banków genów z zastosowaniem ciekłego azotu.
Powszechnie uważa się, iż rośliny rosnące w gruncie mają większą
skłonność do zakażeń [Horn 1992]. Metoda podwójnego odkażania
eksplantatów w 15% roztworze Domestosu zastosowana w doświadczeniu okazała się skuteczna w 100% (tab. 1). Nie było konieczne
94
In vitro culture establishment of selected historical roses
zastosowanie HgCl2 jak miało to miejsce w przypadku badań przeprowadzonych przez Kucharską i in. [2001], ani antybiotyków [Salehi
i Khosh-Khui 1997]. Posługując się tą samą metodą podwójnego odkażania Pawłowska i in. [2009] przy inicjowaniu kultur z róż dziko rosnących w Polsce uzyskała podobnie zadowalające wyniki (91-100%).
W przeprowadzonych badaniach użyto pożywkę o składzie podstawowym makro- i mikroelementów wg Murashige i Skoog’a [1962].
Taki sam skład mineralny do namnażania róż stosowali Khosh – Khai
i Teixeira da Silva [2006], Nak – Udom i in. [2009], Vergne i in. [2010]
oraz Murali i Sindhu [2011]. Ważnym składnikiem pożywek przy
rozmnażaniu roślin drzewiastych jest obecność żelaza. W pożywce
MS występuje w formie fotolabilnej FeEDTA, co powoduje szybkie
uwalnianie się Fe, przez co staje się dla roślin niedostępne. Zalecane
jest więc dodanie do pożywek zawierających już chelat FeEDTA fotostabilnego chelatu FeEDDHA, albo całkowite zastąpienie FeEDTA taką
samą ilością fotostabilnego FeEDDHA. Ta postać żelaza jest znacznie
lepiej i wydajniej pobierana przez roślinę, dzięki czemu lepsza jest
ich kondycja fizjologiczna oraz większa zdolność do namnażania
i ukorzeniania [Orlikowska i Zawadzka 2009]. W przeprowadzonym
doświadczeniu wyłożone na pożywki wierzchołki wzrostu róż regenerowały na wysokim poziomie 92-94% (tab. 1, ryc. 1), nie stwierdzono
istotnej różnicy w regeneracji R. × alba ‘Maxima’ i R. gallica ‘Cardinal
de Richelie’. Podobnie u obu badanych gatunków obserwowano intensywne formowanie kalusa, 90-92% eksplantatów (tab. 1, ryc. 1). Za
tworzenie się kalusa na eksplantatach odpowiedzialne są auksyny. Do
zastosowanej w doświadczeniu pożywki nie dodano regulatorów wzrostu z tej grupy , a pojawianie się kalusa na eksplantatach świadczyć
może o wysokim stężeniu auksyn endogennych. Regeneracja poprzez
kalus nie jest korzystna z uwagi na jego dużą zmienność genetyczną.
Metoda ta jest częściej praktykowana w celu otrzymywania roślin
transgenicznych [Orlikowska i in. 2000]. W kulturach róż najczęściej
prowadzona jest organogeneza bezpośrednia, czyli z pominięciem
stadium rozwoju tkanki kalusowej [Pati i in 2006].
Pożywki zastosowane w doświadczeniu zawierały cytokininę BA
oraz giberelinę GA3.W kulturach in vitro obecność cytokinin odpowiedzialna jest za hamowanie tworzenia się korzeni oraz stymulację wzrostu pąków bocznych. Najczęściej dodawana jest do składu pożywek
95
Ewelina Kwaśniewska
w celu namnażania pędów z pąków bocznych [Kopcewicz i Lewak
2002]. Regenerowanie pędów róż w przeprowadzonych doświadczeniach istotnie zależało od gatunku (tab. 1). Znacznie lepiej regenerowała R. × alba ‘Maxima’ (90% eksplantatów formujących pędy), w porównaniu do R. gallica ‘Cardinal de Richelie’ (58%). Pawłowska [2012]
do inicjacji kultur in vitro z pąków bocznych róż dzikich zastosowała
pożywkę, w skład której również wchodziły BA i GA3. Podstawową
funkcję stosowanych w in vitro giberelin jest wydłużanie międzywęźli
pędów. Dodawana jest również do pożywek inicjalnych dla przyspieszenia wzrostu merystemów [Jankiewicz 1997]. Otrzymane w czasie
etapu stabilizacji kultur in vitro róż pędy charakteryzowały się rozetowym wzrostem, każda roślina zawierała od 2 do 9 liści, a ich średnia
wysokość wynosiła od 3,3 – 4,6 mm (tab. 2). W przeprowadzanych
badaniach dodatek gibereliny do pożywki działała stymulująco na
wydłużanie pędów R. alba ‘Maxima’ (tab. 2).
Tab. 1. Procent zdezynfekowanych i regenerujących róż historycznych
w zależności od gatunku, niezależnie od pożywki
Eksplantaty Eksplan- Eksplantaty Eksplantaty
zdezynfetaty
formujące
formujące
kowane (%) żywe (%) pędy (%)
kalus (%)
Rosa × alba ‚Maxima’
100a*
94a
90a
90a
Rosa gallica ‚Cardinal de
Richelie’
100a
92a
58b
92a
*a b … średnie dla badanych cech oznaczone tymi samymi literami nie różnią się
między sobą istotnie.
Tab. 2. Współczynnik namnażania i długość pędów róż historycznych w zależności od gatunku i zastosowanej pożywki, po 6 tygodniach od inicjacji kultur
Badana cecha
Skład regulatorów wzrostu w pożywce (µM)
Rosa × alba ‚Maxima’
Rosa gallica ‚Cardinal de
Richelie’
Współczynnik
namnażania
Wysokość rozety liściowej
(mm)
5 BA + 1,5 GA3 5 BA 5 BA + 1,5 GA3
5 BA
1,3 a*
1,3 a
5,0 b
4,1ab
1,4 a
1,0 a
3,3 a
3,3 a
*a b … średnie dla badanych cech oznaczone tymi samymi literami nie różnią się
między sobą istotnie.
96
In vitro culture establishment of selected historical roses
120
% regenerujących
100
96 92
a* a
92 92
a a
92
a
64
b
80
92 92
a a
88
a
88 92
a a
52
b
60
Rosa × alba 'Maxima'
40
Rosa gallica 'Cardinal de
Richelie'
20
0
5 BA 1,5 GA3
żywe
5BA
5 BA1,5 GA3
5BA
pędy
Regenerujące
5 BA1,5 GA3
5BA
kalusujące
Ryc. 2. Regeneracja róż historycznych w zależności od gatunku
i zastosowanej pożywki
*a, b … średnie dla badanych cech oznaczone tymi samymi literami nie różnią się
między sobą istotnie.
Wnioski
Pobranie pąków bocznych dwóch gatunków róż historycznych Rosa ×
alba ‘Maxima’ i Rosa gallica ‘Cardinal de Richelie’ z Narodowej Kolekcji
Róż w Ogrodzie Botanicznym - Centrum Zachowania Różnorodności
Biologicznej Polskiej Akademii Nauk w Powsinie, jesienią 2013 roku,
pozwoliło na uzyskanie i ustabilizowanie kultur in vitro.
Zastosowana metoda podwójnej dezynfekcji powierzchniowej
15% roztworem Domestosu była skuteczna w 100%.
92% i 94% wyłożonych na pożywkę wierzchołków wzrostu przeżyło,
92% i 90% z nich regenerowało kalus, 58% i 90% formowało pędy boczne
(odpowiednio dla R. gallica ‘Cardinal de Richelie’ i R. × alba ‘Maxima’).
Otrzymane pędy charakteryzowały się rozetowym wzrostem,
każda roślina zawierała od 2 do 9 liści, a ich średnia wysokość wynosiła 3,3 – 4,6 mm.
Bibliografia
Bach A. Pawłowska B. 2009. Procesy rozwojowe w kulturze in vitro. Typy kultury, [w:] Malepszy S. Biotechnologia roślin, Wydawnictwo Naukowe PWN.
Engelmann F. 2011. Use of biotechnologies for the conservation of plant
biodiversity. In Vitro Cell. Dev.-Pl. 47, 5–16.
Horn W.A.H. 1992. Micropropagation of Rose. W Bajaj Y.P.S. (red.), Biotechnology in Agroculture and Forestry, 20: High-Tech and Micropropagation IV. Springer- Verlag, Berlin, Heidelberg, New York, London, Paris,
Tokyo, Hong Kong, Barcelona, Budapest: 320-335.
97
Ewelina Kwaśniewska
Jacobs G. Allan P. Bornman Ch. 1970. Tissue culture studies on rose: use of
shoot tip explants II. Agroplantae 2.
Jankiewicz L. 1997. Regulatory wzrostu i rozwoju roślin 2. Zastosowanie
w ogrodnictwie, rolnictwie, leśnictwie i w kulturach tkankowych. [w:]
Regulatory roślinne w kulturach in vitro. Red. Orlikowska T. ISiKW,
Skierniewice, PWN, Warszawa: 222- 228.
Khosh – Khui M. Teixeira da Silva J.A. 2006. In Vitro Culture of the Rose
Species. [w:] Floriculture, ornamental and plant biotechnology. Global
Science Books, London, 514 – 525.
Kim C.K. Oh J.Y. Jee S.O. Chung J.D. 2003. In vitro mitropropagation of
Rosa hybrida L. Jurnal of Plant Biotechnology 5: 115 -119.
Kopcewicz J. Lewak S. 2002. Fizjologie roslin. PWN, Warszawa: 130 – 140.
Kucharska D. Wiśniewska – Grzeszkiewicz H. Orlikowska T. 2001. Mikrorozmnażanie podkładki Rosa india ‘Major’. Biotechnologia 3(54): 231236.
Le Bras C. Le Besnerais P.H. Hamama L. Grapin A. 2014. Cryopreservation
of ex-vitro-grown Rosa chinesis ‘Old Blush’ buds Rusing droplet-vitrification and encapsulation-dehydration. Plant Cell Tiss Organ Cult,
116: 235-242.
Monder M.J. 2008. Katalog róż polecanych przez Związek Szkółkarzy Polskich. Agencja Promocji Zieleni.
Murali R. Sindhu K. 2011. In vitro multiplication of rose (Rosa bourboniana).
Int. J. Current Research 4, 100 – 103.
Murashige T. Skoog F. 1962. A revised medium for rapid growth and biomasy with tabacco tissue cultures. Plant. 15: 473-497.
Nak – Udom N. Kanchanapoom K. Kanchanapoom K. 2009. Micropropagation from cultured nodal explants of rose (Rosa hybryda L. cv. ‘Perfume
Delight’). Songklanakarin Journal of Science and Technology 31(6):
583 – 586.
Orlikowska T. Wach I. Kucharska D. 2000. Zastosowanie kultur in vitro
i inżynierii genetycznej w hodowli róż. Biotechnologie 4 (51): 73 – 75.
Orlikowska T. Zawadzka M. 2009. Rola żelaza w kulturach roślin in vitro,
Zeszyty problemowe postępów nauk rolniczych 2009 z. 534:105-115, Instytut Sadownictwa i Kwiaciarstwa, Skierniewice.
Pati P.K. Rath S.P. Sharma M. Sood A. Ahuja P.S. 2006. In vitro propagation
of rose – a review. Biotechnology Advances, 24: 94-114.
Pawłowska B. Bach A. Popek R. 2009. Wykorzystanie kultur in vitro rodzimych gatunków róż do ochrony zasobów genowych. Zeszyty problemowe postępów nauk rolniczych, 534: 199-206.
98
In vitro culture establishment of selected historical roses
Pawłowska B. 2012. Krioprezerwacja rodzimych gatunków róż dla zachowania biologicznej różnorodności (Rozprawa habilitacyjna). Zeszyty Naukowe UR w Krakowie 498, Seria rozprawy, zeszyt 375.
Pawłowska B. Szewczyk-Taranek B. 2014. Droplet vitrification cryopreservation of Rosa canina and Rosa rubiginosa using shoot tips from in situ
plants. Scientia Horticuturae 168:151-156
Popek R. 2002. Róże dziko rosnące Polski. Klucz – atlas. Plantpress, Kraków:
112ss.
Salehi H. Khosh-Khui M. 1997. Effect of explants length and diameter on in
vitro shoot growth and proliferation rate of miniature rose – ‘The Faiy’.
Orissa J. Hortic. 25: 87-90.
Schultheis H. 2003. Róże w ogrodzie pielęgnacja i odmiany. Świat Książki,
Warszawa: 17-23.
Quest – Ritson C. Ritson B. 2003. Encyclopedia of roses. DK. London, New
York, Munich, Melbourne, Delhi: 8-15, 22, 162.
Vergne P. Maene M. Gabant G. Chauvet A. Debener T. Bendahmane M.
2010. Somatic embryogenesis of and transformation of the diploid
Rosa chinensis cv Old Blush. Plant Cell Tiss Organ Cult 100: 73 – 81.
Adres do korespondencji:
Ewelina Kwaśniewska
Promotor: dr hab. inż. Bożena Pawłowska
Badania zostały dofinansowane z dotacji na naukę przez MNiSW,
prowadzone w ramach tematu 2/3500/KRO/2014
99
Marta Leśniak
Maria Pobożniak
Michał Pniak
EPISTEME
22/2014, t. III
s. 101–107
ISSN 1895-2241
WPŁYW OLEJKU POMARAŃCZOWEGO ORAZ
SYNTETYCZNEGO POMARAŃCZOWEGO AROMATU
NA TETRANYCHUS URTICAE (KOCH.), APHIS
PHOMI (DEG.) I ERIOSOMA LANIGERUM (HASM.)
THE INFLUENCE OF ORANGE OIL AND ORANGE
SYNTHETIC AROMA ON TETRANYCHUS URTICAE
(KOCH.), APHIS PHOMI (DEG.) AND ERIOSOMA
LANIGERUM (HASM.)
Abstrakt. W doświadczeniu zbadano wpływ olejku pomarańczowego (PREV-B2) oraz syntetycznego pomarańczowego aromatu na trzy gatunki fitofagów:
T. urticae, A. phomi i E. lanigerum. Badania prowadzono w laboratorium Uniwersytetu Rolniczego w Krakowie. Na podstawie uzyskanych wyników obliczono procent śmiertelności oraz współczynnik efektywności wg wzoru Hendersona – Tiltona. Najwyższą śmiertelność wszystkich testowanych organizmów
powodował PREV-B2. Śmiertelność A. phomi, E. lanigerum i T. urticae już
w 1 dniu po aplikacji wyniosła odpowiednio 99,6 %, 93,7 % i 95,5 %. Również najwyższy współczynnik efektywności uzyskano po zastosowaniu PREV-B2. Dla A. phomi i T. urticae już po 1 dniu wynosił 95,5 %. Dla E. lanigerum
w 1 dniu wynosił 35,8 % jednak już po 3 dniu wzrósł do 97,4 %.
Słowa kluczowe: olejek pomarańczowy, aktywność owadobójcza
Abstract. In this study, laboratory tests of the influence of orange oil (PREV-B2) and a synthetic orange aroma on phytophages (T. urticae, A. phomi,
E. lanigerum) were conducted. The study was conducted under laboratory
condition in University of Agriculture in Krakow. Based on the results obtained, the efficiency coefficient was, as well as the mortality percentage. The
highest mortality rate of all the organisms tested was caused by PREV-B2.
Mortalities of A. phomi, E. lanigerum and T. urticae were respectively 99.6
%, 93.7 % and 95.5 % as early as 1 day after the application. Furthermore,
the highest efficiency coefficient was obtained for PREV-B2. For A. phomi
and T. urticae the figure was 95.5 % (after one day). For E. lanigerum the
value was 35.8 % after one day, but after 3 days it increased to 97.4 %.
Key words: orange oil, activity insecticide
101
Marta Leśniak, Maria Pobożniak, Michał Pniak
Wstęp
Rośliny uprawne każdego roku narażone są na masowe ataki agrofagów.
Podstawowym sposobem walki z nimi jest chemiczna ochrona, która
w ramach Integrowanej Ochrony powinna być zastępowana proekologicznymi metodami. Obecnie wzrasta zainteresowanie preparatami pochodzenia roślinnego, w tym olejkami eterycznymi, które pozyskiwane
są z różnych gatunków roślin. Znajdują one dzisiaj zastosowanie jako
naturalne insektycydy, repelenty lub jako antyfidanty, które ograniczają
rozwój szkodników [Burgieł i in. 2008]. Niektóre z nich charakteryzują
się również działaniem bakterio i grzybobójczym. Zaletą tych środków
jest to, że są przyjazne dla środowiska, nie kumulują się w nim oraz
ulegają relatywnie szybkiej biodegradacji [Górski i Piątek 2008].
Materiał i metody
Badania zostały przeprowadzone w laboratorium Katedry Ochrony
Roślin UR w Krakowie w 2012 roku. W doświadczeniu porównano
skuteczność działania olejku pomarańczowego o handlowej nazwie
PREV-B2 oraz syntetycznego aromatu pomarańczowego na mszycę
jabłoniową - Aphis phomi, bawełnicę korówkę - Eriosoma lanigerum
oraz przędziorka chmielowca - Teranychus urticae. PREV-B2 jest
środkiem o działaniu kontaktowym, zawierającym tłoczony na zimno
olejek pomarańczowy (CAS No. 8028-48-6), 4,2%), alkohol etoksylenowy (8,1 %) oraz bor (2,1%). W skład syntetycznego aromatu pomarańczowego wchodzą: środki aromatyzujące, woda oraz emulgatory
(guma arabska E 414, ksantanowa E 415), kwas mlekowy (E 270),
benzoesan sodu (E 211 < 0,1% m/m), barwniki (żółcień chinolinowa
E 104, żółcień pomarańczowa E 110), BHA (E 320).
Osobniki A. phomi i E. lanigerum wraz z materiałem roślinnym,
na którym żerowały zostały pobrane z ekologicznego sadu jabłoniowego z rejonu Sandomierza. W przypadku tych fitofagów były to
odpowiednio liście i pędy odmiany ‘Ligol’. Natomiast T. urticae wraz
liśćmi róży i bakłażana pochodził z uprawy szklarniowej UR. Materiał
roślinny w postaci pojedynczych liści rozkładano na zdezynfekowane
płytki Petriego, które wyłożono podwójną warstwą bibuły filtracyjnej.
W celu utrzymania odpowiedniej wilgotności oraz turgoru, ogonki
liści umieszczano dodatkowo w plastikowych koreczkach wyścielo102
Wpływ olejku pomarańczowego oraz syntetycznego pomarańczowego aromatu
nych watą celulozową, uprzednio zwilżoną wodą destylowaną. Z kolei
około 15 cm pędy jabłoni wstawiano do fiolek, które umieszczano
w izolatorach. Dla A. phomi i E. lanigerum doświadczenie przeprowadzono w 12, a dla T. urticae w 10 powtórzeniach. W doświadczeniu
uwzględniono również kontrolę, w której fitofagi nie były traktowane
żadnym preparatem. Testowane środki zaaplikowano jednokrotnie za
pomocą atomizera w postaci wodnego roztworu w stężeniu 0,4%. Ich
działanie na fitofagi sprawdzano w 1, 3 i 5 dniu po aplikacji.
Na podstawie uzyskanych wyników obliczono procent śmiertelności fitofagów oraz współczynnik efektywności preparatów wg wzoru
Hendersona – Tiltona [Henderson i Tilton 1955]. Wyniki poddane
zostały analizie statystycznej przy zastosowaniu testu Duncana na
poziomie istotności α = 0,05 (Statistica 10.0, Anova).
Wyniki i dyskusja
Preparat PREV-B2 w wysokim procencie ograniczał liczebność populacji mszycy jabłoniowej we wszystkich terminach obserwacji. Średnia
wartość efektywności tego preparatu w pierwszym, trzecim i piątym
dniu po jego aplikacji nie różniła się statystycznie i wahała się od 99,7
do 100 % (Tab. 1). Niższą skutecznością działania charakteryzował się
syntetyczny aromat pomarańczowy. Średnia wartość jego efektywności oscylowała ok. 56 % we wszystkich trzech terminach po aplikacji.
Po zastosowaniu PREV-B2 śmiertelność mszyc w pierwszym i trzecim
dniu wynosiła 99,7 %, a w piątym dniu osiągnęła wartość maksymalną
tj. 100 %. Z kolei syntetyczny aromat pomarańczowy spowodował
śmiertelność na poziomie 66,4 % w pierwszym dniu po jego zastosowaniu. W kolejnych terminach śmiertelność wzrastała osiągając wartość
80,4% w piątym dniu po aplikacji. W kontroli maksymalną śmiertelność
stwierdzono w piątym dniu obserwacji i wynosiła ona 45,6 % (Tab. 1).
Podobne wyniki uzyskali Górski i Kania [2010], którzy sprawdzali
wpływ olejku kolendrowego oraz olejku z liści pomarańczy (Petitgrain)
na śmiertelność mszycy ziemniaczanej występującej na tytoniu. Testowane olejki charakteryzowały się zbliżonym działaniem do olejku pomarańczowego (PREV-B2). W zwalczaniu Aulacorthum solani (Kalt.)
występującej na tytoniu szlachetnym, równie skuteczne okazały się:
olejek geraniowy, lawendowy oraz tymiankowy [Górski i Piątek 2009].
103
Marta Leśniak, Maria Pobożniak, Michał Pniak
Z kolei Górski i Tomczak [2010] wykazali 100 % śmiertelność A. solani
na oberżynie po zastosowaniu olejków: cytronelowego, paczulowego
i jałowcowego. W ograniczeniu liczebności Dysaphis plantaginea
(Pass.) występującej na jabłoni, skuteczny okazał się olejek otrzymany
z konopi siewnej [Górski i in. 2009]. W walce z Myzus persicae (Sulzer)
znaczący wpływ olejku rozmarynowego wykazał Masatoshi [1998].
Tab. 1. Skuteczność działania naturalnego olejku pomarańczowego (PREV-B2)
oraz syntetycznego aromatu pomarańczowego w zwalczaniu Aphis phomi (Deg.)
Preparat
Kontrola
PREV-B2
Aromat
pomarańczowy
Śmiertelność [ % ] (średnia
± SE)
Po 1
Po 3
Po 5 dniu
dniu
dniu
12,3 ±
6,6 c*
99,7 ±
0,2 a
66,4 ±
5,9 b
22,9 ±
7,3 c
99,7 ±
0,2 a
69,0 ±
4,6 b
45,6 ±
3,9 c
100,0 ±
0,0 a
80,4 ±
4,2 b
Efektywność (średnia ± SE)
Po 1
dniu
Po 3
dniu
Po 5 dniu
------
------
------
99,6 ±
0,2 a
56,6 ±
7,3 b
99,7 ±
0,2 a
54,1 ±
8,6 b
100,0 ±
0,0 a
58,4 ±
8,3 b
*Średnie wartości oznaczone różnymi literami w kolumnach różnią się istotnie przy
α ≤ 0,05
Wyższą skuteczność w zwalczaniu bawełnicy korówki wykazał
preparat PREV-B2 w porównaniu do syntetycznego aromatu pomarańczowego. Po pierwszym dniu średnia efektywność działania PREV-B2 wynosiła 35,8 %, jednak w kolejnych dniach obserwacji znacznie
wzrosła, uzyskując po trzecim i piątym dniu wartości: 97,4 % i 97,1 %
(Tab. 2). Najwyższą efektywność działania aromatu pomarańczowego
stwierdzono w pierwszym i piątym dniu obserwacji i wynosiła ona
około 35 %. Śmiertelność E. lanigerum już w pierwszym dniu po aplikacji PREV-B2 wynosiła 93,9 %, a w piątym dniu wzrosła aż do 96,9 %.
Aromat pomarańczowy w pierwszym dniu po aplikacji spowodował
śmiertelność 30,2 % bawełnicy korówki, która w piątym dniu wzrosła
do 64,5 %. Śmiertelność E. lanigerum w kontroli była bardzo niska
i nie przekraczała 4,6% (Tab. 2).
PREV-B2 wykazywał również wysoką efektywność działania
w stosunku do przędziorka chmielowca. W kolejnych trzech terminach obserwacji wynosiła ona odpowiednio: 95,5 %, 95,6 % i 95,4
%. Preparat ten powodował śmiertelność tego fitofaga w granicach
104
Wpływ olejku pomarańczowego oraz syntetycznego pomarańczowego aromatu
od 95,5 % w pierwszym dniu do 97,1 % w piątym dniu po aplikacji
(Tab. 3). Z kolei śmiertelność T. urticae w piątym dniu po zastosowaniu aromatu pomarańczowego była niższa o 32,1 % w porównaniu
z PREV-B2 i wyższa o 48,3 % w porównaniu do kontroli (Tab. 3). Podobnie kształtowała się efektywność działania aromatu pomarańczowego, która w pierwszym i trzecim dniu po aplikacji była o ok. 31 %,
a w piątym dniu o 44,6 % mniejsza w porównaniu do efektywności
działania PREV-B2 (Tab. 3).
Tab. 2. Skuteczność działania naturalnego olejku pomarańczowego (PREV-B2)
oraz syntetycznego aromatu pomarańczowego w zwalczaniu Eriosoma
lanigerum (Hasm.)
Preparat
Kontrola
PREV-B2
Aromat
pomarańczowy
Śmiertelność [ % ] (średnia
± SE)
Po 1
Po 3
Po 5
dniu
dniu
dniu
2,8 ±
1,9 c*
93,9 ±
3,1 a
30,2 ±
6,0 b
4,6 ±
2,4 c
97,3 ±
1,9 a
32,8 ±
6,8 b
2,9 ±
2,0 c
96,9 ±
2,1 a
64,5 ±
7,8 b
Efektywność (średnia ± SE)
Po 1
dniu
Po 3
dniu
Po 5 dniu
------
------
------
35,8 ±
5,6 a
35,7 ±
5,6 a
97,4 ±
1,9 a
29,9 ±
7,1 b
97,1 ±
2,0 a
35,5 ±
7,8 b
*opis tab. 1.
Tab. 3. Skuteczność działania naturalnego olejku pomarańczowego
(PREV-B2) oraz syntetycznego aromatu pomarańczowego w zwalczaniu
Teranychus urticae (Koch.)
Preparat
Kontrola
PREV-B2
Aromat
pomarańczowy
Śmiertelność [ % ] (średnia
± SE)
Po 1
Po 3
Po 5
dniu
dniu
dniu
0,0 ±
0,0* c
95,5 ±
2,2 a
65,8 ±
5,8 b
6,8 ±
3,1 c
95,7 ±
2,5 a
71,1 ±
7,8 b
20,7 ±
4,7 c
97,1 ±
1,7 a
69,0 ±
4,7 b
Efektywność (średnia ± SE)
Po 1
dniu
Po 3
dniu
Po 5 dniu
------
------
------
95,5 ±
2,2 a
64,1 ±
6,0 b
95,6 ±
2,5 a
64,4 ±
6,5 b
95,4 ±
2,8 a
50,8 ±
8,1 b
*opis tab. 1.
105
Marta Leśniak, Maria Pobożniak, Michał Pniak
W badaniach przeprowadzonych przez Górskiego i Piątek [2008],
śmiertelność T. urticae po zastosowaniu olejków eterycznych: miętowego, geraniowego, tymiankowego oraz lawendowego wynosiła 100
%. W porównaniu z uzyskanymi przez nasz zespół wynikami można
stwierdzić, że olejek pomarańczowy działa na przędziorka chmielowca
równie skutecznie, co olejki wymienione w badaniach powyżej cytowanych autorów.
Wnioski
Preparat PREV-B2, zawierający naturalny olejek pomarańczowy, w odniesieniu do kontroli wykazał wysoką efektywność w zwalczaniu
mszycy jabłoniowej, bawełnicy korówki oraz przędziorka chmielowca.
Syntetyczny aromat pomarańczowy w odniesieniu do kontroli
wykazał niską efektywność w zwalczaniu bawełnicy korówki, nieco
wyższą w stosunku do mszycy jabłoniowej, a najwyższą w stosunku
do przędziorków.
Bibliografia
Burgieł Z. Tomaszkiewicz – Potępa A. Vogt O. Burgieł M. 2008. Fungistatyczne własności ekstraktów z nasion wybranych roślin należących
do rodziny Apiaceae. Progress in Plant Protection / Postępy w Ochronie
Roślin, 48 (2): 701 – 705.
Górski R. Piątek H. 2008. Skuteczność działania naturalnych olejków
eterycznych w zwalczaniu przędziorka chmielowca Tetranychus urticae
(Koch.) występującego na fasoli karłowej. Progress in Plant Protection
/ Postępy w Ochronie Roślin, 48 (4): 1348 – 1350.
Górski R. Piątek H. 2009. Wpływ naturalnych olejków eterycznych na śmiertelność mszycy ziemniaczanej Aulacorthum solani (Kalt.) występującej
na tytoniu szlachetnym. Progress in Plant Protection / Postępy w Ochronie Roślin, 49 (4): 2010 – 2012.
Górski R. Kania A. 2010. Wpływ olejków kolendrowego i petitgrain na śmiertelność mszycy ziemniaczanej Aulacorthum solani (Kalt.) występującej
na tytoniu. Progress in Plant Protection / Postępy w Ochronie Roślin,
50 (3): 1530 – 1532.
Górski R. Szklarz M. Kaniewski R. 2009. Skuteczność olejku eterycznego
z konopi siewnej w zwalczaniu mszycy jabłoniowo-babkowej Dysaphis
106
Wpływ olejku pomarańczowego oraz syntetycznego pomarańczowego aromatu
plantaginea (Pass.) występującej na jabłoni. Progress in Plant Protection / Postępy w Ochronie Roślin, 49 (4): 2014 – 2016.
Górski R. Tomczak M. 2010. Przydatność naturalnych olejków eterycznych
w zwalczaniu mszycy ziemniaczanej Aulacorthum solani (Kalt.)
występującej na oberżynie. Ecological Chemistry and Engineering, 17
(3): 345 – 349.
Henderson C.F. Tilton E.W. 1955. Tests with acaricides against the brow
wheat mite, J. Econ. Entomol. 48: 157-161.
Hołdaj M. Olszak R. Gorzka D. 2012. Badanie skuteczności najczęściej stosowanych aficydów w walce z mszycą jabłoniową (Aphis pomi De Geer,
Aphididae, Homoptera) w uprawach jabłoni na terenie Polski. Progress
in Plant Protection / Postępy w Ochronie Roślin, 52 (2): 226 – 228.
Masatoshi H. 1998. Repellency of rosemary oil against Myzus persicae in
a laboratory and in a screen house. J. Chem. Ecology, 24: 1425–1432.
Adres do korespondencji:
mgr inż. Marta Leśniak
dr hab.inż. Maria Pobożniak
dr inż. Michał Pniak
Katedra Ochrony Roślin
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
Marta Leśniak
ul. Fabryczna 3/ 14
31 - 553 Kraków
Tel. 664824202
Opiekun pracy: dr hab. inż. Maria Pobożniak
107
Gabriela Machaj
EPISTEME
22/2014, t. III
s. 109–115
ISSN 1895-2241
MAPOWANIE REJONU GENOMU MARCHWI
ISTOTNEGO DLA PROCESU UDOMOWIENIA
LOCAL MAPPING OF A CARROT GENOMIC REGION
INVOLVED IN DOMESTICATION
Abstrakt. Marchew uprawna (Daucus carota subsp. sativus Hofmm.) jest
jednym z najważniejszych warzyw korzeniowych uprawianych na świecie.
Może swobodnie krzyżować się z powszechnie występującą marchwią dziką.
Niedawno opisano polimorficzne miejsce zlokalizowane na chromosomie
2, które z dużą dokładnością różnicuje marchew dziką i uprawną. Region
genomu (CULT) otaczający to polimorficzne miejsce prawdopodobnie bierze udział w warunkowaniu cech związanych z udomowieniem marchwi.
Populację mapującą F2 wyprowadzono przez skrzyżowanie marchwi dzikiej
(Daucus carota L. subsp. commutatus) z marchwią uprawną (linia 2874B).
Mapę genetyczną sporządzono w oparciu o wyniki genotypowania 32 loci
u 169 roślin populacji F2. Dwadzieścia osiem loci zlokalizowanych było
w rejonie CULT, spośród nich, 27 weryfikowało insercję transpozonów
MITE. Posłużyły one do skonstruowania lokalnej mapy chromosomu 2 oraz
porównania dystansu fizycznego i genetycznego markerów.
Słowa kluczowe: CULT, mapowanie, marchew, MITE, udomowienie
Summary. Cultivated carrot (Daucus carota subsp. sativus Hofmm.) is one
of the most important vegetables grown in the world. Cultivated and wild
carrots are widespread all over the world and can easily hybridize. Recently,
researchers described a polymorphic site localized on chromosome 2, which
with high accuracy differentiated cultivated and wild carrots. The genomic
region named CULT, surrounding the polymorphic site, is very likely to be
involved in carrot domestication. We derived F2 population from a cross-pollination of a wild carrot (Daucus carota L. subsp. commutatus) with
a cultivated carrot (line 2874B). We genotyped 32 loci in 169 individuals.
Twenty eight of them where located in the CULT region and of those 27 were
MITE insertion polymorphisms. Polymorphic sites were used to construct
a local map of chromosome 2 to compare genetic and physical distances.
Key words: carrot, CULT, domestication, local mapping, MITE
109
Gabriela Machaj
Wstęp
Marchew uprawna (Daucus carota subsp. sativus) jest najważniejszym
pod względem ekonomicznym warzywem korzeniowym uprawianym
na terenie Unii Europejskiej. Marchew uprawna może swobodnie
krzyżować się z marchwią dziką, występującą powszechnie we wszystkich regionach świata o klimacie umiarkowanym [Rong i in. 2013].
Swobodny przepływ genów spowodował, że mimo relatywnie małego
rozmiaru genomu (ok. 480 Mb) [Simon i in. 1997] zmienność genetyczna obu typów marchwi kształtuje się na bardzo wysokim poziomie
[Bradeen i in. 2002].
Poznanie struktury zmienności oraz możliwość rozróżnienia
form dzikich i uprawnych marchwi są bardzo ważnymi zagadnieniami dla rozwoju nowoczesnej hodowli tego warzywa [Macko-Podgórni i in. 2013]. Grzebelus i in. [2013] donieśli o wykorzystaniu
platformy DArT (Diversity Array Technology) do identyfikacji
markerów udomowienia. Badając osobniki reprezentujące odmiany dzikie oraz uprawne ze wschodniej i zachodniej puli genowej,
zidentyfikowali 27 markerów wykazujących związek z procesem
domestykacji. Marker crPt-895548, zmapowany do chromosomu
2, cechował się najwyższym współczynnikiem determinacji i z dużą
dokładnością różnicował marchew dziką i uprawną [Grzebelus i in.
2013]. Został on następnie przekonwertowany w kodominujący,
wydajny i łatwy do amplifikacji marker CULT (ang. cultivated)
typu CAPS (ang. cleaved amplified polymorphic site). Marker ten
jest zlokalizowany na chromosomie 2, w pierwszym intronie genu
kodującego hipotetyczne białko wiążące się z DNA. Marker CULT
może być z łatwością implementowany do screeningu dzikich
i uprawnych marchwi pod kątem ich mieszańcowego charakteru
[Macko-Podgórni i in. 2013]. Inny powszechnie stosowany system
markerowy bazuje na polimorfizmie insercji ruchomych elementów
genetycznych (transpozonów). Przykładowo do badania zmienności populacji i mapowania genomu marchwi wykorzystano wysokowydajny system Transposon Display oparty na polimorfizmie
insercji transpozonów MITE [Macko i Grzebelus 2008, Grzebelus
i Simon 2009]. Transpozony MITE (ang. minature inverted-repeat
transposable elements) należą do klasy II transopozonów DNA.
Opisano je jako małe (do 600 pz), nieautonomiczne ruchome ele110
Mapowanie rejonu genomu marchwi istotnego dla procesu udomowienia
menty genetyczne, nieposiadające funkcji kodujących. Występują
one powszechnie w dużej liczbie kopii w genomach eukariotycznych – do kilkudziesięciu tysięcy kopii na genom haploidalny
[Grzebelus i in. 2009, Yaakov i in. 2012].
Celem niniejszej pracy było lokalne mapowanie chromosomu
2 marchwi, zawierającego czynnik genetyczny odpowiedzialny za udomowienie marchwi [Grzebelus i in. 2013]. W tym celu wykorzystano
opracowany przez Macko-Podgórni i in. [2013] marker CULT-CAPS
oraz zestaw markerów insercji transpozonów MITE. Przeprowadzone
doświadczenia pozwoliły na ocenę siły sprzężenia oraz porównanie
dystansu genetycznego i fizycznego analizowanych markerów.
Materiał i metody
Populacja mapująca obejmowała 169 roślin pokolenia F2. Została
ona wyprowadzona przez samozapylenie jednej z roślin F1 mieszańca
marchwi dzikiej (Daucus carota L. subsp. commutatus) z marchwią
uprawną (linia 2874B). DNA izolowano z liści według zmodyfikowanej metody CTAB. DNA amplifikowano przy użyciu 32 par starterów
(tab. 1, dane niepublikowane). Mieszanina reakcyjna zawierała 20 ng
genomowego DNA, 0,5 µM startera forward, 0,5 µM startera reverse,
0,25 mM dNTPów, 1U polimerazy DreamTaq (Thermo Scientific) oraz
bufor 1×DreamTaq Green. PCR prowadzono według profilu: 94°C
(2min), 30 cykli: 94°C (30s), 56°C (markery MITE) lub 57°C (marker
CULT) (30s), 68°C (1 min), końcowa elongacja: 68°C (6 min). Produkty amplifikacji markera CULT (CAPS) trawiono w 37°C przez 30 min
za pomocą 5U enzymu PstI (Thermo Scientific) w obecności buforu
1×Fast Digest Green Buffer. Produkty PCR i trawienia restrykcyjnego
rozdzielano w 1% żelu agarozowym z dodatkiem bromku etydyny
a następnie wizualizowano w świetle UV.
Do mapowania posłużyły wyniki amplifikacji starterów wykazujących polimorfizm (tab. 1). Mapowanie chromosomu 2 przeprowadzono przy użyciu programu JoinMap. Dystans fizyczny określono na
podstawie danych sekwencyjnych (dane niepublikowane).
111
ATGTGGCGGTCCTTGTTAAA
cl82dh.5-r
CAAAGTGCAAAGCAAAAGCA
cl82dh.5-f
AAAGCTTAAAGCGAAGGCAAT
AATCATGATGCGGCAGTACA
cl67dh.4-f
cl67dh.4-r
5
GGACTTAGTTGGGACAAAGGTG
cl64dh.7-r
10
CCATAACCTTTTCCGGTTTC
cl82dh.4-r
AGGACCCGCGGTATTAAGAT
cl82dh.4-f
AAACGGTCAACAACTAGCGATT
cl64dh.7-f
4
CCAGCAGTTAATGCACAACG
cl64dh.3-r
9
GGTACACCACTTTATTGCCAGA
cl82dh.2-r
TTTTGGGATTAGCTGGGTTG
cl82dh.2-f
ATTTGCATCAGAGCGAGTCC
cl64dh.3-f
3
TGTTGGCAACTTTCTTCCAA
cl64dh.1-r
8
TCTTTTTCGATTCTACTGAAACCA
cl82dh.1-r
TGTTGCTGCAAGGAAACAAG
cl82dh.1-f
GGAGATGAGCATGCATTTTG
cl64dh.1-f
2
TCCTGCCGAAGTATTCATCC
CULTex1i1R
7
GGGATGGTGAGGTTGAGAGA
cl69dh.1-r
GGCACCAACTTACACACCAA
cl69dh.1-f
TGGATGGAAGAGAGGGAATG
112
1
CULTex1i1F
6
Nazwa startera
Nr
Sekwencja
5’à3’
Nazwa startera
Nr
Tab. 1. Wykaz par starterów generujących produkty polimorficzne
Sekwencja
5’à3’
Gabriela Machaj
Wyniki
i Dyskusja
Dziesięć z analizowanych loci generowało
polimorficzne produkty
(tab. 1). Marker CULT
(ryc. 1) zróżnicował
analizowaną populację
na rośliny posiadające wariant dziki (47),
uprawny (33) i o profilu heterozygotycznym
(89). Stosunek wyróżnionych genotypów był
w przybliżeniu równy
1:2:1. Potwierdza to
opisaną przez Grzebelusa i in. [2013] oraz
Macko-Podgórni i in.
[2013] wysoką skuteczność markera CULT.
Wyniki uzyskane dla markera CULT
wraz z wynikami dla
dziewięciu markerów
insercji transpozonów
MI TE posłużyły do
skonstruowania lokalnej mapy chromosomu
2. Długość genetyczna
zmapowanego odcinka
wyniosła 5,5 cM, natomiast odległość fizyczna najbardziej oddalonych loci ok. 1,36 Mb
(ryc. 2). Wyliczono, iż
na analizowanym od-
Mapowanie rejonu genomu marchwi istotnego dla procesu udomowienia
Ryc. 1. Wynik genotypowania roślin populacji mapującej marchwi (W10-1
– W10-16) markerem CULT; a – wariant uprawny, b – wariant dziki, h –
heterozygota, M – wzorzec wielkości fragmentów DNA
cinku na 1cM dystansu genetycznego przypada ok. 0,25 Mb. Jednak
częstość rekombinacji w obrębie analizowanego rejonu nie jest stała
(ryc. 2). Na odcinku pomiędzy loci CL64.3 a CL69.1 mamy do czynienia z wysoką częstością rekombinacji – na 1 cM przypada ok. 0,14 Mb.
Natomiast pomiędzy kolejnymi loci: CL69.1, CL82.1, CL67.4, CULT
oraz CL82.2, nie stwierdzono rekombinacji. Odległość fizyczna (0,25
Mb) pomiędzy skrajnymi loci tej grupy jest zbliżona do odległości
pomiędzy loci CL64.3 i CL69.1. W przypadku kolejnych odcinków
pomiędzy loci: CL82.2 i CL82.5, CL82.5 i CL64.7, CL64.7 i CL82.4 oraz
CL82,4 i CL64.1 na jednostkę odległości genetycznej (1cM) przypada
odpowiednio: 1,18 Mb, 0,35 Mb, 0,13 Mb i 0,22 Mb. Brak rekombinacji loci w sąsiedztwie markera CULT sugeruje brak homologii tego
regionu w genotypach rodzicielskich (marchew dzika i uprawna).
Lokalizacja markera CULT w pierwszym intronie genu kodującego białko, którego prawdopodobna funkcja związana jest z regulacją
transkrypcji lub procesem organizowania chromatyny, wskazuje na
jego związek z procesem udomowienia marchwi [Macko-Podgórni
i in. 2013]. Ponadto pomiary proporcji szerokości ramienia korzenia
marchwi do szerokości głowy korzeni roślin populacji mapującej
(dane niepublikowane) wskazują na wyższy stosunek mierzonych
parametrów u roślin z wariantem uprawnym (genotypowanie CULT-CAPS) niż u roślin posiadających wariant dziki. Wskazuje to na możliwy udział czynników genetycznych sprzężonych z markerem CULT
w procesie przyrostu korzeni na grubość.
Przeprowadzone analizy stanowią bazę do dalszych analiz genetycznych chromosomu 2 marchwi i potwierdzają wytypowanie genu,
113
Gabriela Machaj
w obrębie którego znajduje się marker CULT jako genu kandydującego,
biorącego udział w kształtowaniu cechy (cech) typowych dla marchwi
uprawnej.
Ryc. 2. Wykres zależności odległości genetycznej i fizycznej markerów
zmapowanych do chromosomu 2 marchwi
Wnioski
Mapowanie genetyczne rejonu CULT wykazało brak rekombinacji
pomiędzy loci CL.69.1, CL82.1, CL67.4, CULT oraz CL82.2 na odcinku
o długości ok. 0,25 Mb. Wskazuje to na brak homologii tego regionu
u marchwi uprawnej (linia2874B) i marchwi dzikiej (Daucus carota L.
subsp. commutatus).
Bibliografia
Bradeen JM. Bach IC. Briard M. le Clerc V. Grzebelus D. Senalik DA. Simon
PW 2002. Molecular diversity analysis of cultivated carrot (Daucus carota L.) and wild Daucus populations reveals a genetically nonstructured composition. J Am Soc Hort Sci, 127: 383-391.
114
Mapowanie rejonu genomu marchwi istotnego dla procesu udomowienia
Grzebelus D. Simon PW. 2009. Diversity of DcMaster-like elements of the
PIF/Harbinger superfamily in the carrot genome. Genetica, 135: 347353.
Grzebelus D. Gładysz M. Macko-Podgórni A. Gambin T. Golis B. Rakoczy
R. Gambin A. 2009. Population dynamics of miniature inverted-repeat
transposable elements (MITEs) in Medicago truncatula. Gene, 448:
214-220.
Grzebeus D. Iorizzo M. Senalik D. Ellison S. Cavagnaro P. Macko-Podgorni
A. Heller-Uszynska K. Kilian A. Nothnagel T. Simon PW. Baranski R.
2013. Diversity, genetic mapping, and signatures of domestication in
the carrot (Daucus carota L.) genome, as revealed by Diversity Array
Technology (DArT) markers. Mol Breeding, 33: 625-637
Macko A. Grzebelus D. 2008. DcMaster transposon display markers as
a tool for diversity evaluation of carrot breeding materials and for
hybrid seed purity testing. J Appl Genet, 49: 33-39.
Macko-Podgórni A. Iorizzo M. Smółka K. Simson PW. Grzebelus D. 2013.
Conversion of a Diversity Array Technology marker differentiating wild
and cultivated carrots to a codominant Cleaved Amplified Polymorphic
Site marker. Acta Biochim Pol, (zgłoszony do druku).
Rong J. Xu S. Meirmans PG. Vrieling K. 2013. Dissimilarity of contemporary and historical gene flow in a wild carrot (Daucus carota) metapopulation under contrasting levels of human disturbance: implications
for risk assessment and management of transgene introgression. Ann
Bot, 112: 1361-1370.
Simon PW. Rubatzky VE. Bassett MJ. Strandberg JO. White JM. 1997.
B7262, Purple carrot inbred. Hort Sci, 32: 146-147.
Yaakov B. Ceylan E. Domb K. Kashkush K. 2012. Marker utility of miniature
inverted-repeat transposable elements for wheat biodiversity and evolution. Theor Appl Genet, 124: 1365-1373.
Badania realizowane w ramach projektu nr. 2012/05/B/NZ9/03401 finansowanego go przez Narodowe Centrum Nauki.
Adres do korespondencji:
mgr inż. Gabriela Machaj
Instytut Biologii i Biotechnologii Roślin
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
Opiekun naukowy: dr hab. inż. Dariusz Grzebelus, prof. UR
115
Magdalena Malinowska
Elżbieta Sikora
Jan Ogonowski
EPISTEME
22/2014, t. III
s. 117–122
ISSN 1895-2241
ANALYTICAL METHODS IN THE IDENTIFICATION
OF TRITERPENES ISOLATED FROM BIRCH BARK
Metody analityczne w oznaczaniu triterpenów
wyizolowanych z kory brzozy
Abstract. Birch is one of the most popular trees in our geographical region.
Its resistance to difficult conditions and fast growth make it a perfect tree
for our climate. The white-coloured birch bark contains high concentration
of pentacyclic triterpenes. Due to the presence of triterpenes, birch bark is
used for the treatment of skin diseases, infections and inflammations. The
biological activity of the triterpenes is very diversified and many studies
have already confirmed the following therapeutic effects: anti-inflammatory, antimicrobial, antiviral, antifungial, immunomodulatory, and hepatoprotective. The active compounds are obtained by the extraction of birch
bark using various, mainly organic, solvents. The article presents methods
for a lupeol, one of the extracted triterpene alcohol, identification. Obtained results show effective way of analyzing lupeol concentration and its
purity in birch bark extracts.
Key words: birch bark, extraction, triterpenes, lupeol, Thin Layer Chromatography, UV/VIS, IR, 1H NMR
Abstrakt. Brzoza brodawkowata (Betula pendula Roth) należy do jednych
z najbardziej popularnych gatunków drzew w naszym rejonie geograficznym. Jej niezwykła wytrzymałość na trudne warunki środowiskowe, a także
szybki wzrost czynią ją idealnym drzewem w naszym klimacie. Charakterystyczna, biała kora brzozy zawiera dużą ilość pentacyklicznych związków
triterpenowych. Ze względu na obecność triterpenów, kora brzozy stosowana jest w leczeniu chorób skóry, jej stanów zapalnych i infekcji. Aktywność
biologicznie czynna związków triterpenowych jest bardzo zróżnicowana
i wiele dotychczasowych wyników badań potwierdza ich działanie przeciwzapalne, przeciwdrobnoustrojowe, przeciwwirusowe, przeciwgrzybiczne,
immunostymulujące i hepatochronne. W artykule przedstawiono metody
identyfikacji lupeolu, jednego z ekstrahowanych alkoholi triterpenowych.
Uzyskane wyniki pokazują efektywną drogę analizy stężenia lupeolu, a także jego czystości w ekstrakcie brzozowym.
Słowa kluczowe: kory brzozy, ekstrakcja, triterpeny, lupeol, chromatografia
cienkowarstwowa, UV / VIS, IR, 1H NMR
117
Magdalena Malinowska
Introduction
The white birch is widespread in the northern latitudes of the world,
it represents an abundant and currently under-utilized natural resource, but the use of its bark is limited. It is only used as a low-value
fuel source in solid wood product industries [Hytonen & Issakainen
2001]. On the other hand, birch bark contains high concentration of
triterpenes – pentacyclic compounds which are the products of plant
metabolism (Fig. 1). The amount of triterpene compounds in dry
extract of birch bark is up to 80% (m/m) [Abyshev et al. 2007].
CH2
CH2
H 3C
CH2
H 3C
H 3C
H
CH3
CH3
CH3
CH3
H
CH3
HO
H 3C
H
CH3
lupeol
HO
H
H3C CH3
betulin
CH3
H 3C
CH3
H
C
H
CH2
OH
CH3
CH3
H
CH3
HO
H
H3C CH3
betulinic acid
C
OH
CH3
O
H
CH3
HO
CH3
OH
O
CH3
H
H3C CH3
oleanolic acid
Fig. 1. Structures of main triterpenes contained in birch bark
There is a growing interest in natural triterpene compounds, due
to their wide spectrum of biological activities. They have antioxidant
[Wang et al. 2010], anticancer [Laszczyk 2009], antibacterial [Copp &
Pearce 2007; Fontanay et al. 2008], antivirus [Gong et al. 2004], [Fotie
et al. 2006] and hepatoprotective [Szuster-Ciesielska et al. 2011] activity.
Triterpenes can be obtained from birch bark mainly by extraction
[Qi-he et al. 2009]. Although the isolation and identification of various triterpenes from birch bark have been described by several studies
[St-Pierre et al. 2003; Diouf et al. 2009]. Moreover, few quantification
protocols have been described so far [Abyshew et al. 2007]. To date,
some analytical methods have been reported on the analysis of the
various bioactive ingredients in the birch bark, including betulin,
betulinic acid, lupeol and oleanolic acid [Zhao et al. 2007].
The aim of this study was to develop a method for the simultaneous determination of lupeol, one of the main triterpene obtained
from birch bark using Thin Layer Chromatography (TLC), UV, IR and
1
H NMR detection.
118
Analytical methods in the identification of triterpenes isolated from birch bark
Material and methods
The analysed samples were prepared by dissolving 1 mg of lupeol (Natchem s.c.) in 1 ml of dichloromethane (POCH S.A.). The purity of
lupeol was determined using Thin Layer Chromatography (TLC) method. Before development, TLC plates (Polygram Sil G/UV 254, Macherey Nagel) were sprayed with 50% water solution of phosphoric acid
(Chempur) with addition of 10% isopropanol solution of vanillin (Sigma
Aldrich) (10:1 v/v). The mobile phase for TLC plate were composed of
chloroform (Chempur) and ethyl acetate (POCH S.A.) (10:1 v/v). Triterpenes become visible after heating the plate in 100°C for 2-3 minutes.
TLC plates were integrated with TLSee Demo program version 2.0.
The melting point of crystalic lupeol was measured at room temperature by Stuart SMP10.
UV/VIS spectrum was obtained using Macherey Nagel Nanocolor
UV/VIS Spectrophotometer. The applied concentration of lupeol amounted to 2 mg/cm3; methanol was used as a solvent and as a blank.
The structure of lupeol was confirmed using apparatus Mercury-VX 300 MHz, Varian. The samples were dissolved in CDCl3. Moreover,
IR spectrum has was measured for lupeol solution in chloroform.
Results and discussion
TLC plates gave a clear chromatogram showing pure lupeol with the
retention time of 0.65. No impurities have been observed after integration of the plate with TLSee Demo 2.0. (Fig. 2).
Fig. 2. TLC plate integration using TLSee Demo 2.0.
119
Magdalena Malinowska
The melting point of lupeol was 213-215°C and the absorbance
maximum was 210 nm, which is compatible with the literature data
[Jain & Bari 2010].
The structure of the triterpene was confirmed by 1H NMR and IR
spectrum. The results are presented in Table 1.
Tab. 1. Spectroscopic data of lupeol
Spectroscopic method
Result data
UV max. absorption λ
210 nm
IR: (CHCl3)
3311, 2943, 2872, 1638, 1452, 1467, 1189, 1043, 993,
746, 688 cm-1
H NMR: (CDCl3)
δ4.68(s, 1H, H-29) δ4.56(s, 1H, H-27) δ2.36(m, 1H
H-19) δ1.90(m, 1H, H-21) δ1.68(s, 3H, H-30) δ1.61(t,
1H, H-13) δ1.50(d, 1H, H-11) δ1.46(d, 1H, H-14)
δ1.38(q, 1H, H-6) δ1.35(s, 1H, H-21) δ1.32(q, 1H, H-12)
δ1.27(s, 1H, H-9) δ1.02(s, 1H, H-23) δ0.98(s, 3H, H-23)
δ0.96(s, 3H, H-27) δ0.93(t, 1H, H-18) δ0.84(s, 3H, H-25)
δ0.78(s, 3H, H-28)
1
The IR spectrum shows very intensive broad band at 3311 cm-1
and less intense band at 1189 and 688 cm-1 , which is characteristic for
the O-H bond vibrations of hydroxyl group. Moreover, we can observe
C-H vibrations of the unsaturated bond at 993 cm-1. The corresponding C=C vibrations were shown around 1638 cm-1 as low-intense
band. The stretching and bending vibrations of methyl part were noticed by the intense band 2950 cm-1 and medium intense band at 1467
cm-1. The vibration of the methyl groups was shown by the bands at
2843 cm-1 and at 1452 cm-1. The moderately intense band at 746 cm-1
was attributed to the rocking movement of the methyl groups. The
corresponding C-C vibration was shown as weak band at 1043 cm-1.
In lH-NMR spectrum of lupeol H-29 and H-27 olefinic protons are
showed as multiplets at δ 4.68 and δ 4.56, respectively. H-19 proton is
showed at δ 2.36 as multiplet, H-21 proton appears also as multiplet
at δ 1.90. H-30 proton is visible at δ 1.68, H-13 proton is showed as
triplet at δ 1.61. H-11 and H-12 protons appear as dublets at δ 1.50
and δ 1.46 respectively. We can also see H-6 proton at δ 1.38 and H-12
proton at δ 1.32, both as multiplets. H-21, H-25 and H-28 protons
are visible as singlets at δ 1.35, δ 0.84 and δ 0.78 respectively. Methyl
protons also appear at δ 1.27, δ 1.02, δ 0.98, δ 0.96 and δ 0.93 (3H
120
Analytical methods in the identification of triterpenes isolated from birch bark
each, s, CH3). These assignments are compatible with the literature
data for the structure of lupeol [Imam et al. 2007].
Conclusion
TLC is an efficient method for determining triterpenes purity. Melting
point and the maximum absorbance of the compounds are an additional information about their identity, but they have to be compared to
the literature data. The structure of the triterpenes can be confirmed
using IR and NMR spectroscopy. All of the applied analysis methods
can be used to determine quantity and quality of triterpene compounds obtained from birch bark.
Ackowledgements
The research (work) was supported by the European Union through
the European Social Fund within „Cracow University of Technology
development program — top quality teaching for the prospective
Polish engineers; University of the 21st century” project (contract no.
UDA-POKL.04.01.01-00-029/10-00).
Bibliography
Abyshev A. Z., Agaev E.M., Guseinov A.B. 2007. Studies of the chemical
composition of birch bark extracts (Cortex betula) from the Betulaceae
family. Pharmaceutical Chemistry Journal, 41(8): 22-26.
Co M., Zettersten C., Nyholm L., Sjöberg P.J.R., Turner C. 2012. Degradation
effects in the extraction of antioxidants from birch bark using water at
elevated temperature and pressure. Analytica Chimica Acta, 716: 40–48.
Copp B.R., Pearce A.N. 2007. Natural product growth inhibitors of Mycobacterium tuberculosi. Natural Products Report, 24: 278-297.
Diouf P.N., Stevanovic T., Boutin Y. 2009. The effect of extraction process
on polyphenol content, triterpene composition and bioactivity of
yellow birch (Betula alleghaniensis Britton) extracts. Industrial Crops
and Products, 30: 297–303.
Fontanay S., Grare M., Mayer J., Finance Ch, Duval R.E. 2008. Ursolic, oleanolic and betulinic acids: Antibacterial spectra and selectivity indexes.
Journal of Ethnopharmacology, 120(2): 272–276
Fotie J., Scott Bohle D., Leimanis L.M., Georges E., Rukunga G., Nkengfack A.E.
2006. Lupeol Long-Chain Fatty Acid Esters with Antimalarial Activity
from Holarrhena floribunda, Journal of Natural Products, 69(1): 62–67.
121
Magdalena Malinowska
Gong Y., Raj K.M., Luscombe C.A., Gadawski I., Tam T., Chu J., Gibson D.,
Carlson R., Sacks S.L. 2004. The Synergistic Effects of Betulin with
Acyclovir against herpes simplex viruses. Antiviral Research, 64(2):
127-130.
Hytonen J., Issakainen J. 2001. Effect of repeated harvesting on biomass
production and sprouting of Betula pubescens. Biomass and Bioenergy, 20: 237-245.
Laszczyk M.N. 2009. Pentacyclic triterpenes of the lupane, oleanane and ursane group as tools in cancer therapy. Planta Medica, 75: 1549–1560.
Imam S., Azhar I., Hasan M.M., Ali M.S., Ahmed S.W. 2007. Two triterpenes
lupanone and lupeol isolated and identified from Tamarindus indica
linn. Pakistan Journal of Pharmaceutical Sciences, 20: 125-127.
Jain P.S., Bari S.B. 2010. Isolation of Lupeol, Stigmasterol and Campesterol
from Petroleum Ether Extract of Woody Stem of Wrightia tinctoria.
Asian Journal of plant Sciences, 9(3): 163-167.
Qi-he C., Ming-liang F., Jin L., Hai-feng Z., Guo-qing H., Hui R. 2009. Optimization of ultrasonic-assisted extraction (UAE) of betulin from white
birch bark using response surface methodology. Ultrasonics Sonochemistry, 16: 599–604.
St-Pierre F., Achim A., Stevanovic T. 2003. Composition of ethanolic extracts
of wood and bark from Acer saccharum and Betula alleghaniensis trees
of different vigor classes. Industrial Crops & Products, 41: 179-187.
Szuster-Ciesielska A., Plewka K., Daniluk J., Kandefer-Szersze M. 2011.
Betulin and betulinic acid attenuate ethanol-induced liver stellate cell
activation by inhibiting reactive oxygen species (ROS), cytokine (TNF-,
TGF-) production and by influencing intracellular signaling, Toxicology, 280: 152–163.
Wang X., Ye X., Liu R., Chen H.L., Bai H., Liang X., Zhang X.D., Wang Z., Li
W., Hai C.X. 2010. Antioxidant activities of oleanolic acid in vitro: possible role of Nrf2 and MAP kinases, Chemico-Biological Interactions,
184: 328–337.
Zhao G., Yan W., Cao D. 2007. Simultaneous determination of betulin and
betulinic acid in white birch bark using RP HPLC. Journal of Pharmaceutical and Biomedical Analysis, 43: 959–962.
Adres do korespondencji:
mgr inż. Magdalena Malinowska
Institute of Organic Chemistry and Technology
Chemical Technology and Engineering Department
Cracow University of Technology
e-mail: [email protected]
Supervisors: dr inż. Elżbieta Sikora, prof. dr hab. inż. Jan Ogonowski
122
Ewa Muszyńska
Barbara Piwowarczyk
Anna Kołton
Monika Czaja
EPISTEME
22/2014, t. III
s. 123–130
ISSN 1895-2241
Effect of nitric oxide and hydrogen
peroxide on seed germination and enzymes
activity in Avena fatua seedlings under
cadmium stress
Wpływ tlenku azotu i nadtlenku wodoru
na kiełkowanie nasion i aktywność enzymów
w sadzonkach Avena fatua pod wpływem stresu
kadmu
Abstract. The aim of this study was (1) to evaluate the exogenous NO and
H2O2 application on the Avena fatua seed germination, and (2) to determine
the effect of examined compounds on the activity of antioxidant enzymes
performing protective functions under cadmium stress. Although the treatment of A. fatua seeds with SNP (a donor NO) and H2O2 did not influence
significantly on their germination, the multiple increase in the catalase and
peroxidase activity after 48h and 72h were observed. In contrast, the activity of superoxide dismutase decreased about half after this time in comparison to activity determined after 24 h.
Key words: NO, SNP, H2O2, CAT, POD, SOD, seed germination, cadmium ions
Abstrakt. Celem prezentowanej pracy było określenie wpływu NO i H2O2
na (1) kiełkowanie ziarniaków Avena fatua oraz (2) aktywność enzymów
antyoksydacyjnych, biorących udział w zmniejszaniu wrażliwości otrzymanych siewek na obecność jonów kadmu. Chociaż traktowanie nasion A. fatua SNP (donor NO) oraz H2O2 nie wpłynęło istotnie na ich kiełkowanie, po
upływie 48 h i 72 h od wysiewu stwierdzono wzrost aktywności katalazy
i peroksydazy w badanych ziarniakach. Przeciwnie, po tym czasie aktywność dysmutazy ponadtlenkowej obniżyła się o prawie połowę w stosunku
do aktywności ustalonej po 24 h.
Słowa kluczowe: NO, SNP, H2O2, CAT, POD, SOD, kiełkowanie nasion, jony
kadmu
123
Ewa Muszyńska, Barbara Piwowarczyk, Anna Kołton, Monika Czaja
INTRODUCTION
Nitric oxide (NO) and hydrogen peroxide (H2O2) as molecules of high
biological activity are involved in the regulation of a number of metabolic processes. These molecules influence on dormancy and seeds germination [Gniazdowska and Bogatek 2007, Barba-Espin et al. 2010]. Both,
NO and H2O2 play also an important role in the response of plants to
abiotic stress. They have many positive functions at low concentrations.
In turn, their high concentration observed during a sudden production
of reactive oxygen species (ROS) results in a number of cell damages
[Krasuska et al. 2011, Olko and Kujawska 2011, Shi et al. 2012]. Numerous of various stressors, including heavy metal ions, lead to rapid
production and accumulation of ROS in the cells [Karuppanapandian et
al. 2011]. Plants, in the response to emerging oxidative stress, trigger
a series of metabolic reactions that prevent the negative effects caused
by increased levels of ROS. One of the protection mechanisms is intensified activity of antioxidant enzymes such as catalase (CAT), peroxidase
(POD) and superoxide dismutase (SOD). For this reason, the aim of this
study was to evaluate germination capacity and to analyze antioxidant
enzymes activity in germinating seeds of Avena fatua treated with NO
and H2O2 under cadmium stress.
MATERIAL AND METHODS
Certified seeds of common wild oat (Avena fatua) from Polan company
were used as the experimental material. Seeds were soaked for 24 hours
in distilled water (control), solution of sodium nitroprusside (SNP, NO
donor) at a concentration of 20 mM or solution of hydrogen peroxide
at a concentration of 0.2 mM. Then, 25 seeds from each treatment were
sown in Petri dishes lined with two layers of filter paper moistened
with 5 ml of (1) distilled water (control), (2) 50 μM cadmium chloride
(described as Cd1) or (3) 500 μM cadmium chloride (Cd2). The experiment was conducted in six replicates per treatment. After 24, 48 and
72 h antioxidant enzymes activity was determined in seeds and young
seedlings. Catalase activity (CAT) was analyzed according to the Bartosz
methods (2006). The decomposition of H2O2 by CAT was followed by
the decline in absorbance at 240 nm. Peroxidase activity (POD) was
determined using the Lück methods (1962) by measuring the amount
124
Effect of nitric oxide and hydrogen peroxide on seed germination and enzymes activity...
of the oxidation products of p-phenylenediamine (pPD) in the presence of H2O2. Spectrophotometric measurement of absorbance was
performed at 485 nm. The activity of superoxide dismutase (SOD) was
quantified by measuring the inhibition in the photochemical reduction
of nitroblue tetrazolium. One enzyme unit (U) was defined as the amount of enzyme required to cause 50% inhibition of the rate of nitroblue
tetrazolium reduction measured at 560 nm (Hwang et al. 1999).
Multi-ways analysis of variance (ANOVA) test was used for all
data to evaluate statistical validity of the results and means were
compared according to the Fisher’s test at a= 0.05.
RESULTS AND DISCUSSION
Heavy metals, with their negative impact on a number of metabolic
processes occurring in plants, are particularly noteworthy groups of
pollutants in the environment. Numerous studies have shown that
metal ions affect plant growth and development including decrease of
seed viability and reduction of seed germination [Peralta et al. 2001,
Izmaiłow and Biskup 2003]. Simultaneously, some experiments proved
stimulating and protective effects of NO and H2O2 on seed germination [Krasuska et al. 2011]. Kopyra and Gwóźdź [2003] have shown lower sensitivity of Lupinus luteus seeds and seedlings treated with NO to
the presence of zinc and cadmium ions. For this reason, in presented
study substances stimulating seed germination under cadmium stress
were used. However, cadmium chloride at a concentration of 500μM
(Cd2) reduced seed germination regardless of pre-sawing treatments
(Table 1). Oat caryopsis germinated in the range from 26.6 to 44%.
Tab. 1. Germination of A. fatua seeds treated
with H2O2 and SNP under cadmium stress.
Substratum
H2O
Cd1
Cd2
Seed germination [%]
24h treatment
H2O2
H2O
41,4 b*
44,0 b
40,8 b
43,6 b
28,7 a
27,5 a
SNP
34,3 ab
37,0 ab
26,6 a
* different letters indicate statistically significant differences at a= 0.05
125
Ewa Muszyńska, Barbara Piwowarczyk, Anna Kołton, Monika Czaja
Evaluation of activity of antioxidant enzymes
Susceptibility of plants to environmental stresses are associated with their antioxidative ability. A major protective mechanism
against oxidative stress includes enzymes such as SOD, POD and CAT,
that catalyze conversion and decomposition of free radicals [Hwang
et al. 1999]. In presented experiment, antioxidant enzyme activity
measurements indicated significant increase in CAT activity after 24
h treatment with H2O2 solution, and decrease in seeds treated with
SNP solution in relation to the control (seeds soaked in water) (Fig. 1).
A similar relationship was observed after 48 h of germination. Treatment of H2O2 caused significant increase and SNP-treatment slight
decrease of CAT activity in tested material. Significant increase of CAT
activity was also noted in caryopses not treated with chemicals and
germinating on Cd2 after 48 h. Whereas, after 72 h material treated
before sowing with H2O2 and SNP had lower CAT activity during
germination in the presence of Cd ions and higher in the control in
comparison to seedlings of seeds soaked in water (Fig. 1).
Fig. 1. The activity of catalase in A. fatua caryopses treated before sowing
with H2O2 and SNP (different letters indicate statistically significant differences at a= 0.05 for each time of analysis).
24-hour treatment of oat seeds with solutions of the tested
compounds had no significant effect on the activity of POD. In turn,
POD activity was the highest in caryopses treated with H2O2 and the
lowest in ones soaked in SNP after 48 h. Cd stress caused a significant
increase of the enzyme activity in material untreated chemically and
the decrease in material treated with H2O2 and NO before sowing
126
Effect of nitric oxide and hydrogen peroxide on seed germination and enzymes activity...
(Fig. 2). While, after 72 h activity of POD increased significantly in
material from H2O2 treatment and decreased in one from SNP treatment under Cd2 stress.
Fig. 2. Peroxidase activity in the A. fatua caryopses treated before sowing
with H2O2 and SNP (different letters indicate statistically significant differences at a= 0.05 for each time of analysis).
Similarly to POD activity, chemical treatment did not exert
a significant influence on the activity of SOD in 24 h (Fig. 3). However,
after 48 hours caryopses soaked with H2O2 and SNP had significantly
higher SOD activity as compared to control, especially during germination on Cd2. In turn, after 72 h inverse relationship was observed
- SOD activity in these caryopses clearly decreased, with the exception
of caryopses treated with H2O2 on Cd2 (Fig. 3).
Fig. 3. The activity of superoxide dismutase of the caryopses A. fatua treated before sowing H2O2 and SNP (different letters indicate statistically
significant differences at a = 0.05 for each time of analysis).
127
Ewa Muszyńska, Barbara Piwowarczyk, Anna Kołton, Monika Czaja
Enzyme activity measurements of A. fatua showed that presowing treatment of the caryopses with NO solution in most cases
decreases the most the activity of CAT, POD and SOD compared to
other treatments. The role of this compound is mainly based on the
ability to maintain the oxidation-reduction balance and regulation of
harmful ROS concentration. NO rapidly captures superoxide radicals
generated under stress, making proxynitrile ion that does not have
toxic effects [Grzegorzewska et al. 2009, Lin et al. 2012, Gill et al.
2013]. This may be the reason for not intensified activity of antioxidant enzymes in this experiment. On the other hand, treatment of
oat seed with H2O2 stimulated enzyme activity what can indicate on
the dual role of this compound in the plant response to stress factors.
Firstly, the accumulation of H2O2 in plants, due to the high reactivity
of this molecule contributesto the damage caused by elevated ROS
presence [Olko and Kujawska 2011].
On the other hand, it leads to metabolic adaptations to the currently prevailing conditions, that in our studies was displayed by an
increase antioxidant enzyme activities in oats seeds germinating
under cadmium stress.
CONCLUSIONS
Exogenous treatment of A. fatua seeds with NO and H2O2 did
not affect significantly their germination in the presence of cadmium
ions. However, it contributed to the subsequent changes in the antioxidant enzymes activity. Our experiment showed that although the
impact of the two molecules on the activity of CAT, POD, SOD was
diverse, both NO and H2O2 are involved in alleviating the negative
effects caused by cadmium stress.
This work was supported by Department of Botany and Plant
Physiology, University of Agriculture in Krakow, DS 3500/WO/2013.
REFERENCES
Barba-Espin G., Diaz-Vivancos P., Clemente-Moreno M.J., Albacete A., Faize
L., Faize M. 2010. Interaction between hydrogen peroxide and plant
hormones during germination and the early growth of pea seedlings.
Plant, Cell and Environment, 33: 981 – 994.
128
Effect of nitric oxide and hydrogen peroxide on seed germination and enzymes activity...
Bartosz G. 2006. Druga twarz tlenu. Wolne rodniki w przyrodzie. Wydawnictwo Naukowe PWN, Warszawa. (in Polish)
Gill S.S, Hasanuzzaman M., Nahar K., Macovei A., Tuteja N. 2013. Importance of nitric oxide in cadmium stress tolerance in crop plants. Plant
Physiology and Biochemistry, 63: 254 – 261.
Gniazdowska A., Bogatek R. Regulacyjna rola tlenku azotu w kiełkowaniu
nasion. Postępy Biologii Komórki, 34 (3): 431 – 443. (in Polish)
Grzegorzewska W., Jaworski K., Szmidt-Jaworska A. 2009. Rola tlenku azotu w odpowiedzi roślin na stres abiotyczny. Postępy Biologii Komórki,
36 (4): 663 – 678. (in Polish)
Hwang S-Y., Lin H-W., Chern R-H., Lo H-F., Li L. 1999. Reduced susceptibility to waterlogging together with high-light stress is related to increases in superoxide dismutase and catalase activities in sweet potato.
Plant Growth Regulation, 27: 167–172
Izmaiłow R., Biskup A. 2003. Reproduction of Echium vulgare L. (Boraginaceae) at contaminated sites. Acta Biologica Cracoviensia Series Botanica, 45: 69 – 75.
Karuppanapandian T., Moon J.-C., Kim C., Manoharan K., Kim W. 2011. Reactive oxygen species in plants: their generation, signal transduction,
and scavenging mechanisms. Australian Journal of Crop Science, 5(6):
709 - 725.
Kopyra M., Gwóźdź E. 2003. Nitric oxide stimulates seed germination and counteracts the inhibitory effect of heavy metals and salinity on root growth of
Lupinus luteus. Plant Physiology and Biochemistry. 41: 1011–1017.
Krasuska U., Gniazdowska A., Bogatek R. 2011. Rola ROS w fizjologii nasion. Kosmos, 60 (1-2): 113 – 128. (in Polish)
Lin Y., Liu Z., Shi Q.,Wang X., Wei M., Yang F. 2012. Exogenous nitric oxide
(NO) increased antioxidant capacity of cucumber hypocotyl and radicle
under salt stress. Scientia Horticulturae, 142: 118 – 127.
Lück H. 1962. Methoden der enzymatischen Analyse, Weinheim; Verlag
Chemie GmbH.
Olko A., Kujawska M. 2011. Podwójna rola H2O2 w odpowiedzi roślin na
działanie warunków stresowych. Kosmos, 60 (1-2): 161 – 171.
Peralta J. R., Gardea-Torresdey J. L., Tiemann K. J., Gomez E., Arteaga S., Rascon S., Parsons J. G. 2001. Uptake and effects of five heavy metals on
seed germination and plant growth in alfalfa (Medicago sativa L.). Bulletin of Environmental Contamination and Toxicology, 66: 727 – 734.
Shi H.T., Li R.J., Cai W., Liu W., Fu Z.W., Lu Y.T. 2012. In vivo role of nitric
oxide in plant response to abiotic and biotic stress. Plant Signal. Behav.
7: 437 – 439.
129
Ewa Muszyńska, Barbara Piwowarczyk, Anna Kołton, Monika Czaja
Address for correspondence:
M.Sc. Ewa Muszyńska
Ph.D. Barbara
Ph.D. Anna Kolton
Institute of Plant Biology and Biotechnology
Department of Botany and Plant Physiology
Supervisor: D.Sc. Ewa Hanus-Fajerska
M.Sc. Monika Czaja
Department of Dendrology and Landscape Architecture
Faculty of Horticulture
University of Agriculture in Krakow
Al. 29 Listopada 54, 31-425 Krakow
Supervisor: D.Sc. Piotr Muras
e-mail: [email protected]
130
Adriana Nowicka-Połeć1
Katarzyna Kałużny
Anna Magdalena Ambroszczyk
EPISTEME
22/2014, t. III
s. 131–138
ISSN 1895-2241
WPŁYW PREPARATÓW EMFARMA™
i LIGNOHUMAT® NA PLONOWANIE I SKŁAD
CHEMICZNY NASION I LIŚCI BOBU (VICIA FABA
VAR. MAJOR) W OPÓŹNIONEJ UPRAWIE POLOWEJ
THE INFLUENECE OF PREPARATIONS EMFARMA™
AND LIGNOHUMAT® ON YIELDING AND CHEMICAL
COMPOSITION OF SEEDS AND BROAD BEAN (VICIA
FABA VAR. MAJOR) LEAVES IN DELAYED FIELD
CULTIVATION
Abstrakt. Bób jest wartościową rośliną strączkową i cennym źródłem
odżywczego białka. Zgodnie z zaleceniami bób wysiewa się w marcu, ale
możliwa jest uprawa opóźniona. Doświadczenie polowe założono w Warzywniczej Stacji Doświadczalnej w Krakowie-Mydlnikach w maju 2013 roku.
W trakcie wegetacji, rośliny bobu odmiany ‘Top Bob’ podlewano dwukrotnie, odpowiednio 30 i 60 dni po wysadzeniu 0,02% roztworem preparatu LIGNOhumat® i 3% roztworem preparatu EM Farma™. LIGNOhumat® zawiera 90% związków huminowych. EM Farma™ to kompozycja pożytecznych
naturalnych mikroorganizmów. Wykazano, że LIGNOhumat® stosowany
dwukrotnie zwiększył istotnie plon handlowy oraz zawartość skrobi w nasionach bobu. Pojedyncza aplikacja obu preparatów miała lepszy wpływ niż
podwójna na zawartość chlorofilu a, chlorofilu b i karotenoidów w liściach.
Słowa kluczowe: bobowate, Fabaceae, efektywne mikroorganizmy, substancje
huminowe
Summary. Broad bean is a grain legume and source of valuable protein.
Broad bean is sown commonly in march but delayed cultivation is also possible. The study was conducted in May 2013 at the experimental station of
the University of Agriculture in Mydlniki, Krakow. Broad bean ‘Top Bob’
was used. During vegetation period plants were treated two times, after
30 and 60 days with 0,02% solution of LIGNOhumat® and 3% solution of
EM FarmaTM. LIGNOhumat® contains up to 90 % humic acid particles. EM
131
Adriana Nowicka-Połeć, Katarzyna Kałużny, Anna Magdalena Ambroszczyk
FarmaTM contains mixed culture of beneficial microorganisms. It was stated
that LIGNOhumat® applied twice increased significant marketable yield and
content of starch in broad bean seeds. Single application of both preparation gave better results than double on contents of chlorophyll a, chlorophyll b and carotenoids in leaves.
Key words: Leguminosae, Fabaceae, Effective Microorganisms, humic acid
Wstęp
Bób (Vicia faba L.) jest rośliną strączkową, należącą do rodziny bobowatych (Fabaceae). Zielone nasiona, zbierane w fazie niepełnej
dojrzałości są cennym źródłem wartościowego białka, węglowodanów,
błonnika, minerałów oraz witamin [Duc 1997]. Rośliny bobu mają niewielkie wymagania klimatyczne i tolerują spadki temperatury, dlatego
termin siewu bobu przypada w Polsce na koniec marca. Podejmowane
są również próby uprawy opóźnionej, aby wydłużyć dostępność bobu
na rynku warzyw świeżych. Uprawa opóźniona jest niestety silnie
skorelowana z występowaniem niekorzystnych warunków atmosferycznych (wysoka temperatura) i obniżeniem plonu nawet o 50%
[Czerwińska-Nowak 2010].
Użyty w badaniach preparat LIGNOhumat® jest zarejestrowany
w Polsce jako środek polepszający właściwości gleby. Zawiera ultraczysty koncentrat nawozu huminowego z dodatkiem mikroelementów
w postaci chelatów. Preparat EM Farma™ to bogata kompozycja pożytecznych, naturalnych mikroorganizmów: bakterii kwasu mlekowego,
bakterii fotosyntetyzujących, drożdży, promieniowców i grzybów
fermentujących, wzbogacona o mikroelementy [Źródło internetowe:
www.probiotics.p].
Celem przeprowadzonego doświadczenia było zbadanie wpływu
preparatów: LIGNOhumat® oraz EM Farma™, zastosowanych jednorazowo i dwukrotnie na wielkość i jakość plonu roślin bobu w uprawie
opóźnionej.
Materiał i metody
Jednoczynnikowe doświadczenie polowe założono w maju 2013 roku
w Warzywniczej Stacji Doświadczalnej w Mydlnikach koło Krakowa,
132
Wpływ preparatów emfarma™ i lignohumat® na plonowanie i skład chemiczny nasion...
metodą losowanych bloków w trzech powtórzeniach z wykorzystaniem wczesnej odmiany bobu ‘Top Bob’ firmy Floraland. Badanym
czynnikiem doświadczenia był sposób traktowania roślin: odpowiednio jedno- i dwukrotne podlewanie roślin bobu preparatami: LIGNOhumat® oraz EM Farma™. Kontrolę stanowiły rośliny uprawiane bez
aplikacji preparatów. Wysiewu nasion wprost do gruntu dokonano
w trzeciej dekadzie maja, w rozstawie 45×15 cm. Doświadczenie
obejmowało 5 obiektów x 3 powtórzenia po 10 roślin. Preparat LIGNOhumat® w stężeniu 0,02% oraz preparat EM Farma™ w stężeniu
3% aplikowano doglebowo jedno- i dwukrotnie: odpowiednio 30 i 60
dni po wysiewie nasion do gleby. Jednorazowe zbiory przeprowadzono
w pierwszej dekadzie sierpnia. Po zbiorze zmierzono plon strąków
i plon nasion, wyznaczając plon handlowy i plon poza wyborem, nienadający się do handlu (rozporządzenie komisji WE nr 150/2007).
Przeprowadzone analizy laboratoryjne obejmowały: wyznaczenie
zawartości suchej masy [metoda suszarkowo-wagowa w temp. 70°C],
skrobi i cukrów rozpuszczalnych w nasionach metodą antronową [Yem
i Wills 1954] oraz barwników: chlorofilu a, chlorofilu b i karotenoidów
[metoda Lichtenthaler’a i Wellburn’a 1983] w liściach, zebranych
z roślin tuż po zbiorze nasion (próba reprezentacyjna z całej rośliny,
ze wszystkich powtórzeń). Analizę statystyczną wyników wykonano
z użyciem programu Statistica 10.0 PL. Przeprowadzono jednoczynnikową analizę wariancji, a grupy jednorodne przeanalizowano testem
Fishera na poziomie istotności p = 0,05.
Wyniki i dyskusja
Plon strąków i nasion różnił się statystycznie w poszczególnych obiektach doświadczenia (tab. 1). Najniższy plon strąków uzyskano z roślin
kontrolnych (0,61 kg·m-2), najwyższy natomiast z roślin podlanych
jednokrotnie preparatem EM Farma™ (0,93 kg·m-2). Najwyższy plon
ogólny nasion uzyskano z roślin podlanych dwukrotnie LIGNOhumatem® (0,23 kg·m-2) i był on wyższy o 43,75% w porównaniu do kontroli
(0,16 kg·m-2). W przypadku preparatu LIGNOhumat® zaobserwowano
tendencję do zwiększania plonu wraz ze wzrostem liczby aplikacji,
w przypadku preparatu EM Farma™ wykazano natomiast tendencję
odwrotną. Podobne zależności zaobserwowano w plonie handlowym
133
Adriana Nowicka-Połeć, Katarzyna Kałużny, Anna Magdalena Ambroszczyk
nasion bobu, gdzie rośliny dwukrotnie podlewane LIGNOhumatem®
wykształciły aż o 50% wyższy plon w stosunku do roślin kontrolnych.
Ponadto wykazano, że najlepszy jakościowo plon uzyskano z roślin
poddanych działaniu preparatu LIGNOhumat® podawanego dwukrotnie, notując bardzo niski plon nasion poza wyborem (0,01 kg·m-2).
Najwyższy plon niehandlowy zanotowano u roślin podlewanych EM
Farma™ ( średnio 0,035 kg·m-2). Najkorzystniejszą strukturę plonu
ogólnego (tab. 1) uzyskano z roślin podlanych jednokrotnie preparatem LIGNOhumat® (95% plon handlowy i 5% plon poza wyborem).
Tab. 1. Plonowanie bobu [kg·m-2] w zależności od aplikacji preparatów
Obiekt
Kontrola
Plon
strąków
[kg·m-2]
Plon
ogólny
[kg·m-2]
Plon
Plon
handpoza
lowy
wyborem
[kg·m-2] [kg·m-2]
Struktura plonu
ogólnego [%]
Plon
Plon
handpoza
lowy wyborem
0,61 a
0,16 a
0,14 a
87,5
12,5
80,95
19,05
83,33
16,67
95,00
5,00
91,30
8,70
0,02 a
EM FARMA I
0,93 c 0,21 bc 0,17 ab 0,04 b
podlewanie
EM FARMA II
0,79 bc 0,18 ab 0,15 ab 0,03 ab
podlewania
LIGNOhumat I
0,70 ab 0,20 abc 0,19 bc 0,01 a
podlewanie
LIGNOhumat
0,80 bc 0,23 c 0,21 c
0,01 a
II podlewania
Średnie w poszczególnych kolumnach oznaczone tą samą literą
nie różnią się istotnie przy poziomie p<0,05 (test NIR Fishera)
Korzystny wpływ preparatu LIGNOhumat® zaobserwowali również Matysiak i in. [2010], którzy stwierdzili, że substancje huminowe
i kwasy fulwowe wpływają korzystnie na pH gleby, zwiększanie pojemności buforowej, a także zapobiegają wypłukiwaniu składników
pokarmowych, pozwalając na ich lepszą przyswajalność, co umożliwia
uzyskanie wyższego plonu. Pozytywny wpływ preparatu EM Farma™
na plon strąków, który nie został potwierdzony w plonie nasion oraz
wysoki plon niehandlowy jak sugerują Martyniuk i Księżak [2011],
mogą być spowodowane kontrowersyjną efektywnością i jakością
preparatów. W swoim doświadczeniu nie wykazali oni istotnego
134
Wpływ preparatów emfarma™ i lignohumat® na plonowanie i skład chemiczny nasion...
wpływu biopreparatów opartych na efektywnych mikroorganizmach
na plonowanie kukurydzy.
Przeprowadzone analizy laboratoryjne nasion bobu wykazały istotne statystycznie różnice w zawartości suchej masy, cukrów
rozpuszczalnych i skrobi (tab. 2). Najwyższą zawartość suchej masy
oznaczono w nasionach roślin bobu, podlewanych jednokrotnie preparatem LIGNOhumat® (29,78% św.m.) w porównaniu do kontroli
29,55% św.m. Najniższą zawartość suchej masy zaobserwowano
w nasionach roślin podlewanych dwukrotnie preparatem EM Farma™
24,73% św.m. Zwiększenie liczby aplikacji preparatów wpływało negatywnie na zawartość suchej masy.
Tab. 2. Średnia zawartość suchej masy, cukrów rozpuszczalnych
i skrobi w nasionach bobu [% św.m.]
Obiekt
Kontrola
EM FARMA
I podlewanie
EM FARMA
II podlewania
LIGNOhumat
I podlewanie
LIGNOhumat
II podlewania
Średnia
Średnia zawartość
Średnia
zawartość suchej cukrów rozpuszczalnych zawartość skrobi
masy [% ś.m.]
[% ś.m.]
[% ś.m.]
29,55 bc
3,21 a
4,67 a
26,50 ab
4,13 bc
7,08 bc
24,73 a
4,27 c
4,60 a
29,78 c
4,13 bc
6,14 ab
27,18 abc
3,98 b
8,47 c
Średnie w poszczególnych kolumnach oznaczone tą samą literą
nie różnią się istotnie przy poziomie p<0,05 (test NIR Fishera)
Zauważono również korzystny wpływ stosowania obydwu preparatów na zawartość cukrów rozpuszczalnych w nasionach bobu
w porównaniu do kontroli. Różnice między obiektami a kontrolą pod
względem zawartości cukrów były istotne. Rośliny podlane dwukrotnie LIGNOhumat® i jednokrotnie EM Farma™ zawierały najwięcej
skrobi, odpowiednio 8,47 i 7,08% św.m. Zbliżone wyniki uzyskał Dobrzański [2008], który stosując podobny preparat (Humiplant - kwasy
huminowe + fulwowe) w uprawie marchwi wykazał, że nie wpływał on
na zawartość suchej masy, ale powodował wzrost zawartości cukrów
w korzeniach. W doświadczeniu Nowickiej-Połeć i in. [2013], po135
Adriana Nowicka-Połeć, Katarzyna Kałużny, Anna Magdalena Ambroszczyk
dwójna aplikacja preparatu LIGNOhumat® obniżyła średnią zawartość suchej masy, a największą zawartość cukrów i skrobi uzyskano
w nasionach bobu roślin kontrolnych.
Wykazano również istotne statystycznie różnice w zawartości
barwników w liściach roślin bobu (tab. 3). Zaobserwowano niższy
poziom badanych barwników fotosyntetycznie czynnych w liściach
roślin dwukrotnie podlewanych badanymi preparatami. Prawidłowość
tę odnotowano również badając stosunek chlorofilu a do chlorofilu
b. Jednakże zastosowanie w uprawie LIGNOhumatu® i EM Farmy™
wpłynęło korzystnie na stosunek chlorofilu a do chlorofilu b w liściach
bobu w porównaniu do liści z roślin kontrolnych. Korzystny wpływ
EM Farmy™ na zawartość barwników w liściach roślin bobu nie został potwierdzony przez Kowalską i Remlein-Starostę [2013], które w
dwuletnim doświadczeniu nie stwierdziły znacznego wpływu zabiegów
z użyciem efektywnych mikroorganizmów na zawartość chlorofilu
a i b w liściach roślin truskawek. W badaniach Wierzbickiej i Hallman
[2013] zastosowanie efektywnych mikroorganizmów wpłynęło istotnie
na zwiększenie zawartości karotenoidów ogółem i luteiny w bulwach
ziemniaka. Matysiak i in. [2010] w uprawie rzepaku, po zastosowaniu
preparatu Humiplant, nie wykazali istotnych różnic w zawartości chlorofilu, podobnie Nowicka-Połeć i in. [2013] we wcześniejszym doświadczeniu, gdzie zwiększenie ilości oprysków LIGNOhumatem® obniżyło
zawartość barwników fotosyntetycznych w liściach.
Tab. 3. Średnia zawartość chlorofilu a, chlorofilu b, karotenoidów [mg 100g1
św.m] oraz stosunek chlorofilu a do chlorofilu b w liściach roślin bobu
Obiekt
Kontrola
EM FARMA
I podlewanie
EM FARMA
II podlewania
LIGNOhumat
I podlewanie
LIGNOhumat
II podlewania
136
Średnia zawartość chlorofilu a
[mg·100g-1św.m.]
Średnia zawartość chlorofilu
b [mg·100g-1św.m.]
Średnia zawartość karotenoidów [mg·100g-1św.m.]
Stosunek
chl a:chl
b
1,16 ab
0,45 bc
0,32 a
2,61 a
1,59 d
0,49 c
0,41 b
3,22 c
1,23 bc
0,40 ab
0,32 a
3,11 c
1,38 c
0,44 bc
0,39 b
3,12 c
1,02 a
0,35 a
0,29 a
2,88 b
Wpływ preparatów emfarma™ i lignohumat® na plonowanie i skład chemiczny nasion...
Średnie w poszczególnych kolumnach oznaczone tą samą literą
nie różnią się istotnie przy poziomie p<0,05 (test NIR Fishera)
Wnioski
Dwukrotne zastosowanie preparatu LIGNOhumat® miało pozytywny
wpływ na plon ogólny świeżych nasion 0,23 kg·m-2 w porównaniu do
kontroli 0,16 kg·m-2 .
Zwiększenie ilości aplikacji poszczególnymi preparatami wpłynęło negatywnie na zawartość wszystkich badanych barwników
w liściach bobu.
Stwierdzono również korzystny wpływ stosowania obydwu
preparatów na zawartość cukrów rozpuszczalnych w nasionach bobu.
Bibliografia
Czerwińska-Nowak A. 2010. Bób od wiosny do jesieni. Plantpress Warszawa.
Warzywa 4: 28-29.
Dobrzański A., Anyszka Z., Elkner K. 2008. Response of carrots to application of natural extracts from seaweed (Sargassum Sp.)-Algaminoplant
and from leonardite - Humiplant. J. Res. Appl. Agric. Engng. 53: 53-58.
Duc G. 1997. Faba bean( Vicia faba L.). Field Crops Res. 53: 99-109.
Kowalska J., Remlein-Starosta D. 2013. Zastosowanie efektywnych mikroorganizmów (EM) w uprawie truskawki. Zagadnienia doradztwa rolniczego. Poznań. 3: 46-55.
Lichtenthaler H.K., Wellburn A.R. 1983. Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents.
Biochem. Soc. Trans. 603: 591–592.
Martyniuk S., Księżak J. 2011. Ocena pseudomikrobiologicznych biopreparatów stosowanych w uprawie roślin. Polish Journal of Agronomy.
6: 27–33.
Matysiak K., Kaczmarek S., Kierzek R., Kardasz P. 2010. Ocena działania
ekstraktów z alg morskich oraz mieszaniny kwasów huminowych
i fulwowych na kiełkowanie i początkowy wzrost rzepaku ozimego
(Brassica napus L.). J. Res. Appl. Agric. Engng. 55: 28-32.
Nowicka-Połeć A., Kałużny K., Ambroszczyk A.M., Szumlańska M. 2013.
Wpływ preparatu LIGNOhumat® na cechy biometryczne roślin i jakość
nasion bobu (Vicia faba var. major) w doświadczeniu wazonowym. Prace naukowe 2. Ster II-Strategia-Taktyka-Ekonomia-Rozwój. Instytut
Ekonomiczno-Przyrodniczy MarGo. Karpacz. 372-376.
137
Adriana Nowicka-Połeć, Katarzyna Kałużny, Anna Magdalena Ambroszczyk
Wierzbicka A., Hallmann E. 2013. Zawartość karotenoidów w bulwach
ziemniaka uprawianego systemem ekologicznym. J. Res. Appl. Agric.
Engng. 58: 223-227.
Yemm E.W., Wills A.J. 1954. The estimation of carbohydrates in plant extracts by anthrone. Biochem. J. 57: 508-514.
Źródło internetowe: www.probiotics.pl/probio-emy/dla-roslin/emfarma.
html
Adres do korespondencji:
mgr inż. Adriana Nowicka-Połeć
dr inż. Anna Magdalena Ambroszczyk
Katedra Roślin Warzywnych i Zielarskich
Uniwersytet Rolniczy w Krakowie
Al. 29 Listopada 54, 31-425 Kraków
Opiekun naukowy: dr hab. Edward Kunicki, prof. UR
138
Beata Ochał1
Jan Błaszczyk
EPISTEME
22/2014, t. III
s. 139–145
ISSN 1895-2241
WPŁYW PREPARATÓW ORGANICZNOMINERALNYCH NA PLONOWANIE I JAKOŚĆ
JABŁEK ODMIANY LIGOL
INFLUENCE OF DIFFERENT ORGANIC-MINERAL
FERTILIZERS ON TOTAL YIELD AND QUALITY
OF ‘LIGOL’ APPLE
Abstrakt. Badania prowadzono w roku 2013 na jabłkach odmiany Ligol
zbieranychz drzew rosnących na podkładce M.9, które pochodziły z prywatnego sadu zlokalizowanego w Olszanie koło Łącka. Celem badań było
porównanie skuteczności dwóch preparatów organiczno-mineralnych, stosowanych w celu poprawienie jakości owoców. W badaniach wykorzystano
preparaty dystrybuowane przez firmę Arysta LifeScience Polska takie jak:
Goëmar BM 86 (3,0 dm3 ∙ ha-1) oraz Biozyme (0,25 dm3 ∙ ha-1, 0,5 dm3 ∙ ha-1,
1,0 dm3 ∙ ha-1). Preparaty stosowano trzykrotnie, wykonując opryskiwanie
drzew: w fazie zielonego pąka, w pełni kwitnienia oraz pod koniec kwitnienia. Po zbiorze oceniono następujące parametry: plon handlowy, masę
i średnicę owoców, jędrność miąższu oraz zawartość ekstraktu. Na podstawie uzyskanych wyników nie stwierdzono istotnych statystycznie różnic
w przypadku jędrności miąższu oraz średnicy owoców. Natomiast najwyższy plon oraz największą zawartość ekstraktu uzyskano po zastosowaniu
preparatu Biozyme 1,0 dm3 ∙ ha-1.
Słowa kluczowe: jabłka, biopreparaty, jędrność miąższu, ekstrakt, plon handlowy
Abstract. The experiment was carried out in the 2013 year in the orchard
located in Olszana near Łącko on apple ‘Ligol’ cultivar. Trees were grafted
on M.9 rootstock. The aim of this research was to compare of efficiency
two organic-mineral fertilizers which were used to improve quality of fruit.
Goëmar BM 86 (3.0 dm3 ∙ ha-1) and Biozyme (0.25 dm3 ∙ ha-1, 0.5 dm3 ∙ ha-1
and 1.0 dm3 ∙ ha-1) were used in this study. These products were distributed
by Arysta LifeScience Poland firm. Trees were sprayed three times: during
139
Beata Ochał, Jan Błaszczyk
green bud stage, at the full bloom and ending at the full bloom. After harvest the following parameters were determined: total yield, mean weight
and diameter of fruit, flesh firmness and soluble solid content. No statistically significant differences were found for flesh firmness and diameter
of fruit. However, the highest: soluble solid content and total yield of fruit
were obtained for apple treated with Biozyme 1.0 dm3 ∙ ha-1.
Key words: apple, biofertilizer, flesh firmness, soluble solid content, total yield
WSTĘP
Wysokie wymagania konsumentów i duża konkurencja na rynku
owoców zmuszają producentów do dostarczania produktów wysokiej
jakości [Tomala i in. 2006] W związku z tym w produkcji sadowniczej powszechnie stosuje się preparaty poprawiające jakość owoców.
W ostatnich latach, wraz z rozwojem rolnictwa ekologicznego, wzrosło zainteresowanie preparatami pochodzenia naturalnego, które są
przyjazne bądź neutralne dla środowiska. Obecnie w sadownictwie
popularnie stosowane są ekstrakty z alg takich jak: Ascophyllum
nodusum, Ecklonia maxima, czy niektóre gatunki z rodzaju Laminaria o właściwościach stymulujących wzrost i rozwój roślin [Howard 2006]. Preparaty te zawierają poliaminy [Biasi i in. 1988, Norie
i Keathley 2006], fitohormony oraz makro- i mikroelementy [Tay i in.
1987, Lapin 2008]. Związki te poprawiają efektywność zapłodnienia
i zawiązywania zawiązków przyczyniając się do zwiększenia plonu
[Broquedis i in. 1995, Kloareg i in. 1996]. Przedstawicielem tej grupy
biopreparatów jest obecny na polskim rynku Goëmar BM 86. Badania
wykazały pozytywny wpływ tego środka na wielkość owoców [Wrona
i Misiura 2008], poprawę jędrności miąższu, zawartość ekstraktu
i lepsze wybarwienie owoców [Szwonek 2003]. Liczne doświadczenie
potwierdziły pozytywny wpływ preparatu Goëmar BM 86 na jakość
jabłek [Wrona i Misiura 2008, Błaszczyk i Gąstoł 2009, Marjańska‐Cichoń i Sapieha‐Waszkiewicz 2012], gruszek [Błaszczyk 2008],
truskawek [Masny i in. 2004] oraz winorośli [Norrie i in. 2002; Norie
i Keathley 2006]. W uprawach warzyw pozytywny wpływ na jakość
i wielkość plonu wykazano po zastosowaniu preparatu Biozyme [Manna i in. 2012, Ramteke i Shirgave 2012, Manna i in. 2013, Ramteke
i in. 2013].
140
Wpływ preparatów organiczno-mineralnych na plonowanie i jakość jabłek odmiany ligol
Celem prowadzonych badań było porównanie wpływu preparatu
Goëmar BM 86 i stosowanego w różnych stężeniach preparatu Biozyme na plonowanie i jakość jabłek odmiany Ligol.
MATERIAŁ I METODY
Doświadczenie przeprowadzono w roku 2013 w prywatnym sadzie
zlokalizowanym w Olszanie koło Łącka. Sad założony był na glebie
gliniastej klasy III b. Przedmiotem badań były 10-letnie jabłonie odmiany Ligol szczepione na podkładce M.9. Doświadczenie składało
się z 5 kombinacji, a każda kombinacja z 4 powtórzeń. Powtórzenie
stanowiło 7 drzew o wyrównanej sile wzrostu. W ocenie uwzględniano
jedynie pięć drzew z każdego powtórzenia (nie oceniano drzew rosnących na początku i na końcu poletka). W czasie trwania doświadczenia
drzewa opryskiwano następującymi preparatami: Goëmar BM 86
o stężeniu 3,0 dm3 ∙ ha-1 oraz Biozyme w trzech stężeniach - 0,25
dm3 ∙ ha-1, 0,5 dm3 ∙ ha-1, 1,0 dm3 ∙ ha-1. Kontrolę stanowiły drzewa
opryskiwane wodą. Dawka cieczy roboczej wynosiła 500 dm3 ∙ ha-1.
Preparaty stosowano trzykrotnie wykonując opryskiwanie drzew:
w fazie zielonego pąka, w pełni kwitnienia oraz pod koniec kwitnienia.
Goëmar BM 86 i Biozyme należą do grupy dolistnych preparatów
organiczno-mineralnych. Goëmar BM 86 jest preparatem opartym na
bazie ekstraktu z alg A. nodusum zawierającym makro- i mikroelementy (4% N, 4,8% Mg, 2% B, 0,02% Mo), który stymuluje kwitnienie, poprawia efektywność zapłodnienia i zawiązywania zawiązków,
zwiększa szybkość podziałów komórkowych wpływając tym samym na
wielkość owoców [Arysta Lifescience 2006]. Biozyme jest preparatem
organicznym, którego 75% składu stanowią ekstrakty z wyciągów
roślinnych.
Po zbiorze oceniono takie parametry jak: plon handlowy, masę
i średnicę owoców, jędrność miąższu oraz zawartość ekstraktu. W celu zarejestrowania plonu handlowego skalibrowano owoce, a następnie zsumowano masę jabłek o średnicy powyżej 66 mm. Wartość
plonu podano w kg ∙ drzewo-1. Średnią masę owoców [g] oszacowano
na podstawie stosunku plonu z drzewa do liczby owoców. W ocenie
plonu handlowego oraz średniej masy jabłek pod uwagę brano jedynie
owoce z trzech najbardziej wyrównanych drzew w każdym powtórze141
Beata Ochał, Jan Błaszczyk
niu. Średnicę owoców [mm] oszacowano porównując po 25 owoców
w każdym powtórzeniu. Jędrność miąższu [N] oznaczono jędrnościomierzem Instron 500, pomiaru dokonano na 25 owocach z każdego
powtórzenia. Zawartość ekstraktu [%] oznaczono w soku z jabłek za
pomocą refraktometru Atago PR-101.
Uzyskane wyniki opracowano statystycznie w programie STATISTICA 10 metodą analizy wariancji z zastosowaniem testu NIR
Fishera przy poziomie istotności α = 0,05.
WYNIKI I DYSKUSJA
Zastosowanie biopreparatów wpłynęło korzystnie na zwiększenie
plonu handlowego (tab. 1). U drzew traktowanych preparatem Biozyme o stężeniu 1,0 dm3 ∙ ha-1 odnotowano plonowanie wyższe nawet
o 42,2% w stosunku do kontroli. Potwierdzają to wyniki uzyskane
wcześniej przez Wronę i Misiurę [2008], Błaszczyka i Gąstoła [2009]
oraz Marjańską‐Cichoń i Sapiehę‐Waszkiewicz [2012], którzy również stosowali preparaty na bazie wyciągów z alg. Analizując średnią
masę owoców wykazano istotny wpływ zastosowanych preparatów
na jej wzrost (tab. 1). Podobne wyniki otrzymali: dla jabłek odmiany Šampion [Wrona i Misiura 2008], [Błaszczyk i Gąstoł 2009], dla
jabłek odmiany Šampion, Elise i Novamac [Marjańska‐Cichoń i Sapieha‐Waszkiewicz 2012], a także dla gruszek odmiany Konferencja
opryskiwanych preparatem Goëmar BM 86 oraz Fruton [Błaszczyk
2008]. Z kolei oceniając średnicę owoców nie wykazano wpływu
zastosowanych preparatów na wielkość jabłek (tab. 1). Natomiast
wyniki uzyskane przez Szwonka [2003], Tomalę i in. [2006] oraz
Basaka [2008] wskazują dodatni wpływ preparatu Goëmar BM 86
na wartość tej cechy. Wzrost średnicy owoców odnotowano również
u gruszek odmiany Konferencja [Błaszczyk 2008]. Opryskiwanie
drzew biopreparatami nie miało wpływu na jędrność miąższu owoców
(tab. 1). Natomiast Błaszczyk i Gąstoł [2009] wykazali, że traktowanie
preparatem Goëmar BM 86 ma korzystny wpływ na ten parametr
jakościowy. Rozpatrując oddziaływanie biopreparatów na zawartość
ekstraktu w owocach stwierdzono, że ich wpływ zależał zarówno od
rodzaju preparatu, jak również w przypadku preparatu Biozyme, od
zastosowanego stężenia (tab. 1). Szczególnie istotny wzrost zawar142
Wpływ preparatów organiczno-mineralnych na plonowanie i jakość jabłek odmiany ligol
tości ekstraktu w jabłkach odnotowano u owoców traktowanych
preparatem Biozyme o stężeniach 0,25 dm3 ∙ ha-1 oraz 1,0 dm3 ∙ ha-1,
gdzie wzrost wynosił odpowiednio 2,6% oraz 3,5% w stosunku do
kontroli. Wyniki licznych badań przedstawiają jednak różny efekt
działania biopreparatów na wartość omawianej cechy w jabłkach
[Wrona i Misiura 2008, Błaszczyk i Gąstoł 2009, Marjańska‐Cichoń
i Sapieha‐Waszkiewicz 2012], gruszkach [Błaszczyk 2008], truskawkach [Marjańska‐Cichoń i Sapieha‐Waszkiewicz 2011], malinach [Krok
i Wieniarska 2008] oraz winogronach [Colapietra i Alexander 2006].
Tab. 1. Wpływ różnych preparatów na wielkość plonu, średnią masę
i średnicę owoców, jędrność miąższu oraz zawartość ekstraktu
jabłek odmiany Ligol
Kombinacja
Kontrola
Biozyme 0.25
Biozyme 0.5
Biozyme 1.0
Goëmar BM 86
Średnia Średnica
Plon handlowy
masa
ow- owocu
[kg ∙ drzewo-1]
ocu [g]
[mm]
69,88 a
126 a
21,54 a*
70,23 a
149 b
26,32 bc
71,15 a
148 b
23,13 ab
70,90 a
144 b
30,63 d
71,79 a
153 b
26,88 c
Jędrność
miąższu
[N]
64,7 a
63,8 a
64,2 a
65,1 a
64,3 a
Ekstrakt
[%]
11,4 a
11,7 bc
11,2 a
11,8 c
11,5 ab
* średnie oznaczone tymi samymi literami w kolumnach nie różnią się istotnie przy
poziomie istotności α = 0,05.
WNIOSKI
Stosowanie nawozów organiczno-mineralnych miało korzystny wpływ
na wielkość plonu handlowego oraz średnią masę owoców.
Najwyższy plon handlowy oraz najwyższą zawartość ekstraktu
w jabłkach odnotowano po zastosowaniu preparatu Biozyme o stężeniu 1.0 dm3 ∙ ha-1.
Zastosowanie biopreparatów Goëmar BM 86 oraz Biozyme w podanych stężeniach nie miało wpływu na średnicę owoców i jędrność
miąższu.
Na ogół wykazano pozytywny wpływ zastosowanych nawozów
organiczno-mineralnych na plonowanie oraz wybrane cechy jakościowe owoców. Najlepsze rezultaty osiągnięto opryskując drzewa
biopreparatem Biozyme o stężeniu 1,0 dm3 ∙ ha-1.
143
Beata Ochał, Jan Błaszczyk
BIBLIOGRAFIA
Arysta Lifescience 2006. Ochrona roślin sadowniczych. 13-17.
Basak A. 2008. Effect of preharvest treatment with seaweed products, Kelpak and Goëmar BM 86, on fruit quality in apple. Int. J. Fruit Sci. 8
(1–2): 1–14.
Biasi R., Bagni N., Costa G. 1988. Endogenous polyamines in apple and their
relationship to fruit set and growth. Physiologia Plantarum. 73: 201-205.
Błaszczyk J. 2008. Quality of ‘Conference’ pears as affected by Goëmar BM
86 and Fructon. Bioregulators in modern agriculture. Sadowski A. (Ed.)
Fruit Crops. Editorial House Wieś Jutra, Ldt., Warsaw: 18-24.
Błaszczyk J., Gąstoł M. 2009. Quality and storage properties of Šampion
apples as affected by different biofertilizers. Zeszyty Problemowe
Postępów Nauk Rolniczych. 536: 45-51.
Broquedis M., Lespy-Labaylette P., Bourand J. 1995. Effect of cryocrashed
seaweed cream sprays on the composition of polyamines in vine flower
bunches at flowering. Phytom. 474: 33-36.
Colapietra M., Alexander A. 2006. Effect of foliar fertilization on yield and
quality of table grapes. Acta Hortic. 721: 213–218.
Howard J. 2006. A natural partner: Using biostimulants in increase your
yield. TurfNews [TPI] 30 (2): 52–54.
Kloareg B., Broquedis M., Joubert J.M. 1996. Fruit development. Elicioter
effects of biostimulants. Arboriculture Fruitiere 498: 39-42.
Krok K., Wieniarska J. 2008. Effect of Goëmar BM 86 application on development and quality of primocane raspberry fruits. p. 49–59. In:
Monographs Series: Biostimulators in Modern Agriculture, Fruit Crops
(A. Sadowski, ed.). Wieś Jutra, Warszawa, 106 pp.
Lapin R. 2008. Preparaty zawierające wyciągi z glonów morskich w nowoczesnej produkcji sadowniczej. s. 55–58. W: 4. Międzynarodowe Targi
Agrotechniki Sadowniczej. Warszawa, 11–12.12.2008, 190 ss.
Manna D., Sarkar A., Maity T. K. 2012. Impact of Biozyme on growth, yield
and quality of chilli [Capsicum annuum L.]. Journal of Crop and Weed.
8 (1): 40-43.
Manna D., Sarkar A., Maity T. K. 2013. Influence of Biozyme on growth,
yield, and quality of onion (Allium cepa L.) cv. Sukhsagar. The Bioscan.
8(4): 1271-1273.
Marjańska-Cichoń B., Sapieha-Waszkiewicz A. 2011. Efekty stosowania
kilku biostymulatorów w uprawie truskawki odmiany Salut. Prog.
Plant Prot./Post. Ochr. Roślin 51 (2): 932–936.
Marjańska‐Cichoń B., Sapieha‐Waszkiewicz A. 2012. Wpływ preparatu
Goëmar BM 86 na plonowanie trzech odmian jabłoni i wybrane cechy
144
Wpływ preparatów organiczno-mineralnych na plonowanie i jakość jabłek odmiany ligol
jakościowe jabłek. Postępy w ochronie roślin. 52 (4): 1193‐1199, ISSN
1427‐4337.
Masny A., Basak A., Żurawicz E. 2004. Effects of foliar applications of Kelpak SL and Goëmar BM 86 preparations on yield and fruit quality in
two strawberry cultivars. J. Fruit Ornam. Plant Res. 12: 23-27.
Norrie J., Branson T., Keathley P.E. 2002. Marine plant extracts impact on
grape yield and quality. Acta Hort. 594: 315-319.
Norrie J., Keathley J.P. 2006. Benefits of Ascophyllum nodusum marineplant extract application to ‘Thompson Seedless’ grape production.
Acta Hort. (ISHS) 727: 243-248.
Ramteke, A.A., Shirgave, P.D. 2012. Study the effect of common fertilizers
on plant growth parameters of some vegetable plants. J. Natur. Prod.
and Plant Res. 2 (2): 328-333.
Ramteke, A.A., Narwade, M.L., Gurav, A.B., Chavan, S.P., Wandre, A.G.
2013. Study of germination effect of fertilizers like urea NPK and biozyme on some vegetable plants. Der Chemica Sinica. 4 (3): 22-26.
Szwonek E. 2003. Goëmar BM 86. Wyciąg nawozowy z alg morskich. Owoce,
Warzywa, Kwiaty. 7: 18.
Tay S.A.B., Palni L.M.S., McLeod J.K. 1987. Identification of cytokinin glucosides in a seaweed extracts. J. Plant Growth Regulation 5 (3): 133–
138.
Tomala K., Andziak E., Badowski P., Szczepaniak M. 2006. Jakość jabłek
z punktu widzenia sadownika i konsumenta. s. 40-44.W: Materiały
44. Ogólnopolskiej Konferencji Sadowniczej. ISiK, Skierniewice, 3031.08.2006, 103 ss.
Wrona D., Misiura M. 2008. Effect of Goëmar BM 86 on yield and quality
of Šampion apples. Bioregulators in modern agriculture. Sadowski A.
(Ed.) Fruit Crops. Editorial House Wieś Jutra, Ldt., Warsaw: 91-96.
Adres do korespondencji:
mgr Beata Ochał
Katedra Sadownictwa i Pszczelnictwa
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
Opiekun naukowy: dr hab. inż. Jan Błaszczyk
145
Agnieszka Ilczuk
Paweł Petelewicz
Katarzyna Jagiełło-Kubiec
EPISTEME
22/2014, t. III
s. 147–154
ISSN 1895-2241
Effect of Beta-Chikol on acclimatization
to ex vitro conditions of common ninebark
(Physocarpus opulifolius (L.) Maxim.) ‘Red Baron’
Wpływ beta-Chikol na aklimatyzację do
warunków ex vitro pęcherznicy kalinolistnej
(Physocarpus opulifolius (L.) Maxim.) ‘Red Baron’
Abstract. Common ninebark is a decorative deciduous shrub often planted in the public and private green areas. Nurserymen reproduce it by softwood or semi lignified stem cuttings, but also more effective propagation
methods are used, such as micropropagation. Plants growing in vitro adapt
to the specific conditions prevailing in the glass, i.e. low light intensity and
high relative air humidity. Therefore, during acclimatization to the greenhouse conditions, they are exposed to biotic and abiotic stresses. Stresses can
be alleviated by the use of Beta-Chikol, a biostimulant having chitosan in
its composition. Foliar application of this biostimulant at a concentration
of 0.25% had a positive impact on the growth and development of ninebark
plants ex vitro. However, there was a significant reduction in the level of
chlorophyll a, b, a+b, carotenoids and RWC in their leaf blades.
Key words: biostimulant, chitosan, chlorophyll, carotenoids, in vitro, stress
Abstrakt. Wspólna ninebark jest dekoracyjny krzew liściasty często sadzone w publicznych i prywatnych terenów zielonych. Szkółkarzy odtworzyć go
drewna iglastego lub pół zdrewniałych sadzonek, ale również bardziej skuteczne metody rozprzestrzeniania są używane, takie jak mikrorozmnażania.
Rośliny rosnące w warunkach in vitro dostosować do specyficznych warunków panujących w szkle, czyli niskie natężenie światła i wysoka wilgotność
względna powietrza. Dlatego też, w czasie aklimatyzacji do warunków cieplarnianych, są narażone na stresy biotyczne i abiotyczne. Naprężenia mogą
być złagodzone poprzez zastosowanie Beta Chikol, biostymulator chitozan
posiadającego w swym składzie. Dolistne tym biostymulator w stężeniu
0,25% miało pozytywny wpływ na wzrost i rozwój roślin ex vitro ninebark.
Jednakże, nie było znaczne obniżenie poziomu chlorofilu a, B, A + B, karotenoidów i RWC w ich blaszkach liściowych.
Słowa kluczowe: biostymulator, chitosan, chlorofil, karotenoidy, in vitro, stres
147
Agnieszka Ilczuk, Petelewicz Paweł, Katarzyna Jagiełło-Kubiec
Introduction
In recent years a growing number of ornamental trees and shrubs are
propagated in vitro, including cultivars of common ninebark (Physocarpus opulifolius (L.) Maxim.). Conventional methods of propagation are not very efficient, therefore nurserymen decide to purchase
material from the in vitro production. However, at the stage of plant
acclimation to the ex vitro conditions, important losses occur due to
the low survival rate of regenerants compared to the high production
costs [Ilczuk et al. 2013].
Adaptation of plants to modified environmental conditions is the
most difficult stage of micropropagation. After leaving the sterile conditions microcuttings are exposed to acclimatization stress resulting
from a small amount of epicuticular waxes emerged on the leaves and
poorly developed cuticle, malfunctioning stomata and an insufficient
photosynthesis rate [Hazarika 2006, Mišalová et al. 2009]. These abnormalities can lead to physiological disorders, especially in transpiration,
which is the main cause of low surviving percentage of microcuttings
after their transfer to the ex vitro conditions [Ziv 1995].
One of the methods to counteract the stressors may be the use of
biostimulants. In the available literature there are only a few reports
on the efficacy of biostimulants during the acclimatization of plants
to the in vivo conditions. One of them may be chitosan (poly-D-glucosamine) obtained from the exoskeletons of marine crustaceans. Dissolved in a mixture of lactic acid and succinic acids at a concentration
of 20 g∙dm-3, this is the active substance of Beta-Chikol provided by
Poli-farm (formerly Biochikol 020 PC), which is positively affecting
the overall condition of the plants and supporting their natural immunity [Jacygrad and Pacholczak 2010] also preventing fungal diseases
[Wojdyła 2004].
The aim of this study was to determine the effect of Beta-Chikol
preparation on acclimatization of common ninebark (Physocarpus
opulifolius (L.) Maxim.) ‘Red Baron’ to ex vitro conditions. Also changes in morphological, physiological and biochemical parameters that
occurred in acclimatized plants were investigated.
148
Effect of beta-chikol on acclimatization to ex vitro conditions of common ninebark...
Materials and methods
Plant material and culture conditions
Plant material was obtained from established Physocarpus opulifolius
‘Red Baron’ in vitro cultures propagated on MS medium [Murashige
and Skoog 1962] with 1 mg∙dm-3 BA and 0.1 mg∙dm-3 NAA. Microshoots (2 cm length) were rooted on MS medium supplemented with 2
mg∙dm-3 NAA. After 3 months of culture the rooted plants were taken
for further analysis.
All media were supplemented with 30 g∙dm-3 sorbitol, solidified
with 8 g∙dm-3 Bacto-Agar. Before autoclaving pH was adjusted to 5.8.
Decontamination was performed for 20 min in an autoclave at 121°C
under an overpressure of 0.1 MPa. The culture was conducted in
a growth chamber at 24°C with a 16-hour day provided by light with
a quantum irradiance of 24 µmol·m-2·s-1.
Plant acclimatization
Rooted plants were taken out from the containers and the agar
medium was removed by thoroughly rinsing the root system in distilled
water. Plants were potted into P9 containers filled with sterile substrate
composed of peat mixed with perlite in the ratio 2:1. Afterwards plants
were sprayed with Proplant 722 SL at concentration 0.1% , and then
with Beta-Chikol at the following concentrations: 0.25%, 0.5%, 1%, 2%
(three treatments at weekly intervals). Control plants were sprayed with
fungicide and distilled water. Plants were putted into plastic, transparent
boxes covered with glass and placed for 2 months in a growth chamber
at 24°C with a 16-hour day provided by light with a quantum irradiance
of 24 µmol·m-2·s-1. After this time they were removed from the boxes and
transferred to the greenhouse at 24/17°C with a quantum irradiance of
180 µmol·m-2·s-1. Six months after potting percentage of plants acclimatized to ex vitro conditions, the height and number of internodes were
examined. Each treatment consisted of 36 plants (12 in single repetition;
3 repetitions were provided). For control and plants treated with 0.25%
solution of Beta-Chikol the leaf area measurements were executed using
the AREA METER AM100 planimeter provided by ADC Bioscientific LTD.
The relative water content (RWC) determination was performed according to Barrs [1968], dry weight of leaves by the method of Strzelecka et
al. [1982] and chlorophyll a, b, a+b and total carotenoids’ contents were
149
Agnieszka Ilczuk, Petelewicz Paweł, Katarzyna Jagiełło-Kubiec
measured using spectrophotometric method according to Lichtenthaler
and Welburn [1983]. Plant material for analysis were leaves located between 2 and 4 node, starting from the top of the shoot.
Statistical analysis
The results were statistically analyzed in IBM SPSS Statistics 21, using
one- factorial analysis of variance. Means given as a percentage were
transformed according to Bliss. For means comparison Duncan’s test
was used at significance level α = 0.05 [Wójcik and Landański 1989].
Results
Beta-Chikol significantly affected acclimatization of Physocarpus opulifolius ‘Red Baron’ plants to ex vitro conditions (tab 1). One hundred
percent survival was obtained in treatment with 0.25% solution of
biostimulant. With the increase of the concentration of Beta-Chikol a
number of plants acclimated decreased. Foliar application of 1% and 2%
solution of biostimulant resulted in only 60% acclimatized individuals,
but this value was about 10% higher comparing to the control (tab. 1).
Tab. 1. Effect of Beta-Chikol on survival, height, number of internodes and
of Physocarpus opulifolius ‘Red Baron’ plants under in vivo conditions.
Treatment
Acclimatized plants
(%)*
Height (cm)
Number of internodes /
plant
Control
50.0 a**
20.6 ab**
13.8 a**
0.25%
100.0 d
19.5ab
14.0 a
0.5%
80.6 c
24.5 c
24.5 b
1%
61.1 b
23.5 c
13.6 a
2%
61.1 b
21.9 c
13.0 a
100% = 36 plants
Means followed by the same letter do not differ significantly at α = 0.05.
*
**
A significant effect of 0.5-2% concentration of Beta-Chikol on
plant height has been demonstrated (tab. 1). Shoots from these treatments were on the average 23 cm high, significantly higher than
control plants and those treated with the lowest biostimulant con150
Effect of beta-chikol on acclimatization to ex vitro conditions of common ninebark...
centration. Significantly more internodes (tab. 1) were produced by
plants treated with 0.5% Beta-Chikol solution (tab. 1).
There was no significant impact of Beta-Chikol in concentration
0.25% on the leaf surface (tab. 2) nor the dry matter content (tab. 2).
Plants treated with the biostimulant had a lower water content than
control plants.
Relative to control plants there was a significant decrease in
chlorophyll a, b, a+b and total carotenoids contents in leaves of acclimatized common ninebark ‘Red Baron’ plants after 0.25% Beta-Chikol
treatment (tab. 2).
Tab. 2. Effect of Beta-Chikol on physiological parameters and photosynthetic pigments’ contents in Physocarpusopulifolius ‘Red Baron’ plants.
Treatment
Control
0.25%
BetaChikol
Leaf blade
surface
(mm2)
RWC
(%)
Photosynthetic pigments (mg∙g-1
Dry
f.m.)
matter
Chlo(g
ChloroCaroteChloro- rod.m.∙g-1
phyllanoids
phyll a phyll
f.m.)
+b
b
2219.3 a* 86.7 b*
0.3 a*
14.0 b* 4.7 b* 21.2 b* 16.2 b*
2245.2 a 84.3 a
0.3 a
12.3 a
3.8 a
16.6 a
14.6 a
Means followed by the same letter do not differ significantly at α = 0.05.
*
Discussion
Adaptation to the ex vitro conditions is the last and also the most difficult stage of the in vitro propagation of woody plants. Changes in the
environmental conditions involve a strong acclimation stress. Therefore,
at this stage of propagation use of biostimulants may be very helpful
[Ertani et al. 2013]. Ilczuk et al. [2012] showed that a foliar application
of Beta-Chikol at concentration 0.1% on Begonia rex ‘Fairy’ resulted in
acclimatization of 100% plants to ex vitro. However, there was no effect
of the biostimulant on the height of the plants. Similar results were observed in common ninebark ‘Red Baron’, except that the plants sprayed
with 0.5% Beta-Chikol were characterized by intense shoot growth. It can
be assumed that biostimulants contributed to the development of the
root ball, a better nutrient uptake and hence more intense elongation.
Jacygrad and Pacholczak [2010] on Physocarpus opulifolius ‘Diabolo’
151
Agnieszka Ilczuk, Petelewicz Paweł, Katarzyna Jagiełło-Kubiec
showed that foliar application of Beta-Chikol could replace a treatment
with Rhizopon AA, a commercial rooting powder containing IBA.
Durability of plant leaves transferred to ex vitro conditions depends on the species and intensity of stressors. Some species shed
leaves in a few days after moving to in vivo [Fabberi et al. 1986]. This
effect was not observed in common ninebark ‘Red Baron’. Under in
vivo conditions plants produced new leaves but leaves from in vitro
conditions increased their size. It can be assumed that biostimulants
contributed to reduction of transpiration and caused an increase in
epidermal resistance to adverse growth conditions.
The study did not show clear differences in water management in
studied plants. Relative water content indicator (RWC) in tissues was
within the range of 84-86%. Less saturated with water were leaves of
plants treated with Beta-Chikol. The observed changes in the intensity
of physiological parameters under study may be the result of both:
stress and recovery mechanisms [Starck 2002]. During dehydration,
modifications in the structure of proteins and lipids and high accumulation of ions in both: the vacuole and in the cytoplasm can occur.
Water stress causes denaturation of proteins located in the membrane,
therefore the membrane permeability is increased, causing uncontrolled
leakage of electrolytes, especially potassium ions [Starck et al. 1995].
According to Ertani et al. [2013] biostimulants are increasing
the efficiency of the photosynthetic apparatus and the intensity of
photosynthesis. Studies conducted by Jacygrad and Pacholczak [2010]
on Physocarpus opulifolius ‘Dart‘s Gold’ plants indicated that after
applying 2% solution of Biochikol 020PC (Beta-Chikol), content of
chlorophyll a+b tripled. This experiment demonstrated a reduction
in photosynthetic pigments in common ninebark ‘Red Baron’ plants
treated with Beta-Chikol. In turn, Jacygrad and Pacholczak [2010]
proved that Biochikol 020PC (Beta-Chikol) used during the rooting
of common ninebark ‘Dart‘s Gold’ and ‘Diabolo’ cuttings, increased
levels of chlorophyll, polyphenol and free amino acids.
Conclusions
Beta-Chikol at 0,25% concentration positively affected acclimatization
of Physocarpus opulifolius ‘Red Baron’.
Foliar application of Beta-Chikol decreased contents of photosynthetic pigments and RWC in leaves.
152
Effect of beta-chikol on acclimatization to ex vitro conditions of common ninebark...
Bibliography
Barrs H.D. 1968. Determination of water deficits in plant tissues. In: (Eds.)
Kozłowski T. Water Deficits and Plant Growth. Vol. I: Development,
Control and Measurement. Academic Press. New York, 394: 235-368.
Ertani A., Nardi S., Altissimo A. 2013. Review: Long-term research activity
on the biostimulant properties of natural orgin compounds. Proceedings of the First World Congress on the Use of Biostimulants in Agriculture. In: Saa Silva S., Brown P., Ponchet M. (Eds.) ActaHorticulturae
1009: 181-188.
Fabberi A. Sutter E. Dunston S.K. 1986. Anatomical changes in persistent
leaves of tissue cultured strawberry plants after removal from culture.
ScientiaHorticulturae, 28: 331-337.
Hazarika B.N. 2006. Morpho-physiological disorders in in vitro culture of
plants. ScientiaHorticulturae, 108 (2): 105-120.
Ilczuk A. Jacygrad E. Jagiełło-Kubiec K. Pacholczak A. 2013. Rozmnażaniein
vitroroślindrzewiastych – perspektywy i problemy [In vitro propagation of woody plants – perspectives and problems] In: Conf. Mat.:
Skutnik E. Rabiza-Świder J. (Eds.) Ogrodnictwo ozdobne sektorem
gospodarki narodowej [Ornamentalhorticulture as a sector in the nationaleconomy], 4-5.09.2013, Warszawa, 41-52. (in Polish)
Ilczuk A. Jagiełło-Kubiec K. Jacygrad E. Świtlaga P. 2012. Effect of biostimulants: AlgaminoPlant and Biochikol 020 PC on acclimatization of
microplantlets of Begonia ×rexPutz. ‘Fairy’ to ex vitro conditions. 1st
World Congress on the use of Biostimulants in Agriculture, New Ag
International, 26-29.11.2012, Strasbourg, France: 28
Jacygrad E. Pacholczak A. 2010. Effect of biopreparations Amino Total and Biochikol 020 PC on rhizogenesis in stem cuttings of
Physocarpusopulifolius’Dart’s Gold’ and ‘Diabolo’. Annals of Warsaw
University of Life Sciences – SGGW Horticulture and Landscape Architecture 31: 19-27.
Lichtenthaler H.K. Welburn A.R. 1983. Determinations of total carotenoids
and chlorophylls a and b leaf extracts in different solvents. Biochemical
Society Transaction, 603: 591-592.
Mišalová A. Ďurkovič J. Mamonova M. Prwitzer T. Langeyelova A. Hladka
D. Lux A. 2009. Changes in leaf organisation, photosynthetic performance and wood formation during ex vitro acclimatisation of black
mulberry (Morusnigra L.). Plant Biology, 11 (5): 686-693.
Murashige T.Skoog F. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. PhysiologiaPlantarum, 15: 473-497.
Starck Z. 2002. Mechanizmyintegracjiprocesówfotosyntezy i dystrybucjibiomasy w niekorzystnychwarunkachśrodowiska [Integration
153
Agnieszka Ilczuk, Petelewicz Paweł, Katarzyna Jagiełło-Kubiec
mechanisms of photosynthesis and biomass distribution in adverse
environmental conditions]. Zeszyty Problemowe Postępów Nauk Rolniczych, 481: 113–123. (in Polish)
Starck Z.Chołuj D. Niemyska B. 1995. Fizjologiczne reakcje roślin na
niekorzystne czynniki środowiska [Physiologicalresponses of plants to
adverseenvironmentalfactors]. Wydawnictwo SGGW-AR, Warszawa:
27-48. (in Polish)
Strzelecka H. Kamińska J. Walewska E. 1982. Chemiczne metody badania
roślinnych surowców leczniczych [Chemicalmethods for the study of
medicinal plant raw materials]. PZWL, Warszawa: 131-132. (in Polish)
Wojdyła A.T. 2004. Chitosan (biochikol 020 PC) in the control of some ornamental foliage diseases. Communications in Agricultural and Applied
Biological Sciences 69(4):705-15.
Wójcik A.R.Landański Z. 1989. Planowanie i wnioskowaniestatystyczne
w doświadczalnictwie [Statistical planning and concluding in experimentalworks]. PWN, Warszawa: 130. (in Polish)
Ziv M. 1995. In vitro acclimatization. In: (Eds.) Aitken-Christie J. Kozai T.
Smith M.L. Automation and environmental control in plant tissue culture. Kluwer Academic Publishers, Dordrecht: 493-516.
Adres do korespondencji:
dr inż. Agnieszka Ilczuk
Department of Ornamental Plants
Warsaw University of Life Sciences
e-mail: [email protected]
mgr inż. Paweł Petelewicz
Department of Ornamental Plants
Warsaw University of Life Sciences
e-mail: paweł[email protected], [email protected]
mgr inż. Katarzyna Jagiełło-Kubiec
Department of Ornamental Plants
Warsaw University of Life Sciences
e-mail: [email protected], [email protected]
Faculty of Horticulture, Biotechnology and Landscape Architecture
Department of Ornamental Plants
ul. Nowoursynowska 166, 02-787 Warszawa
Research supervisor: prof. dr hab. inż. Aleksandra Łukaszewska
154
Julia Rochala1
Diana Anna Musiał2
Ewa Skutnik3
Agata Jędrzejuk 4
EPISTEME
22/2014, t. III
s. 155–162
ISSN 1895-2241
SENESCENCE IN CUT COSMOS BIPINNATUS
FLOWERS: WATER RELATIONS AND MEMBRANE
PERMEABILITY
Starzenie kwiatów ciętych kosmosu
podwójnie pierzastego: stosunki wodne
i przepuszczalność błon
Abstract. Petal senescence is a process which marks the final stage of flower life. Cosmos bipinnatus is a popular garden annual plant, which may also
be used as cut flower in floral compositions. Longevity of cut cosmos ‘Sonata Carmine’ in water was 3.5 days. The preservative composed of 8-HQC
and 2% sucrose increased longevity to 6 days, and a similar effect was obtained in the solution of nanosilver with 2% sucrose – 5.5 days, while Chrysal Professional 2 shortened longevity to 3.2 days. The permeability of cells
changed with age what was demonstrated by an increase of ion leakage and
changes in membrane properties as indicated by a higher pH of the cell sap
and its higher electrical conductivity. The solutions 8-HQC with 2% sucrose
and nanosilver with 2% sucrose decreased electrical conductivity relative to
H2O, but did not affect the sap pH. Chrysal Prof.2 had no effect on membrane parameters, however it delayed a decrease in the relative water content in florets.
Keywords: longevity, cell sap pH, electrical conductivity, relative water content
Abstrakt. Starzenie się płatek jest procesem, który przypada na ostatni etap
życia kwiata. Cosmos bipinnatus - to popularna ogrodowa roślina jednoroczna, która może być również używana jako kwiat cięty w kompozycjach kwiatowych. Środek konserwujący złożony z 8-HQC i 2% sacharozy zwiększona
trwałość do 6 dni, a Podobny efekt uzyskano w rozwiązaniu nanosrebra
z 2% sacharozy - 5,5 dni, a Chrysal profesjonalne 2 skrócenie żywotności do
3,2 dni. Przepuszczalności komórek zmianie wraz z wiekiem, co wykazano
przez wzrost wycieku jonowej i zmiany właściwości membran, na co wskazuje wyższy pH soku komórkowego i ich wyższą przewodność elektryczną.
155
Julia Rochala, Diana Anna Musiał, Ewa Skutnik, Agata Jędrzejuk
Roztwory 8 HQC z 2% sacharozy i nanosrebra z 2% sacharozy obniżoną
przewodność elektryczną w porównaniu do H2O, ale nie miało wpływu na
pH SAP. Chrysal Prof. 2 nie miał wpływu na parametry membran, ale opóźniony spadek względnej zawartości wody w różyczki.
Słowa kluczowe: sok komórkowy pH, przewodność elektryczna, względna zawartość wody
Introduction
Senescence is a culmination of development for plant organs such as
leaves, flower or fruits. In flowers it is a complex metabolic process
under strict control by developmental and environmental signals.
Visible as wilting and fading of floral organs, senescence is proceeded
and accompanied by the extensive degradation of nucleic acids, proteins and membrane components. Petal senescence is a distinct factor
affecting flower vase life, which is an important determinant of the
quality of cut flowers, decisive not only for distributors but also consumers [Rubinstein 2000, van Doorn and Woltering 2008].
Increased membrane permeability is a characteristic attribute of
senescing plant tissues [Simon 1974]. The physiological consequences
of physical and chemicals changes in the membrane lipids include
modifications in the membrane permeability, loss of membrane bound
enzymatic activity and enhanced efflux of cellular constituents such as
vacuolar pigments and sugars [Mazliak 1981]. Water potential of cut
flowers declines with time and the same is true for water uptake and
water conductivity in the flower stem. The decline in water conductivity is one of the main reasons for impaired water balance. Relative
water content (RWC) represents a useful indicator of the state of plant
water balance [Halevy 1976, Gonzalez and Gonzalez-Vilar, 2001].
The aim of study was to cheeked effect of post-harvest treatments
of selected aspects of senescence of cut florets Cosmos bipinnathus.
Material and methods
Plants of Cosmos bipinnatus ‘Sonata Carmine’ were grown in the fields
of Department of Ornamental Plants of the Warsaw University of Life
Sciences. The stems were harvested at the same stage of development,
i.e. open flowers with no visible mechanical defects or symptoms of
156
Senescence in cut cosmos bipinnatus flowers: water relations and membrane permeability
disease or insect pests and were immediately transferred to laboratory
and trimmed to 40 cm. Shoots were placed in distilled water, the standard preservative composed of 200 mg·dm-3 8-hydroxyquinoline citrate
and 2% sucrose (8-HQC+2% S), the 5 mg·dm-3 solution of nanosilver
with 2% sucrose (Ag+2% S) and the commercial preservative Chrysal
Professional 2 (product of Chrysal International). There were 90 shoots in each treatment, individually tagged and treated as individual
replications. The experiments were conducted at 18–20ºC and a 12 h
photoperiod, provided by luminescence light with a quantum irradiance
of 25 µmol·m-2·s-1. The relative air humidity was maintained at 60%.
Ray florets from each treatment and terms when samples were
collected were used to define the changes in membrane properties.
From ligulate flowers picked from capitulum 10 discs of 10 mm diameter were taken and hydrated by floating and shaking on deionized
water (10 ml) for 24 h. Electrical conductivity (EC) and the pH of
cell sap were determined by the methods described by Whitlow et al.
[1992] using the Microcomputer pH/conductivity meter CPC-551.
To describe relative water content (RWC) ray florets were weighed
(W) then the samples were immediately hydrated by floating on deionized water in a closed Petri dish to full turgidity for 24 h under
normal room light and temperature. After hydration the samples
were taken out of water, drained on a paper tissue and immediately
weighed to obtain fully turgid weight (TW). Next they were dried
at 105ºC for 24h and weighed to determine dry weight (DW). RWC
was calculated as: RWC (%) = [(W-DW) / (TW-DW)] x 100 [Barrs and
Weatherly 1962].
All results were statistically analyzed by ANOVA 2 by SPSS Statistics 21, followed by means’ separation using the Duncan’s test at
α=0.05.
Results and discussion
Field production of specialty cut flowers is increasing due to consumer
and florist interest in new plants. Cut flower growers are always interested in new sizes, shapes and colors of flowers. C. bipinnatus is a very
popular garden annual plant in Europe, but because of its beautiful flowers, this species may also provide cut flowers for floral compositions.
157
Julia Rochala, Diana Anna Musiał, Ewa Skutnik, Agata Jędrzejuk
It is used as such in the United States; the European flower market still
lacks suitable cosmos cultivars and methods allowing to control their
postharvest quality. This creates a broad opportunity for the European
growers and breeders of ornamental plants. The results presented here
provide an insight into postharvest physiology of this species.
Positive influence of 8-HQC+2%S was observed on longevity of
cut C. bipinnatus ‘Sensation’ [Redman et al. 2002]. Longevity of cut
C. bipinnatus ‘Sonata Carmine’ used in this experiment depended on
a treatment (Tab. 1). Vase life of flowers held in water was 3.6 days.
The preservative 8-HQC+2%S increased longevity to 6 days, and
a similar effect was obtained in stems kept in the solution of Ag+2%S
– 5.5 days, while Chrysal Professional 2 reduced vase life to 3.2 days.
The latest result is not surprising as this preservative is not “a flower
food”: it contains little sugar and is used by wholesalers and retailers
to support flower life in a market supply chain.
Tab. 1. Effect of different postharvest solutions on longevity
of cut C. bipinnatus
Treatment
Longevity (days):
H2O (control)
3.6 a*
8-HQC+2% S**
6.1 b
Ag+2% S**
5.5 b
Chrysal Prof. 2
3.2 a
* Means followed by the same letter do not differ significantly at α=0.05
** Solution contains sucrose
Membrane integrity is a prerequisite for enhanced flower longevity. Membrane condition can be evaluated by measuring parameters
relating to the properties of cell sap such as pH and electrical conductivity [Shahri et al. 2011]. During senescence, chemical changes occur
in the cells of petals. The flower color change is generally associated
with a steady increase in the pH of cell sap [Borochov et al. 1976].
158
Senescence in cut cosmos bipinnatus flowers: water relations and membrane permeability
Tab. 2. Effect of treatments on changes in pH of cell sap in florets
of C. bipinnatus.
Treatment
H2O (control)
8-HQC+2% S**
Ag+2% S**
Chrysal Prof. 2
Mean for date
pH of cell sap on day:
2
4
6
5.9 e*
6.1 ef
5.6 d
5.7 d
5.9 b
5.4 c
5.0 b
6.1 ef
4.5 a
5.3 a
6.4 g
6.0 ef
6.4 g
6.0 ef
6.2 c
Mean for treatment
5.9 c
5.7 b
6.0 d
5.4 a
* Means followed by the same letter do not differ significantly at α=0.05
** Solution contains sucrose
Generally, the pH of cell sap in cosmos increased during senescence (Tab. 2). The lowest mean pH was in senescing florets on stems
kept in Chrysal Prof. 2.
Durkin et al. [1991] showed that increase in pH of cell sap, the
evolution of complex molecule hydrolysis (evaluated in terms of the
increase in osmolarity of cell sap) and the increase in ionized forms
(measured by the increased conductivity of cell sap) were all considerably slowed in cut roses kept in a preservative solution.
A typical increase in membrane permeability as measured by the
electrical conductivity of cell sap was observed in the control cosmos
florets, where its value doubled on the 6th day of vase life. Similar situation was observed after Chrysal Prof. 2 application. In senescing
cosmos florets held in the solution 8-HQC+2%S EC was the highest
(Tab. 3) what is an unexpected result in view of the longevity extension by the above preservative. The preservative containing silver
significantly limited the increase in EC. A mechanism of action of both
preservatives on cosmos cut flowers remains therefore to be elucidated.
Tab. 3. Effect of treatments on changes in electrical conductivity
of cell sap in florets of C. bipinnatus
Treatment
H2O (control)
8-HQC+2% S**
Electrical conductivity of cell sap [m
2
4
6
Mean for treatment
12.8 c*
9.0 b
13.1 c
8.0 ab
25.7 e
30.0 f
17.1 c
15.7 b
159
Julia Rochala, Diana Anna Musiał, Ewa Skutnik, Agata Jędrzejuk
Ag+2% S**
Chrysal Prof. 2
Mean for date
8.0 ab
6.5 a
9.1 a
9.1 b
13.4 c
10.9 b
22.7 d
26.5 e
26.2 c
13.3 a
15.5 b
* Means followed by the same letter do not differ significantly at α=0.05
** Solution contains sucrose
During water deprivation the RWC in the plants declines in stressed plants and cutting flowers is one of the important kind of stress
which they have to cope with. Edrisi et al. [2012] suggested that the
water potential relationships of the carnation petals change with age,
resulting in a lower water holding capacity of the petals.
After 6 days of vase life in the control cosmos florets on the stems
held in water, the RWC level dropped by more than one third. All preservatives helped to keep the water content in petals on higher level
relative to control (Tab. 4).
Tab. 4. Effect of treatments on changes in RWC of florets
of C. bipinnatus.
Treatment
H2O (control)
8-HQC+2% S**
Ag+2% S**
Chrysal Prof. 2
Mean for date
RWC [%] on day:
2
4
6
75 ef*
64 cd
58 c
66 cd
b
79 f
81 f
66 cd
81 f
77 c
21 a
36 b
39 b
45 b
35 a
Mean for treatment
58 ab
60 ab
54 a
64 c
* Means followed by the same letter do not differ significantly at α=0.05
** Solution contains sucrose
Conclusions
Treating cosmos cut flowers with solutions containing sucrose and
antibacterial compounds extended the longevity by 2-2.5 day.
During flower senescence the values of the cell sap parameters
increased while the tissue hydration decreased.
Generally, no direct relationship was observed between cell sap
parameters or RWC and the effects of preservatives on cosmos longevity.
160
Senescence in cut cosmos bipinnatus flowers: water relations and membrane permeability
References
Barrs, H. D. Weatherley P. E. 1962. A re-examination of the relative turgidity
technique for estimating water cleficits in leaves. Australian Journal of
Biological Sciences, 15: 413-428.
Borochov A. Mayak S. Halevy A. H. 1976. Combined effects of acid and sucrose on growth and senescence of rose flowers. Plant Physiology, 36:
221-224.
Durkin D. Barthe P. Vaillant V. Arene L. 1991. Effect of preservative solutions on some indicators of senescence in cut rose flowers. Acta Horticulture, 298: 141-144.
Edrisi B. Sadrpoor A. Saffari V. R. Jiroft I. 2012. Effects of chemicals on vase
life of cut carnation (Dianthus caryophyllus L. ‘Delphi’) and microorganisms population in solution. Journal of Ornamental and Horticultural Plants, 2(1): 1-11.
Gonzalez L. Gonzalez-Vilar M. 2001. Determination of relative water content. In: M.J. Reigosa Roger (ed.). Handbook of plant ecophy- siology
techniques. Kluwer Academic Publishers, Dordrecht, the Netherlands:
207-212.
Halevy A. H. 1976. Treatments to improve water balance of cut flowers.
Acta Horticulture, 64: 223-230.
Mazliak P. 1981. Plant membrane lipids: changes and alternations during
ageing and senescence. In: Postharvest physiology and crop preservation. Liberman M. (ed.). Plenum Press. London: 144-145.
Redman P. B. Dole J. M. Maness N. O. Anderson J. A. 2002. Postharvest
handling of nine specialty cut flower species. Scientica Horticulturae,
92(3): 293-303.
Rubinstein B. 2000. Regulation of cell death in flower petals. Plant Molecular Biology, 44: 303-318.
Shahri W. Tahir I. Islam S. T. Bhat M. A. 2011. Physiological and biochemical
changes associated with flower development and senescence in so far
unexplored Helleborus orientalis Lam. cv. Olympicus. Physiology and
Molecular Biology of Plants, 17(1): 33-39.
Simon E. W. 1974. Phospholipids and plant membrane permeability. New
Phytology, 73: 377-420.
Whitlow T. H. Bassuk N. L. Ranney T. G. Reichert D. L. 1992. An improved
method for using electrolyte leakage to assess membrane competence
in plant tissues. Plant Physiology, 98(1): 198-205.
Van Doorn W.G. Woltering E. J. 2008. Physiology and molecular biology
of petal senescence. Journal of Experimental Botany, 59(3): 453-480.
161
Julia Rochala, Diana Anna Musiał, Ewa Skutnik, Agata Jędrzejuk
Adres do korespondencji:
inż. mgr Julia Rochala
Department of Ornamental Plants
Warsaw University of Life Sciences – SGGW
e-mail: [email protected], [email protected]
mgr inż. Diana Anna Musiał
Department of Ornamental Plants
Warsaw University of Life Sciences – SGGW
e-mail: [email protected]
dr hab. Ewa Skutnik
Department of Ornamental Plants
Warsaw University of Life Sciences – SGGW
e-mail: [email protected]
dr Agata Jędrzejuk
Department of Ornamental Plants
Warsaw University of Life Sciences – SGGW
e-mail: [email protected]
Faculty of Horticulture
Biotechnology and Landscape Architecture
Department of Ornamental Plants
ul. Nowoursynowska 166, 02-787 Warszawa
Research supervisor: dr hab. Ewa Skutnik
162
Joanna Śniegowska
Anita Biesiada
EPISTEME
22/2014, t. III
s. 163–170
ISSN 1895-2241
Związki biologicznie czynne i aktywność
antyoksydacyjna w wybranych gatunkach
warzyw z rodziny Brassicaceae
i Asteraceae
Biologically active compounds and
antioxidant activity of some vegetables
from Brassicaceae and Asteraceae family
Abstrakt. Doświadczenie polowe przeprowadzono w 2010 roku w Katedrze Ogrodnictwa UPWr w celu oceny zawartości związków biologicznie
czynnych i aktywności antyoksydacyjnej wybranych gatunków warzyw z rodziny Brassicaceae: kapusta głowiasta (biała, czerwona), kalafior (o białych,
zielonych, fioletowych różach), jarmuż (zielono-, fioletowo-listny) i Asteraceae: sałata siewna (o zielonych i fioletowych liściach), cykoria sałatowa.
Wyższą zawartość witaminy C stwierdzono u roślin z rodziny Brassicaceae
niż Asteraceae, różnica ta wnosiła średnio 85 mg • 100 g-1 ś.m. Największą
zawartość chlorofilu a+b odnotowano w jarmużu (182 mg • 100 g-1 ś.m.),
a najmniej u kapusty głowiastej białej (2,5 mg • 100 g-1 ś.m.). Spośród odmian o purpurowych liściach, największą zawartość antocyjanów miała
kapusta głowiasta czerwona, podczas gdy najmniejszą jarmuż. Wysoką aktywność antyoksydacyjną wykazał kalafior o fioletowych (test DPPH) i zielonych (test ABTS) różach, oraz jarmuż o purpurowych liściach.
Słowa kluczowe: warzywa kapustne, warzywa liściowe, związki biologicznie
czynne, aktywność antyoksydacyjna
Abstract. The field experiment was conducted in 2010 at the Wrocław University of Environmental and Life Sciences in order to assess the content of
biologically active compounds and antioxidant activity of selected species
of vegetables from Brassicaceae and Asteraceae : cabbage (white, red), cauliflower (white, green, violet florets heads), kale (green-,purple-leaf) likewise
lettuce (with green, violet leaf), chicory radicchio. Chemical analyzes showed a higher content of vitamin C in plants of Brassicaceae than Asterace163
Joanna Śniegowska, Anita Biesiada
ae, the difference was over 85 mg • 100 g-1 f.w. The highest chlorophyll a+b
level was noticed in leaves of kale (182 mg • 100g-1 f.w.), while the smallest
one in white cabbage (2.5 mg • 100g-1 f.w.). Among cultivars with the purple
leaves, higher anthocyanins content had red cabbage, while the lowest one
kale. High antioxidant activity were noticed in cauliflower with violet florets
(DPPH test), and with green ones (by ABTS) likewise in purple leaf of kale.
Key words: brassicace vegetables, leafy vegetables, biologically active compounds, antioxidant activity
Wstęp
Związki biologicznie czynne występujące w warzywach i owocach
stanowią znaczące ogniwo aparatu antyoksydacyjnego chroniącego
organizm człowieka, poprzez wiązanie wolnych rodników, przed
stresem oksydacyjnym przyczyniającym się do rozwoju chorób nowotworowych, udarów, zawałów serca oraz przyspieszenia starzenia
się tkanek [Czechi Rusinek 2012, Biegańska-Marecik i RadziejewskaKubzdela 2009].
Ważną grupą związków roślinnych o właściwościach antyoksydacyjnych są polifenole. Charakteryzują się one zdolnością do wiązania,
zmiatania i dysmutacji wolnych rodników i wzmacniania działania
innych antyoksydantów [Gawlik-Dziki 2004, Grajek 2004]. Do grupy związków o właściwościach przeciwutleniających należą również
szeroko rozpowszechnione w świecie roślin barwniki. Chlorofil jest
dla człowieka źródłem magnezu i wspomaga przemianę materii. Karotenoidy są związkami lipofilnymi odpowiadającymi za barwę roślin,
od żółtej po czerwoną. Niektóre są prekursorami witaminy A, chronią
skórę i oczy przed uszkodzeniami UV oraz jako przeciwutleniacze
zapobiegają rozwojowi nowotworów. Antocyjany to barwniki rozpuszczalne w wodzie i w zależności od pH soku komórkowego odpowiadają
za różne zabarwienie roślin: m.in. ich liści, kwiatów, owoców. Charakteryzują się działaniem antykancerogennym, preciwzapalnym oraz
neuroprotekcyjnym [Bołonkowska i in. 2011]. Mniejsze właściwości
przeciwutleniające niż niektóre związki fenolowe posiada witamina
C [Szajdek i Borowska 2004]. Pełni ona jednak wiele dodatkowych
funkcji, m. in. wspomaga wchłanianie żelaza niehemowego, bierze
udział w syntezie kolagenu i pozytywnie wpływa na odporność organizmu [Kunachowicz i in. 2005].
164
Związki biologicznie czynne i aktywność antyoksydacyjna...
Celem badań była ocena zawartości związków biologicznie czynnych i aktywności antyoksydacyjnej u wybranych gatunków i odmian
warzyw należących do rodziny Brassicaceae i Asteraceae.
Materiał i metody
Doświadczenie założono w 2010 roku w Stacji Badawczo- Dydaktycznej Katedry Ogrodnictwa Uniwersytetu Przyrodniczego we Wrocławiu. Badaniem objęto następujące gatunki i odmiany użytkowe roślin
z rodziny Brassicaceae i Asteraceae: kapusta głowiasta biała (Brassica
oleracea var. capitata f. alba) ‘Menza F1’, kapusta głowiasta czerwona (Brassica oleracea var. capitata f. rubra) ‘Langendijker’, kalafior
(Brassica oleracea var. botrytis) ‘Rober’, ‘Noverde’, Graffiti F1’, jarmuż
(Brassica oleracea var. acephala) ‘Vitessa’, Redbor F1’ oraz sałata siewna (Lactuca sativa var. capitata) ‘Lollo Bionda’, ‘Lollo Rosa’ i cykoria
(Cichorium intybus var. foliosum) ‘Indigo’.
Doświadczenie polowe założono na czarnej ziemi zdegradowanej
należącej do klasy bonitacyjnej IIIa o pH 7,65 i zasoleniu 0,1 g NaCl ·
l-1, zawierającej następujące ilości składników: N-NO3 19 mg · dm-3, Mg
106 mg · dm-3, P 180 mg · dm-3, Ca 1750 mg · dm-3, K 200 mg · dm-3.
Rozsadę produkowano w wielodoniczkach wypełnionych substratem
torfowym w ogrzewanej szklarni. Na 10 dni przed wysadzeniem na
miejsce stałe rozsadę zahartowano w nieogrzewanym tunelu foliowym. Przed posadzeniem roślin pole nawieziono saletrą amonową
w dawce 100 kg N · ha-1. Rozstawa dla roślin kapustnych wynosiła 45
cm x 45 cm, dla sałaty i cykorii 25 cm x 25 cm. W czasie uprawy rośliny
podlewano i odchwaszczano ręcznie. Zbiór warzyw przeprowadzono
w fazie dojrzałości konsumpcyjnej.
W świeżej masie części jadalnych badanych gatunków warzyw
oznaczono zawartość cukrów redukujących i ogółem metodą Lane-Eynona (PN-90/A-75101/07), witaminy C metodą Tillmansa (PN-90/A-75101/11), antocyjanów metodą Fuleki i Francisa (Feluki,
Francis 1968), polifenoli ogółem metodą Folina-Ciocalteu (Slinghart,
Singleton 1977), karotenoidów oraz chlorofilu a i b metodą kolorymetryczną (Bielecki i in. 1997). Dodatkowo przeprowadzono analizę
właściwości przeciwutleniających: całkowity potencjał przeciwutleniający metodą FRAP, aktywność antyoksydacyjną metodą ABTS (Re
165
Joanna Śniegowska, Anita Biesiada
i in. 1999) i siłę zmiatania rodników 2,2- difenylo- 1- pikrylohydrozylowych DPPH (Yen and Chen 1995).
Wyniki i dyskusja
Największą zawartością karotenoidów, polifenoli i witaminy C charakteryzował się jarmuż, co potwierdzają Łata i Wińska-Krysiak
[2006] oraz Biegańska-Marecik i Radziejewska-Kubzdela [2009].
Czech i Rusinek [2012] badając zawartość związków przeciwutleniających wykazały zwiększoną zawartość witaminy C w warzywach
o ciemnym zabarwieniu liści (Tab.1). Również w badaniach własnych
przeprowadzonych na odmianach kalafiora, jarmużu i sałaty odnotowano podobną zależność, natomiast odmiany kapusty nie wykazały
takiej zależności. Najmniejszą zawartość witaminy C stwierdzono
w warzywach z rodziny Asteraceae, a szczególnie w sałacie masłowej
‘Lollo Bionda’ (3,97 mg • 100 g-1 ś.m.). Spośród odmian o barwnych
liściach, największą zawartość antocyjanów odnotowano w kapuście
czerwonej odmiany ‘Langendijker’- 93,34 mg • 100 g-1 ś.m., wynik ten
był jednak zdecydowanie niższy od średniej uzyskanej przez Biesiadę
i in. [2010]. Odnotowano stosunkowo niską zawartość antocyjanów
w jarmużu (14,45 mg • 100 g-1 ś.m.) i sałacie (14,08 mg • 100 g-1 ś.m.).
Największą zawartość cukrów stwierdzono w kapuście głowiastej białej, w zakresie 3,5- 3,8 % cukrów redukujących i 3,95-4,28 % cukrów
ogółem, wykazując wartości wyższe niż Biesiada i in. [2010]. Wśród
warzyw liściowych przeszło dwukrotnie większą zawartość cukrów
odnotowano w cykorii sałatowej niż w sałacie masłowej. Wyniki Majkowskiej-Godamskiej i Wierzbickiej [2005] oraz Francke i Majkowskiej-Gadomskiej [2008], potwierdzają tę zależność. Podsędek [2007]
w swojej pracy analizowała zawartość karotenoidów w warzywach
kapustnych, wykazując ich zawartość w odmianach czerwonych kapusty głowiastej na poziomie 0,43 mg • 100 g-1 ś.m., w białych 0,26 mg
• 100 g-1 ś.m. natomiast w jarmużu 39,55 mg • 100 g-1 ś.m. Podobne
rezultaty wykazujące śladową zawartość karotenoidów w główkach
kapusty i wysoką w jarmużu uzyskano w badaniach własnych. Kaur
i Kapoor [2002] wykazali ścisłą zależność pomiędzy zawartością polifenoli a właściwościami przeciwutleniającymi warzyw: im większa
zawartość polifenoli tym wyższe właściwości przeciwutleniające.
166
średnia
1,14
Indigo
0,96
Lollo rosa
2,12
0,89
0,82
Lollo bionda
1,19
1,25
Vitessa
Redbor F1
2,62
3,05
Graffiti F1
* nie oznaczono- śladowe ilości
Cykoria sałatowa
średnia
Sałata siewna
Jarmuż
średnia
2,14
2,68
3,65
3,50
3,80
% Cukry
redukujące
Noverde
Rober
Langedijker
Kapusta głowiasta
czerwona
Kalafior
Menza F1
Kapusta głowiasta
biała
średnia
Odmiana
botaniczna
Gatunek
2,42
1,14
1,10
1,19
1,62
1,66
1,58
2,79
3,18
2,24
2,97
4,11
4,28
3,94
6,71
6,85
9,73
3,97
121,29
122,63
119,94
110,58
104,83
146,75
80,17
44,05
34,51
55,39
%Cukry
Witamina C
ogółem
39,43
-
14,45
-
-
14,08
-
-
47,30
-
-
-
93,34
-
Antocyjany
272,64
96,05
192,00
100,10
339,47
336,79
342,16
206,46
225,62
244,31
119,45
170,87
259,91
81,84
Polifenole
0,35
-
no*
6,04
20,26
22,24
18,28
0,30
0,03
0,88
0,00
-
no*
0,00
Karotenoidy
Tab.1. Związki biologicznie czynne w wybranych roślinach warzywnych (mg • 100 g -1 ś.m.)
3,47
32,49
30,03
34,95
181,76
194,51
169,01
5,64
3,61
10,31
2,99
-
no*
2,57
Chlorofil
a+b
Związki biologicznie czynne i aktywność antyoksydacyjna...
167
Joanna Śniegowska, Anita Biesiada
Tab.2. Właściwości przeciwutleniajace wybranych gatunków warzyw
(µM Trolox • g -1 ś.m.).
Gatunek
Odmiana botaniczna
FRAP
ABTS
DPPH
Kapusta głowiasta biała
Menza F1
2,62
5,05
3,15
Kapusta głowiasta
czerwona
Langedijker
11,79
18,55
5,52
średnia
Kalafior
7,20
11,80
4,33
Rober
4,89
10,26
9,62
Noverde
11,05
39,00
8,47
Graffiti F1
7,27
19,94
9,97
7,74
23,06
9,35
Vitessa
11,71
26,84
8,59
Redbor F1
13,86
31,31
9,49
średnia
Jarmuż
średnia
Sałata siewna
12,78
29,07
9,04
Lollo bionda
2,37
9,34
1,55
Lollo rosa
4,11
21,96
2,35
3,24
15,65
1,95
5,06
19,81
8,43
średnia
Cykoria sałatowa
Indigo
Tab.3. Współczynnik korelacji pomiędzy zawartością polifenoli
a aktywnością antyoksydacyjną.
Korelacja
Polifenole
Kapusta
Kalafior
Jarmuż
Sałata
Cykoria
FRAP
-0,87112
-0,83143
0,547418
-0,62546
0,218948
ABTS
0,704638
0,870664
0,812453
0,389455
-0,0907
DPPH
0,815848
0,999629
-0,9917
0,999825
0,13859
W badaniach własnych zależność ta została zaobserwowana, w korelacji z testem DPPH, w sałacie, kapuście i kalafiorze. Największą
całkowitą aktywnością antyoksydacyjną odnotowano w jarmużu,
średnia z odmian wyniosła 29,07 µM Trolox • g -1 ś.m., według Biegańskiej-Marecik i Radziejewska-Kubzdela [2009] wartość ta sięga 11,34
µM Trolox • g -1 ś.m.
168
Związki biologicznie czynne i aktywność antyoksydacyjna...
Wnioski
1. Rośliny z rodziny Brassicace a szczególnie jarmuż charakteryzowały się większą wartością odżywczą mierzoną poziomem cukrów,
witaminy C, polifenoli, karotenoidów, chlorofilu a+b w porównaniu
do przedstawicieli rodziny Asteraceae.
2. Większe właściwości antyoksydacyjne wykazywały odmiany roślin warzywnych o antocyjanowo wybarwionych częściach jadalnych.
3. Zaobserwowano pozytywny wpływ wzrostu zawartości polifenoli w warzywach kapustnych na ich aktywność antyoksydacyjną.
Bibliografia
Biegańska-Marecik R., Radziejewska- Kubzdela E. 2009. Zmiany zawartości związków fenolowych i zdolności przeciwutleniającej w jarmużu
o małym stopniu przetwarzania pakowanym w atmosferze modyfikowanej. Biomat.chem.toksykol. –XLII, 3: 854-860.
Bielecki K., Demczuk A., Grzyś E., Skrabka H. 1997.Skrypt- Ćwiczenia
z fizjologii roślin. Wyd. Akademii Rolniczej we Wrocławiu.
Biesiada A., Nawirska- Olszańska A., Kucharska A., Sokół- Łętowska A,
Kędra K. 2010. The effect of nitrogen fertilization on nutritive value
and antioxidant activity of red cabbage. Acta Sci. Pol., Hortorum Cultus 9 (2): 13-21.
Bołonkowska O., Pietrosiuk A., Sykłowska-Baranek K. 2011 Roślinne
związki barwne i ich właściwości biologiczne oraz możliwości wytwarzania w kulturach in vitro. Biul. Wydz. Farm. WUM 1: 1-13.
Czech A., Rusinek E. 2012. Zawartość związków przeciwutleniajacych
w wybranych warzywach kapustnych. Biomat.chem. toksykol. –XLV,1:
59-65.
Francke A., Majkowska- Gadomska J. 2008. Effect of planting date and
method on the chemical composition of radicchio heads. J. Elementol.
13 (2): 199-204.
Fuleki T., Francis F.J. 1968. Quantitative Methods for Anthocyanins. 1.
Extraction and Determination of Total Anthocyanin in Cranberries.
J. Food Sci. 33: 72-77.
Gawlik- Dziki U. 2004. Fenolokwasy jako bioaktywne składniki żywności.
Żywność. Nauka. Technologia. Jakość. 4(41)S,29–40.
Grajek W. 2004. Rola przeciwutleniaczy w zmniejszeniu ryzyka wystąpienia
nowotworów i chorób układu krążenia. Żywność. Nauka. Technologia.
Jakość. 1:4.
169
Joanna Śniegowska, Anita Biesiada
Kaur C., Kapoor H.C., 2002. Anti- oxidant activity and total phenolic content of some Asian vegetables. International Jurnal of Food Technology. 37: 153- 161.
Kunachowicz K., Nadolna I., Iwanow K., Przygoda B. 2005. Wartość odżywcza wybranych produktów spożywczych i typowych potraw. Wyd. lek.
PZWL.
Łata B., Wińska- Krysiak M. 2006. Skład chemiczny jarmużu uprawianego
na dwóch typach gleby. Acta Agrophysica 7 (3): 663-670.
Majkowska- Godamska J., Wierzbicka B. 2005. Wpływ terminu uprawy
i sorbentów na plon i zawartość wybranych składników pokarmowych
w liściach sałaty. Zeszyty Naukowe Akademii Rolniczej we Wrocławiu.
859 (515): 339-345.
Podsędek A. 2005. Natural antioxidants and antioxidant capacity of Brassica vegetables: A review. Elsevier LWT 40: 1-11.
Re R., Pellegrini N., Proteggente A., Pannala A., Yang M., 1999. Antioxidant
activity applying an improved ABTS radical cation decolorization assay.
Free Radical Biology & Medicine, 26,1231–1237.
Slinghart K., Singleton V. L., 1977. Total phenol analysis: automation and
comparison with manual method. Am. J. Enol. Vitic., 28, 49–55.
Szajdek A., Borowska E.J. 2004. Właściwości przeciwutleniające żywności
pochodzenia roślinnego. Żywność. Nauka. Technologia. Jakość. 41:
1-24.
Yen. G.C., Chen. H.Y., 1995. Antioxidant activity of various tea extracts in
relation to their antimutagenicity. J. Agric. Food Chem., 43, 27–32.
Adres do korespondencji:
mgr inż. Joanna Śniegowska
Katedra Ogrodnictwa
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. inż. Anita Biesiada
170
Karolina Wietnik
Piotr Muras
Anna Kołton
Monika Czaja
EPISTEME
22/2014, t. III
s. 171–177
ISSN 1895-2241
OCENA STANU FIZJOLOGICZNEGO APARATU
FOTOSYNTETYCZNEGO TRZECH GATUNKÓW
RÓŻANECZNIKÓW (RHODODENDRON SP.)
W OKRESIE SPOCZYNKU
PHOTOSYNTHETIC APPARATUS CONDITION OF
THREE RHODODENDRON SPECIES (RHODODENDRON
SP.) DURING THE DORMANCY PERIOD
Abstrakt. Liście roślin zimozielonych narażone są na niekorzystne warunki środowiska w okresie zimy. Czynniki takie jak niska temperatura oraz
jej wahania dobowe, wysuszające wiatry i pokrywa śnieżna uniemożliwiają
pobieranie wody z zamarzniętej gleby oraz wywołują zjawisko suszy fizjologicznej. Uszkodzenia wywołane tymi czynnikami występują przede wszystkim w błonach biologicznych, a ich konswkwencją są zaburzenia procesów
fizjologicznych w komórce. Fluorescencja chlorofilu a jest wykorzystywana
jako bardzo precyzyjne narzędzie do określania reakcji aparatu fotosyntetycznego na warunki stresowe. W doświadczeniu wykonano pomiar fluorescencji chlorofilu a oraz analizę zawartości barwników asymilacyjnych
w liściach trzech wschodnioazjatyckich gatunków różaneczników (Rhododendron sp.). Analizy wykonywano co 2 tygodnie, od października (2012)
do marca (2013). Najlepiej niekorzystne warunki mrozowe znosił gatunek
R. yakushimanum „Koichiro Wada” (RKW). Liście R. purdomii i R. brachycarpum charakteryzowały się niższym parametrem Fv/Fm niż RKW. Pomiar
fluorescencji chlorofilu a w ocenie tolerancji tych roślin na mróz można
uznać za w pełni przydatny.
Słowa kluczowe: Rhododendron sp., fluorescencja chlorofilu a, rośliny zawsze
zielone
Abstract. Evergreen leaves are exposed to adverse environmental conditions during the winter. Factors such as: low temperature and its diurnal
changes, drying winds and snow cover hinder the water uptake causing
the phenomenon of physiological drought. The damage caused by these
factors are mainly observed on biological membranes. As a consequence,
physiological processes in the cell are changed. Chlorophyll a fluorescence is
171
Karolina Wietnik, Piotr Muras, Anna Kołton, Monika Czaja
used as a very precise tool for determining the response of photosynthetic
apparatus to stress conditions. Chlorophyll a fluorescence and content of
assimilation pigment in the leaves were measured during the experiment.
Three East-Asian species of Rhododendron were analyzed during the research. Plant samples were collected every 2 weeks, from October (2012) to
March (2013). The best tolerance to frost showed. R. yakushimanum „Koichiro Wada”. The values of Fv/Fm parameter showed by R. purdomii and
R. brachycarpum were lower than for R. yakushimanum „Koichiro Wada”.
Key words: Rhododendron sp, fluorescence of chlorophyll a, evergreen plants
Wstęp
Różaneczniki to rośliny zawsze zielone, a starzenie się i opadanie ich
liści rozciąga się na cały rok. Rośliny z rodzaju Rhododendron odznaczają się ogromnym zróżnicowaniem pod względem mrozoodporności.
Wrażliwość na mróz jest różna w zależności od części krzewów. Do
najodporniejszych należy kora, mniej odporne są liście oraz ksylem
(drewno), zaś najwrażliwszą częścią krzewów są pąki generatywne [Sakai i in. 1996]. Zimotrwałość różaneczników zależy od ich zdolności
do uniknięcia odwodnienia komórek pędów i liści [Czekalski 1991].
Podczas zimy mrozoodporność krzewów ulega ciągłym zmianom.
Różaneczniki wykazują największą odporność na mrozy od grudnia
do końca lutego [Pellet i Holt 1981, Wagner 1996]. W zależności od
przebiegu pogody i czasu trwania mrozu występują różne uszkodzenia
u tych samych taksonów [Houghton 1995, Morsink 2000]. Odporność
na niskie temperatury jest związana z dostosowaniem rytmiki rozwoju krzewów do warunków klimatycznych środkowej Europy [Wagner
1996, Tigersted 2002]. Według Wagner [1996], obiektywną metodą
oceny mrozoodporności i zimotrwałości różaneczników jest ta, dokonana po mroźnej zimie w miejscu ich występowania. Obserwacje
zmian morfologicznych powstałych w wyniku uszkodzeń mrozowych
w warunkach polowych są jednak długotrwałe i kosztowne. Dlatego
wykorzystuje się często metody laboratoryjne do oceny tolerancji
mrozowej zimozielonych tkanek.
Celem prezentowanego doświadczenia była ocena stanu fizjologicznego aparatu fotosyntetycznego trzech gatunków różaneczników
(Rhododendron sp.) w czasie trwania spoczynku zimowego.
172
Ocena stanu fizjologicznego aparatu fotosyntetycznego trzech gatunków różaneczników...
Materiał i metody
Doświadczenie prowadzono od października 2012 do marca 2013.
Obiektami badań były jednoroczne liście różaneczników, wykształcone w sezonie wegetacyjnym 2012 roku:
1. R. yakushimanum „Koichiro Wada” (RKW)
2. R. purdomii (RP)
3. R. brachycarpum (RB)
Materiał pobierano co dwa tygodnie w godzinach porannych.
W każdym terminie ścinano losowo 10-15 liści z części sferycznej
korony krzewów.
Fluorescencję chlorofilu a mierzono przy użyciu Fluorymetru
Handy PEA firmy Hansatech, nie później niż 2 godziny od momentu
pobrania liści. Do oceny reakcji roślin wybrano parametr Fv/Fm. Pomiary wykonywano po uprzednim zaadaptowaniu liści do ciemności.
Zawartość barwników asymilacyjnych oznaczono spektrofotometrycznie w ekstrakcie acetonowym [Wellburn 1994].
Uzyskane dane opracowano statystycznie z wykorzystaniem testu ANOVA (Statistica wersja 9), a różnice oceniono testem NIR Fishera dla α=0,05.
Grupy jednorodne wyznaczono w obrębie poszczególnych gatunków.
7,3
6,4
6
5,2
4,6
4,6
2,9
3,1
2,4
2,2
1,8
1,2
2
0
-0,3
-2
-2,7
-4
-6
-3,5
-1,4
-1,8
-3
-4,1
lis-12
sty-13
lut-13
12 tydz.
11 tydz.
9 tydz.
10 tydz.
7 tydz.
6 tydz.
5 tydz.
4 tydz.
2 tydz.
3 tydz.
1 tydz.
51 tydz.
gru-12
52 tydz.
50 tydz.
48 tydz.
47 tydz.
46 tydz.
44 tydz.
paź-12
45 tydz.
-6,1
43 tydz.
-8
-1,1
-2,4
-4,5
49 tydz.
temperatura [˚C]
4
8 tydz.
8
mar-13
Ryc. 1. Rozkład średnich temperatur powietrza w kolejnych tygodniach
od października 2012 do marca 2013
Pod koniec października oraz listopada (od 43 do 48 tygodnia
roku) nie zanotowano znacznego spadku temperatur poniżej 0˚C
i przez większość dni średnie temperatury utrzymywały się powyżej
5˚C. Utrzymujące się temperatury mrozowe zanotowano na początku
grudnia (49 tydzień). Pod koniec grudnia zanotowano wzrost temperatury po czym pod koniec stycznia 2013 roku zaobserwowano
173
Karolina Wietnik, Piotr Muras, Anna Kołton, Monika Czaja
wyraźne obniżenie się temperatur (średnia temperatura tygodniowa
wynosiła -6.1˚C). W kolejnych tygodniach średnie temperatury zawierały się w przedziale od -3˚C do 3,1˚C. Przy czym w ostatnim tygodniu
zbioru materiału średnie temperatury tygodniowe były niższe od 0˚C.
Wyniki i dyskusja
W przeprowadzonym doświadczeniu zaobserwowano, że wartość
parametru fluorescencji Fv/Fm nie różni się istotnie dla RP i RKW
w pierwszych trzech terminach analiz (ryc. 2). Natomiast wartość
Fv/Fm była stała aż do początku stycznia u RKW. W przypadku RB
wartość tego parametru zmieniła się już w drugim terminie pobierania materiału. Wraz z obniżeniem temperatury w styczniu obniżyła
się wartość parametru fluorescencji Fv/Fm o 7%, utrzymując się do
11.03 na podobnym poziomie u RKW. Pod koniec marca nastąpiło ponowne obniżenie parametru Fv/Fm u wszystkich gatunków.
Analizując liście różaneczników RP i RB zaobserwowano, że wzrost
i obniżenie się wartości fluorescencji chlorofilu a zależy od przebiegu
pogody. Niskie wartości tego parametru dla RP i RB odnotowano
w grudniu i styczniu. Wykazano również, około 50% spadek maksymalnej wydajności kwantowej PS II pod koniec marca RP i RB. RKW
przyjmował najwyższą wartość Fv/Fm we wszystkich terminach
analiz. Bjorkman i Demming ustalili, że dla zdrowych roślin naczyniowych prawidłowy stosunek Fv/Fm powinien wynosić 0,83 [Garstka 1999]. Najbliżej tej wartości są wyniki pomiarów fluorescencji
różanecznika RKW 0,77 (średnio z całego doświadczenia). Obniżenie
wartości parametru Fv/Fm świadczy o uszkodzeniach wywołanych
przez czynniki stresowe w zimie [Kalaji i Łoboda 2009]. Takie obniżenie obserwowane było u RB i RP w trakcie zimy co świadczy
o ich gorszej kondycji w tym trudnym okresie. Lundmark i in. [1998]
także dowodzą, że wskutek zimowych przymrozków stosunek Fv/
Fm zmniejsza się, a wahania dobowe temperatur silnie oddziałują
na wartość parametru Fv/Fm. Oliveira i Peñuelas [2000], wykazali,
że u roślin występujących w rejonie Morza Śródziemnomorskiego
Quercus ilex i Cissus albidus, wystepuje obniżenie sprawności PSII
wyrażone stosunkiem Fv/Fm w okresie zimowym, a szczególnie
w chłodne dni.
174
a
e
c
d
bc
cd
a
a
a
0,300
a
b
b
abc
bcd
cd
d
d
0,500
ab
Fv/Fm
0,600
0,400
bc
b
e
bc
b
b
f
cd
cde
def
def
f
f
f
e
0,700
e
0,800
f
0,900
ef
Ocena stanu fizjologicznego aparatu fotosyntetycznego trzech gatunków różaneczników...
0,200
0,100
0,000
26/10/12 09/11/12 23/11/12 06/12/12 19/12/12 03/01/13 15/01/13 30/01/13 14/02/13 25/02/13 11/03/13 26/03/13
RP
RB
RKW
Ryc. 2. Wartość parametru fluorescencji Fv/Fm liści trzech gatunków różaneczników. Litery oznaczają grupy jednorodne wyznaczone dla każdego
gatunku oddzielnie, przy a=0,05
Najwyższą zawartość chlorofilu a w każdym z analizowanych
terminów odnotowano u RKW (ryc. 3) spośród wszystkich badanych
różaneczników. W przypadku różaneczników RKW najwyższą istotnie statystycznie zawartość chlorofilu a wykazano podczas analiz
3 stycznia 2014. Analizując zawartość barwnika u gatunków RP i RB
obserwowano niewielkie wahania w czasie. Stres wywołany czynnikami abiotycznymi takimi jak susza glebowa czy ekstremalne temperatury powietrza wpływa na indukcję procesu starzenia. Podczas tego
procesu zaburzona zostaje aktywność fotosyntetyczna, następuje
rozpad wielu struktur komórkowych w tym chloroplastów oraz chlorofilu [Zhang i Zhou 2012].
Najlepszą tolerancją na niekorzystne warunki zimowe odznaczał
się RKW o czym świadczy wysoka wartość parametru Fv/Fm oraz
wysoka zawartość chlorofilu a. Obserwacje te ściśle połączone są
z morfologiczną budową Rhododendron yakushimanum odmiany
‘Koichiro Wada’. Liście tego gatunku pokryte są grubą warstwą jasnobrunatnego kutneru, który stanowi naturalną ochronę przed niskimi
temperaturami, także transpiracją [Czekalski 1991].
175
d
c
ba
a
ba
bca
a
bcd
bc
bcd
bcd
ba
b
a
ba
bcde
cdef
cdef
cdef
efgh
b
g
h
ba
ba
bcda
ef
defg
b
c
c
b
def
fgh
1,800
1,600
1,400
1,200
1,000
0,800
0,600
0,400
0,200
0,000
fg
gh
mg * gˉ1 śm.m.
Karolina Wietnik, Piotr Muras, Anna Kołton, Monika Czaja
26/10/12 09/11/12 23/11/12 06/12/12 19/12/12 03/01/13 15/01/13 30/01/13 14/02/13 25/02/13 11/03/13 26/03/13
RP
RB
RKW
Ryc. 3. Wartość parametru fluorescencji Fv/Fm liści trzech gatunków różaneczników. Litery oznaczają grupy jednorodne wyznaczone dla każdego
gatunku oddzielnie, przy a=0,05
Bibliografia
Czekalski M. 1991. Różaneczniki. PWRiL, Warszawa.
Garstka M. 1999. Fotosynteza. Wydawnictwo Naukowo-Techniczne,
Warszawa: 211-219.
Houghton R.A. 1995. ARS hardiness reporting criteria. J. Am. Rhod. Soc.,
49 (3), 234.
Kalaji M.H., Łoboda T. 2009. Fluorescencja chlorofilu w badaniach stanu
fizjologicznego roślin. Wydawnictwo SGGW, Warszawa: 29-82.
Lundmark T., Bergh J., Strand M., Koppel A. 1998. Seasonal variation of
maximum photochemical efficiency in boreal Norway spruce stands.
Trees 13: 63-67.
Morsink W.A.G. 2000. Estimating hardiness using cold duration and extent
of shelter. J. Am. Rhod. Soc., 54 (2), 70-73.
Oliveira G., Peñuelas J. 2000. Comparative photochemical and phenomorphological responses to winter stress of an evergreen (Quercus ilex
L.) and a semi-deciduous (Cissus albidus L.) Mediterranean woody species. Acta Oecologica 21 (2), 97-107.
Pellet N.E., Holt M.A. 1981. Comparison of flower bud cold hardiness of
several cultivars of Rhododendron ssp. Hort. Science, 16 (5), 675-676.
Sakai A., Fuchigami L., Weiser C.J. 1996. Cold hardiness in the genus Rhododendron. J. Amer. Soc. Hort. Sci., 111 (2), 273-280.
Tigerstedt P.M.A. 2002. Züchtung von Rhododendron für extreme Klimaverhältnisse. Rhododendron und immergrüne Laubgehölze, Jahrbuch,
117-133.
176
Ocena stanu fizjologicznego aparatu fotosyntetycznego trzech gatunków różaneczników...
Wagner I. 1996. Vergleichbarkeit von Literaturangaben zur Frosttoleranz
von Rhododendron. Rhododendron und immergrüne Laubgehölye,
Jahrbuch, 83-93.
Wellburn A.R. 1994. The spectral determination of chlorophylls a and b as
well as total carotenoids, using various solvents with spectrophotometers of different resolution. Journal of Plant Physiology, 144:307-313.
Zhang H., Zhou C. 2012. Signal transduction in leaf senescence. Plant molecular biology. 82 (6), 539-45.
Adres do korespondencji:
mgr inż. Karolina Wietnik
Katedra Dendrologii i Architektury Krajobrazu
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
dr hab. Prof. UR Piotr Muras
Katedra Dendrologii i Architektury Krajobrazu
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
dr inż. Anna Kołton
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Instytut Biologii Roślin i Biotechnologii
Zakład Botaniki i Fizjologii Roślin
e-mail: [email protected]
mgr inż. Monika Czaja
Katedra Dendrologii i Architektury Krajobrazu
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
Opiekun naukowy: dr hab. inż. Piotr Muras, Prof. UR
177
Anna Witek
Maja Dobińska
Elżbieta Wojciechowicz-Żytko
EPISTEME
22/2014, t. III
s. 179–186
ISSN 1895-2241
ZALEŻNOŚCI POMIĘDZY CZYNNIKAMI
SIEDLISKOWYMI A LICZEBNOŚCIĄ I BOGACTWEM
SKŁADU GATUNKOWEGO MUCHÓWEK
NALEŻĄCYCH DO RODZINY SYRPHIDAE
W OKOLICY OJCOWSKIEGO PARKU NARODOWEGO
DEPENDENCIES BETWEEN HABITAT FACTORS
AND THE ABUNDANCE AND RICHNESS OF SYRPHID
SPECIES (DIPTERA, SYRPHIDAE) IN THE AREA
OF OJCOWSKI NATIONAL PARK
Abstrakt. Celem pracy było stwierdzenie zależności pomiędzy czynnikami
siedliskowymi a liczebnością i bogactwem składu gatunkowego muchówek
należących do rodziny Syrphidae. Z kwiatów występujących na badanych
stanowiskach odłowiono łącznie 135 muchówek należących do rodziny
Syrphidae, które przyporządkowano do 18 gatunków. Spośród wszystkich
odłowionych gatunków wydzielono trzy grupy troficzne. Największą liczbę
osobników i jednocześnie gatunków stanowiły gatunki drapieżne. Koprofagi i saprofagi wodne stanowiły niewielki procent ogólnej liczby odłowionych
muchówek. Występowanie Syrphidae było zależne od czynników siedliskowych takich jak obecność zadrzewień, stopień nasłonecznienia i zanieczyszczenia oraz odległość od Ojcowskiego Parku Narodowego. Zanieczyszczenie
środowiska zdaje się nie mieć znaczącego negatywnego wpływu na liczebność i skład gatunkowy Syrphidae.
Słowa kluczowe: Ojcowski Park Narodowy, Syrphidae, skład gatunkowy, grupy troficzne, warunki siedliskowe.
Summary. The aim of this study was to determine the relationship between
habitat factors and abundance and richness of species composition Diptera
in the family of Syrphidae. During the observations 135 specimens of Syrphidae belonging to the 18 species were collected. The greatest number of
individuals and species were predatory Syrphids. Water’s saprophags and
coprophags constituted small amount of collected Diptera. The occurrence
179
Anna Witek, Maja Dobińska, Elżbieta Wojciechowicz-Żytko
of Syrphidae was dependent on habitat factors such as the presence of trees,
degree of pollution, sunlight and the distance from the Ojcowski National
Park. Environmental pollution does not seem to have a significant negative
impact on the abundance and species composition of Syrphidae.
Key words: Ojcowski National Park, Syrphidae, species composition, thropic
groups, habitat factors
Wstęp
Biorąc pod uwagę istniejące dla środowiska naturalnego zagrożenia
coraz większy nacisk kładzie się na prowadzenie stałego monitoringu
tworzących go komponentów, w tym również entomofauny. Stale
pozyskiwane informacje na temat jej przemian mogą stworzyć możliwość zdiagnozowania stanu środowiska i tempa zachodzących w nim
zmian oraz prognozowania jego kolejnych przekształceń [Chudzicka
i Skibińska 2000]. Jedną z grup owadów, która mogłyby posłużyć do
biomonitoringu zmian środowiska, mogą być muchówki (Diptera),
w tym stosunkowo dobrze poznana rodzina Syrphidae. Jak większość
muchówek, tak i Syrphidae są wrażliwe na zmiany warunków atmosferycznych i siedliskowych. Zagrożeniem dla bzygowatych jest degradacja
środowiska związana z działalnością człowieka. Chodzi tu w dużej mierze o zanieczyszczenie powietrza, wód i gleb na skutek emitowania do
nich różnego rodzaju zanieczyszczeń [Krzemiński i in. 2000].
Celem opracowania było stwierdzenie zależności pomiędzy różnorodnymi czynnikami siedliskowymi a liczebnością i bogactwem składu
gatunkowego muchówek należących do rodziny Syrphidae.
Materiał i metody
Badania prowadzono od maja do września 2012 roku na czterech stanowiskach zlokalizowanych w okolicy Ojcowskiego Parku Narodowego
oraz chroniącej go otuliny (Sułoszowa, Skała, Czajowice, Modlnica).
Stanowiska te były zróżnicowane między sobą pod kilkoma względami wynikającymi z wystawienia tych miejsc na działanie czynników
o zróżnicowanych parametrach (Tab. 1). Oceny stopnia zanieczyszczenia dokonano na podstawie wizualnego oszacowania ilości oraz
bliskości źródeł zanieczyszczeń (np. dróg) w pobliżu poszczególnych
stanowisk. Nasłonecznienie zostało ocenione na podstawie stopnia
zacienienia stanowisk.
180
Zależności pomiędzy czynnikami siedliskowymi a liczebnością...
Tab. 1. Zróżnicowanie warunków siedliskowych
na poszczególnych stanowiskach
Czynnik
Stanowisko
Nasłonecznienie
Zadrzewienia
Zanieczyszczenie
Odległość
od OPN
Sułoszowa
++
+++
+
++**
Skała
++
++
++
++**
Czajowice
+++
++
+++
+*
Modlnica
+
++
+
+++***
+ najmniejsze nasilenie czynnika
++ średnie nasilenie czynnika
+++ największe nasilenie czynnika
OPN – Ojcowski Park Narodowy (* <1 km, ** 1.0 – 1.5 km *** >3 km)
Stosowano metodę „na upatrzonego” z wykorzystaniem siatki entomologicznej, przy użyciu której odławiano muchówki siedzące na liściach
i kwiatach roślin (m.in. krwawnik pospolity, rumian polny, wyka ptasia).
Owady odławiano w odstępach dwutygodniowych (8 odłowów z każdego
stanowiska), w godzinach popołudniowych, w zależności od przebiegu
warunków pogodowych. Muchówki oznaczano do gatunku na podstawie
klucza Bańkowskiej [1963], van Veena [2004] oraz Haarto i Kerppola
[2007]. Udział procentowy poszczególnych gatunków wyliczono według
wzoru podanego przez Szujeckiego [1980] i na tej podstawie ustalono
dominację gatunków posługując się skalą zawartą w pracy Petryszaka
[1982]. Częstotliwość występowania gatunków na poszczególnych stanowiskach obliczono według wzoru podanego przez Trojana [1975].
Wyniki i dyskusja
Skład gatunkowy Syrphidae. Z kwiatów rosnących na badanych stanowiskach odłowiono 135 muchówek należących do 18 gatunków. Na
poszczególnych stanowiskach liczebność bzygowatych, jak również
skład gatunkowy, były różne. Najliczniej występującymi gatunkami były
Episyrphus balteatus i gatunki z rodzaju Sphaerophoria, które stanowiły 60% ogółu odłowionych muchówek i jednocześnie występowały na
wszystkich stanowiskach (Tab. 3). Episyrphus balteatus był odławiany
181
Anna Witek, Maja Dobińska, Elżbieta Wojciechowicz-Żytko
najczęściej na stanowiskach w Modlnicy i Skale (na obu stanowiskach
jego frekwencja wynosiła 75%), a najrzadziej na stanowisku w Sułoszowej (37,5%). Częstotliwość występowania gatunku Sphaerophoria
scripta kształtowała się jednakowo na stanowiskach w Sułoszowej
i Czajowicach (87,5%), a w Modlnicy wyniosła jedynie 50% (Tab. 2).
Tab. 2. Frekwencja najliczniej występujących gatunków Syrphidae na
poszczególnych stanowiskach
Sphaerophoria scripta
Sphaerophoria spp.
Episyrphus balteatus
Sułoszowa
Skała
Czajowice
Modlnica
87,5
75,0
37,5
62,5
35,5
75,0
87,5
50,0
50,0
50,0
50,0
75,0
Pozostałe gatunki występowały tylko na niektórych stanowiskach, a niektóre notowano stosunkowo rzadko, np. Platycheirus
scutatus (Modlnica), Eupeodes spp. (Czajowice). Podobny skład gatunkowy, za wyjątkiem odłowionego poza granicami Parku gatunku
Platycheirus scutatus, stwierdzili Klasa i Soszyński [2011] prowadzący
badania w Ojcowskim Parku Narodowym. Autorzy odnotowali występowanie 174 gatunków Syrphidae.
Dominacja gatunków bzygowatych była różna na poszczególnych
stanowiskach. Do eudominantów (Ed) zaliczono Episyrphus balteatus
i rodzaj Sphaerophoria, do dominantów (D): Platycheirus albimanus,
Syrphus vitripennis i Syritta pipiens; subdominantami (Sd) były
Syrphus ribesii, Eristalis arbustorum, Melanostoma mellinum i Myathropa florea. Pozostałe gatunki występowały w mniejszej liczbie
i zaszeregowano je do recedentów (R) oraz subrecedentów (Sr) (Tab. 3).
Grupy troficzne. Spośród wszystkich odłowionych gatunków
wydzielono trzy grupy troficzne. Największą liczbę osobników i równocześnie gatunków stanowiły gatunki drapieżne (P) (od 82 do 93%),
których występowanie odnotowano na obszarze wszystkich czterech
stanowisk (Ryc.1).
Na stanowisku mieszczącym się w Sułoszowej, w porównaniu z pozostałymi, zaobserwowano znacznie więcej koprofagów (C). Na stanowisku tym nie zaobserwowano występowania saprofagów wodnych (WS).
W Skale odnotowano występowanie wszystkich trzech grup troficznych, w których znaczny udział miała grupa saprofagów wodnych.
Koprofagi stanowiły niewielki procent wszystkich odłowionych na
tym obszarze Syrphidae.
182
Zależności pomiędzy czynnikami siedliskowymi a liczebnością...
Klasa dominacji
Grupa troficzna
25.9
13.3
22.2
5.2
7.4
2.2
8.1
1.5
1.5
1.5
0.7
0.7
2.9
2.2
2.2
0.7
1.5
100
Ed
Ed
Ed
D
D
Sd
D
R
R
R
Sr
Sr
Sd
Sd
Sd
Sr
R
P
P
P
C
P
WS
P
WS
P
P
P
P
P
WS
P
P
P
Gatunek
Sułoszowa
Skała
Czajowice
Modlnica
Suma [szt.]
%
Tab. 3. Skład gatunkowy i struktura dominacji Syrphidae
Sphaerophoria scripta (L.)
Sphaerophoria spp.*
Episyrphus balteatus (DE GEER)
Syritta pipiens (L.)
Platycheirus albimanus (F.)
Myathropa florea (L.)
Syrphus vitripennis MEIG.
Helophilus trivittatus (F.)
Melangyna umellatarum (F.)
Eupeodes luniger (MEIG.)
Eupeodes latifasciatus (MACQ.)
Eupeodes corollae (F.)
Syrphus ribesii (L.)
Eristalis arbustorum (L.)
Melanostoma mellinum (L.)
Platycheirus scutatus (MEIG.)
Platycheirus angustatus (ZETT.)
Liczba osobników [szt.]
Liczba gatunków [szt.]
10
7
3
4
8
0
0
0
0
0
0
0
0
0
2
0
0
34
6
10
3
9
1
2
3
3
2
1
0
0
0
0
0
0
0
0
34
9
11
4
5
0
0
0
6
0
1
2
1
1
2
3
1
0
0
37
11
4 35
4 18
13 30
2
7
0 10
0
3
2 11
0
2
0
2
0
2
0
1
0
1
2
4
0
3
0
3
1
1
2
2
30 135
8 17
* Sphaerophoria taeniata (MEIG.), Sphaerophoria batava GOELDLIN
Na stanowisku w Czajowicach nie zaobserwowano występowania koprofagów. Odnotowano natomiast występowanie saprofagów wodnych.
W Modlnicy nie odnotowano występowania saprofagów wodnych.
Stanowisko to charakteryzowało się największym spośród wszystkich
stanowisk udziałem zoofagów. Odnotowano również występowanie
koprofagów (Ryc. 1).
183
Anna Witek, Maja Dobińska, Elżbieta Wojciechowicz-Żytko
Ryc. 1. Udział procentowy grup troficznych Syrphidae na poszczególnych
stanowiskach
Wpływ warunków siedliskowych na występowanie bzygowatych.
Największym bogactwem gatunkowym, a jednocześnie największą
liczebnością osobników, charakteryzowało się stanowisko w miejscowości Czajowice (Tab. 3). Było ono położone w niewielkiej odległości
od Ojcowskiego Parku Narodowego i chroniącej go otuliny a jednocześnie blisko ulicy (duże natężenie ruchu i zanieczyszczenie powietrza).
W swoich badaniach Kula [1997] wykazał, iż siedliska w najwyższym
stopniu zdegradowane przez zanieczyszczenia są stanowiskami o najbogatszym składzie tych muchówek. Z miejsc tych, w porównaniu
do stanowisk o niższym stopniu skażenia, autor odłowił największą
liczbę osobników i gatunków Syrphidae.
Cechą wyróżniającą stanowisko w Czajowicach było największe
nasłonecznienie. Gilbertem [1985] i Wnuk [2005] stwierdzili, że
występowanie muchówek z rodziny Syrphidae jest zależne od temperatury powietrza i natężenia światła. Według badań przeprowadzonych przez Gilberta [1985] ich liczebność jest większa w wyższych
temperaturach.
184
Zależności pomiędzy czynnikami siedliskowymi a liczebnością...
W Czajowicach, w bezpośrednim sąsiedztwie miejsca prowadzenia
odłowów, znajdowały się niezbyt gęste pasy zadrzewień, jednak zlokalizowany w pewnej odległości od stanowiska las mógł stanowić miejsce
schronienia Syrphidae. Arrignon i in. [2005] podają, że szczególnie ważną
rolę dla bzygowatych odgrywają zadrzewienia mieszczące się w pobliżu
łąk porośniętych kwiatami, które w ciągu dnia stanowią bazę pokarmową
dla tych muchówek. Pozytywny wpływ bliskiej obecności zadrzewień
przedstawiają również Marcos-Garcia i in. [2011]. Stwierdzili oni największe bogactwo gatunkowe Syrphidae na terenach leśnych.
Najmniejszą liczbę bzygowatych odłowiono na stanowisku w Modlnicy. Charakteryzowało się ono dużym zacienieniem wynikającym
z gęstej zabudowy, niezbyt licznymi drzewami oraz niższym stopniem
zanieczyszczenia. Znajdowało się jednak w największej odległości od
otuliny Ojcowskiego Parku Narodowego (Tab. 1).
W Sułoszowej i Skale odłowiono taką samą liczbę osobników, przy
czym stanowisko drugie charakteryzowało się występowaniem większej
liczby gatunków Syrphidae (Tab. 2). Stanowisko w Sułoszowej wyróżniało się obecnością największej liczby zadrzewień, średnią odległością
od Ojcowskiego Parku Narodowego oraz umiarkowanym nasłonecznieniem. W Skale nie odnotowano aż tylu zadrzewień, jednak było to
stanowisko bardziej zanieczyszczone (Tab. 1). Bowie i in. [2003] podają,
iż z jednej strony żywopłoty i zadrzewienia stanowią cenną ostoję oraz
źródło pożywienia, z drugiej jednak – mogą utrudniać rozprzestrzenianie się i migrację owadów latających, w tym Syrphidae.
Wnioski
Interpretując uzyskane wyniki można stwierdzić, iż największy wpływ
na występowanie muchówek z rodziny Syrphidae miały takie czynniki
jak: obecność zadrzewień, nasłonecznienie, a także odległość od granic
Ojcowskiego Parku Narodowego. Zanieczyszczenie środowiska zdaje
się nie mieć znaczącego negatywnego wpływu na liczebność i skład
gatunkowy Syrphidae. W celu zweryfikowania tej hipotezy konieczna
jest kontynuacja badań.
Bibliografia
Arrignon F., Barreau G., Bouyjou B., Ouin A., Sarthou J. 2005. Landscape parameters explain the distribution and abundance of Episyrphus balteatus (Diptera: Syrphidae). European Journal Entomology, 102: 539-545.
185
Anna Witek, Maja Dobińska, Elżbieta Wojciechowicz-Żytko
Bańkowska R. 1963. Syrphidae, [w:] Klucze do oznaczania owadów Polski
cz. XXVIII, Z. 34. Państwowe Wydawnictwo Naukowe. Warszawa.
Bowie M.H., Evans A.M., Hickman J.M., Sedcole J.R., Tylianakis J.M., Wratten S.D. 2003. Field boundaries as barriers to movement of hoverflies
(Diptera: Syrphidae) in Cultivated Land. Oecologia, 134: 605-611.
Chudzicka E., Skibińska E. 2000. Owady w monitoringu przyrodniczym.
Wiadomości entomologiczne, 18 Supl. 2: 289-302.
Gilbert F.S. 1985. Diurnal activity patterns in hoverflies (Diptera, Syrpidae). Ecological Entomology, 10: 385-392.
Haarto A., Kerppola S. 2007. Finnish hoverflies and some species in adjacent countries. Otavan Kirjapaino.
Klasa A., Soszyński B. 2011. Bzygowate (Syrphidae; Diptera) Ojcowskiego Parku Narodowego. Parki Narodowe i Rezerwaty Przyrody, 30 (1-2): 61-102.
Kula E. 1997. Hoverflies (Diptera: Syrphidae) of Spruce Forest in Different
Health Condition. Entomophaga, 42 (1/2): 133-138.
Krzemiński W., Palaczyk A., Soszyński B. 2000. Zagrożenia i perspektywy
ochrony muchówek. Wiadomości entomologiczne, 18 Supl. 2: 165-176.
Marcos-Garcia M.A., Moreno C.E., Ricarte A. 2011. Assessing the effects of
vegetation type on hoverfly (Diptera: Syrphidae) diversity in a Mediterranean landscape: implications for conservation. Journal of Insect
Conservation, 15: 865-877.
Petryszak B. 1982. Ryjkowce (Curculionidae, Coleoptera) Beskidu Ślaskiego.
UJ, Rozpr. Habilit., 68.
Szujecki A. 1980. Ekologia owadów leśnych. PWN, Warszawa.
Trojan P. 1975. Ekologia ogólna. PWN, Warszawa.
Van Veen M.P. 2004. Hoverflies of Northwest Europe. Identification keys to
the Syrphidae. KNNV Publishing.
Wnuk A. 2005. Roślinność w łańcuchach pokarmowych dla mszycożernych
bzygowatych (Diptera, Syrphidae). Ochrona środowiska naturalnego
w XXI wieku – nowe wyzwania i zagrożenia. Fundacja na Rzecz Wspierania Badań Naukowych Wydziału Ogrodniczego w Krakowie, 95-104.
Adres do korespondencji:
mgr inż. Anna Witek
Katedra Ochrony Roślin
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
Opiekun naukowy: dr hab. inż. Elżbieta Wojciechowicz-Żytko
186
Marcin Andrzejewski
Anna Krzepiłko
Iwona Zych-Wężyk
EPISTEME
22/2014, t. III
s. 187–194
ISSN 1895-2241
Zużycie oraz ceny nawozów mineralnych
w Polsce w latach 2008 – 2012
Consumption and prices of mineral
fertilizers in Poland in the years 2008 - 2012
Abstrakt. Nawożenie jest zabiegiem agrotechnicznym mającym na celu
zwiększyć żyzność gleb przeznaczonych pod uprawę. Zasadniczym celem stosowania nawozów mineralnych jest uzyskanie przez rolnika plonu
o dobrej jakości. Nawożenie jest obecnie jednym z najdroższych zabiegów
w produkcji rolniczej. Celem niniejszego opracowania była analiza zużycia
nawozów, kosztów ich zakupu oraz relacji między ceną płodów rolnych,
a nawozami w latach 2008 - 2012. Analiza danych pokazuje, że poziom zużycia nawozów mineralnych w Polce w analizowanym przedziale lat zmalał
o 5,7 %, jakkolwiek w badanych latach występowały korzystne relacje cen
wybranych grup nawozów do cen pszenicy.
Słowa kluczowe: nawozy mineralne, ceny nawozów, relacje cenowe, zakwaszenie gleb
Summary. Fertilization is an agro-technique procedure designed to increase the fertility of the soil used for cultivation. The main aim of mineral
fertilizers is to obtain high quality crops. Fertilization is one of the most
expensive treatments in agricultural production. Therefore, the aim of this
study was to analyze the use of fertilizers, their cost and the relationship
between the price of agricultural products and fertilizers for the period of
2008 – 2012. The results showed that the use of the mineral fertilizers in
Poland has decreased by 5.7% in the last five years. In the research period
there were observed beneficial price relationships of the selected fertilizers
to wheat prices.
Key words: mineral fertilizers, prices of mineral fertilizers, price relations, acidification of soils
187
Marcin Andrzejewski, Anna Krzepiłko, Iwona Zych-Wężyk
Wstęp
Jednym ze wskaźników służących do oceny ekonomicznej w rolnictwie
jest poziom zużycia nawozów mineralnych. Zużycie nawozów mineralnych w Polsce uzależnione jest od opłacalności produkcji rolniczej
(czyli relacji cen nawozów do cen płodów rolnych) oraz zasobności
finansowej gospodarstw rolnych. Rolnicy w ostatnich latach dostrzegają gwałtowny wzrost cen nawozów przy jednocześnie niskich cenach
skupu płodów rolnych [Zalewski 2011].
Należy jednak zaznaczyć, że wielu polskich rolników nie oszczędza na aplikowaniu nawozów. Wynika to między innymi z potrzeby
poprawienia zasobności gleb (głównie gleby lekkie) w składniki odżywcze. Ponadto opłacalność produkcji można znacznie zwiększyć
przez osiągniecie wysokich plonów, co ściśle wiąże się z koniecznością
zastosowania optymalnego nawożenia. W przeciwnym wypadku koszty stałe ponoszone przez rolników znacznie przekroczą ich przychody
[Czubiński 2008].
Ważnym czynnikiem determinującym wzrost zużycia nawozów
mineralnych w skali globalnej jest czynnik demograficzny. Przyrost
liczby ludności wymusza na rolnictwie wzrost produkcji artykułów
rolniczych, które zaspokoją potrzeby żywieniowe [Zalewski 2011].
Materiał i metody
Celem pracy była analiza zużycia nawozów mineralnych w latach
2008 – 2012 i ocena zmieniających się relacji cen wybranych grup
nawozów do cen pszenicy. Podjęty w pracy problem opracowano
w oparciu o dane opublikowane przez Główny Urząd Statystyczny oraz
Instytut Ekonomiki Rolnictwa i Gospodarki Żywnościowej. Zebrane
dane zestawiono przy pomocy programu EXCEL 2007
Wyniki i dyskusja
W roku 2008 zużycie nawozów NPK wynosiło 132,6 kg∙ha-1 UR,
a w roku 2012 zużycie nawozów zmieniło się do poziomu 125,1 kg
NPK∙ha-1 UR (tab.1). Poziom zużycia nawozów mineralnych w Polsce
w analizowanym okresie zmalał o 5,7 %. W Polsce zaobserwowano
regionalne zróżnicowanie stosowania nawozów mineralnym. Naj188
Zużycie oraz ceny nawozów mineralnych w Polsce w latach 2008 – 2012
mniejsze zużycie nawozów stwierdzono w centralnej i wschodniej
części kraju, natomiast największe odnotowano w zachodniej i północno-zachodniej Polsce [Piwowar 2010].
Tab.1. Zużycie nawozów mineralnych w Polsce w poszczególnych grupach
nawozowych w latach 2008 – 2012 (w kg na ha UR w przeliczeniu na czysty
składnik)
Rok
Nawozy
Nawozy fos- Nawozy poazotowe (N) forowe (P205) tasowe (K2O)
NPK
Nawozy wapniowe (CaO)
2007/2008
2008/2009
2009/2010
2010/2011
2011/2012
70,7
68
66,3
70,7
72,7
28,6
23,3
27,7
26,4
24,6
33,3
26,6
25,6
29,5
27,8
132,6
117,9
119,6
126,6
125,1
38,5
32,9
38,2
36,8
33,7
średnio
69,68
26,12
28,56
124,36
36,02
Źródło: opracowanie własne na podstawie danych GUS
Struktura zużycia poszczególnych nawozów mineralnych
w omawianym okresie była bardzo zróżnicowana (tab.1). W polskim
rolnictwie stosuje się głównie nawozy azotowe. Wynika to głównie
z faktu, że azot jest pierwiastkiem plonotwórczym, który w pierwszej
kolejności decyduje o jakości i ilości uzyskanego plonu. Najniższy
poziom nawożenia nawozami azotowymi odnotowano w roku 2010
i wynosił 66,3 kg N∙ha-1 UR. Z danych przedstawionych w tabeli 1 wynika, że w okresie od 2008 do 2010 roku zużycie nawozów azotowych
sukcesywnie malało, tj. z 70,7 do 66,3 kg N∙ha-1 UR. Tendencja ta
w pozostałych latach została przerwana i od 2010 roku odnotowujemy
wzrost zużycia tych nawozów. Stosowanie omawianej grupy nawozów
w 2012 roku (72,7 kg N∙ha-1 UR) zwiększyło się o 2,8 % w porównaniu
do roku 2008 (70,7 kg N∙ha-1 UR).
Analizując poziom zużycia nawozów fosforowych i potasowych w badanym okresie stwierdzono tendencję spadkową. Zużycie
w porównaniu do roku 2008 nawożenie fosforem i potasem zmalało odpowiednio o 4 i 5,5 kg K∙ha-1 UR. Średnie zużycie nawozów
azotowych było około 2,5-krotnie większe od fosforowych i potasowych (Tab 1). W związku z tym stosunek N:P:K w nawożeniu ciągle
zwiększa się na korzyść azotu. Taki stan prowadzi do zmniejszenia
189
Marcin Andrzejewski, Anna Krzepiłko, Iwona Zych-Wężyk
zasobności gleby w przyswajany fosfor i potas, co w konsekwencji
przyczynia się do spadku efektywności działania nawozów azotowych.
Jest to zjawisko niekorzystne zarówno ze względów produkcyjnych jak
i środowiskowych [Igras i in. 2010].
Niekorzystnym zjawiskiem obserwowanym w naszym kraju
jest małe zużycie nawozów, które zmniejszają kwasowość odczynu
gleby. Udział gleb kwaśnych w Polsce od wielu lat przekracza 50 %
powierzchni użytków rolnych, co w porównaniu do innych krajów
mających podobne warunki glebowe i klimatyczne wskazuje na konieczność stosowania nawozów alkalizujących [Kamionka 2010].
Odczyn gleb wpływa na przyswajalność składników pokarmowych
zwłaszcza fosforu, co bezpośrednio wpływa na wzrost i plonowanie
roślin i zmniejsza efektywność i opłacalność produkcji roślinnej [Igras
i in 2010].
W pierwszej dekadzie lat 90 ubiegłego wieku stosowano średnio
około 135 kg CaO∙ha-1 UR [Kamionka 2010]. Dla przykładu średnie
zużycie CaO w latach 2008-2012 wyniosło zaledwie 36 kg CaO∙ha-1 UR
(tab.1) i było niższe o 74 % w porównaniu do lat 90. Spadek nawożenia
CaO∙ha-1 UR w okresie 2011/2012 w stosunku do okresu 2007/2008
wynosił 12,5%. Przyczyną utrzymującej się tendencji zniżkowej zużycia CaO jest ograniczenie dotacji do produkcji wapna nawozowego
od 2004 roku, jak również zaniedbania w zakresie szkoleń rolników.
Należy zaznaczyć, że polscy rolnicy w roku 2011/2012 zużyli 3,5-krotnie mniej nawozów wapniowych w porównaniu do poziomu zużycia
nawozów mineralnych NPK (tab.1).
Według Zalewskiego [2011] wzrostowi cen surowców rolnych
towarzyszy wzrost opłacalności produkcji rolnej. Zależność ta przyczynia się do rosnącego popytu na środki produkcji (głównie nawozów),
co z kolei związane jest ze wzrostem ich cen.
Dynamika wzrostu cen nawozów jest silnie skorelowana z kosztem surowców niezbędnych do ich produkcji. Na przykład ceny nawozów azotowych są w głównej mierze uzależnione od cen gazu ziemnego, który stanowi 90% kosztów produkcji amoniaku. Natomiast
synteza amoniaku to 60% kosztów produkcji saletry. Ceny fosforytów wpływają na poziom cen nawozów fosforowych, a surowej soli
potasowej na ceny nawozów potasowych. Stąd też koszt wydobycia,
produkcji i importu surowców są ważnymi czynnikami, które decy190
Zużycie oraz ceny nawozów mineralnych w Polsce w latach 2008 – 2012
dują o wysokości cen nawozów na świecie i w Polsce [Zalewski 2011;
Bromberek 2010].
Porównując zmiany ceny detalicznych wybranych nawozów
w latach 2008 – 2012 stwierdzono wzrost ich cen (tab. 2). Największy
odnotowano w przypadku soli potasowej (61%) saletry amonowej
i polifoski (po 57%). Wyraźny wzrost cen w latach 2008 – 2012 dotyczył również ceny superfosfatu granulowanego (20% P2O5) o 43%,
a wapna tlenkowego (60% CaO) o 44,3%. Wyraźny wzrost cen nawozów w omawianym przedziale lat odnotowano w 2009 roku. W tym
czasie, polifoska zdrożała o 103 zł za 100 kg nawozu tj. o 72,6%, a sól
potasowa o 74 zł (60%) w porównaniu z rokiem 2008. Istotny spadek
cen nawozów (szczególnie polifoski o 68,7zł za 100 kg nawozu) odnotowano w 2010 roku.
Tab. 2. Ceny detaliczne wybranych nawozów mineralnych
w latach 2008 – 2012 (zł za 100 kg)
Wyszczególnienie
2008
luty
2009
luty
Saletra amonowa
94,1 121,8
–34% (N)
Superfosfat
73,2 127,0
granulowany 20% (P2O5)
Polifoska 8% N,
142,6 246,2
24% P2O5 i 24%
K2O
Sól potasowa –
124,0 198,0
60% (K2O)
wapno tlenkowe 60,4 71,7
60% CaO
2010
luty
2011
luty
2012
luty
2012
średnio
grudzień
102,0 119,1 145,1
147,0
121,5
104,6 94,2
99,7
105,0
100,6
177,5 185,8 217,0
224,2
198,9
185,8 172,8 197,8
200,0
179,7
78,2
76,6
73,0
80,5
70,7
Źródło: opracowanie własne na podstawie danych IERiGŻ [Zalewski, Zalewski 2009,
2010, 2011, 2012, 2013]
Popyt na nawozy uzależniony jest od cen detalicznych nawozów
oraz relacji między cenami płodów rolnych a ceną nawozów mineralnych [Piwowar 2011]. Ekonomiczną analizę zmian cen i opłacalności
nawożenia przeprowadza się na podstawie relacji cen nawozów do
cen ziarna zbóż. W niniejszej pracy taką analizę przeprowadzono
w porównaniu do pszenicy.
191
Marcin Andrzejewski, Anna Krzepiłko, Iwona Zych-Wężyk
W badanych latach nieznacznie polepszyły się relacje cen wybranych nawozów do cen pszenicy (tab. 3).
Tab. 3. Cena 1 kg czystego składnika nawozu wyrażona w kg pszenicy
Pszenica
Wyszczególnienie
Saletra amonowa
–34% (N)
Superfosfat granulowany –20% (P2O5)
Polifoska 8% N, 24%
P2O5 i 24% K2O
Sól potasowa –60%
(K2O)
wapno tlenkowe 60% CaO
NPK
średnia
2008 2009 2010 2011 2012
2012
luty luty luty luty luty grudzień
5,2
6,9
5,0
3,8
5,4
4,3
5,1
7,4
12,6
8,7
5,0
6,3
5,2
7,5
5,5
8,2
5,2
3,6
4,9
3,9
5,2
4,2
7,2
4,9
3,1
4,2
3,3
4,5
1,7
2,6
2,2
1,4
1,5
1,3
1,8
5,7
8,3
7,3
3,9
5,3
4,2
5,8
Źródło: opracowanie własne na podstawie danych IERiGŻ[Zalewski, Zalewski 2009,
2010, 2011, 2012, 2013]
W roku 2008 na zakup 1 kg NPK należało przeznaczyć równoważność 5,7 kg pszenicy. Natomiast w 2012 (w grudniu) o 1,5 kg
pszenicy mniej tj. 4,2 kg (tab. 3). Najgorsze relacje cenowe (z punku
widzenia rolnika) kształtowały się na początku 2009 roku, za 1 kg
czystego składnika superfosfatu granulowanego (20%P2O5) należało zapłacić równoważność 12,6 kg pszenicy tj. o ponad 58% więcej
w porównaniu do grudnia 2012. Relatywnie najtańszymi nawozami
w latach 2008 - 2012 było wapno tlenkowe i sól potasowa (tab. 3).
Za 1 kg czystego składnika tych dwóch nawozów trzeba było średnio
zapłacić równoważność: 1,8 kg i 4,5 kg pszenicy. Najdroższym nawozami okazały się superfosfat granulowany (średnio 7,5 kg pszenicy)
oraz polifoska (średnio 5,2 kg pszenicy).
Wnioski
Zużycie nawozów mineralnych w Polce w latach 2008 - 2012 zmniejszyło się w porównaniu do okresu 2007-2008 o 5,7 %. W strukturze
192
Zużycie oraz ceny nawozów mineralnych w Polsce w latach 2008 – 2012
zużycia nawozów mineralnych na polskim rynku dominują nawozy
azotowe. W roku 2012 zużycie nawozów azotowych zwiększyło się
o 2,8% w porównaniu do roku 2008. Analizując poziom zużycia nawozów fosforowych i potasowych w badanym okresie stwierdzono
tendencję spadkową. Niekorzystnym zjawiskiem jest niskie zużycie
nawozów odkwaszających glebę. W opisywanym okresie czasu stwierdzono wzrost cen detalicznych wybranych grup nawozów. Największy
wzrost cen odnotowano w przypadku saletry amonowej, polifoski
i soli potasowej. Rynek nawozów w Polsce jest rynkiem bardzo dynamicznym i trudno jest przewidzieć przyszłe relacje cen, a co za tym
idzie opłacalność produkcji rolniczej.
Bibliografia
Bromberek J. 2010. Nawozowa huśtawka. Top Agrar Polska, 12: 26-28.
Czubiński T. 2008. Dramatyczne ceny nawozów. Top Agrar Polska, 8: 22-25.
Igras J., Kopiński J., Matyka M. 2010. Ocena zużycia nawozów mineralnych
w Polsce w układzie regionalnym. Wieś Jutra, 8(9): 25-27.
Kamionka J. 2010. Analiza kosztów wapnowania gleb w Polsce. Problemy
Inżynierii Rolniczej, 2: 25-30.
Piwowar A. 2010. Zużycie i relacje cenowe wybranych nawozów mineralnych
do ziarna pszenicy. Journal of Agrobusiness and Rural Development,
2(16): 101-109.
Piwowar A. 2011: Analiza cen nawozów mineralnych w latach 2000 - 2010.
Journal of Agrobusiness and Rural Development, 3(21): 71-79.
Zalewski A, Zalewski A. 2009. Rynek środków produkcji dla rolnictwa. Rynek Rolny, 4(218): 77-78.
Zalewski A, Zalewski A. 2010. Rynek środków produkcji dla rolnictwa. Rynek Rolny, 4(230): 77-78.
Zalewski A, Zalewski A. 2011. Rynek środków produkcji dla rolnictwa. Rynek Rolny, 4(244): 77-78.
Zalewski A, Zalewski A. 2012. Rynek środków produkcji dla rolnictwa. Rynek Rolny, 4(254): 77-78.
Zalewski A, Zalewski A. 2013. Rynek środków produkcji dla rolnictwa. Rynek Rolny, 4(266): 77-78.
Zalewski A. 2011. Światowy rynek nawozów mineralnych z uwzględnieniem zmian cen bezpośrednich nośników energii oraz surowców. Raport
programu wieloletniego 2011 – 2014 nr.16. IERiGŻ, Warszawa.
193
Marcin Andrzejewski, Anna Krzepiłko, Iwona Zych-Wężyk
Adres do korespondencji:
Mgr inż. Marcin Andrzejewski
dr hab. Anna Krzepiłko
mgr Iwona Zych–Wężyk
Zakład Biochemii i Chemii Środowiskowej
Wydział Nauk Rolniczych w Zamościu
Uniwersytet Przyrodniczy w Lublinie
e-mail: [email protected]
Opiekun naukowy: dr hab. Anna Krzepiłko
194
Ada Biela
Aleksander Owczarek
EPISTEME
22/2014, t. III
s. 195–202
ISSN 1895-2241
WPŁYW WYBRANYCH CZYNNIKÓW
INDUKUJĄCYCH STRES SUSZY NA WZROST
KALUSA PSZENICY JAREJ (Triticum L.)
INFLUENCE OF SELECTED FACTORS INDUCING
DROUGHT STRESS ON THE GROWTH OF SPRING
WHEAT CALLUS (Triticum L.)
Abstrakt. Hodowla nowych odmian tolerancyjnych na stresy abiotyczne takie
jak susza, ma ogromne znacznie dla zwiększenia wydajności upraw. Jednym
z głównych narzędzi pozwalających na szybką ocenę oraz selekcję genotypów
charakteryzujących się odpornością na zadany czynnik stresowy jest zastosowanie technik kultur tkankowych. Indukcja stresu suszy w warunkach in
vitro uzyskiwana jest przy użyciu różnych substancji zmniejszających potencjał osmotyczny. Celem pracy było porównanie reakcji kalusa pszenicy jarej
w warunkach działania trzech wybranych substancji indukujących fizjologiczny stres suszy: glikolu polietylenowego (PEG-6000), mannitolu oraz
chlorku sodu w stężeniach wyznaczających dwa poziomy potencjału osmotycznie czynnego -0,8 oraz -1,4 MPa. Materiałem testowym był kalus wyprowadzony z zarodków pszenicy jarej - odmiana Ostka Smolicka. Wpływ
poszczególnych związków stresujących oceniany był na podstawie przyrostu masy kalusa, zawartości wody oraz suchej masy. Wyniki doświadczenia
wykazują różnice w reakcji w zależności od bezpośredniego źródła stresu.
Największy negatywny wpływ na wzrost kalusa miał chlorek sodu, natomiast na zawartość wody i suchej masy – mannitol.
Słowa kluczowe: stres suszy, pszenica jara, kalus, kultury in vitro
Abstract. Development of new varieties that are more tolerant to abiotic stresses such as drought, are of immense importance to increase crop
productivity. One of the main tools for quick assessment and selection of
stress-tolerant plants is the use of tissue culture techniques. Drought stress
in in vitro cultures may be induced by use of substances capable to decrease
in osmotic potential. The aim of this study was to compare three osmotic
agent: polyethylene glycol (PEG-6000), mannitol and sodium chloride in in195
Ada Biela, Aleksander Owczarek
ducing drought stress at concentrations defining two levels of osmotic potential: -0,8 and 1,4 MPa. Experiment was conducted using callus obtained
from Triticum aestivum cvs. Ostka Smolicka. Comparison was made on the
basis of the informations about influence the drought stress on cell viability
and cell growth. The experimental results show variations in the response,
depending on the direct source of stress. The biggest negative impact on the
growth of callus was sodium chloride, whereas the water content and dry
weight was the most dependent on mannitol.
Key words: drought stress, spring wheat, callus, in vitro cultures.
Wstęp
Szusza jest jednym z najczęściej występujących stresów abiotycznych
limitujących plon zbóż na całym świecie. Tradycyjne metody hodowlane, pozwalające na wyprowadzanie odmian o zwiększonej tolerancji
na stres suszy są bardzo czasochłonne oraz mało efektywne. Spowodowane jest to przede wszystkim brakiem ściśle określonych kryteriów
selekcji i niespecyficznie przekazywanych genów podczas krzyżowań.
Jedną z bardziej obiecujących metod wytwarzania stabilnych, tolerancyjnych na stres suszy genotypów jest wykorzystanie naturalnej
różnorodności genetycznej oraz wariancji somaklonalnej [Rai i in.
2011, Soliman i Hendawy 2013].
Efektywna selekcja genotypów odpornych na stres suszy może
być przeprowadzana w warunkach in vitro. Ponadto, kultury tkankowe działają również mutagennie, co dodatkowo zwiększa zmienność
genetyczną, nawet w ramach jednej odmiany. Stosując te techniki poczyniono już znaczny postęp w hodowli takich roślin jak: kukurydza,
ryż, pszenica i in. [Mahmood i in. 2012].
Celem niniejszej pracy jest porównanie działania trzech wybranych związków chemicznych indukujących fizjologiczny stres suszy:
glikolu polietylenowego (PEG-6000), mannitolu oraz chlorku sodu
w stężeniach wyznaczających dwa poziomy potencjału osmotycznie
czynnego -0,8 oraz -1,4 MPa. Badania te mogą przyczynić się do optymalizacji procesu selekcji genotypów pszenicy jarej z wykorzystaniem
technik in vitro, jak również do rozwoju narzędzi biotechnologicznych
użytecznych w rozwiązywaniu krytycznych problemów hodowli zbóż.
196
Wpływ wybranych czynników indukujących stres suszy na wzrost kalusa pszenicy jarej...
Materiał i metody
Do badań wybrane zostały trzy związki chemiczne indukujące fizjologiczny stres suszy: chlorek sodu, mannitol oraz glikol polietylenowy
(PEG-6000). Doświadczenie przeprowadzono na kalusie pszenicy jarej
(odmiana - Ostka Smolicka) w dwóch powtórzeniach. W ramach jednego powtórzenia badano kalusy pochodzące z 10 ziarniaków. Kultury
kalusa pszenicy wyprowadzano zgodnie z metodyką zaproponowaną
przez Farshadfar i in. [2012].
Kalusy o określonej masie (100-500 mg), wykładano na pożywkę
Linsmaier’a i Skoog’a [Linsmaier i Skoog 1965], suplementowaną
kwasem 2,4-dichlorofenoksyoctowym (2,4-D) w stężeniu 2mg∙l−1
oraz pH wynoszącym 5,7 przed autoklawowaniem. Stężenie testowanych związków dobrano tak, aby przybliżony potencjał osmotyczny
pożywek wynosił odpowiednio -0,08 i -1,4 MPa. Dokładne stężenia
stresorów wyznaczone zostały na podstawie danych literaturowych
[Gopal i Iwama 2007, Lutts i in. 2004]. Po 30 dniach hodowli w ciemności, w temperaturze 25˚C, kalusy ponownie ważono oraz, z pomocą
wagosuszarki (model: RADWAG MA 60.3Y IR 160), oznaczano ich
zawartość wody i suchej masy. Zebrane dane pozwoliły na wyliczenie
następujących parametrów:
•przyrost masy kalusa (M) – wyliczany na podstawie procentowego wzrostu masy kalusa w stosunku do masy początkowej (mp)
,
•zawartość wody (W) oraz sucha masa (S) kalusa – wyliczane jako
procent zawartości wody/suchej masy w stosunku do masy świeżego
kalusa.
Wyniki opracowano statystycznie, w celu weryfikacji hipotezy
zerowej o braku wpływu zastosowanych substancji i ich stężeń (potencjału osmotycznego) na wzrost kalusa, zawartość wody i suchą
masę, wykonując jednoczynnikową analizę wariancji. Grupy średnich
jednorodnych wyznaczono przeprowadzając test Tukey’a, przy poziomie istotności wynoszącym α=0,05.
Wyniki
Na podstawie przeprowadzonych obserwacji stwierdzono, że wszystkie testowane związki wywołujące stres suszy fizjologicznej działa197
Ada Biela, Aleksander Owczarek
ły niekorzystnie na wzrost kalusa, powodując jego przebarwienia,
a w niektórych przypadkach nawet usychanie. Przeprowadzona analiza wariancji wykazała istotne statystycznie różnice pomiędzy rodzajami użytych stresorów oraz ich dawkami pod względem wszystkich
testowanych parametrów (Tab. 1).
Tab. 1. Średnie kwadraty oraz istotność zróżnicowania dla przyrostu masy,
zawartości wody oraz suchej masy kalusa pszenicy jarej w warunkach suszy
Źródło zmienności
Liczba
stopni
swobody
Przyrost
masy kalusa
(M)
Zawartość
wody (W)
Zawartość
suchej masy
(S)
Czynnik stresujący
w określonym stężeniu
6
1881,86**
68,4**
68,434**
Błąd
45
285,08
1,2
1,216
**poziom istotności α = 0,05
Najbardziej agresywnym wobec kalusa pszenicy okazał się chlorek
sodu. Jego obecność w pożywce powodowała najsilniejsze zahamowanie wzrostu tkanki, a przy stężeniu odpowiadającemu Ψπ = -1,4 MPa
obserwowano całkowite jego zatrzymanie. Niemniej, spowodował
on najmniejszy spadek zawartości wody oraz suchej masy w kalusie
wraz ze wzrostem stężenia czynnika stresującego. Odmienna reakcja kalusa wystąpiła w obecności mannitolu. Przy niższym stężeniu
czynnika stresującego działał on wręcz stymulująco na wzrost tkanki, powodując jednocześnie największy spadek zawartości wody oraz
suchej masy, w stosunku do prób kontrolnych. Glikol polietylenowy
w stosunku do pozostałych testowanych substancji wykazywał właściwości pośrednie. Zahamowanie wzrostu kalusa było porównywalne do
zahamowania wywołanego przez mannitol, natomiast zawartość wody
i suchej masy po 30-dniowym okresie stresu najbardziej zbliżona była
do rezultatów uzyskanych przy zastosowaniu chlorku sodu. Graficzne
zwizualizowanie wyników oraz grupy jednorodne potwierdzające podobieństwo poszczególnych średnich przedstawione zostały na Rys. 1–3.
Rys. 1. Wykres procentowego przyrostu masy kalusa pszenicy (M)
w zależności od rodzaju związku chemicznego wywołującego fizjologiczny
stres suszy i ich stężeń (Ψπ); a, b, c, d – grupy jednorodne wyznaczone przy
pomocy testu Tukeya (α=0,05)
198
Wpływ wybranych czynników indukujących stres suszy na wzrost kalusa pszenicy jarej...
Rys. 2. Wykres procentowej zawartości wody w kalusie pszenicy (W)
w zależności od rodzaju związku chemicznego wywołującego fizjologiczny
stres suszy i ich stężeń (Ψπ); a, b, c, d – grupy jednorodne wyznaczone przy
pomocy testu Tukeya (α=0,05)
Rys. 3. Wykres procentowej zawartości suchej masy kalusa pszenicy (S)
w zależności od rodzaju związku chemicznego wywołującego fizjologiczny
stres suszy i ich stężeń (Ψπ); a, b, c, d – grupy jednorodne wyznaczone przy
pomocy testu Tukeya (α=0,05)
199
Ada Biela, Aleksander Owczarek
Dyskusja i wnioski
Uzyskane wyniki wskazują, że wystąpiła zróżnicowana reakcja wzrostu kalusa pszenicy jarej odmiana – Ostka Smolicka w kulturze in
vitro, w warunkach suszy indukowanej chlorku sodu, mannitolem
oraz PEG-6000 przy stężeniach wywołujących potencjał osmotycznie
czynny -0,8 oraz -1,4 MPa. Potwierdza to przypuszczenie przedstawiane przez innych autorów, że stopień odporności pszenicy na stres
suszy, zależy przynajmniej częściowo, od istniejących mechanizmów
odpornościowych na poziomie komórkowym [Bajji i in. 2000].
Istotne różnice pomiędzy efektami działania poszczególnych stresorów wynikają niewątpliwie z ich odmiennych właściwości chemicznych. Każda z użytych substancji posiada zdolność obniżania potencjału osmotycznego roztworu, uniemożliwiając optymalny pobór wody
przez roślinę. Trzeba jednak zwrócić uwagę na odmienny mechanizm
tego procesu w odniesieniu do właściwości zastosowanych związków
chemicznych. Chlorek sodu (związek jonowy), oraz mannitol (związek niejonowy) są zdolne do wnikania wewnątrz tkanek roślinnych
oddziałując na potencjał osmotyczny również wewnątrzkomórkowo.
Natomiast glikol polietylenowy, ze względu na wielkość cząsteczek nie
jest w stanie penetrować tkanek, limitując dostępność wody jedynie
zewnątrzkomórkowo [Lutts i in. 2004, Almansouri i in. 2001]. Dlatego
ryzyko wystąpienia dodatkowych efektów toksycznych w obecności
200
Wpływ wybranych czynników indukujących stres suszy na wzrost kalusa pszenicy jarej...
NaCl czy mannitolu jest znacznie większe. Zaobserwowany stymulujący wpływ mannitolu na wzrost kalusa mógł być spowodowany tym,
że związek ten występuje jako cukier prosty, podobnie jak sacharoza
standardowo zawarta w pożywce i może również stanowić źródło węgla
dla rozwijającego się kalusa. Dopiero jego wyższe stężenie wywołujące
potencjał osmotycznie czynny -1,4 MPa staje się toksyczne dla kultury.
Najmniejszy wpływ na zmianę zawartości wody w kalusie pszenicy miał chlorek sodu. Można zatem przypuszczać, że szkody wyrządzone stresem wynikały nie bezpośrednio ze zmniejszenia dostępności wody, ale raczej z toksycznego oddziaływania NaCl oraz jego
wpływu na inne procesy komórkowe [Almansouri i in. 2001].
Potencjał osmotyczny na poziomie -0,8 oraz -1,4 MPa ustalony dla
każdej z zastosowanych substancji wydaje się pomocny do wykorzystania w selekcji materiałów tolerancyjnych na stres suszy. Podobne
obserwacje poczynili Mahmood i in. [2012] wykazując znaczący wpływ
zbliżonych potencjałów osmotycznych na rozwój kalusa. Potencjał ten
pozwala na selekcję genotypów mniej tolerancyjnych, jednocześnie
umożliwiając przeżycie bardziej odpornych wariantów somaklonalnych.
Nie można jednoznacznie określić, która z badanych substancji
może być najbardziej użyteczna w selekcji genotypów tolerancyjnych.
Chorek sodu najprawdopodobniej najmniej imituje susze w warunkach
in vivo, co znajduje potwierdzenie w literaturze [Almansouri i in. 2001].
Na obecnym etapie badań działanie mannitolu i PEG-6000 wydaje się
być zbliżone, jednakże aby móc ocenić, który z nich ma lepsze właściwości selekcyjne, konieczna jest kontynuacja doświadczenia – regeneracja
wyselekcjonowanych kalusów oraz testy w warunkach in vivo.
Bibliografia
Almansouri M. Kinet J.M. Lutts S. 2001. Effect of salt and osmotic stresses
on germination in durum wheat (Triticum durum Desf.). Plant and Soil,
231: 243-254.
Bajji M. Lutts S. Kinet J.M. 2000. Physiological Changes after Exposure to
and Recovery from Polyethylene Glycol-induced Water Deficit in Callus
Cultures Issued from Durum Wheat (Triticum durum Desf.) Cultivars Differing in Drought Resistance. Journal of Plant Physiology, 156: 75-83.
Farshadfar E. Jamshidi B. Cheghamirza K. Teixeira da Silva J.A. 2012. Evaluation of drought tolerance in bread wheat (Triticum aestivum L.)
201
Ada Biela, Aleksander Owczarek
using in vivo and in vitro techniques. Annals of Biological Research,
3(1): 465-476.
Gopal J. Iwama K. 2007. In vitro screening of potato against water-stress
mediated through sorbitol and polyethylene glycol. Plant cell reports,
26: 693-700.
Linsmaier E.M. Skoog F. 1965. Organic growth factor requirements of tobacco tissue cultures. Plant Physiology, 18: 100–127.
Lutts S. Almansouri M. Kinet J.M. 2004. Salinity and water stress have contrasting effects on the relationship between growth and cell viability during
and after stress exposure in durum wheat callus. Plant Science, 167: 9-18.
Mahmood I. Razzaq A. Ashraf M. Hafiz I.A. Kaleem S. Qayyum A. Ahmad
M. 2012. Interaction of callus selection media and stress duration for
in vitro selection of drought tolerant callus of wheat. African Journal
of Biotechnology: 11(17), 4000-4006.
Rai M.K. Kalia R.K. Singh R. Gangola M.P. Dhawan A.K. 2011. Developing
stress tolerant plants through in vitro selection - an overview of the recent progress. Environmental and Experimental Botany: 71(1), 89-98.
Soliman H.I.A. Hendawy M.H. 2013. Selection for Drought Tolerance Genotypes in Durum Wheat (Triticum durum Desf.) Under In vitro Conditions. Middle-East Journal of Scientific Research: 14(1), 69-78.
Adres do korespondencji:
mgr inż. Ada Biela
mgr inż. Aleksander Owczarek
Katedra Genetyki, Hodowli Roślin i Nasiennictwa
Zakład Genetyki i Biotechnologii Roślin
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]; [email protected]
Opiekun naukowy: dr hab. inż. Renata Galek
202
Barbara Biniaś
Janina Gospodarek
Milena Rusin
EPISTEME
22/2014, t. III
s. 203–210
ISSN 1895-2241
WPŁYW WYBRANYCH WYCIĄGÓW ROŚLINNYCH
NA ŻEROWANIE PCHEŁKI CHRZANOWEJ
(PHYLLOTRETA ARMORACIAE KOCH) NA
CHRZANIE (ARMORACIA RUSTICANA GAERTN)
EFFECT OF SELECTED PLANT EXTRACTS ON
FEEDING PHYLLOTRETA ARMORACIAE KOCH ON
HORSERADISH (ARMORACIA RUSTICANA GAERTN)
Abstrakt. Celem badań było określenie wpływu wyciągów z suszu pokrzywy zwyczajnej (Urtica dioica L.), bylicy piołunu (Artemisia absinthium L.)
oraz skrzypu polnego (Equisetum arvense L.) w stężeniu 2% oraz ze świeżych
części roślin pokrzywy i skrzypu (stężenia 10% i 30%) na żerowanie pchełki
chrzanowej (Phyllotreta armoraciae Koch) na liściach chrzanu (Armoracia
rusticana). Codziennie mierzono powierzchnię uszkodzeń liści chrzanu,
w odniesieniu do całkowitej ich powierzchni, z użyciem programów komputerowych Quantum GIS oraz Auto CAD. Wodny wyciąg z suszu bylicy piołunu wykazuje silne działanie ograniczające żerowanie pchełki chrzanowej,
co sugeruje możliwość wykorzystania go do zwalczania tych szkodników.
Z pośród badanych wyciągów z pokrzywy, tylko 30% wyciąg ze świeżego
materiału roślinnego wykazywał działanie hamujące żerowanie pchełki
chrzanowej. Wyciągi wodne z suszu i świeżego skrzypu polnego nie ograniczały żerowania pchełki chrzanowej, jednak notowano podwyższoną śmiertelność szkodników po ich użyciu (wyciąg 30% z materiału świeżego i 2%
z suszu).
Słowa kluczowe: pchełka chrzanowa (Phyllotreta armoraciae Koch), chrzan
pospolity (Armoracia rusticana), biologiczna ochrona roślin, wyciągi roślinne
Summary. The aim of the study was to determine the effect of extracts
of dried nettle (Urtica dioica L.), mugwort wormwood (Artemisia absinthium
L.) and horsetail (Equisetum arvense L.) at concentrations of 2 % and fresh
parts of plants of nettle and horsetail (concentration of 10 % and 30 %) for
203
Barbara Biniaś, Janina Gospodarek, Milena Rusin
feeding horseradish flea (Phyllotreta armoraciae Koch) on the leaves of horseradish (Armoracia rusticana). Eaten area of horseradish leaves was measured daily with respect to their total surface area, using computer programs
and GIS Quantum Auto CAD. Dried aqueous extract of mugwort wormwood
(concentration 2%) shows a strong restrictive activity on feeding of horseradish flea beetles, suggesting the possibility of using it to control these pests.
Among the tested extracts of nettle, only 30% of the extract of the fresh
plant material shown to inhibit feeding of flea horseradish beetles. Aqueous
extracts of dried and fresh horsetail not limited feeding of flea horseradish,
however, increased mortality of pests after use (extract 30% of the fresh
material and 2% of dried) was reported.
Key words: Phyllotreta armoraciae Koch, horseradish (Armoracia rusticana
Gaertn), biological control, plant extracts
WSTĘP
Chrzan pospolity (Armoracia rusticana) w polskich warunkach klimatycznych, ze względu na stosunkowo długi okres wegetacji (kilka
miesięcy), narażony jest na szkodliwą działalność licznych gatunków
owadów [Szwejda 2004]. Wśród nich jeden z najważniejszych to pchełka chrzanowa (Phyllotreta armoraciae Koch) [Horbowicz i in. 2004;
Rogowska i Horbowicz 2004; Rogowska 2005]. Pchełki uszkadzają
liście poprzez ich dziurawienie. Sporadycznie występuje minowanie
liści. Tego typu silne uszkodzenia liści powodują ich przebarwienia,
zmiany koloru (od żółtego do brunatnego) oraz więdnięcie i w ostateczności zasychanie liścia [Sandner 1990; Wnuk 1990]. Jedną z metod wykorzystywanych w biologicznej ochronie roślin do ograniczania
żerowania szkodników, jest stosowanie wyciągów z roślin. Badania
na ten temat są prowadzone od dawna i wskazują na ich różną skuteczność, zależnie od gatunku zwalczanego owada, rodzaju użytego
wyciągu (wodny, alkoholowy, ze świeżego materiału, z suszu) i jego
stężenia [Blaim 1965; Harmatha i Nawrot 1985; Achremowicz i Cież
1992; Achremowicz 1995; Achremowicz i Cież 1998; Dankowska i Kłosek 2008]. W dostępnej literaturze niewiele jest informacji na temat
możliwości użycia wyciągów roślinnych do zwalczania szkodników
chrzanu [Radziewicz i Lewandowski 2011].
Celem pracy było zbadanie oddziaływania wyciągów roślinnych
z pokrzywy zwyczajnej, skrzypu polnego i bylicy piołunu na intensywność żerowania pchełki chrzanowej na liściach chrzanu.
204
Wpływ wybranych wyciągów roślinnych na żerowanie pchełki chrzanowej...
MATERIAŁ I METODY
W maju 2013 roku zebrano świeże liście chrzanu pospolitego. Wybrane fragmenty liści (przycięte do rozmiaru szalki), potraktowano
następującymi wyciągami roślinnymi: z suszu oraz świeżych fragmentów pokrzywy zwyczajnej (Urtica dioica L.), z suszu bylicy piołunu (Artemisia absinthium L.) i z suszu oraz świeżych części skrzypu
polnego (Equisetum arvense L.). W celu przygotowania wyciągów
roślinnych, odpowiednio 2 g (zdefiniowane jako stężenie 2%), 10 g
(stężenie 10%) i 30 g (stężenie 30%) materiału roślinnego (susz bądź
świeże fragmenty roślin) zalewano 100 ml zimnej wody redestylowanej i odstawiano na okres 24 godzin w ciemności, w temperaturze
pokojowej. Po upływie doby gotowe wyciągi przesączono przez sączek
bibułowy i natychmiast użyto do przeprowadzenia doświadczeń laboratoryjnych. Wyciągi z suszu zostały sporządzone w stężeniu 2%,
natomiast ze świeżych roślin przygotowano wyciągi 10% i 30%. Liście
chrzanu zanurzano na 3 sekundy w roztworze odpowiednich wyciągów lub w wodzie destylowanej (kontrola), suszono w temperaturze
pokojowej, po czym umieszczano w szalkach Petriego wyłożonych
wilgotną bibułą. Następnie do każdej szalki wprowadzano po 2 osobniki pchełki chrzanowej. W odstępach 40 godzinnych, czterokrotnie
mierzono powierzchnię uszkodzeń na tych samych fragmentach liści,
w odniesieniu do całkowitej ich powierzchni, z użyciem programów
komputerowych Quantum GIS oraz Auto CAD. Doświadczenie wykonano w 3 powtórzeniach. Analizę statystyczną otrzymanych wyników
przeprowadzono przy użyciu programu Statistica 10.0.PL. Istotność
różnic statystycznych między średnimi została zbadana przez przeprowadzenie analizy wariancji jednoczynnikowej, a średnie różnicowano
testem NIR Fishera na poziomie istotności α = 0,05.
WYNIKI BADAŃ I DYSKUSJA
W efekcie badań ustalono, iż wyciąg z piołunu (2%) (ryc. 2) miał
najsilniejsze działanie ograniczające proces uszkadzania liści chrzanu przez chrząszcze (Phyllotreta armoraciae Koch). Widoczne zahamowanie uszkadzania liści nastąpiło po 80 godz. od rozpoczęcia
obserwacji i utrzymywało się przez kolejne dni badania. Z pośród
analizowanych wyciągów z pokrzywy tylko 30 % wyciąg ze świeżych
205
Barbara Biniaś, Janina Gospodarek, Milena Rusin
części wykazywał działanie hamujące żerowanie szkodników. Różnice
istotne statystycznie w odniesieniu do kontroli stwierdzono po 120
godzinach od momentu rozpoczęcia eksperymentu (ryc.1). Pomimo
braku różnic w stopniu uszkadzania liści chrzanu zależnie od użycia
pozostałych wyciągów z pokrzywy, odnotowano jednak negatywne
działanie wszystkich wyciągów z pokrzywy przejawiające się ginięciem
części osobników w trakcie trwania eksperymentu. Wodne wyciągi ze
skrzypu polnego, zarówno z suszu jak i świeżego materiału roślinnego, niezależnie od stężenia nie wpłynęły istotnie na wielkość zjadanej powierzchni liści chrzanu (ryc. 3), przy czym zastosowanie 30%
wyciągu ze skrzypu świeżego oraz 2% z suszu (odpowiednio po 80
i po 160 godz. obserwacji), spowodowało śmierć części osobników.
W dostępnej literaturze bardzo mało jest informacji na temat możliwości zwalczania szkodników chrzanu z użyciem wyciągów roślinnych.
Moczenie sadzonek chrzanu w ekologicznym roztworze z pokrzywy,
bądź spryskiwanie roślin w momencie zawiązywania się pąków, jest
wymieniane przez niektórych autorów jako sposób zwalczania m.in.
Ryc. 1. Wpływ wyciągów wodnych z pokrzywy zwyczajnej na żerowanie
pchełki chrzanowej (Phyllotreta armoraciae Koch) na liściach chrzanu, po 40, 80, 120 i 160 godzinach obserwacji. K - kontrola, pokrzywa
świeża w stężeniu 10 % - P10, pokrzywa świeża w stężeniu 30% - P30,
susz pokrzywy w stężeniu 2% - P2. Wartości oznaczone symbolem „*”
odpowiednio dla danego terminu obserwacji różnią się istotnie w odniesieniu do obiektu kontrolnego przy α = 0,05.
206
Wpływ wybranych wyciągów roślinnych na żerowanie pchełki chrzanowej...
Ryc. 2. Wpływ wyciągów wodnych z bylicy piołunu na żerowanie pchełki
chrzanowej (Phyllotreta armoraciae Koch) na liściach chrzanu po 40, 80, 120
i 160 godzinach obserwacji. K - kontrola, susz bylicy piołunu w stężeniu
2% - PN2. Wartości oznaczone symbolem „*” odpowiednio dla danego terminu obserwacji różnią się istotnie w odniesieniu do obiektu kontrolnego
przy α = 0,05.
Ryc. 3. Wpływ wyciągów wodnych ze skrzypu polnego na żerowanie pchełki
chrzanowej (Phyllotreta armoraciae Koch) na liściach chrzanu po 40, 80,
120 i 160 godzinach obserwacji. K - kontrola, skrzyp polny świeży w stężeniu 10 % - S10, skrzyp polny świeży w stężeniu 30% - S30, susz skrzypu
polnego w stężeniu 2% - S2. Wartości oznaczone symbolem „*” odpowiednio dla danego terminu obserwacji różnią się istotnie w odniesieniu do
obiektu kontrolnego przy α = 0,05.
207
Barbara Biniaś, Janina Gospodarek, Milena Rusin
pchełki chrzanowej [Radziewicz i Lewandowski 2011]. Z kolei występowanie chrząszczy i larw pokrewnych gatunków, tj. pchełki smużkowanej (Phyllotreta nemorum L.) oraz czarnej (P. atra Fabr.), na wybranych roślinach kapustowatych (Brassica L.), znacznie zahamowano,
stosując wodne wyciągi z aksamitki niskiej pełnej (T. patula nana)
[Jankowska 2008]. Wysoką śmiertelność szkodników roślin (głównie mszyc) obserwowano w trakcie badania wpływu wyciągów m.in.
z pokrzywy oraz piołunu [Achremowicz 1995]. Badania dowodzą, iż
oddziaływanie owadobójcze wybranych wyciągów zależy w znacznej
mierze od użytego rozpuszczalnika [Achremowicz i Cież 1988].
WNIOSKI
1. Wodny wyciąg z suszu bylicy piołunu (stężenie 2%) wykazuje silne
działanie ograniczające żerowanie pchełki chrzanowej (Phyllotreta
armoraciae Koch) na liściach chrzanu pospolitego (Armoracia rusticana),
co sugeruje możliwość wykorzystania go do zwalczania tych uciążliwych szkodników.
2. Z pośród badanych wyciągów z pokrzywy, tylko 30% wyciąg
ze świeżego materiału roślinnego hamował żerowanie pchełki chrzanowej. Odnotowano przy tym podwyższoną śmiertelność owadów
w trakcie eksperymentu pod wpływem wszystkich rodzajów wyciągów
z pokrzywy.
3. Wyciągi wodne z suszu i świeżego skrzypu polnego nie ograniczały żerowania pchełki chrzanowej, jednak notowano podwyższoną
śmiertelność szkodników po ich użyciu (wyciąg 30% z materiału
świeżego i 2% z suszu).
BIBLIOGRAFIA
Achremowicz J. 1995. Badania nowych aficydów pochodzenia roślinnego.
Pestycydy (4), 27-36.
Achremowicz J. Cież W. 1992. Ekstrakty roślinne jako naturalne pestycydy
do zwalczania mszyc. Materiały XXXII Sesji Naukowej IOR (II), 242248.
Achremowicz J. Cież W. 1998. Doświadczenia nad skutecznością działania
wyciągów z roślin stosowanych jako aficydy. Zesz. Probl. Post. Nauk
Rol., 353: 53-66.
208
Wpływ wybranych wyciągów roślinnych na żerowanie pchełki chrzanowej...
Blaim K. 1965. Swoiste substancje roślin uprawnych. PWRiL. Warszawa
Dankowska E. Kłosek I. 2008. Plant extracts, infusions and decoctions as
factors limiting feeding activity of deroceras leave (O.F. Müller, 1774).
(Gastropoda: Pulmonata: Agriolimacidae). Folia Malacologica. Poznań.
(16/1), 35-38.
Harmatha J. Nawrot J. 1985. Substancje roślinne wpływające na rozwój
i zachowanie się owadów. Materiały XXV Sesji Naukowej IOR, 141-151.
Hiiesaar K. Kaasik R. Williams I. H. Svilponis E. Jogar K. Metspalu L.
Mand M. Ploomi A. Luik A. 2012. Cold hardiness of horseradish flea
beetle (Phyllotreta armoraciae Koch). Zemdirbyste Agriculture. (99/2),
203‒208.
Horbowicz M. Rogowska M. Szwejda J. 2004. Relation between flavonols
and isothiocyanates content in horseradish leaves and population of
its main pests: flea beetles (Phyllotreta spp.), diamondback moth (Plutella xylostella L.) and turnip sawfly (Athalia rosae L.). Pol. J. Entomology. (73), 273-282.
Jankowska B. 2008. Wpływ wodnego wyciągu z aksamitki (Tagetes patula
nana) na występowanie szkodliwej entomofauny na kapuście białej.
Progress in Plant Protection. (48/2), 724-729.
Radziewicz J. Lewandowski K. 2011. Chrzan, roślina na zagospodarowanie
nieużytków. Poradnik gospodarski. Rolniczy Magazyn Elektroniczny.
Uprawa i nawożenie roślin. Centralna Biblioteka Rolnicza im. Michała
Oczapowskiego. (1), 18-19.
Rogowska M. 2005. Hasło Ogrodnicze. Warzywnictwo. Szkodniki lubią chrzan. cz. I. (4). Plantpress. Kraków.
Rogowska M. Horbowicz M. 2004. Różnice w zasiedlaniu dwóch typów chrzanu przez pchelki (Phyllotreta spp.), tantnisia krzyzowiaczka (Plutella
xylostella L.) i gnatarza rzepakowca (Athalia rosae L.). Progress Plant
Protection. (44/2), 1050-1053.
Sandner H. 1990. Owady. Państwowe Wydawnictwo Naukowe. (3), 452.
Szwejda J. 2004. Przegląd szkodników i ich wrogów naturalnych aktualnie
występujących na warzywach kapustowatych w Polsce. Nowości Warzywnicze. Skierniewice, 97-102.
Wnuk A.1990. Entomologia dla rolników. Część I ogólna. Akademia Rolnicza im. H. Kołłątaja w Krakowie. Skrypty dla Szkół Wyższych. Kraków,
115-123.
209
Barbara Biniaś, Janina Gospodarek, Milena Rusin
Adres do korespondencji:
mgr Barbara Biniaś
dr hab. inż. Janina Gospodarek
mgr inż. Milena Rusin
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Rolniczo-Ekonomiczny
Katedra Ochrony Środowiska Rolniczego
Al. Mickiewicza 21, 31-120 Kraków
e-mail: [email protected]
210
Roman Bezus
Anastasiia Cherniavska
Maciej Chowaniak, Dorota Gala
Andrzej Joniec, Marcin Niemiec
EPISTEME
22/2014, t. III
s. 211–220
ISSN 1895-2241
WPŁYW NACHYLENIA STOKU, SYSTEMU
UPRAWY I OKRYWY ROŚLINNEJ NA WYBRANE
WŁAŚCIWOŚCI FIZYCZNE GLEBY
EFFECT OF SLOPE GRADIENT, TILLAGE SYSTEM
AND CROP COVER ON SELECTED PHYSICAL
PROPERTIES OF THE SOIL
Summary. The experiment was conducted in years 2007 - 2010 on a brown,
loess-derived soil, at the Experimental Station in Cracow – Mydlniki. The
objective of the experiment was to determine the effect of slope gradient
(9 and 16 %), soil tillage system (ploughing and direct drilling) and plant
cover (faba beans, spring wheat and winter canola on capillary and aeral
capacity of soil. In conducted research slope gradient has a significant effect
on capillary capacity of soil. Also tillage system has significant effect on this
soil parameter but only in 0-10 cm soil layer. On the objects with direct
drilling capillary capacity was greater than in ploughing tillage while greater
aeral capacity was observed on objects with ploughing tillage system.
Key words: tillage systems, soil properties, slope gradient.
Streszczenie. Doświadczenie przeprowadzono w latach 2007 - 2010 na
glebie brunatnej wytworzonej z lessu w Stacji Doświadczalnej w Krakowie – Mydlnikach. Celem badań było określenie wpływu nachylenia stoku
(9 i 16 %), systemu uprawy (płużny i siew bezpośredni), okrywy roślinnej
(bobik, pszenica jara, rzepak ozimy) na pojemność kapilarną i aeracyjną gleby. W przeprowadzonym badaniu nachylenie stoku w istotny sposób wpływało na pojemność kapilarną gleby. Również system uprawy powodował
istotne różnice dotyczące tego parametru gleby, ale tylko odnośnie warstwy
0 – 10 cm. Na obiektach z siewem bezpośrednim pojemność kapilarna była
większa niż w uprawie płużnej. Natomiast większa pojemność aeracyjna została zaobserwowana na obiektach z systemem płużnym
Słowa kluczowe: systemy uprawy, właściwości gleby, nachylenie stoku.
211
Roman Bezus, Anastasiia Cherniavska, Maciej Chowaniak, Dorota Gala...
Wstęp
Stosowanie uproszczeń w uprawie wiąże się ze zmianami właściwości fizycznych gleby. Zmiany te dotyczą zwłaszcza stosunku porów
kapilarnych małych do dużych, który w systemach uproszczonych
w porównaniu do konwencjonalnego (płużnego) zmienia się na korzyść małych [Tebrügge i Wagner 1995]. Jednocześnie ze zmianą ilości
porów i ich wielkości zmienia się zdolność gleby do gromadzenia wody
co w dalszym etapie wpływa na plonowanie roślin, podatność gleby na
erozję wodną przez ograniczenie zwiększenie przepuszczalności gleby.
Celem pracy było określenie wpływu nachylenia stoku, systemu
uprawy i okrywy roślinnej na porowatość kapilarną i aeracyjną gleby.
Materiał i metody
Badania przeprowadzono w Stacji Doświadczalnej Katedry Agrotechniki
i Ekologii Rolniczej Uniwersytetu Rolniczego w Krakowie zlokalizowanej w Mydlnikach. Doświadczenie zostało zlokalizowane na stoku południowym, na glebie brunatnej wytworzonej z lessu. Trójczynnikowe
płodozmianowe doświadczenie polowe zostało założone metodą losowanych podbloków w układzie zależnym w czterech powtórzeniach na
poletkach o powierzchni 44 m2. Pierwszym czynnikiem doświadczenia
było nachylenie stoku, czynnik ten obejmował nachylenie 9% (strefa
dolna stoku) i nachylenie 16% (strefa górna stoku). Drugim czynnikiem
doświadczenia były dwa systemy uprawy roli: system orkowy i system
siewu bezpośredniego. Trzeci czynnik stanowiła okrywa roślinna, którą
reprezentowały rośliny uprawiane w następującym płodozmianie: bobik, pszenica jara, rzepak ozimy. Pojemność kapilarna oraz pojemność
aeracyjna oznaczonoprzy pomocy stalowych cylindrów Kopecky’ego
o pojemności 100 cm3. Próbki gleby pobierano na każdym poletku
w dwóch powtórzeniach z warstw 0-10, 10-20 i 20-30 cm. Poboru
próbek dokonywano w następujących terminach: dla bobiku w pełni
stadium rozwoju liści i pędu (40 – 50 wg skali BBA) i po zbiorze roślin,
dla pszenicy jarej: w pełni krzewienia (25 – 29 wg skali Zadoksa [Zadoks
i in. 1974]) i po zbiorze roślin, dla rzepaku ozimego: w pełni stadium
kwitnienia (64 – 69 wg skali BBA) i po zbiorze roślin. Do opracowania
statystycznego uzyskanych wyników wykorzystano analizę wariancji.
Istotność średnich różnic obiektowych testowano z wykorzystaniem
212
Wpływ nachylenia stoku, systemu uprawy i okrywy roślinnej na wybrane właściwości...
procedury porównań wielokrotnych z wykorzystaniem testu Tukeya
na poziomie istotności α = 0,05.
Wyniki
Na pojemność kapilarną gleby w warstwie 0 – 10 istotnie wpływało
nachylenie stoku i system uprawy (tab. 1-3). Gleba z obiektów znajdujących się w strefie górnej stoku o nachyleniu 16% posiadała w warstwie
0 – 10 cm średnio o 1,76% mniejszą pojemność kapilarną niż (tab. 1).
Z kolei system uprawy badany parametr gleby różnicował istotnie jedynie w wierzchniej warstwie gleby (0 – 10 cm) (tab. 1-3). W niższych
badanych warstwach (10-20 i 20-30 cm) zaobserwowano podobną tendencję, choć nie udowodnioną statystycznie. Spostrzeżenie to potwierdza analiza współdziałania czynników doświadczenia (tab. 1) z której
wynika, iż wartości charakteryzujące pojemność kapilarną pochodzącą
z uprawy bobiku i pszenicy jarej były niższe. Podobnie w badaniach
Wojciechowskiego i Sowińskiego [2002] siew bezpośredni w porównaniu z uprawą tradycyjną, istotnie zwiększył pojemność kapilarną gleby.
Z kolei w badaniach Idkowiak i Kordasa [2004] siew bezpośredni powodował zmniejszenie się pojemności kapilarnej gleby w odniesieniu do
uprawy konwencjonalnej w wierzchniej warstwie gleby.
W przypadku pojemności powietrznej jedynie system uprawy
powodował istotne różnice w wierzchniej warstwie gleby (tab. 4-6).
Zastosowanie siewu bezpośredniego wpłynęło na zmniejszenie pojemności powietrznej gleby w warstwie 0 – 10 cm, średnio o 20,7%
w porównaniu do systemu płużnego. Podobne efekty uzyskali
w swoich badaniach Lipiec i in. [2006] Natomiast Tavares Filho i Tessier [2009] nie stwierdzili istotnych różnic między pojemnością powietrzną a systemem uprawy roślin siewem bezpośrednim i systemem
płużnym. W badaniach własnych analiza statystyczna nie wykazała
istotnych różnic w głębszych warstwach gleby (10 - 20, 20 - 30 cm).
Podobnie nachylenie stoku nie wykazało istotnego wpływu na
analizowaną właściwość fizyczną gleby. Jedynie zaobserwowano, że
gleba w górnej strefie stoku o nachyleniu 16% odznaczała się wyższymi wartościami pojemności powietrznej
Analogicznie w pierwszej i drugiej warstwie na obiektach z pszenicą jarą zaobserwowano nie udowodnioną statystycznie tendencję
do zmniejszenia pojemności powietrznej i zwiększenia na obiektach
z bobikiem.
213
214
Bobik
Pszenica jara
Rzepak ozimy
System uprawy
Siew bezpośredni
System płużny
średnio
Siew bezpośredni
System płużny
średnio
9%
16%
Bobik
0,3521
0,3418
0,3470
0,3451
0,3349
0,3400
0,3458
0,3397
0,00534
0,3435
0,3425
0,3424
Pszenica jara
0,3499
0,3419
0,3459
0,3420
0,3362
0,3391
średnio dla
syst. uprawy
*r.n.-różnica nieistotna
NRI α = 0,05
r.n*.
NRI α = 0,05 dla współdziałania nachylenia z systemem uprawy 0,00795
dla współdziałania nachylenia z rośliną 0,00782
dla współdziałania systemu uprawy z rośliną r.n.
dla współdziałania nachylenia, systemu uprawy, roślin 0,01113
średnio dla
roślin
średnio dla
nachyl.
NRI α = 0,05
16%
9%
Nachylenie
NRI α = 0,05
Rzepak ozimy
0,3455
0,3438
0,3447
0,3446
0,3355
0,3401
Siew bezpośredni
System płużny
Tab. 1. Pojemność kapilarna gleby [cm3 ∙ cm-3] w warstwie 0 - 10 cm
średnio
0,3492
0,3425
0,3458
0,3439
0,3355
0,3397
0,3465
0,3390
0,00581
Roman Bezus, Anastasiia Cherniavska, Maciej Chowaniak, Dorota Gala...
Bobik
Pszenica jara
Rzepak ozimy
System uprawy
Siew bezpośredni
System płużny
średnio
Siew bezpośredni
System płużny
średnio
9%
16%
Bobik
0,3434
0,3474
0,3454
0,3271
0,3282
0,3277
0,3429
0,3345
0,00325
0,3365
0,3410
0,3386
Pszenica jara
0,3426
0,3408
0,3417
0,3408
0,3396
0,3402
średnio dla
syst. uprawy
NRI α = 0,05
r.n.
NRI α = 0,05
NRI α = 0,05 dla współdziałania nachylenia z systemem uprawy 0,00791
dla współdziałania nachylenia z rośliną r.n.
dla współdziałania systemu uprawy z rośliną r.n.
dla współdziałania nachylenia, systemu uprawy, roślin 0,01045
średnio dla
roślin
średnio dla
nachyl.
NRI α = 0,05
16%
9%
Nachylenie
Rzepak ozimy
0,3429
0,3405
0,3417
0,3394
0,3316
0,3355
Siew bezpośredni
System płużny
Tab. 2. Pojemność kapilarna gleby [cm3 ∙ cm-3] w warstwie 10 - 20 cm
średnio
0,3430
0,3429
0,3429
0,3358
0,3331
0,3345
0,3394
0,3380
r.n.
Wpływ nachylenia stoku, systemu uprawy i okrywy roślinnej na wybrane właściwości...
215
216
Bobik
Pszenica jara
Rzepak ozimy
System uprawy
Siew bezpośredni
System płużny
średnio
Siew bezpośredni
System płużny
średnio
9%
16%
Bobik
0,3569
0,3489
0,3529
0,3282
0,3471
0,3377
0,3493
0,3395
0,00751
0,3453
0,3418
0,3460
Pszenica jara
0,3402
0,3467
0,3435
0,3396
0,3408
0,3402
średnio dla
syst. uprawy
NRI α = 0,05
r.n.
NRI α = 0,05
NRI α = 0,05 dla współdziałania nachylenia z systemem uprawy 0,00891
dla współdziałania nachylenia z rośliną 0,00964
dla współdziałania systemu uprawy z rośliną r.n.
dla współdziałania nachylenia, systemu uprawy, roślin 0,01044
średnio dla
roślin
średnio dla
nachyl.
NRI α = 0,05
16%
9%
Nachylenie
Rzepak ozimy
0,3586
0,3444
0,3515
0,3316
0,3494
0,3405
Siew bezpośredni
System płużny
Tab. 3. Pojemność kapilarna gleby [cm3 ∙ cm-3] w warstwie 20 - 30 cm
średnio
0,3519
0,3467
0,3493
0,3331
0,3458
0,3395
0,3425
0,3462
r.n.
Roman Bezus, Anastasiia Cherniavska, Maciej Chowaniak, Dorota Gala...
Bobik
Pszenica jara
Rzepak ozimy
System uprawy
Siew bezpośredni
System płużny
średnio
Siew bezpośredni
System płużny
średnio
9%
16%
Bobik
0,0751
0,0901
0,0826
0,0834
0,01041
0,0938
0,0838
0,0888
r.n.
0,0882
0,0831
0,0875
Pszenica jara
0,0760
0,0894
0,0827
0,0745
0,0926
0,0836
średnio dla
syst. uprawy
r.n.
NRI α = 0,05
NRI α = 0,05 dla współdziałania nachylenia z systemem uprawy 0,01342
dla współdziałania nachylenia z rośliną r.n.
dla współdziałania systemu uprawy z rośliną 0,01393
dla współdziałania nachylenia, systemu uprawy, roślin 0,0158
średnio dla
roślin
średnio dla
nach.
NRIα = 0,05
16%
9%
Nachylenie
NRI α = 0,05
Rzepak ozimy
0,0784
0,0938
0,0861
0,0818
0,0961
0,0890
Siew bezpośredni
System płużny
Tab. 4. Pojemność powietrzna gleby [cm3 ∙ cm-3] w warstwie 0 - 10 cm
średnio
0,0765
0,0911
0,0838
0,0799
0,0976
0,0888
0,0782
0,0944
0,01054
Wpływ nachylenia stoku, systemu uprawy i okrywy roślinnej na wybrane właściwości...
217
218
System uprawy
Bobik
Pszenica jara
Rzepak ozimy
Siew bezpośredni
System płużny
średnio
Siew bezpośredni
System płużny
średnio
9%
16%
Bobik
0,0746
0,0797
0,0772
0,0820
0,0854
0,0837
0,0774
0,0813
r.n.
0,0804
0,0770
0,0806
0,0730
0,0796
0,0763
0,0838
0,0816
0,0777
średnio dla
syst. uprawy
Pszenica jara
NRI α = 0,05
r.n.
NRIα = 0,05 dla współdziałania nachylenia z systemem uprawy r.n.
dla współdziałania nachylenia z rośliną 0,00622
dla współdziałania systemu uprawy z rośliną r.n.
dla współdziałania nachylenia, systemu uprawy, roślin r.n.
średnio dla
roślin
średnio dla
nachyl.
NRIα = 0,05
16%
9%
Nachylenie
NRI α = 0,05
0,0775
0,0802
0,0789
0,08034
0,0814
0,0824
Siew bezpośredni
System płużny
Rzepak ozimy
Tab. 5. Pojemność powietrzna gleby [cm3 ∙ cm-3] w warstwie 10 - 20 cm
średnio
0,0750
0,0798
0,0774
0,0797
0,0828
0,0813
0,0774
0,0813
r.n.
Roman Bezus, Anastasiia Cherniavska, Maciej Chowaniak, Dorota Gala...
Bobik
Pszenica jara
Rzepak ozimy
Bobik
0,0599
0,0615
0,0607
0,0617
0,0670
0,0644
0,0618
0,0631
r.n
0,0625
0,0632
0,0617
System uprawy
Siew bezpośredni
System płużny
średnio
Siew bezpośredni
System płużny
średnio
9%
16%
0,0635
0,0624
0,0630
0,0626
0,0642
0,0634
średnio dla
syst. uprawy
Pszenica jara
NRIα = 0,05
r.n.
NRI α = 0,05 dla współdziałania nachylenia z systemem uprawy r.n.
dla współdziałania nachylenia z rośliną r.n.
dla współdziałania systemu uprawy z rośliną r.n.
dla współdziałania nachylenia, systemu uprawy, roślin r.n.
średnio dla
roślin
Średnio dla
nachyl.
NRI α= 0,05
16%
9%
Nachylenie
NRI α = 0,05
0,0617
0,0619
0,0618
0,0603
0,0628
0,0616
Siew bezpośredni
System płużny
Rzepak ozimy
Tab. 6. Pojemność powietrzna gleby [cm3 ∙ cm-3] w warstwie 20 - 30 cm
średnio
0,0617
0,0619
0,0618
0,0615
0,0647
0,0631
0,0616
0,0633
r.n.
Wpływ nachylenia stoku, systemu uprawy i okrywy roślinnej na wybrane właściwości...
219
Roman Bezus, Anastasiia Cherniavska, Maciej Chowaniak, Dorota Gala...
Wnioski
Nachylenie stoku wpływało w istotny sposób na pojemność kapilarną
gleby na głębokości od 0 do 30 cm. leba pochodząca ze stoku o nachyleniu 9 % odznaczała się istotnie większą pojemnością kapilarną niż
z obiektów o nachyleniu 16%.
Siew bezpośredni powodował w warstwie gleby 0-10 cm istotne
zwiększenie pojemności kapilarnej i zmniejszenie pojemności aeracyjnej
Uprawiane gatunki roślin nie wpływały w istotny sposób na zmiany badanych właściwości fizycznych gleby
Literatura
Idkowiak M., Kordas L. 2004. Wpływ sposobu uprawy i nawożenia azotem
na właściwości fizyczne gleby w uprawie pszenżyta ozimego. Annales
UMCS, Sec. E., 59, 3, 1097 –1104.
Lipiec J., Kuś J., Słowińska-Jurkiewicz A., Nosalewicz A. 2006. Soil porosity
and water infiltration as influenced by tillage methods. Soil & Tillage
Research 89; 210-220.
Tavares Filho J., Tessier D. 2009. Characterization of soil structure and porosity under long-term conventional tillage and no-tillage systems.
R. Bras. Ci. Solo, 33; 1837-1844.
Tebrügge F., Wagner A. 1995. Soil structure and trafficability after longterm application of no-tillage. Experience with the Applicability of Notillage Crop Production in the West-European countries. Proceedings
of the Second Workshop, 15-17 May, Silsoe, UK. Wissenschaftlicher
Fachverlag, Giessen; 49-57.
Wojciechowski W., Sowiński J. 2002. Kształtowanie się wybranych
właściwości fizycznych gleby pod wpływem zróżnicowanego siewu
pszenicy ozimej w monokulturze cz. i. ocena w fazie trzech liści. Acta
Scientiarum Polonorum, Agricultura 1 (2); 15 – 23.
Zadoks J.C., Chang T.T., Konzak C.F. 1974: A decimal code for the growth
stages of cereal. Weed Res., Oxford, 14, 415–421.
Adres do korespondencji:
Roman Bezus, Dnipropetrovs’k State Agrarian University, Ukraine
Anastasiia Cherniavska National Metallurgical Academy of Ukraine
Maciej Chowaniak, Dorota Gala, Andrzej Joniec, Marcin Niemiec
University of Agriculture in Cracow
e-mail: [email protected]
220
Roman Bezus
Iuliia Amelina
Maciej Chowaniak
EPISTEME
22/2014, t. III
s. 221–229
ISSN 1895-2241
INFORMATIZATION OF SOCIETY AS A GUARANTEE
OF CONSUMPTION OF ORGANIC PRODUCTS
ŚWIADOMOŚĆ SPOŁECZEŃSTWA GWARANCJĄ
KONSUMPCJI PRODUKTÓW EKOLOGICZNYCH
Abstrakt. Celem artykułu jest próba określenia poziomu świadomości oraz
zainteresowania mieszkańców regionu, a także identyfikacja przyczyn, które mają wpływ na gotowość płacenia wyższych cen za tego rodzaju asortyment. Badanie przeprowadzono z zastosowaniem kwestionariusza ankietowego, który skierowany został do 850 respondentów. Na podstawie
uzyskanych wyników wskazano, iż poziom świadomości nabywcy wywiera
istotny wpływ na gotowość do płacenia wyższych cen za dostępne na rynku
produkty ekologiczne. Do najważniejszych czynników warunkujących zakup żywności ekologicznej respondenci zaliczyli natomiast jej dostępność
na lokalnym rynku zbytu oraz poziom dochodów osiągany przez członków
badanych gospodarstw domowych.
Słowa kluczowe: świadomość ekologiczna, ceny rynkowe, poziom dochodów,
produkty ekologiczne.
Summary. The aim of the article is an attempt to estimation of the awareness level and interest of citizens of Dnepropetrovsk region in organic
products and also identification of causes, which have influence to readiness
to pay more to buy this kind of products. Research was conducted with questionnaires addressed to 850 respondents. Based on the results was identified that the level of awareness of purchaser has a significant influence
to readiness to pay higher prices for organic products. The most relevant
factors determined purchasing organic food respondents pointed accessibility of this products on local sales market and level of incomes gained by
members of the surveyed households.
Key words: ecological awareness, market prices, level of incomes, organic products
221
Roman Bezus, Iuliia Amelina, Maciej Chowaniak
INTRODUCTION
Ukrainian organic farming has reached a territory about 300 thousand
hectares. With the volumes of organic production still relatively low for
such a big country as Ukraine. Organic production (certified) is about
EUR 112 to 158 million, of which around EUR 30 to 40 million are exported to mainly EU countries. Another EUR 1 to 2 million is sold on the
domestic market as organic, and the remainder is sold as conventional
products [UNEP 2013]. That low level of sell in domestic market is related
with many factors, social awareness, availability of products, incomes etc.
The purpose of the article is to determine the level of awareness
of residents of Dnipropetrovsk region about organic products and the
readiness to buy it, and also identify causes why that people are ready
to overpay for organic food.
MATERIAL AND METHODS
The study was conducted by collecting primary sociological information using methods of questioning and self-rating. Based on this empirical material different types of analysis have been used: structural,
factor, cluster. Besides, statistical analysis of the data was carried out.
The study was based on quantitative data collection methods - selective survey using questionnaires of residents of Dnipropetrovsk region
(villages, towns, and cities with a population of 3,3 million people).
Total number of respondents is 850 people. (Confidence probability 95 %, confidence interval - 5%). To determine the general trend factor
analysis was used and principal components method, whose main
objective is to reduce the number of variables (data reduction) and
determine the structure of relationship between variables, i.e. classification of variables [Shumetov 1999]. Until now Ukraine has never
carried out the comprehensive study of public awareness of organic
products. As a rule some aspects were analysed in different regions
of Ukraine [Artysh 2006, Mylovanov 2009, Berlach 2010 Yatsenko
and Zavadska 2010, Pidlisnyuk and Stefanovska 2008, Tchaika 2011].
RESULTS
In first question respondents were asked to rate their awareness about
organic products on ten point scale. 50,3% of respondents rated their
222
Informatization of society as a guarantee of consumption of organic products
awareness level as above average. 12% of respondents believe that they
are well-informed about organic food their awareness is rated at 10
points. 5,9% of respondents rated their awareness on this issue of 9
points, 8,2% - 8 points, 10,6% - 7 points, 13,6% - in 6 points, 16,5% - 5
points, 9,9% - 4 points, 9,3% - 3 points, 4,6% - 2 points, 6,1 % - 1 point
that is noted that they are not well-informed. By contrast, in France 9%
of residents consider themselves as very well -informed about organic
products [Baromètre de.... 2012, Organic market report 2013].
The study in the Dnepropetrovsk region shows that self-esteem increases together with the age concerning respondents awareness of what
organic production is. So every second respondent aged over 75 years
assessed his knowledge on the subject in 10 points out of 10. One in four
respondents aged 45 to 49 years rated his knowledge in 10 points, 60 to
64 years, from 70 to 74 years and one in five aged 65 to 69 years. Among
respondents who rated their knowledge as very good or good enough the
largest proportion of respondents is aged 35 to 39, from 60 to 64 and
from 45 to 49 years (62,7%, 59,1% and 55,3% respectively).
Interesting is the fact that the age group of 70 years and over has
never said the answer “is not well-informed” while determining the
level of their awareness. Among those who has estimated the lowest
level of awareness of organic products are most respondents in the
age group of 65 to 69 years – 16,7% , from 16 to 18 and from 19 to 21
years – 15,4%, and from 45 to 4 49 years – 14,9% (Fig.1).
Fig. 1. Level of awareness about the organic products in different age
groups. Source: own research.
223
Roman Bezus, Iuliia Amelina, Maciej Chowaniak
The highest percentage of those who rated their awareness in the
highest point among respondents depends on their education: secondary education (14,4% of respondents), higher education(12,6% of respondents) and incomplete higher education (11,6% of respondents).
A major part of those who rated their awareness in the lowest point
according to education is the respondents with incomplete secondary
education 12,5%). To one of the key questions in the questionnaire
“Do you wish to buy organic products” almost 83 % of respondents
affirmed their readiness to buy this products. This confirm the statement that a segment of consumers of organic products has already
being formed in the Dnepropetrovsk region. The main factors that
affect the willingness of the population of Dnepropetrovsk region to
buy organic products desire to eat “healthy food” - 55%, the desire
to feed their children and grandchildren with organic produce - 12%,
the desire of new taste sensations - 9% and the desire to preserve the
environment - 6%. 15% of respondents wouldn’t tend to buy organic
products as they fully meet the “normal” foodstuff (Fig. 2).
Fig. 2. Structure of factors, which influence on the respondents’ willingness
to buy organic or non-organic products. Source: own research
Thus, one could argue that people prefer to organic products in
Dnepropetrovsk region as well as in France primarily because of concern about their own health and for their families [Organic market
report 2013]. Interesting is the fact that according to the results of
research in the Dnepropetrovsk region the proportion of respon224
Informatization of society as a guarantee of consumption of organic products
dents willing to buy organic products with increasing income per
family member per month is slightly reduced. For example, 85,6 % of
respondents has expressed the wish to buy organic products among
respondents with incomes up to 1,000 UAH per family member per
month and 70,4 % of respondents has also expressed such a desire
among respondents with incomes of more than 5001 USD”. On the
question “Where would you like to buy organic production?” almost
half, namely 48% of respondents answered that in conventional food
stores (supermarkets), 21% - would like to buy at specialized stores for
organic products, 14% - at the market; 5% - directly from the producer
(at farm), 2% - from online stores (home delivery), 6% - are undecided,
4% of users hasn’t no written answers (Fig. 3).
Fig. 3. The results of the answers to the question „Where would you like
to buy organic produce?” Source: own research
The majority of residents of Dnipropetrovsk region are ready to
pay extra for organic products. Only 19,1% of respondents are not
ready to pay more for these products and about 13% can’t answer.
There are different levels of readiness to pay extra cost for organic
products. It depends on the type of product (tab. 1).
As a result of calculations using the software Statistical Package for the Social Sciences, we can conclude that the general trend
shows that with increasing the amount of additional fees for organic
products the desire to buy organic products is reduced after 31% of
respondents. Readiness to pay 10% for organic production domina225
15,2
27,3
20,0
8,9
3,6
4,1
5,2
1,9
1,6
1,5
1,1
0,1
0,9
8,5
0%
1-10%
11-20%
21-30%
31-40%
41-50%
51-60%
61-70%
71-80%
81-90%
91-100%
101-200%
> 200%
No answer
Source: own research.
Cultured
milk foods
Overpay
for organic
products [%]
Fruits
12,7
16,0
22,4
16,9
12,1
4,9
4,4
3,9
2,4
1,5
0,5
0,8
0,6
0,9
Vegetables
11,6
15,8
23,2
14,5
14,4
4,6
5,1
3,9
2,7
0,9
0,6
1,4
0,2
1,2
Meat
10,0
14,6
21,1
16,1
11,5
6,8
5,1
4,7
2,6
3,3
1,6
1,3
0,5
0,8
Fish
13,3
15,8
22,1
16,0
8,9
5,5
5,9
4,4
1,5
2,6
1,1
1,1
0,9
0,9
Eggs
13,1
17,6
26,6
13,3
8,7
5,1
4,2
3,9
2,4
1,9
1,2
0,9
0,2
0,9
Prepared
food
13,1
22,1
25,2
13,4
7,6
4,0
3,8
4,2
2,6
0,6
1,3
0,8
0,5
0,8
Tinned food
12,5
21,4
25,6
16,4
6,4
4,5
4,1
4,0
1,9
0,9
1,1
0,4
0,2
0,7
Cereals
13,3
19,3
27,6
14,1
6,0
4,0
5,1
3,9
1,9
1,1
0,8
1,1
0,7
1,2
Snacks
14,9
29,8
28,8
9,9
4,8
2,8
2,4
2,6
0,7
0,6
0,5
0,7
0,5
1,1
Sweets
14,6
19,9
23,8
17,6
8,1
3,5
3,4
4,1
1,3
1,1
0,6
0,8
0,4
0,8
14,4
18,2
25,4
15,3
7,2
5,1
3,6
4,8
1,3
1,3
0,8
1,2
0,6
0,8
Baked
goods
226
15,3
19,8
26,8
15,8
6,2
3,3
3,2
3,6
1,8
0,9
1,1
0,8
0,7
0,7
Water and
drinks
Tab. 1. Proportion of respondents willing to pay extra cost for organic products [%].
Juices
13,5
17,9
25,2
18,4
7,9
3,4
3,6
3,6
1,6
1,3
0,8
0,8
0,9
0,9
Alcoholic
beverages
13,6
22,4
30,5
12,1
6,5
2,4
4,1
2,5
1,6
1,1
0,7
0,8
0,5
1,3
Roman Bezus, Iuliia Amelina, Maciej Chowaniak
Informatization of society as a guarantee of consumption of organic products
tes, followed by a sufficient sample of respondents, who are ready to
overpay 11-20 % for organic products. If we consider only the willingness to pay more for organic products, the number of people who are
willing to buy organic products with a higher price than conventional
products at 11-20% is at least twice than those who are willing to
overpay up to 10%. Values from 0 to 10% is characterized by very high
positive values of the factor variable equal to 2,3%, in terms of value
of this factor it can be concluded that the most attractive price of
organic products should not exceed 10% (tab. 1). This concerns some
values of basic variables such as alcoholic beverages, snacks, cereals,
cultured milk foods. A high positive value of factors implies approval
of elementary variables, which is identically to strong willingness
to pay more for organic products ranging from 0 to 10%. Foregoing
shows that maximum demand of consumers is related with organic
production which value does not exceed more than 30% of the cost of
conventional products. As the indicator of level of awareness among
the population of Dnepropetrovsk region is differential indicating
Fig. 4. Effect of awareness level of organic products and the level of income
per 1 family member among the residents of Dnipropetrovsk region, who
are ready to pay more for organic products.
Source: own research.
227
Roman Bezus, Iuliia Amelina, Maciej Chowaniak
a rather strong informational disparity, it will be advisable to use
cluster analysis, which allows integration of the respondents in the respective clusters by the closest values of awareness level. To calculate
the distance between objects we use the square of the Euclidean distance. For the cluster analysis we use statistical package SPSS (Fig. 4).
CONCLUSION
So, after factor analysis and clustering one could argue that the level
of awareness of organic products has a positive effect on willingness
to pay more for organic products. Overall readiness for the group is
27,1%. Willingness to pay more for organic products is confirmed by
the relatively higher income per family member in the group - more
than 2000 UAH per family member. As for the willingness to buy
organic products by representatives of other clusters, as a whole, it
depends on the level of awareness of organic products and is supported by income per family member. Taking into account the direct
dependence between education level of respondents and level of awareness, it can be argued that formation of centers of natural farming
in educational establishments promotes awareness and, consequently,
willingness to pay extra buying organic products.
REFERENCES
Artysh V. I. 2006. Management aspects of the production of environmentally friendly products in agriculture of Ukraine Scientific Journal of
Nat. Agrarian Univ. - K.,102. 242-247
Baromètre de consommation et de perception des produits biologiques en
France Edition 2012. Agence Bio. 123.
Berlach N.2010. Analysis of motivational factors in terms of administrative and legal regulation in the development of organic agriculture in
Ukraine Scientific Journal “Legal Psychology and Pedagogy” - 2010.
2 (8) - 7, 186-194.
Pidlisnyuk V. V. 2008. Ecological (organic) agriculture is a part of sustainable agriculture. Environmental Security 3-4. 102-109.
Mylovanov Y. V. 2009. Organic agriculture: prospects for Ukraine Handbook
of Ukrainian Farmer: scientific-practical. collection. - 2009.7. 257-260.
228
Informatization of society as a guarantee of consumption of organic products
Yatsenko O. M., Zavadska Y. S. 2010 Formation of demand on organic products in the agro-food market. Ukrainian scientific-practical journal
“Innovative Economy” -3. 204-208.
Tchaika T. A. 2011. Status of the market of Ukrainian organic production
and its potential Journal of Ryazansk State Agrotechnical University
named P. A. Kostycheva. 4 ( 12).63-67.
Organic market report 2013. Soil Association 23.
Shumetov V. G. Faktor analysis: 1999. Approach with Application computers Orel HTU, 88.
United Nations Environment Programme (UNEP) 2013 http://www.unep.
org/
Adres do korespondencji:
Bezus Roman PhD
Amelina Iuliia [email protected]
Dnipropetrovs’k State Agrarian University, Ukraine
Maciej Chowaniak PhD
e-mail: [email protected]
University of Agriculture in Cracow
229
Iwona Florczak
Sylwia Andrusiewicz
Jacek Słoma
Marek Klimkiewicz
EPISTEME
22/2014, t. III
s. 231–238
ISSN 1895-2241
Wpływu procesu prasowania obierek
ziemniaczanych na właściwości
powstałych materiałów
Influence of potato peels compression
on the properties of obtained materials
Abstrakt. Obierki ziemniaczane mogą być surowcem do wytwarzania materiałów biodegradowalnych o dobrych właściwościach użytkowych. Obierki
z trzech odmian ziemniaków (Melodia, Verona i Irga) prasowano w matrycy
pod obciążeniem 10, 20 i 30 kN na maszynie wytrzymałościowej Instron. Scharakteryzowano takie cechy surowca, jak skład granulometryczny i jednostkową
energię zagęszczania oraz gęstość pozorną wyprasek, co pozwoliło ocenić jakość
i przydatność użytych surowców odpadowych. Wypraski osiągnęły gęstość pomiędzy 1,29 a 1,40 g∙cm-3. Wykazały dobrą podatność na proces zagęszczania.
Przypuszczalnie, na spoistość wpłynąć mógł skład chemiczny obierek (zawartość skrobi, celulozy i białka) oraz skład granulometryczny cząstek, który charakteryzował się największą ilością cząstek o wymiarach 1,0-1,6 mm (22-36%
dla wszystkich odmian). Otrzymane obrazy skaningowej mikroskopii elektronowej (SEM) wyprasek potwierdziły dobrą spoistość materiałów i wskazały na
konieczność stosowania materiałów o zróżnicowanej wielkości cząstek.
Słowa kluczowe: mikrostruktura, obierki ziemniaczane, prasowanie, wytrzymałość
Abstract. Potato peels are wastes that could be used as compressed biodegradable materials with good strength properties. In the article potato peels
from three varieties (Melodia, Verona, Igra) were shredded and compressed
with the 10, 20 and 30 kN load on Instron machine. There were characterized such substrate features as granulometric distribution of particles,
unit compression energy and density of material, what allowed to assess
the quality and usefulness of substrates processed. The results show density
between 1.29 and 1.40 g·cm-3 and good susceptibility to compaction of substrates. It may be due to the chemical composition (starch, cellulose, protein
content) and size distribution of particles that have the largest content in
the range of 1,0-1,6 mm (22-36% for all varieties). Scanning electron microscopy (SEM) structure observations confirmed a good cohesion of the materials and indicated the need to use a material with diversified particle sizes.
Key words: microstructure, potato peels, compression, strength
231
Iwona Florczak, Sylwia Andrusiewicz, Jacek Słoma, Marek Klimkiewicz
Wstęp
W 2012 roku zebrano 9,1 mln ton ziemniaków [Nosecka 2012], z czego
1,68 mln ton, czyli ponad 18% przeznaczono na przerób przemysłowy.
Ziemniaki jako tani surowiec, o niskiej zawartości tłuszczu, będący dobrym źródłem węglowodanów, głównie skrobi, wysokiej jakości białka
pochodzenia roślinnego, błonnika (celulozy) i witamin, odgrywają dużą
rolę w żywieniu człowieka. Te naturalne składniki, występujące również w obierkach z ziemniaków, mogą być dobrym substratem, który
w procesie prasowania mógłby przyczynić się do powstania materiałów
biokompozytowych, nieszkodliwych dla środowiska naturalnego. Istotę
procesu prasowania wyjaśnia m.in. praca Heima [2005]. W literaturze
nie odnaleziono jednak szczegółowych badań dotyczących wytwarzania
materiałów z tego typu surowców. Wykorzystaniem wycierki ziemniaczanej w procesie prasowania zajmował się Obidziński [2009].
Celem pracy było określenie przydatności obierek z trzech odmian ziemniaków do wytwarzania materiałów biodegradowalnych
w procesie prasowania przy różnej sile nacisku.
Materiał i metody
W badaniach wykorzystano obierki z trzech odmian ziemniaków:
Melodia, Verona i Irga. Materiał badawczy został uzyskany dzięki
uprzejmości firmy wytwarzającej skrobię. Początkowa wilgotność
obierek kształtowała się na poziomie 79%. Surowce wysuszono naturalnie w temperaturze 25°C, przy wilgotności względnej powietrza
35%, w ciągu 4 dni. Po wysuszeniu została zmierzona wilgotność,
która wyniosła średnio 8%.
Kolejnym etapem badań było rozdrobnienie surowca za pomocą
rozdrabniacza nożowego. Czas rozdrabniania wynosił 12 s. Rozdrobniony surowiec poddano analizie sitowej wg normy DIN ISO 3310-1
(wytrząsarka laboratoryjna Multiserv typ LPzE-2e, wielkości sit [mm]:
0,1; 0,15; 0,2; 0,25; 0,5; 0,71; 0,8; 1,0; 1,6; 2,0; 2,5; 3,15; 3,55; 4,0;
wielkość próbki: 100 g, amplituda: 60 mm, częstotliwość 2 Hz, czas
10 minut, 3 powtórzenia, waga analityczna o dokładności 10-3g).
Określono również gęstość nasypową poprzez pomiar masy i objętości
niewstrząśniętego materiału, która wyniosła 0,48 g∙cm-3 dla odmiany
Melodia, 0,40 g∙cm-3 – Verona oraz 0,50 g∙cm-3 – Irga.
232
Wpływu procesu prasowania obierek ziemniaczanych na właściwości powstałych materiałów
Kolejno, odważano próbki o masie 0,15±0,01 g, zasypywano je
do cylindrycznej matrycy o średnicy wewnętrznej 9 mm i prasowano
jednoosiowo na maszynie wytrzymałościowej Instron 8802 z głowicą
ściskającą (nacisk/ciśnienie: 10 kN/156,25 MPa, 20 kN/312,50 MPa,
30 kN/468,75 MPa). Proces prasowania przebiegał w następujący sposób: zadane naciski osiągano z prędkością narastania siły 20 kN·min-1,
po osiągnięciu zadanej siły przetrzymywano próbkę pod stałym ciśnieniem przez czas ściskania relaksacyjnego wynoszący 1,5 min, w temperaturze otoczenia 20ºC i wilgotności względnej otoczenia 33%. Dla
każdej próby wykonano trzy powtórzenia. W trakcie eksperymentu
rejestrowano jednostkową energię zagęszczania za pomocą programu
Bluehill2. Następnie mierzono gęstość pozorną (nie uwzględniono
znacznej porowatości) uzyskanych wyprasek poprzez pomiar ich masy
(waga analityczna o dokładności 10-3g) i objętości (mikrometr Topex
o dokładności 10-2mm). Pomiar powtórzono po 24 godzinach, po
ustabilizowaniu się wymiarów. Próbki przechowywano w eksykatorze
w temperaturze 20ºC.
Obserwacje mikroskopowe powierzchni wyprasek prowadzono
za pomocą skaningowego mikroskopu elektronowego (SEM) FEI
Quanta 200 ESEM, w trybie niskopróżniowym, ze względu na niską
przewodność elektryczną materiałów, w celu uniknięcia skomplikowanej preparatyki (np. napylania złota). Uzyskane obrazy są efektem
kompozycji sygnałów detektora elektronów wtórnych (SE) i elektronów rozproszonych wstecznie (BSE). Stosowano powiększenia od 50
do 400x.
Ocenę statystyczną wyników wykonano w programie Microsoft
Excel 2010. Obejmowała ona obliczenie średniej arytmetycznej oraz
analizę wariancji, w której do weryfikacji istotności różnic między
wartościami średnimi zastosowano test Tukey’a, przy założonym
poziomie istotności α = 0,05.
Wyniki i dyskusja
Analiza składu granulometrycznego cząstek badanych trzech odmian
ziemniaków wykazała, że charakteryzuje się on rozkładem zbliżonym
do normalnego (ryc. 1). Najwięcej cząstek zawierało się w przedziale
1,0-1,6 mm wielkości. Dla odmiany Verona i Melodia cząstek naj233
Iwona Florczak, Sylwia Andrusiewicz, Jacek Słoma, Marek Klimkiewicz
mniejszych (<0,8 mm) i największych (>2,5 mm) było najmniej. Dla
odmiany Irga ilość cząstek najmniejszych była porównywalna z ilością
cząstek ze środkowego przedziału wielkości. Wielkość cząstek ma
duży wpływ na spoistość sprasowanego materiału. Zbyt duże cząstki
powodują odłamywanie się ich od powierzchni wypraski i powstawanie pęknięć. Cząstki mniejsze zapełniają wolne przestrzenie między
większymi oraz lepiej się z nimi mieszają [Shinoj i in. 2011].
Ryc. 1. Procentowy udział frakcji rozdrobnionych obierek ziemniaczanych.
Jednostkowa energia zagęszczania wzrasta wraz ze wzrostem sił
nacisku głowicy (ryc. 2). Wykazano istotne różnice w jednostkowej
energii zagęszczania dla prasowania obierek odmiany Irga w porównaniu z dwoma pozostałymi odmianami dla sił 10 i 20 kN. Wskazywać
to może na lepszą podatność na prasowanie obierek odmiany Irga.
Nie uzyskano wzrostu gęstości pozornej wyprasek wraz ze wzrostem siły nacisku (ryc. 3). Różnice w gęstości pozornej widoczne są
natomiast między odmianą Irga i dwiema pozostałymi odmianami.
Wypraski odmiany Igra uzyskały najmniejszą gęstość: 1,29 g∙cm-3 dla
nacisku prasowania 10 kN i 1,32 g∙cm-3 dla nacisku prasowania 20 kN.
Dużą gęstością pozorną charakteryzowały się wypraski odmiany
Verona i Melodia 1,38-1,40 g∙cm-3 średnio dla wszystkich sił nacisku
(różnice między nimi były nieistotne statystycznie). Zwiększanie siły
nacisku ponad 10 kN nie ma znaczenia z punktu widzenia poprawy
gęstości wyprasek.
234
Wpływu procesu prasowania obierek ziemniaczanych na właściwości powstałych materiałów
Ryc. 2. Jednostkowa energia zagęszczania materiałów dla trzech sił nacisku
(małymi literami zaznaczono różnice między średnimi – jednakowe litery
oznaczają brak istotnych różnic, różne – występowanie istotnych różnic
między wynikami)
Ryc. 3. Gęstość pozorna wyprasek dla trzech sił nacisku (małymi literami
zaznaczono różnice między średnimi – jednakowe litery oznaczają brak istotnych różnic, różne – występowanie istotnych różnic między wynikami).
235
Iwona Florczak, Sylwia Andrusiewicz, Jacek Słoma, Marek Klimkiewicz
Ryc. 4. Przykładowe obrazy SEM sprasowanych skórek ziemniaczanych:
a. przełom (50x), b. powierzchnia z widocznymi komórkami celulozy
i skrobi (400x).
Na ryc. 4a pokazano przykładowy elektrono-mikroskopowy obraz
przełomu wypraski. Obecność większych cząstek (>1 mm) powodowała powstawanie pęknięć i odprysków. Cząstki mniejsze łączyły się
dzięki obecności substancji takich, jak skrobia czy celuloza, widocznych na ryc. 4b [Lisińska i Gołubowska 2005]. Powyższe rozważania
potwierdza Luo i in. [2011] - zwiększenie rozdrobnienia wpływa na
poprawę gęstości, a dodatkowo zagęszczanie mniejszych cząstek eliminuje wewnętrzne przestrzenie w materiale. Struktury biologiczne
np. białka, pod wpływem tarcia, wilgoci i czasu oddziaływania denaturują, łącząc cząstki, wpływając dodatnio na twardość i trwałość
wyprasek. Podobnie skrobia wpływa adhezyjnie na wypraski – poprzez
żelifikowanie poprawia spójność cząstek. Podwyższona przez tarcie
temperatura wpływa na plastyfikację substancji lignocelulozowych,
zwiększa się gęstość, a wypraska staje się bardziej elastyczna [Carone
i in. 2011].
Wnioski
Przeprowadzone badania potwierdzają, że obierki ziemniaczane są
surowcem przydatnym do wytwarzania prasowanych materiałów
biodegradowalnych. Posiadają zróżnicowaną podatność na prasowanie
w zależności od odmiany ziemniaków, z których pochodzą. Odmiana
236
Wpływu procesu prasowania obierek ziemniaczanych na właściwości powstałych materiałów
Irga wykazała wyższą podatność (niższą energię zagęszczania) od pozostałych odmian. Zwiększenie siły nacisku powyżej 10 kN nie prowadziło do wzrostu gęstości, a jedynie do wzrostu jednostkowej energii
prasowania. Otrzymane wypraski charakteryzowała dobra spoistość,
co potwierdziły badania elektrono-mikroskopowe. Jednocześnie wykazały one, że zbyt duże cząstki powodowały powstawanie pęknięć,
cząstki mniejsze wpływały na utrzymanie bardziej zwartej struktury.
Wykorzystanie obierek ziemniaczanych do wytwarzania materiałów
biokompozytowych jest obiecującym sposobem na zmniejszenie ilości odpadów składowanych na wysypiskach oraz w przyszłości może
pozwolić na wprowadzenie technologii bezodpadowych w zakładach
przemysłu ziemniaczanego.
Bibliografia
Carone M.T. Pantaleo A. Pellerano A. 2011. Influence of process parameters
and biomass characteristics on the durability of pellets from the pruning residues of Olea europaea L. Biomass and Bioenergy, 35: 402-410.
Heim A. 2005. Zagadnienia procesowo-aparaturowe aglomeracji. Materiały
VII Ogólnopolskiej Konferencji w problematyce inżynierii Środowiska
pt. Kompleksowe i szczegółowe problemy inżynierii środowiska. Politechnika Koszalińska: 33-54.
Lisińska G. Gołubowska G. 2005. Structural changes of potato tissue during
French fries production. Food Chemistry, 93: 681–687.
Luo S. Liu C. Xiao B. Xiao L. 2011. A novel pulverization technology. Renewable Energy, 36: 578-582.
Obidziński S. 2009. Studies of potato pulp compaction. Acta Agrophysica,
14, 2: 383-392.
Nosecka B. 2012. Rynek owoców i warzyw - stan i perspektywy. Raport nr
41. Wyd. Instytut Ekonomiki Rolnictwa i Gospodarki Żywnościowej.
Warszawa.
Shinoj S. Visvanathan R. Panigrahi S. Kochubabu M. 2011. Oil palm fiber
(OPF) and its composites: A review. Industrial Crops and Products, 33
(1): 7-22.
237
Iwona Florczak, Sylwia Andrusiewicz, Jacek Słoma, Marek Klimkiewicz
Adres do korespondencji:
mgr inż. Iwona Florczak
Katedra Organizacji i Inżynierii Produkcji
Wydział Inżynierii Produkcji
Szkoła Główna Gospodarstwa Wiejskiego w Warszawie
Nowoursynowska 164, 02-787 Warszawa
e-mail: [email protected]
inż. Sylwia Andrusiewicz
Katedra Organizacji i Inżynierii Produkcji
Wydział Inżynierii Produkcji
Szkoła Główna Gospodarstwa Wiejskiego w Warszawie
e-mail: [email protected]
dr inż. Jacek Słoma
Katedra Organizacji i Inżynierii Produkcji
Wydział Inżynierii Produkcji
Szkoła Główna Gospodarstwa Wiejskiego w Warszawie
e-mail: [email protected]
dr hab. inż. Marek Klimkiewicz
Katedra Organizacji i Inżynierii Produkcji
Wydział Inżynierii Produkcji
Szkoła Główna Gospodarstwa Wiejskiego w Warszawie
e-mail: [email protected]
Promotor: dr hab. inż. Marek Klimkiewicz, prof. SGGW
238
Dorota Gala
Anna Gorczyca
Marek Kołodziejczyk
Maciej Chowaniak
EPISTEME
22/2014, t. III
s. 239–248
ISSN 1895-2241
WPŁYW NAWOŻENIA AZOTEM I APLIKACJI
EFEKTYWNYCH MIKROORGANIZMÓW NA
WYSTĘPOWANIE CHORÓB PODSUSZKOWYCH
I CHORÓB LIŚCI W UPRAWIE PSZENICY JAREJ
EFFECT OF NITROGEN FERTILIZATION AND
APPLICATION OF EFFECTIVE MICROORGANISMS
ON OCCURRENCE OF STEM-BASED DISEASES
AND LEAVES DISEASES IN CULTIVATION OF SPRING
WHEAT
Abstrakt. Celem wykonanych badań było określenie wpływu zróżnicowanych dawek nawożenia azotem i aplikacji preparatu mikrobiologicznego Efektywne Mikroorganizmy na występowanie chorób podsuszkowych i chorób
liści w uprawie pszenicy jarej. Dwuletnie doświadczenie polowe przeprowadzono w warunkach klimatyczno-glebowych wybranego rejonu Małopolski –
w Prusach k. Krakowa. W uprawie pszenicy jarej stwierdzono występowanie
trzech chorób podsuszkowych – fuzaryjnej zgorzeli podstawy źdźbła oraz,
w śladowym nasileniu, zgorzeli podstawy źdźbła i ostrej plamistości oczkowej
(rizoktoniozy zbóż). Na liściach pszenicy wystąpiły objawy rdzy żółtej zbóż
i septoriozy plew. W przypadku wszystkich chorób nie stwierdzono istotnego zróżnicowania zdrowotności pomiędzy pszenicą uprawianą z wykorzystaniem lub bez Efektywnych Mikroorganizmów. Dla kompleksu chorób
podstawy źdźbła i rdzy żółtej czynnikiem istotnie decydującym o nasileniu
występowania były warunki agroklimatyczne roku uprawy.
Słowa kluczowe: pszenica jara, nawożenie azotem, Efektywne Mikroorganizmy
Summary. The aim of the carried out research was to estimate the influence of different doses of nitrogen fertilization and application of microbiological preparation Effective Microorganisms on occurrence of stem-based and leaves diseases in the cultivation of spring wheat. A two-year field
experiment was conducted in climatic-soil conditions of selected region of
Małopolska – in Prusy near Kraków. In cultivation of spring wheat there
239
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Maciej Chowaniak
were observed three stem-based diseases – Fusarium foot rot and in minimum intensity – take-all and sharp eyespot. On the leaves of wheat occurred symptoms of stripe (yellow) rust and septoria leaf blotch. In case of
all diseases there were no significant differences of health between wheat
cultivated with or without Effective Microorganisms. For the complex of
stem-based diseases and yellow rust a major factor affecting on occurrence
were the agroclimatic conditions of cultivation year.
Key words: spring wheat, nitrogen fertilization, Effective Microorganisms
WSTĘP
Racjonalne nawożenie azotem, unikanie monokultur zbożowych,
optymalny termin i gęstość siewu oraz stosowanie kwalifikowanego
materiału siewnego należą do najważniejszych sposobów zapobiegania rozwojowi chorób, szkodników i chwastów w uprawie pszenicy
[Rosada i in. 2010]. Optymalna dawka azotu niesie za sobą również
wzrost plonu ziarna głównie poprzez zwiększenie obsady kłosów,
a w mniejszym stopniu poprzez wzrost masy ziarniaków w kłosie
[Kołodziejczyk i in. 2012]. Azot pozytywnie wpływa na jakość ziarna
pszenicy – powoduje m.in. wzrost zawartości substancji białkowych,
w tym białek glutenowych, które decydują o wartości wypiekowej
mąki pszennej [Cacak-Pietrzak i Sułek 2007].
W ciągu ostatnich kilkunastu lat, ze względu na postępującą
degradację środowiska naturalnego oraz troskę o zdrowie człowieka,
obserwowana jest wyraźna tendencja do stosowania w uprawach
tzw. biopreparatów. Ich zadaniem jest poprawa zdrowotności roślin
poprzez polepszenie struktury gleby i ułatwienie pobierania z niej
składników pokarmowych, ale też stymulowanie odporności roślin
na agrofagi. Wśród obecnie stosowanych środków biologicznych coraz
większą popularność na świecie i w Polsce zdobywa preparat mikrobiologiczny Efektywne Mikroorganizmy (EM) [Piskier 2006; Janas 2009].
Celem przeprowadzonych badań było określenie wpływu zróżnicowanych dawek nawożenia azotem i stosowania preparatu mikrobiologicznego Efektywne Mikroorganizmy na występowanie chorób
podsuszkowych i chorób liści w uprawie pszenicy jarej w warunkach
klimatyczno-glebowych wybranego rejonu Małopolski.
240
Wpływ nawożenia azotem i aplikacji efektywnych mikroorganizmów...
MATERIAŁ I METODY
Warunki agronomiczne
Doświadczenie polowe zostało przeprowadzone na terenie Stacji
Doświadczalnej Uniwersytetu Rolniczego w Krakowie w miejscowości Prusy. Badania zdrowotności pszenicy jarej wykonano w latach
2006–2007. Jako czynnik doświadczalny zastosowano pięć poziomów
nawożenia azotem: 0, 40, 80, 120 i 160 kg·ha -1, które stosowano
z wykorzystaniem lub bez preparatu Efektywne Mikroorganizmy. Ocenianą odmianą pszenicy jarej była Bombona. Doświadczenie założono
w układzie losowanych bloków w trzech powtórzeniach. Wielkość
poletek do zbioru wynosiła 10 m2.
Pszenicę uprawiano na czarnoziemie zdegradowanym, zaliczanym
do I klasy bonitacyjnej i 1. kompleksu przydatności rolniczej. Odczyn
gleby był lekko kwaśny – pHKCl 6,4. Przedplonem był ziemniak. Siew wykonano w pierwszej dekadzie kwietnia, zbiór w pierwszej lub drugiej dekadzie sierpnia. Badana odmiana została wysiana w obsadzie 450 szt.·m-2
i rozstawie rzędów 12,5 cm. Azot na poletkach nawożonych dawkami 40 i 80 kg ha-1 zastosowano w całości przedsiewnie. W przypadku
obiektów nawożonych dawkami wyższymi – 80 kg N·ha-1 podano przed
siewem, natomiast pozostałą część w fazie strzelania w źdźbło (BBCH 32)
i w fazie kłoszenia (BBCH 51). Nawożenie fosforowo-potasowe zostało
zastosowane w ilości 50 kg P2O5·ha-1 i 120 kg K2O·ha-1. Preparat Efektywne Mikroorganizmy (Greenland Technology EM, Polska) aplikowano
doglebowo: przedsiewnie – przed wiosenną uprawą roli oraz pogłównie
– w fazie pierwszego kolanka (BBCH 31) w dawce 3 l·ha-1. Zawiera on
bakterie kwasu mlekowego (Lactobacillus casei, Streptococcus lactis), bakterie fotosyntetyczne (Rhodobacter space, Rhodopseudomonas palustrus),
drożdże (Candida utilis, Saccharomyces albus), promieniowce (Streptomyces
albus, S. griseus) i pleśnie (Aspergillus oryzae, Mucom hiemalis). Ochrona
fungicydowa objęła oprysk preparatem Tilt Plus 400 EC i Amistar 250 SC,
a ochrona herbicydowa oprysk preparatem Lintur 70 WG.
Warunki pogodowe
Warunki pogodowe występujące podczas przeprowadzania badań
można ocenić jako średnio korzystne dla wzrostu pszenicy jarej.
Warunki sezonów badań w porównaniu do średnich wieloletnich
przedstawia ryc. 1. Od kwietnia do lipca roku 2006 i 2007 zarejestro241
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Maciej Chowaniak
wano niższe sumy opadów atmosferycznych niż w odpowiadających
miesiącach wielolecia. Szczególnie suchy był kwiecień 2007 r. oraz lipiec 2006 r. Jedynie sierpień obu sezonów wegetacyjnych obfitował w
opady bardziej niż wielolecie. Okres kwiecień–sierpień 2007 r. i lipiec
2006 r. cechowały się wyższą o 2–4°C średnią temperaturą powietrza.
140
25
120
20
100
[mm]
80
15
60
10
[oC]
40
5
20
0
IV
V
VI
VII
VIII
IV
V
2006 r.
Opady sezon badań
Opady dla wielolecia
VII
VI
VIII
0
2007 r.
Temperatura w sezonie badań
Temperatura dla wielolecia
Ryc. 1. Warunki pogodowe sezonów badawczych na tle wielolecia w Stacji
Doświadczalnej w Prusach
Analizy zdrowotności
Oceny porażenia podstawy źdźbła i liści pszenicy przez patogeny
grzybowe dokonano makroskopowo. Podczas każdej analizy oceniono
10 losowo pobranych roślin z każdego wariantu doświadczalnego. Do
tego celu wykorzystano ogólnie przyjętą metodykę skal graficznych,
w której stopień porażenia wyznacza się na podstawie procentowego
pokrycia ocenianej części rośliny przez zmiany chorobowe. Otrzymane
w skali wyniki zostały przeliczone na procentowy indeks porażenia,
według poniższego wzoru, który wskazuje na udział roślin porażonych
w łanie w stopniu średnim.
I p = 100% � [
� v ×n ×100%
]
i ×N
gdzie:
v – stopień porażenia analizowanej części rośliny w obranej skali,
n – liczba roślin zaliczonych do danego stopnia porażenia,
i – najwyższy stopień porażenia w obranej skali,
N – całkowita liczba badanych roślin.
242
Wpływ nawożenia azotem i aplikacji efektywnych mikroorganizmów...
Statystyczne opracowanie wyników
Statystyczną analizę uzyskanych wyników wykonano z wykorzystaniem dwuczynnikowej analizy wariancji (sezon wegetacji i poziom
nawożenia azotem z dodatkiem lub bez EM). Istotność zróżnicowania
danych została zweryfikowana przy pomocy testu Duncana z transformacją Bliss`a na poziomie istotności α=0,05.
WYNIKI I DYSKUSJA
Analiza zdrowotności podstawy źdźbła pszenicy wykazała występowanie objawów kompleksu chorób podsuszkowych – fuzaryjnej zgorzeli
podstawy źdźbła i korzeni (sprawcy Fusarium spp.) oraz, w minimalnym nasileniu, zgorzeli podstawy źdźbła (sprawca Gaeumannomyces
graminis) i ostrej plamistości oczkowej (rizoktoniozy zbóż; sprawca
Rhizoctonia cerealis).
Symptomy kompleksu chorób podsuszkowych zostały zaobserwowane w nasileniu od 10% do 36% (tab. 1). Sezon uprawy decydował w sposób istotny o wielkości porażenia. Istotnie wyższy Ip, wynoszący 23,94%,
odnotowano w 2006 r. W kolejnym sezonie wegetacyjnym wyniósł on
14,87%. Nie stwierdzono istotnej różnicy pomiędzy porażeniem podstawy źdźbła pszenicy uprawianej z dodatkiem preparatu EM i bez dodatku.
Najwyższe indeksy porażenia zostały odnotowane w przypadku dawki
80 kg N·ha-1, zarówno przy stosowaniu środka mikrobiologicznego, jak
i przy jego braku. Istotnie najniższe porażenie przez sprawców kompleksu
chorób podsuszkowych – 11,19% wystąpiło u pszenicy nienawożonej
azotem i niewspomaganej biopreparatem. Brak wpływu Efektywnych Mikroorganizmów na zmniejszenie stopnia zainfekowania podstawy źdźbła
pszenicy przez sprawców chorób podsuszkowych (łamliwości źdźbła
i zgorzeli podstawy źdźbła) w swoich badaniach wykazały Boligłowa i Gleń
(2008) (dawka całkowita 5 l·ha-1, podzielona na 5 aplikacji po 1 l·ha-1).
Z kolei Stępień i Adamiak (2009) udowodnili wpływ preparatu EM na
obniżenie porażenia podstawy źdźbła przez sprawców łamliwości źdźbła
i fuzaryjnej zgorzeli podstawy źdźbła (oprysk doglebowy w ilości 5 l·ha-1,
podzielonej na dwie dawki – pierwsza 3 l·ha-1 tuż przed siewem, druga
2 l·ha-1 podczas pielęgnacji). Również Majchrzak i in. (2005) wykazali, że
zastosowanie preparatu EM w uprawie pszenżyta ogranicza występowanie chorób podsuszkowych.
243
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Maciej Chowaniak
Tab. 1. Indeks porażenia pszenicy przez grzyby Fusarium spp., Gaeumannomyces graminis i Rhizoctonia cerealis – sprawców kompleksu chorób
podsuszkowych (fuzaryjnej zgorzeli podstawy źdźbła, zgorzeli podstawy
źdźbła i ostrej plamistości oczkowej) [%]
Dawka azotu
[kg·ha-1]/
EM [l·ha-1]
Sezon wegetacyjny
2006
Średnia
2007
0/0
40/0
80/0
120/0
160/0
0/3
40/3
80/3
120/3
160/3
10,49
27,86
35,96
27,41
20,55
19,88
21,98
22,80
27,64
28,24
ab*
abc
c
abc
abc
abc
abc
abc
abc
bc
11,91
11,17
15,66
14,95
19,96
10,35
12,24
27,78
13,76
13,64
ab
ab
ab
ab
abc
a
ab
abc
ab
ab
Średnia
23,94
b*
14,87
a
11,19
18,79
25,12
20,84
20,26
14,79
16,83
25,25
20,25
20,45
a**
ab
b
ab
ab
ab
ab
b
ab
ab
-
* Średnie oznaczone tymi samymi literami w wierszu nie różnią się istotnie według
testu Duncana (α=0,05)
** Średnie oznaczone tymi samymi literami w kolumnie nie różnią się istotnie
według testu Duncana (α=0,05)
Obok obserwacji mających na celu określenie zdrowotności podstawy źdźbła, wykonano również analizy porażenia liści przez patogeny. Stwierdzono występowanie objawów dwóch chorób liści – rdzy
żółtej zbóż i traw, powodowanej przez grzyba Puccinia striiformis oraz
septoriozy plew na liściach, powodowanej przez grzyby Mycosphaerella
graminicola, Leptosphaeria nodorum i Leptosphaeria avenaria f.sp. triticea. Kurt (2002) podaje, że spośród wielu chorób pszenicy – rdza żółta
i septorioza liści należą do najbardziej rozpowszechnionych. Według
Korbasa i in. (2008) septoriozy (paskowana liści i plew) w uprawie
pszenicy jarej są chorobami o dużym znaczeniu gospodarczym, natomiast znaczenie rdzy żółtej ma charakter lokalny.
Grzyb Puccinia striiformis w przeprowadzanym doświadczeniu
powodował porażenie od śladowego (średni Ip dla roku 2006 – 0,21%)
do wynoszącego nieco ponad 20% (średni Ip dla roku 2007 – 20,50%)
244
Wpływ nawożenia azotem i aplikacji efektywnych mikroorganizmów...
(tab. 2). Podobnie jak w przypadku kompleksu chorób podsuszkowych
czynnikiem istotnie różnicującym porażenie były warunki pogodowe
roku uprawy. Istotnie większe porażenie liści stwierdzono w 2007 r.,
mogło to być spowodowane stosunkowo wysoką temperaturą powietrza w całym okresie wegetacji – wyższą w porównaniu do wielolecia.
Nie stwierdzono wpływu aplikacji Efektywnych Mikroorganizmów
na występowanie rdzy żółtej w uprawie pszenicy. Najwyższy średni
indeks porażenia odnotowano dla pszenicy uprawianej bez preparatu
mikrobiologicznego, nawożonej dawką 120 kg N·ha-1, natomiast najniższy w kombinacji bez EM z dawką 160 kg N·ha-1. Odmienne wyniki,
świadczące o hamującym wpływie Efektywnych Mikroorganizmów na
rozwój grzybów z rodzaju Puccinia (dokładnie P. recondita – sprawcę
rdzy brunatnej pszenicy) otrzymali Stępień i Adamiak (2009).
Tab. 2. Indeks porażenia pszenicy przez grzyba Puccinia striiformis –
sprawcę rdzy żółtej zbóż i traw [%]
Sezon wegetacyjny
Dawka azotu
[kg·ha-1]/
EM [l·ha-1]
0/0
2006
0,37
Średnia
2007
a*
25,67
c
8,52
ab**
40/0
0,19
a
17,82
bc
5,63
ab
80/0
0,37
a
14,51
bc
5,02
ab
120/0
1,97
a
23,11
bc
9,96
b
160/0
0,00
a
10,43
b
2,68
a
0/3
0,00
a
29,16
c
7,92
ab
40/3
0,00
a
16,86
bc
4,41
ab
80/3
0,00
a
23,25
bc
6,20
ab
120/3
0,76
a
23,14
bc
8,42
ab
160/3
0,37
a
24,02
bc
8,00
ab
Średnia
0,21
a*
20,50
b
-
*jak w Tab. 1
Septorioza plew na liściach w obu sezonach badawczych występowała w dużym nasileniu (tab. 3). Średnie indeksy porażenia nie były
istotnie różne biorąc pod uwagę rok uprawy oraz dawkę nawożenia,
245
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Maciej Chowaniak
połączoną lub nie ze stosowaniem Efektywnych Mikroorganizmów.
W roku 2006 średni Ip wyniósł 21,02%, natomiast w roku 2007 –
17,69%. Najwyższy (25,05%) średni indeks porażenia został stwierdzony w przypadku pszenicy nienawożonej azotem i niewspomaganej
preparatem mikrobiologicznym. Najniższy (14,95%) odnotowano po
zastosowaniu dawki 80 kg N·ha-1 połączonej ze środkiem EM. Nie
były to jednak różnice istotne statystycznie. Boligłowa i Gleń (2008)
informują o skutecznym działaniu Efektywnych Mikroorganizmów
przeciwko sprawcom septoriozy liści i brunatnej plamistości liści. Natomiast Stępień i Adamiak (2009) w swoich badaniach wykazali brak
istotnego wpływu EM na obniżenie porażenia przez grzyby powodujące
septoriozy na liściach.
Tab. 3. Indeks porażenia pszenicy przez grzyby Mycosphaerella graminicola,
Leptosphaeria nodorum i Leptosphaeria avenaria f.sp. triticea – sprawców
septoriozy plew na liściach [%]
Dawka azotu
[kg·ha-1]/
EM [l·ha-1]
Sezon wegetacyjny
2006
Średnia
2007
0/0
17,16
abc*
33,88
c
25,05
a**
40/0
21,36
abc
23,78
bc
22,56
a
80/0
17,53
abc
15,65
abc
16,58
a
120/0
21,56
abc
17,63
abc
19,56
a
160/0
18,30
abc
12,56
abc
15,32
a
0/3
21,22
abc
21,22
abc
21,22
a
40/3
20,96
abc
18,22
abc
19,57
a
80/3
22,19
abc
8,93
ab
14,95
a
120/3
21,15
abc
28,19
bc
24,59
a
160/3
29,61
bc
4,98
a
15,18
a
Średnia
21,02
a*
17,69
a
-
*jak w Tab. 1
WNIOSKI
Najwyższa, podana przedsiewnie, dawka azotu (80 kg·ha-1) istotnie
sprzyja porażeniu podstawy źdźbła przez sprawców kompleksu cho246
Wpływ nawożenia azotem i aplikacji efektywnych mikroorganizmów...
rób podsuszkowych, natomiast brak nawożenia azotowego powoduje
istotnie najniższe porażenie podstawy źdźbła przez patogeny badanej
pszenicy jarej.
Efektywne Mikroorganizmy w dawce 3 l·ha-1 nie różnicują istotnie stopnia porażenia pszenicy jarej przez stwierdzane w sezonach
badawczych grzyby chorobotwórcze.
Czynnikiem istotnie wpływającym na występowanie kompleksu
chorób podsuszkowych oraz rdzy żółtej zbóż są warunki agroklimatyczne sezonu wegetacyjnego.
Septorioza plew na liściach występuje w dużym nasileniu, ale jej
nasilenie na pszenicy jarej nie jest zależne od zastosowanych czynników badawczych.
BIBLIOGRAFIA
Boligłowa E., Gleń K. 2008. Assessment of Effective Microorganism activity
(EM) in winter wheat protection against fungal diseases. Ecol. Chem.
Eng. A 15 (1–2): 23–27.
Cacak-Pietrzak G., Sułek A. 2007. Wpływ poziomu nawożenia azotem na
plonowanie i jakość technologiczną ziarna pszenicy jarej. Biuletyn
IHAR 245: 47–55.
Janas R. 2009. Możliwości wykorzystania Efektywnych Mikroorganizmów
w ekologicznych systemach produkcji roślin uprawnych. Probl. Inż.
Rol. 3 (65): 111–119.
Kołodziejczyk M., Szmigiel A., Kulig B. 2012. Plonowanie pszenicy jarej
w warunkach zróżnicowanego nawożenia azotem oraz stosowania mikrobiologicznych preparatów poprawiających właściwości
gleby. Fragm. Agron. 29 (1): 60–69.
Korbas M., Mrówczyński M., Paradowski A., Horoszkiewicz-Janka J., Jajor
E., Pruszyński G. 2008. Ochrona roślin w integrowanej produkcji pszenicy. Prog. Plant Prot./Post. Ochr. Roślin 48 (4):1502–1515.
Kurt S. 2002. Screening of wheat cultivars for resistance to stripe rust and
leaf blotch in Turkey. Crop Prot., 21 (6): 495–500.
Majchrzak B., Waleryś Z., Okorski A. 2005. Wykorzystanie Efektywnych
Mikroorganizmów (EM) w biologicznej ochronie pszenżyta przed
chorobami podsuszkowymi. XLV Sesja Naukowa Instytutu Ochrony
Roślin, Poznań, s. 155–156.
Piskier T. 2006. Reakcja pszenicy jarej na stosowanie biostymulatorów i absorbentów glebowych. J. Res. Appl. Agric. Eng. 51 (2): 136–138.
247
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Maciej Chowaniak
Rosada J., Dubas A., Bubniewicz P. 2010. Perspektywy agrotechnicznych
metod ochrony roślin. Prog. Plant Prot./Post. Ochr. Roślin 50 (3):
1181–1187.
Stępień A. Adamiak E. 2009. Efektywne Mikroorganizmy (EM-1) i ich wpływ
na występowanie chorób zbóż. Prog. Plant Prot./Post. Ochr. Roślin 49
(4): 2027–2030.
Adres do korespondencji:
mgr inż. Dorota Gala
Katedra Agrotechniki i Ekologii Rolniczej
e-mail: [email protected]
dr inż. Anna Gorczyca
Katedra Ochrony Środowiska Rolniczego
e-mail: [email protected]
dr inż. Marek Kołodziejczyk
Instytut Produkcji Roślinnej
e-mail: [email protected]
dr inż. Maciej Chowaniak
Katedra Agrotechniki i Ekologii Rolniczej
e-mail: [email protected]
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
al. Mickiewicza 21
31-120 Kraków
Opiekun naukowy: prof. dr hab. inż. Teresa Dąbkowska
248
Dorota Gala
Anna Gorczyca
Marek Kołodziejczyk
Andrzej Joniec
EPISTEME
22/2014, t. III
s. 249–257
ISSN 1895-2241
WPŁYW NAWOŻENIA AZOTOWEGO
NA WYSTĘPOWANIE SZKODNIKÓW W UPRAWIE
PSZENICY JAREJ
INFLUENCE OF NITROGEN FERTILIZATION
ON OCCURRENCE OF PESTS IN CULTIVATION
OF SPRING WHEAT
Abstrakt. Celem przeprowadzonych badań była ocena wpływu zróżnicowanego nawożenia azotowego na występowanie szkodników owadzich w uprawie pszenicy jarej. Czynnikiem doświadczalnym było pięć poziomów nawożenia azotem: 0, 40, 80, 120 i 160 kg·ha-1. Badania polowe przeprowadzono
w Stacji Doświadczalnej Uniwersytetu Rolniczego w Krakowie, w miejscowości Prusy w latach 2006–2007. W uprawie pszenicy jarej obserwowano:
muchówki z rodziny pryszczarkowatych (Cecidomyiidae) i niezmiarkowatych
(Chloropidae) oraz skrzypionki (Oulema sp.). Największe uszkodzenia pszenicy powodował przedstawiciel rodziny pryszczarkowatych – pryszczarek
zbożowiec (Haplodiplosis equestris). Czynnikiem wpływającym na występowanie obu grup muchówek były warunki klimatyczne sezonu wegetacyjnego. Dawka azotu nie wpływała na występowanie badanych owadów.
Słowa kluczowe: szkodniki, nawożenie azotem, dawka azotu, pszenica jara
Summary. The aim of the study was to estimate the effect of different nitrogen fertilization on the occurrence of insect pests in the cultivation of
spring wheat. The experimental factor was five level of nitrogen fertilization: 0, 40, 80, 120 and 160 kg·ha-1. The field researches were conducted at
the Experimental Station of Cracow University of Agriculture in Prusy in
the years 2006–2007. In the cultivation of spring wheat were observed: flies
from gall gnats family (Cecidomyiidae) and frit flies family (Chloropidae) and
leaf beetles (Oulema sp.). The biggest damages of wheat caused representative of gall gnats family – Haplodiplosis equestris. A factor affecting on
occurrence of flies were the climactic conditions of vegetation season. The
nitrogen dose didn’t effect on occurrence of examined group of pests.
Key words: pests, nitrogen fertilization, dose of nitrogen, spring wheat
249
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Andrzej Joniec
WSTĘP
Szkodnikami o dużym znaczeniu gospodarczym w uprawie pszenicy na terenie Polski są obecnie skrzypionki (Oulema sp.): zbożowa
(O. melanopa) i błękitek (O. gallaeciana) oraz muchówki z rodziny
pryszczarkowatych (Cecidomyiidae): pryszczarek pszeniczny (Sitodiplosis mosellana) i pryszczarek zbożowiec (Haplodiplosis equestris). Bardzo
szkodliwą grupą owadów na polach z pszenicą są również mszyce:
zbożowa (Sitobion avenae), czeremchowo-zbożowa (Rhopalosiphum
padi) i różano-trawowa (Metopolophium dirhodum). Mniejsze, lokalne
znaczenie mają m.in.: niezmiarka paskowana (Chlorops pumilionis),
łokaś garbatek (Zabrus tenebroides), wciornastki (Thysanoptera), miniarkowate (Agromyzidae), ploniarka zbożówka (Oscinella frit) czy
rolnice (Agrotinae) [Mrówczyński i in. 2007; Korbas i in. 2008; Korbas
i Mrówczyński 2009; Horoszkiewicz-Janka i in. 2013].
Coraz większe zagrożenie upraw pszenicy przez szkodniki wynika
ze zmian w technologii produkcji zbóż. Uproszczenia w strukturze
zasiewów i agrotechnice, niezrównoważone nawożenie mineralne,
stosowanie chemicznych środków ochrony roślin, a także zmiany
klimatyczne należą do głównych czynników sprzyjających rozwojowi
owadów szkodliwych [Pruszyński 1997; Korbas i Mrówczyński 2009].
Jako jeden ze sposobów ograniczania występowania szkodników o największym znaczeniu ekonomicznym w uprawach pszenicy
wymienia się racjonalne nawożenie azotowe. Dobór dawek azotu
powinien być dostosowany do założonego plonu, warunków siedliskowych (zawartości Nmin) oraz przyjętego kierunku użytkowania
[Korbas i in. 2008; Horoszkiewicz-Janka i in. 2013]. Owadami silnie
reagującymi na dawkę nawożenia azotowego są szkodniki o aparacie
gębowym kłująco-ssącym, przede wszystkim mszyce, które preferują
uprawy, gdzie zastosowano wyższe dawki azotu. Mało rozpoznanym
zagadnieniem jest wpływ nawożenia azotowego na występowanie
szkodników gryzących.
Celem realizowanych badań było określenie wpływu zróżnicowanych poziomów nawożenia azotem na występowanie i szkodliwość
muchówek pryszczarkowatych i niezmiarkowatych oraz skrzypionek
w uprawie pszenicy jarej odmiany Bombona na obszarze wybranego
rejonu Małopolski.
250
Wpływ nawożenia azotowego na występowanie szkodników w uprawie pszenicy jarej
MATERIAŁ I METODY
Dwuletnie (2006–2007) doświadczenie polowe przeprowadzono
w warunkach klimatyczno-glebowych centralnej części Małopolski –
w miejscowości Prusy k. Krakowa (50°06’ N, 20°04’ E). Badania realizowano na terenie Stacji Doświadczalnej Zakładu Szczegółowej
Uprawy Roślin Uniwersytetu Rolniczego w Krakowie.
Czynnikiem eksperymentalnym było pięć poziomów nawożenia
azotowego: 0, 40, 80, 120 i 160 kg·ha-1. Dawki azotu 40 i 80 kg·ha-1
zastosowano w całości przedsiewnie, natomiast większe w ilości – 80
kg N·ha-1 przedsiewnie, a pozostałą część pogłównie w fazie strzelania w źdźbło i kłoszenia (BBCH-32 i 51). Azot doglebowo stosowano
w formie saletry amonowej, natomiast dolistnie w formie mocznika.
Doświadczenie zostało założone w układzie losowanych bloków,
w trzech powtórzeniach. Wielkość poletek do zbioru wynosiła 10
m2. Badaną odmianą pszenicy jarej była Bombona (odmiana elitarna – grupa E, zalecana do uprawy w województwie małopolskim;
hodowca DANKO Hodowla Roślin). Pszenicę uprawiano na czarnoziemie zdegradowanym (I klasa bonitacyjna), wytworzonym z lessu.
Warstwa orna gleby charakteryzowała się odczynem lekko kwaśnym
(pHKCl 6,4), wysoką zasobnością w magnez i fosfor oraz średnią zasobnością w potas. Przedplonem był ziemniak. Nawożenie fosforowe
zastosowano w dawce 50 kg P2O5.ha-1 (superfosfat potrójny), potasowe w dawce 120 kg K2O.ha-1 (sól potasowa). Siew został wykonany
w I dekadzie kwietnia, zbiór w I–II dekadzie sierpnia, w zależności
od sezonu wegetacyjnego. Gęstość siewu wynosiła 450 kiełkujących
ziarniaków na 1 m2, rozstawa rzędów 12,5 cm. Chemiczna ochrona
roślin obejmowała aplikację herbicydu Lintur 70 WG oraz fungicydów
Amistar 250 SC i Tilt Plus 400 EC.
W obu latach uprawy, w których prowadzono badania występowały średnio korzystne dla wzrostu pszenicy jarej warunki pogodowe
(tab. 1). Odnotowano mniejsze niż w wieloleciu sumy opadów atmosferycznych w okresie od kwietnia do lipca, jak i dla całych sezonów
wegetacji pszenicy jarej. W analizowanych okresach stwierdzono
również wyższą średnią temperaturę powietrza (poza majem i sierpniem 2006 r.).
Ocena uszkodzeń roślin pszenicy jarej charakterystycznych dla
poszczególnych grup owadów została wykonana makroskopowo.
251
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Andrzej Joniec
Tab. 1. Charakterystyka warunków opadowo-termicznych w okresie badań
Rok
Miesiąc
IV
V
VI
VII
VIII
Średnia/
Suma
temperatura powietrza (°C)
2006
9,2
13,2
17,4
21,6
17,7
15,8
2007
10,4
15,8
18,1
19,6
19,4
16,7
Wielolecie
8,1
13,7
16,5
18,2
17,9
14,9
opady (mm)
2006
36
60
62
28
93
279
2007
15
57
59
72
125
328
Wielolecie
50
65
80
75
79
349
Z każdego obiektu doświadczalnego pobrano 10 losowo wybranych
roślin. Wykorzystano ogólnie przyjętą metodykę skal graficznych
(5-stopniową), w której 1. stopień oznacza całkowite zniszczenie
badanej części rośliny przez szkodniki, natomiast 5. stopień – brak
oznak żerowania. Uzyskane wyniki przeliczono na procentowy indeks
uszkodzenia, określający udział roślin zniszczonych przez owady
w łanie w stopniu średnim. Przeliczenia zostały dokonane według
poniższego wzoru:
I u = 100% � [
� v ×n ×100%
]
i ×N
v – stopień uszkodzenia badanej części rośliny w obranej skali,
n – liczba roślin zaliczonych do danego stopnia uszkodzenia,
i – najwyższy stopień uszkodzenia w obranej skali,
N – całkowita liczba badanych roślin.
Statystyczną analizę wyników przeprowadzono za pomocą dwuczynnikowej analizy wariancji (pierwszy czynnik – dawka nawożenia
azotem, drugi – rok uprawy). Istotność zróżnicowania danych weryfikowano wykorzystując test Duncana z transformacją Bliss`a na
poziomie α=0,05.
252
Wpływ nawożenia azotowego na występowanie szkodników w uprawie pszenicy jarej
WYNIKI I DYSKUSJA
W uprawie badanej odmiany pszenicy stwierdzono uszkodzenia powodowane przez chrząszcze z rodzaju Oulema (syn. Lema) oraz muchówki z rodziny pryszczarkowatych (Cecidomyiidae) i niezmiarkowatych
(Chloropidae).
Objawy żerowania dwóch gatunków skrzypionek – zbożowej
(O. melanopa) i błękitek (O. gallaeciana), widoczne w postaci podłużnych
otworów wyjadanych w liściach, zostały zaobserwowane w śladowym
nasileniu (tab. 2). Indeks uszkodzenia wahał się w przedziale od 0,30 do
3,83%. Nie stwierdzono statystycznie istotnych różnic między uszkodzeniami blaszek liściowych w pierwszym i drugim roku uprawy. Nieco więcej
uszkodzeń, w odniesieniu do pozostałych obiektów i kontroli, stwierdzono w przypadku roślin nawożonych dawką 80 i 120 kg N·ha-1. Jednak
obserwowane różnice nie okazały się istotne statystycznie. Mrówczyński
i in. [2004] oraz Kaniuczak i in. [2011] podają, że rozwojowi skrzypionek
sprzyjają ciepłe i suche warunki pogodowe, co nie potwierdziło się w badaniach własnych. Z kolei m.in. Korbas i Mrówczyński [2009] czy Horoszkiewicz-Janka i in. [2013] informują, że oprócz racjonalnego nawożenia
azotem dużą rolę w ograniczaniu występowania Oulema sp. odgrywają
również: starannie wykonane zabiegi uprawowe, izolacja przestrzenna od
innych roślin zbożowych oraz opryskiwanie roślin (zwłaszcza na brzegach
pola) selektywnymi insektycydami.
Tab. 2. Indeks uszkodzenia pszenicy przez skrzypionki (Oulema sp.)
Rok uprawy
Dawka azotu
[kg·ha-1]
0
40
80
120
160
Średnia
2006
2,37
0,30
3,64
2,00
0,30
1,42
Średnia
2007
a*
a
a
a
a
a*
0,45
0,45
2,22
3,83
1,96
1,54
a
a
a
a
a
a
1,22
0,37
2,89
2,84
0,95
a**
a
a
a
a
-
* Średnie oznaczone tymi samymi literami w wierszu nie różnią się istotnie według
testu Duncana (α=0,05)
** Średnie oznaczone tymi samymi literami w kolumnie nie różnią się istotnie
według testu Duncana (α=0,05)
253
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Andrzej Joniec
Owadami, których żerowanie także zaobserwowano w uprawie
pszenicy jarej były pryszczarki łodygowe, a dokładnie przedstawiciele
gatunku pryszczarek zbożowiec (Haplodiplosis equestris). Larwy H.
equestris żerują na źdźbłach pomiędzy drugim a piątym międzywęźlem, powodując powstawanie na nich siodełkowatych wyrośli.
W przeprowadzonym doświadczeniu szkodliwość pryszczarków była
największa spośród wszystkich analizowanych szkodników (tab. 3).
Średnie indeksy uszkodzenia wyniosły od 8,28% do 55,38%. Stwierdzono istotne statystycznie zróżnicowanie między pierwszym (Iu
– 13,74%), a drugim (Iu – 34,66%) sezonem badań. Najmniejsze
uszkodzenia roślin zostały odnotowane w przypadku pszenicy nienawożonej azotem, natomiast największe po zastosowaniu dawki 80
kg·ha-1, jednak nie były to ponownie różnice istotne statystycznie.
Wystąpienie znaczenie większych uszkodzeń źdźbła w 2007 r., mogło
być spowodowane sprzyjającymi dla rozwoju pryszczarków warunkami klimatycznymi. Kaniuczak i Bereś [2011] w swoich badaniach
wykazali także większe nasilenie żerowania tej grupy owadów w latach
z wyższymi średnimi temperaturami powietrza i wyższymi sumami
opadów atmosferycznych. Jak podają Mrówczyński i in. [2007], podobnie jak w przypadku skrzypionek, ważnym elementem profilaktyki
jest prawidłowa agrotechnika – zrównoważone nawożenie, głęboka
orka jesienna i unikanie uprawy zbóż po sobie.
Tab. 3. Indeks uszkodzenia pszenicy przez pryszczarka zbożowca
(Haplodiplosis equestris)
Rok uprawy
Dawka azotu
[kg·ha-1]
Średnia
2007
0
15,89
a*
21,76
ab
18,74
a**
40
24,56
ab
21,93
ab
23,23
a
80
13,89
a
55,38
b
32,87
a
120
8,28
a
35,57
ab
20,14
a
160
8,55
a
41,14
ab
22,69
a
Średnia
13,74
a*
34,66
b
* jak w Tab. 1
254
2006
-
Wpływ nawożenia azotowego na występowanie szkodników w uprawie pszenicy jarej
Szkodnikiem o znaczeniu lokalnym, którego występowanie obserwowano w realizowanych badaniach była niezmiarka paskowana
(Chlorops pumilionis). Uszkodzenia charakterystyczne dla tego gatunku
zostały stwierdzone jedynie w pierwszym roku uprawy (tab. 4). Efektem żeru larw pokolenia letniego (mającego znaczenie gospodarcze)
jest skrócenie dokłosia, a często niewykłaszanie się roślin. Średni
indeks uszkodzeń zawierał się w przedziale od 0% do 10,24%. Ze
względu na brak oznak żerowania larw niezmiarki w drugim sezonie
wegetacyjnym, uszkodzenia, które zostały stwierdzone w pierwszym
roku badań były istotnie wyższe. Dla całości uzyskanych wyników,
ze względu na brak objawów w 2007 r., nie wykazano statystycznie
wpływu dawki nawożenia azotem na występowanie i szkodliwość Ch.
pumilionis. Jednak w roku pojawu (2006) niezmiarki istotnie najbardziej uszkadzały obiekty z zastosowanym nawożeniem na najwyższym
poziomie tj. 120 i 160 kg N.ha-1. Optymalną w tym przypadku (istotnie
najmniej uszkodzeń) okazała się dawka azotu 80 kg.ha-1. Jak podaje
Kaniuczak [2007] wilgotna pogoda nie sprzyja lotom i składaniu jaj
przez niezmiarki, co potwierdziły wyniki badań własnych. Również
Kaniuczak i Bereś [2011] w przeprowadzonym doświadczeniu udowodnili kluczowy wpływ warunków pogodowych na występowanie
niezmiarki paskowanej.
Tab. 4. Indeks uszkodzenia pszenicy przez niezmiarkę paskowaną
(Chlorops pumilionis)
Rok uprawy
Dawka azotu
[kg·ha-1]
2006
Średnia
2007
0
5,80
bc*
0,00
a
1,47
a**
40
5,54
bc
0,00
a
1,41
a
80
0,60
ab
0,00
a
0,15
a
120
10,24
c
0,00
a
2,63
a
160
8,70
c
0,00
a
2,23
a
Średnia
5,50
b*
0,00
a
-
* jak w Tab. 1
255
Dorota Gala, Anna Gorczyca, Marek Kołodziejczyk, Andrzej Joniec
WNIOSKI
Największe nasilenie występowania, wśród analizowanych szkodników w uprawie pszenicy jarej, szczególnie w latach z dużą ilością
opadów atmosferycznych i wysoką temperaturą powietrza, wykazują
pryszczarki zbożowe.
Ogólnie wysokość dawki azotu nie wpływa istotnie na żerowanie
stwierdzonych grup szkodników w uprawie pszenicy jarej.
Warunki pogodowe istotnie różnicują występowanie pryszczarka zbożowca i niezmiarki paskowanej, a nie różnicują występowania
skrzypionek.
BIBLIOGRAFIA
Horoszkiewicz-Janka J., Korbas M., Mrówczyński M. (red.) 2013. Metodyka
integrowanej ochrony pszenicy ozimej i jarej dla producentów. Wyd.
IOR-PIB, Poznań, 50, 55–56.
Kaniuczak Z. 2007. Efekty chemicznego zwalczania niezmiarki paskowanej
(Chlorops pumilionis bjerk.) w pszenicy jarej na Podkarpaciu. Prog.
Plant Prot./Post. Ochr. Roślin, 47 (1): 249–252.
Kaniuczak Z., Bereś P. K., Kowalska J. 2011. Skuteczność zwalczania larw
skrzypionek (Oulema spp.) w pszenicy w gospodarstwie ekologicznym
w latach 2008-2010. J. Res. Appl. Agric. Eng. 56 (3): 196–199.
Kaniuczak Z., Bereś P. K. 2011. Występowanie oraz szkodliwość ważnych
gospodarczo szkodników zbóż w gospodarstwach ekologicznych na
Podkarpaciu w latach 2008-2010. J. Res. Appl. Agric. Eng. 56 (3): 189–
195.
Korbas M., Mrówczyński M. (red.) 2009. Integrowana produkcja pszenicy
ozimej i jarej. Wyd. IOR-PIB, Poznań, 137, 139.
Korbas M., Mrówczyński M., Paradowski A., Horoszkiewicz-Janka J., Jajor
E., Pruszyński G. 2008. Ochrona roślin w integrowanej produkcji pszenicy. Prog. Plant Prot./Post. Ochr. Roślin 48 (4):1502–1515.
Mrówczyński M., Boroń M., Wachowiak H., Zielińska W., Dryjańska M.
2004. Atlas szkodników kukurydzy. Wyd. IOR, Poznań, Syngenta Crop
Protection, Warszawa, 41–46.
Mrówczyński M., Kaniuczak Z., Bereś P. K., Pruszyński G., Bubniewicz P.,
Wachowicz H. 2007. Podręczny atlas szkodników pszenicy. Wyd. Plantpress, Kraków, 6, 44–46.
Pruszyński S. 1997. Znaczenie ochrony roślin w rozwoju rolniczych technologii produkcji. Prog. Plant Prot./Post. Ochr. Roślin 37 (1): 19–26.
256
Wpływ nawożenia azotowego na występowanie szkodników w uprawie pszenicy jarej
Adres do korespondencji:
mgr inż. Dorota Gala
Katedra Agrotechniki i Ekologii Rolniczej
e-mail: [email protected]
dr inż. Anna Gorczyca
Katedra Ochrony Środowiska Rolniczego
e-mail: [email protected]
dr inż. Marek Kołodziejczyk
Instytut Produkcji Roślinnej
e-mail: [email protected]
mgr inż. Andrzej Joniec
Katedra Agrotechniki i Ekologii Rolniczej
e-mail: [email protected]
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
al. Mickiewicza 21, 31-120 Kraków
Opiekun naukowy: prof. dr hab. inż. Teresa Dąbkowska
257
Andrzej Joniec
Dorota Gala
Maciej Chowaniak
EPISTEME
22/2014, t. III
s. 259–366
ISSN 1895-2241
WYBRANE PARAMETRY FIZYCZNE GLEBY
W TRADYCYJNEJ I UPROSZCZONEJ UPRAWIE
BOBIKU
FORMATION OF SELECTED SOIL PHYSICAL
PROPERTIES UNDER THE INFLUENCE
OF CULTIVATION SYSTEM OF FABA BEAN
Abstrakt. W latach 2010 - 2012 w Stacji Doświadczalnej Katedry Agrotechniki i Ekologii Rolniczej w Krakowie - Mydlnikach prowadzono badania nad wybranymi właściwościami fizycznymi gleby. Doświadczenie
założono na glebie brunatnej właściwej w czterech powtórzeniach. Czynnikiem doświadczenia były dwa systemy uprawy roli: tradycyjny - płużny i bezpłużny, gdzie pług zastąpiono kultywatorem podorywkowym.
Uprawianą rośliną w dwóch systemach był bobik. Przed zbiorem bobiku pobrano glebę do głębokości 30 cm metodą Kopecky’ego i oznaczono
w niej: gęstość objętościową, wilgotność względną oraz kapilarną pojemność wodną gleby. Po zbiorze bobiku za pomocą sondy Penetrologger
P1.52 firmy Eijkelkamp zbadano opór penetracji gleby w warstwach, co
1 cm do głębokości 30 cm. Pod wpływem uproszczeń w uprawie roli zwiększeniu uległa wilgotność gleby w całym badanym przekroju oraz stwierdzono mniejszą gęstość objętościową na głębokości 10 - 30 cm. Oznaczona po zbiorze bobiku zwięzłość gleby była istotnie większa na obiektach
z uprawą uproszczoną na głębokości 10 - 20 cm.
Słowa kluczowe: systemy uprawy roli, uprawa uproszczona, właściwości fizyczne gleby, bobik
Summary. A field experiment was conducted in 2010 - 2012, at the agricultural experimental station of Agriculture University in Krakow. The aim of
the study was to assess the effect of two soil tillage systems on selected soil
physical properties. The experiment was established on the typical brown
soil. The compared tillage systems were: ploughing - a traditional cultivation
and ploughless - a reduced tillage system. Reduced tillage system resulted in
significantly higher water content and penetration resistance and in a lower
bulk density in relation to conventional tillage.
Key words: physical properties of soil, tillage system, faba bean
259
Andrzej Joniec, Dorota Gala, Maciej Chowaniak
WSTĘP
Uprawa roli dzięki kształtowaniu jej właściwości fizycznych, chemicznych i biologicznych ma za zadanie zapewnić jak najlepsze warunki do
wzrostu i rozwoju uprawianych roślin. Tradycyjna płużna uprawa roli,
która niezmiennie dominuje w rolnictwie, coraz chętniej zastępowana
jest alternatywnymi metodami uprawy. Wśród głównych przyczyn
odejścia od tradycyjnej uprawy roli wymienia się mniejsze nakłady
pracy i energii [Kordas 2009], ograniczenie procesu mineralizacji
próchnicy [Davidson i Acerman 1993], czy zmniejszenie podatności
gleby na erozję wodną i wietrzną [Holland 2004] w wyniku wprowadzanych uproszczeń. Oprócz pozytywnych efektów uprawa uproszczona może prowadzić do pogorszenia fizycznych właściwości gleby,
tj. gęstość i zwięzłośc gleby [Blecharczyk i in. 2007] oraz może powodować wzrost zachwaszczenia [Weber i Hryńczuk 2005, Stupnicka-Rodzynkiewicz i in. 2004]. Plony roślin uzyskiwane w uproszczonych
systemach uprawy roli są bardzo zróżnicowane, a ich wielkość w dużej
części zależy od takich czynników jak: warunki glebowe, klimatyczne,
odpowiednie następstwo roślin, dobór pestycydów, czy rodzaj użytych
maszyn do uprawy roli i siewu [Małecka i in. 2009].
Celem badań było określenie wpływu zastosowanych uproszczeń
w uprawie bobiku na wybrane parametry fizyczne gleby.
MATERIAŁ I METODY
Doświadczenie polowe prowadzono w latach 2010 - 2012 w Stacji Doświadczalnej Katedry Agrotechniki i Ekologii Rolniczej Uniwersytetu
Rolniczego w Krakowie - Mydlnikach. Badania, w układzie losowanych
podbloków (split – plot), prowadzono w czteropolowym płodozmianie: bobik - pszenica ozima - pszenica jara - jęczmień jary. Gleba pola
doświadczalnego sklasyfikowana została jako gleba brunatno ziemna,
typ – płowa, podtyp – gleba płowa opadowo – glejowa, gatunek – pył
zwykły, rodzaj – wytworzona z lessu. Gleba zaliczona została do kompleksu pszennego dobrego przydatności rolniczej, klasy bonitacyjnej
II. W tradycyjnym - płużnym i uproszczonym – bezpłużnym systemie
uprawiano bobik odmiany „Kasztelan”. W uproszczonym systemie
uprawy roli pług zastąpiono w uprawie pożniwnej i przedzimowej
bobiku kultywatorem podorywkowym. Bezpośrednio przed siewem
w obydwu wariantach glebę doprawiano agregatem uprawowym składającym się z kultywatora i wału strunowego.
260
Wybrane parametry fizyczne gleby w tradycyjnej i uproszczonej uprawie bobiku
Przed zbiorem bobiku, w trzech warstwach: 0-10, 10-20 i 20-30
cm, pobierano próbki gleby w dwóch powtórzeniach do cylindrów o
objętości 100 cm3 wg metody Kopecky’ego. W pobranym materiale
oznaczono: gęstość objętościową stałej fazy gleby „na sucho” [Mg·m-3],
wilgotność względną gleby [% objętościowych], pojemność kapilarną
gleby [% objętościowych] oraz porowatość gleby [% objętościowych].
Po zbiorze bobiku, w czterech powtórzeniach, za pomocą sondy Penetrologger P1.52 firmy Eijkelkamp zbadano zwięzłość gleby, dla
przedziału 10 cm do głębokości 30 cm.
Otrzymane wyniki oceniono statystycznie metodą analizy wariancji. Natomiast testowanie różnic między średnimi szacowano
testem Tukey’a na poziomie α=0,05.
WYNIKI I DYSKUSJA
W badaniach własnych uproszczenia w uprawie roli oddziaływały
istotnie na takie parametry fizyczne gleby jak gęstość objętościowa,
wilgotność oraz zwięzłość.
Porównywana na głębokości 30 cm gęstość objętościowa uległa
istotnemu zmniejszeniu w warstwie 10-30 cm pod wpływem prowadzonej uprawy uproszczonej (bezpłużnej), a obserwowane zmniejszenie gęstości wyniosło ok. 5% (tab. 1). Średnie zmniejszenie gęstości
obserwowane na obiektach z uprawą uproszczoną w całym badanym
przekroju było na poziomie 3%.
Tab. 1. Gęstość objętościowa gleby [Mg·m-3] na głębokości 0–30 cm
(średnia dla lat 2010–2012)
Głębokość pomiaru [cm] (B)
0 - 10
NIR 0,05
10 - 20
NIR 0,05
20 - 30
NIR 0,05
Średnio dla systemu uprawy
NIR 0,05
System uprawy (A)
tradycyjny
uproszczony
1,42
1,46
r.n.
1,47
1,40
0,067
1,48
1,39
0,063
1,45
1,41
0,030
Średnio
1,44
1,43
1,43
r.n.
r.n. – różnica nieistotna
261
Andrzej Joniec, Dorota Gala, Maciej Chowaniak
W wierzchniej warstwie roli zauważalna była z kolei odwrotna
tendencja do zwiększania się gęstości gleby pod wpływem wprowadzanych uproszczeń uprawowych. Pabin i in. [2008] pod wpływem
wprowadzonej uproszczonej uprawy roli obserwowali największy
wzrost gęstości objętościowej gleby na głębokości 10-15 cm. Natomiast zmniejszenie gęstości gleby w wyniku uproszczeń w uprawie
roli w swoich badaniach stwierdził Ball [1995]. W przypadku gęstości
objętościowej gleby podobną do badań własnych zależność stwierdziła
Małecka i in. [2012], która w wyniku uprawy uproszczonej stwierdziła
zwiększenie gęstości objętościowej w warstwie 0-10 cm, a w głębszych
warstwach obserwowano odwrotne relacje.
Rezygnacja z pługa na rzecz kultywatora w uprawie roli prowadziła do zwiększenia wilgotności gleby w całym analizowanym profilu (tab. 2). Największy wzrost wilgotności, o ok. 12% odnotowano
w wierzchniej warstwie gleby. Podobne zależności obserwował Pabin
i in. [2008]. Najlepsze rezultaty w przypadku uprawy zerowej uzyskał
z pozostawiania na powierzchni gleby mulczu. Również inni badacze
wskazują na pozytywne oddziaływanie bezpłużnej uprawy roli na
wzrost zawartości wody w górnych warstwach gleby [Biskupski i in.
2003, Schillinger 2001].
Tab. 2. Średnie wartości uwilgotnienia gleby [% obj.]
(średnia dla lat 2010 - 2012)
Głębokość pomiaru [cm] (B)
0 - 10
System uprawy (A)
tradycyjny
uproszczony
24,7
27,6
0,98
NIR 0,05
10 - 20
24,1
20 - 30
24,5
NIR 0,05
25,1
r.n.
NIR 0,05
Średnio dla systemu uprawy
25,6
1,12
NIR 0,05
24,4
26,1
0,62
Średnio
26,1
24,8
24,8
0,92
r.n. – różnica nieistotna
Kapilarna pojemność wodna badana w trakcie doświadczenia nie
zmieniała się pod wpływem prowadzonej uprawy (tab. 3).
262
Wybrane parametry fizyczne gleby w tradycyjnej i uproszczonej uprawie bobiku
Tab. 3. Kapilarna pojemność wodna gleby [% obj.]
(średnia dla lat 2010 – 2012)
Głębokość pomiaru [cm] (B)
0 - 10
System uprawy (A)
tradycyjny
uproszczony
39,7
39,1
r.n.
NIR 0,05
10 - 20
40,8
r.n.
NIR 0,05
20 - 30
40,8
41,0
r.n.
NIR 0,05
Średnio dla systemu uprawy
40,9
40,4
40,3
r.n.
NIR 0,05
Średnio
39,4
40,8
40,9
0,82
r.n. – różnica nieistotna
Jednak niezależnie od systemu uprawy roli istotnie większą pojemność kapilarną stwierdzono w górnej warstwie profilu glebowego.
Małecka i in. [2012] w uprawie grochu stwierdzili zwiększenie wilgotności oraz kapilarnej pojemności wodnej w wierzchniej warstwie
gleby pod wpływem uproszczeń uprawowych, najbardziej w siewie
bezpośrednim. W głębszej warstwie autorzy stwierdzili w przypadku
kapilarnej pojemności wodnej odwrotną relację. Z kolei Kuc i Zimny
[2004] nie obserwowali zmian w kapilarnej pojemności wodnej gleby
pod wpływem uproszczeń w uprawie buraka.
Tab. 4. Średnie wartości porowatości gleby [% obj.] w warstwie 0-30 cm
(średnia dla lat 2010 – 2012)
Głębokość pomiaru [cm]
0 - 10
System uprawy
tradycyjny
uproszczony
46,3
44,8
r.n.
NIR 0,05
10 - 20
47,8
r.n.
NIR 0,05
20 - 30
46,9
NIR 0,05
47,5
r.n.
NIR 0,05
Średnio dla systemu uprawy
47,3
47,0
46,5
r.n.
Średnio
45,5
47,5
47,2
1,43
r.n. – różnica nieistotna
263
Andrzej Joniec, Dorota Gala, Maciej Chowaniak
Porowatość gleby oznaczona w trakcie doświadczenia nie była
istotnie modyfikowana przez porównywane systemy uprawy roli (tab.
4). Z racji powiązania objętości porówz gęstością objętościową gleby
zauważalny jest spadek porowatości gleby w wierzchniej warstwie
gleby i wzrost na głębokości 20-30 cm na obiektach z bezpłużną
uprawą roli.
Podobnie jak w badaniach własnych również Kuc i Zimny [2004]
nie stwierdzili zmian w porowatości gleby pod wpływem wprowadzonej uprawy uproszczonej w porównaniu do tradycyjnej metody uprawy
buraka cukrowego.
Jednym z ważniejszych parametrów opisujących glebę jest jej
zwięzłość. Rezygnacja z płużnej uprawy roli i zastosowanie kultywatora podorywkowego jako głównego narzędzia uprawowego przyniosło
istotne zwiększenie zwięzłości gleby (tab. 5). Różnica na głębokości 10-20 cm pomiędzy uprawą tradycyjna a uproszczoną wynosiła
36%. W kolejnym badanym poziomie, zwięzłość gleby oznaczona na
obiektach z uprawą tradycyjną była większa o 24%. Średnio zwięzłość
gleby w trakcie trwania doświadczenia wzrosła o 20% na obiektach
uprawianych bezpłużnie.
Tab. 5. Średnie wartości zwięzłości gleby [MPa] w warstwie 0-30 cm
(średnia dla lat 2010 – 2012)
Głębokość pomiaru [cm]
0 - 10
NIR 0,05
10 - 20
NIR 0,05
20 - 30
NIR 0,05
Średnio dla systemu uprawy
NIR 0,05
System uprawy
tradycyjny
uproszczony
2,7
2,7
r.n.
3,6
4,9
0,42
4,1
5,1
0,84
3,5
4,2
Średnio
2,7
4,2
4,6
0,40
0,27
r.n. – różnica nieistotna
Podobne zmiany zwięzłości zachodzące pod wpływem uproszczeń
uprawowych potwierdzają również wyniki innych badań [Idkowiak i
Kordas 2004, Cudzik i in 2012].
264
Wybrane parametry fizyczne gleby w tradycyjnej i uproszczonej uprawie bobiku
WNIOSKI
Wprowadzone uproszczenia uprawy roli wpływały w zróżnicowany
sposób na badane fizyczne właściwości gleby.
Korzystne oddziaływanie uproszczeń w uprawie stwierdzone
zostało w przypadku gęstości objętościowej gleby, która była istotnie
niższa na obiektach uprawianych bezpłuznie.
Zastosowanie uproszczeń w uprawie roli zwiększało zapas wody
w glebie w porównaniu do obiektów uprawianych tradycyjnym systemem.
Zwięzłość gleby uległa istotnemu zwiększeniu na głębokości 1030 cm pod wpływem uprawy uproszczonej.
BIBLIOGRAFIA
Ball B.C. 1995. Soil response to tillage and their enviromental implication in
Scotland. Experience with the applicability of no-tillage crop production in the West-European countries. Procedings of the EC Workshop
2: 7-16.
Biskupski A., Włodek S., Pabin J. 2003. Sposoby uprawy roli a plonowanie
i zmiany wilgotności gleby. Zesz. Probl. Post. Nauk Rol., 493: 335-343
Blecharczyk A., Małecka I., Sierpowski J. 2007. Wpływ wieloletniego oddziaływania systemów uprawy roli na fizyko-chemiczne właściwości gleby. Fragm. Agron., 24 (1): 7-13.
Cudzik A., Białczyk W., Czarnecki J., Brennensthul M., Kaus A. 2012. Ocena systemów uprawy w aspekcie zużycia paliwa, plonowania roślin
i właściwości gleby. Inż. Rol., 2 (137) t. 2: 17-27.
Davidson E.A., Ackerman I.L. 1993. Changes in soil carbon inventories following cultivation of previously untilled soils. Biogeochemistry, 20 (3):
161-193.
Holland J.M. 2004. The environmental consequences of adopting conservation tillage in Europe: reviewing the evidence. Agric. Ecosys. Environ.,
103: 1-25.
Kordas L. 2009. Efektywność ekonomiczna różnych systemów uprawy roli
w uprawie pszenicy ozimej po sobie. Fragm. Agron. 26(1): 42-48.
Kuc P., Zimny L. 2004. Kształtowanie sie właściwości fizycznych gleby pod
wpływem zróżnicowanych systemów uprawy buraka cukrowego. Annales UMCS, Sec. E., 59 (3): 1129-1138.
265
Andrzej Joniec, Dorota Gala, Maciej Chowaniak
Małecka I., Blecharczyk A., Dobrzeniecki T. 2009. Produkcyjne i środowiskowe skutki wieloletniego stosowania systemów bezorkowych
w uprawie grochu siewnego. Fragm. Agron., 26 (3): 118–127.
Małecka I., Swędrzyńska D., Blecharczyk A., Dytman-Hagedorn M. 2012.
Wpływ systemów uprawy roli pod groch na właściwości fizyczne, chemiczne i biologiczne gleby. Fragm. Agron. 29(4): 106-116.
Pabin J., Włodek S., Biskupski A. 2008. Niektóre uwarunkowania środowiskowe i produkcyjne przy stosowaniu uproszczonych sposobów
uprawy roli. Inż. Rol. 1 (99): 333-338.
Schillinger W.F. 2001. Minimum and delayed conservation tillage for wheat
– fallow farming. Soil. Sci. Soc. Amer. J., 65: 1203-1209
Stupnicka-Rodzynkiewicz E., Stępnik K., Lepiarczyk A. 2004. Wpływ zmianowania, sposobu uprawy roli i herbicydów na bioróżnorodność zbiorowisk chwastów. Acta Sci. Pol., Agric., 3 (2): 235-245.
Weber R., Hryńczuk B. 2005. Wpływ sposobu uprawy roli i przedplonu na
zachwaszczenie pszenicy ozimej. Annales UMCS, Sec. E, 60: 93-102.
Adres do korespondencji:
mgr inż. Andrzej Joniec
Katedra Agrotechniki i Ekologii Rolniczej
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. inż. Andrzej Lepiarczyk
266
Agnieszka Kalandyk
Piotr Waligórski
Franciszek Dubert
EPISTEME
22/2014, t. III
s. 267–274
ISSN 1895-2241
ZASTOSOWANIE BIOSTYMULATORÓW
W ŁAGODZENIU SKUTKÓW SUSZY I INNYCH
STRESÓW ŚRODOWISKOWYCH U SOI
ZWYCZAJNEJ (Glycine max L. Merr.)
USE OF BIOSTIMULATORS IN MITIGATING
THE EFFECTS OF DROUGHT AND OTHER
ENVIRONMENTAL STRESSES
IN SOYA BEAN (Glycine max L. Merr.)
Abstrakt. Rośliny uprawne w trakcie wegetacji są poddawane stresom klimatycznym należącym do stresów abiotycznych, które stają się przyczyną
utraty plonu. Celem badań było określenie efektywności wybranych substancji stymulujących w łagodzeniu skutków suszy w doświadczeniu tunelowym oraz stresów związanych z wegetacją w polu. Materiał roślinny
stanowiła soja zwyczajna odmiany Augusta. Efektywność poszczególnych
biostymulatorów określono na podstawie pomiarów parametrów charakteryzujących fazę generatywną (liczba kwiatów, strąków i stopień aborcji
kwiatów) oraz parametrów plonu (liczba nasion na roślinę, liczba nasion
w strąku, masa nasion na roślinę i masa 1000 nasion). Bardziej efektywnym
stymulatorem w warunkach suszy okazał się SILVIT, który zwiększył liczbę
strąków na roślinę o 20%, a liczbę nasion z rośliny o 27%. W doświadczeniu
polowym na tle innych substancji wyróżnił się preparat OPTYSIL, przy użyciu którego liczba strąków zwiększyła się o ok. 14%, a masa nasion o 21%
w stosunku do kontroli.
Słowa kluczowe: soja zwyczajna (Glycine max L. Merr.), stres suszy, stresy
polowe, stresy abiotyczne, biostymulatory
Abstract. Plants during the growing season are subjected to the climate
stresses, among them drought stress, which causes a loss in yield. The aim of
the experiments was to determine the effectiveness of selected stimulants
in mitigating the effects of drought on plant grown in the tunnel and sum of
the stresses in the field. The plant material was soya bean cultivar Augusta.
267
Agnieszka Kalandyk, Piotr Waligórski, Franciszek Dubert
The effectiveness of individual biostimulators was determined by measuring parameters that characterize the generative phase and yield parameters. Under drought conditions more effective stimulator was SILVIT, which
increased the number of pods per plant by 20% and the number of seeds per
plant by 27%. In the field study the OPTYSIL stimulant distinguished itself
from other substances. It increased the number of pods almost by 14% and
seed weight by 21% as compared to control (plants drought treated, but non
treated with stimulators).
Key words: soya bean (Glycine max L. Merr .), drought stress, field stresses,
abiotic stresses, biostimulators
WSTĘP
Począwszy od końca XIX wieku klimat Polski wykazuje systematyczną
tendencję wzrostu temperatury powietrza. Wraz ze wzrostem temperatury poprawiają się w Polsce warunki klimatyczne do uprawy roślin
ciepłolubnych, do których należy m.in. soja. Wzrost temperatury w
okresie późnozimowym i wczesnowiosennym przyspiesza początek
okresu wegetacyjnego i stwarza możliwość wcześniejszego rozpoczęcia
prac polowych. Jednak zmienia się także struktura opadów, które stają
się bardziej gwałtowne, krótkotrwałe, niszczycielskie, powodujące coraz
częściej powodzie i podtopienia. Jednocześnie zanikają opady niewielkie
(poniżej 1mm · doba -1). Pogłębiający się niedobór wody jest czynnikiem
powodującym stopniowe zmniejszanie się efektywności produkcji
w rolnictwie. Obserwuje się występowanie dużych wahań plonów (lata
urodzaju i nieurodzaju), tak więc niedobór wody, rzadziej jej nadmiar,
stają się coraz częściej przyczyną niewykorzystania możliwości produkcyjnych, jakie stwarzają warunki termiczno-energetyczne środowiska
przyrodniczego i nowoczesne technologie [Sadowski i Gworek 2013].
Nadmierne okresowe wahania temperatury oraz wahania zawartości wody glebowej to czynniki, które wywołują u roślin wspólne
symptomy stresu oksydacyjnego, takie jak akumulacja reaktywnych
form tlenu, które uszkadzają komórki na poziomie ich składników
chemicznych. Przeciwdziałanie stresowi oksydacyjnemu na drodze
klasycznej hodowli lub metodami inżynierii molekularnej, jest trudne,
podobnie jak próba selekcji odporniejszych genotypów. Dlatego alternatywnym działaniem wydaje się traktowanie roślin stymulatorami,
hormonami lub innymi substancjami łagodzącymi stres, podawanymi
zwykle w postaci oprysku [Gawrońska i in. 2008, Przybysz i in. 2008].
268
Zastosowanie biostymulatorów w łagodzeniu skutków suszy...
Celem wykonanych prac było określenie efektywności preparatów
OPTYSIL oraz SILVIT w łagodzeniu skutków stresu trzytygodniowej
suszy glebowej, działającej w okresie kwitnienia roślin, w doświadczeniu wazonowym u soi uprawnej, oraz efektywności preparatów
OPTYSIL, OPTYPLUS oraz GROW ON w łagodzeniu różnych stresów
środowiskowych występujących w trakcie wegetacji roślin w warunkach polowych.
MATERIAŁ I METODY
Badania przeprowadzono na roślinach soi uprawnej odmiany Augusta, której nasiona otrzymano z Katedry Genetyki i Hodowli Roślin
Uniwersytetu Przyrodniczego w Poznaniu.
Doświadczenie w otwartym tunelu foliowym. Doświadczenie
obejmowało 4 obiekty: kontrola (rośliny podlewane do 70% pojemności wodnej gleby, nieopryskiwane), susza (do 25% pojemności wodnej
gleby od okresu pełni kwitnienia roślin przez 3 tygodnie), susza +
OPTYSIL (0,25 %) oraz susza + SILVIT (0,25 %). Każdy obiekt składał
się z 5 doniczek o śr. 25 cm i objętości ok. 8 dm3. W każdej doniczce
rosło po 5 roślin. Opryski biostymulatorami wykonano trzykrotnie w
odstępach dwutygodniowych począwszy od fazy 6 liści. Do każdego
oprysku użyto 60 cm3 danego roztworu.
Doświadczenie polowe. Doświadczenie polowe założono na terenie stacji doświadczalnej Uniwersytetu Rolniczego w Mydlnikach,
metodą losowanych bloków. Obejmowało ono cztery obiekty: kontrolę
oraz trzy traktowania (OPTYSIL, OPTYPLUS i GROW ON). Jeden
obiekt składał się z ok. 120 roślin. Oprysk biostymulatorem OPTYSIL
(0,25 %) wykonano trzykrotnie, co dwa tygodnie począwszy od fazy
6 liści, biostymulatorem OPTYPLUS (0,75 %) dwukrotnie począwszy
od fazy 6 liści, biostymulatorem GROW ON (2,5 %) dwukrotnie, na
początku oraz na końcu fazy kwitnienia. Do oprysku każdego poletka
użyto 250 cm3 roztworu. Poletko kontrolne zostało opryskane 250
cm3 wody destylowanej.
Okres wegetacji charakteryzował się bardzo wysoką temperaturą
oraz niewielką ilością opadów, zwłaszcza w fazie kwitnienia roślin.
W celu oceny skutków działania suszy i innych czynników stresowych towarzyszących wegetacji w warunkach polowych przyjęto
269
Agnieszka Kalandyk, Piotr Waligórski, Franciszek Dubert
następujące parametry określane w czasie fazy generatywnej roślin:
liczba kwiatów, liczba produkcyjnych strąków, stopień odrzucania
kwiatów oraz parametry plonu: liczba nasion w strąku, liczba strąków
oraz liczba i masa nasion z jednej rośliny, a także masa 1000 nasion.
Dodatkowo w doświadczeniu polowym określono wysokość osadzenia
pierwszego węzła generatywnego.
WYNIKI I DYSKUSJA
Doświadczenie wazonowe w otwartym tunelu foliowym:
OBIEKTY
liczba kwiatów
na roślinę [szt.]
liczba strąków
na roślinę [szt.]
stopień aborcji
kwiatów [%]
liczba nasion na
roślinę [szt.]
masa nasion na
roślinę [g]
masa 1000 nasion [g]
liczba nasion na
strąk [szt.]
Tab. 1. Wpływ badanych preparatów na przebieg fazy generatywnej i elementy struktury plonowania soi w doświadczeniu wazonowym.
KONTROLA
SUSZA
susza + SILVIT
susza + OPTYSIL
48,3
46,0
53,0
52,5
7,2b
3,4a
4,1a
4,0a
85,2
92,5
92,3
92,3
15,3b
6,3a
8,0a
6,9a
1,261b
0,593a
0,666a
0,561a
84,4a
94,2b
81,6a
82,7a
2,1c
1,8ab
2,0bc
1,7a
Różne litery wskazują statystycznie istotne różnice dla p< 0,05
wg testu Duncana.
W trakcie wegetacji rośliny poddane stresowi suszy odrzuciły ponad 92% kwiatów i młodych strąków, podczas gdy rośliny nawadniane
(kontrola) odrzuciły 85% kwiatów i młodych strąków. Zastosowane
stymulatory nie zmniejszyły aborcji kwiatów, zwiększyły jednak liczbę
strąków na roślinę (SILVIT o 20%, a OPTYSIL o 18%) w porównaniu
z roślinami poddanymi działaniu suszy. Okresowa susza spowodowała
znaczne zmniejszenie liczby i masy nasion na roślinę oraz redukcję
liczby nasion w strąku w porównaniu z kontrolą, masa tysiąca nasion
była o 10% większa w porównaniu do nasion kontroli. Preparat SILVIT zwiększył liczbę nasion na roślinę o 27%, liczbę nasion w strąku
o 11%, a średnią masę nasion z rośliny o 12% w porównaniu z roślinami poddanymi działaniu suszy, a nietraktowanymi żadnym
z preparatów.
270
Zastosowanie biostymulatorów w łagodzeniu skutków suszy...
Jak podaje producent, OPTYSIL zawiera przyswajalny przez
rośliny krzem, który oddziałuje korzystnie na ich rozwój i plonowanie. OPTYSIL ogranicza wpływ stresów, reguluje pobieranie makroi mikroelementów, łagodzi negatywne skutki okresowego niedoboru
wody, wysokiego zasolenia oraz aktywizuje naturalne mechanizmy
odpornościowe roślin, a wzmacniając ściany komórkowe zmniejsza
podatność roślin na uszkodzenia mechaniczne.
SILVIT ogranicza fizyczną penetrację tkanek przez szkodniki,
gdyż ściany komórkowe stają się bardziej odporne na enzymy produkowane przez patogeny (działanie fungistatyczne). Zwiększa tolerancję roślin na niskie temperatury, redukuje transpirację w okresie suszy,
intensyfikuje fotosyntezę w warunkach słabego światła, ogranicza
wpływ wysokiego zasolenia gleby na wzrost roślin, ogranicza wpływ
niedoboru fosforu poprzez regulowanie jego pobierania i eliminuje
toksyczne działanie glinu na wzrost korzenia.
Doświadczenie polowe:
OBIEKTY
liczba kwiatów na
roślinę [szt.]
liczba strąków na
roślinę [szt.]
stopień aborcji
kwiatów [%]
wysokość osadzenia
pierwszego strąka
[nr węzła]
liczba nasion na
roślinę [szt.]
masa nasion na
roślinę [g]
masa 1000 nasion
[g]
liczba nasion na
strąk [szt.]
Tab. 3. Wpływ badanych preparatów na przebieg fazy generatywnej
i elementy struktury plonowania soi w doświadczeniu polowym.
KONTROLA
GROW ON
OPTYPLUS
OPTYSIL
47,5
48,8
45,0
48,3
6,3b
6,4b
3,5a
7,2c
86,8
86,9
92,3
85,1
3,9
4,2
5,6
3,9
13,7bc
12,4b
6,3a
15,3c
1,09b
1,05b
0,42a
1,31c
78,0b
85,2a
67,8c
85,0a
2,2a
2,0b
1,8c
2,2a
Różne litery wskazują statystycznie istotne różnice dla p< 0,05
wg testu Duncana.
W warunkach polowych na tle kontroli wyróżnił się preparat
OPTYSIL, po użyciu którego zaobserwowano zwiększenie liczby strąków o ok. 14% w stosunku do kontroli oraz 21% wzrost masy nasion
na roślinę. Efektem aplikacji stymulatorów OPTYSIL oraz GROW
271
Agnieszka Kalandyk, Piotr Waligórski, Franciszek Dubert
ON było zwiększenie masy 1000 nasion o 9%. Ponadto OPTYSIL
spowodował także wzrost liczby nasion z rośliny o 12%. Zastosowanie preparatu OPTYPLUS spowodowało zmniejszenie liczby strąków,
liczby nasion i masy nasion na roślinę oraz liczby nasion na strąk w
porównaniu z roślinami kontrolnymi. Zaobserwowano także zasychanie kwiatów na dolnych węzłach.
GROW ON to preparat przeznaczony do szybkiego zaopatrzenia
roślin w fosfor, zwłaszcza w warunkach ograniczonej dostępności tego
składnika w glebie. Polecany szczególnie do stosowania dla upraw na
glebach kwaśnych, zimnych, w okresach niskiej temperatury gleby
oraz w czasie chłodów.
OPTYPLUS jest preparatem mineralnym wspomagającym naturalne mechanizmy obronne roślin (produkcja fitoaleksyn) znacząco
poprawia odporność roślin na porażenia przez patogeny grzybowe
z gromady Oomycetes, dostarcza fosfor w formie, która wykorzystywana jest przez rośliny w dłuższym okresie czasu oraz jest źródłem
łatwo przyswajalnego potasu.
Gong i in. [2005] wykazali, że zastosowanie krzemu poprawiło
stan uwodnienia roślin w warunkach suszy, zwiększyło aktywność
niektórych enzymów antyoksydacyjnych (dysmutazy ponadtlenkowej, katalazy i reduktazy glutationowej) oraz zwiększyło zawartość
nienasyconych kwasów tłuszczowych, barwników fotosyntetycznych
i białka rozpuszczalnego. Ponadto aplikacja krzemu spowodowała
intensyfikację fotosyntezy netto w czasie suszy. Autorzy sugerują, że
korzystne działanie krzemu na rośliny w stresie suszy jest związane
ze wzrostem zdolności antyoksydacyjnych komórek, zatem polega
na łagodzeniu uszkodzeń wywołanych przez reaktywne formy tlenu.
W badaniach Chen i in. [2011] aplikacja krzemu spowodowała znaczną poprawę podstawowych parametrów fotosyntezy u roślin ryżu
w warunkach stresu suszy oraz przywróciła zakłóconą przez suszę
równowagę we wchłanianiu składników mineralnych.
W badaniach u Vigna aconitifolia Jacq. Marechal zastosowanie
fosforu znacznie łagodziło negatywne skutki suszy obserwowane
jako zmiany parametrów takich jak: potencjał wodny roślin, względna
zawartość wody, wydajność fotosyntezy netto, zawartość chlorofilu,
skrobi rozpuszczalnej i białek oraz aktywność reduktazy azotanowej
[Garg i in. 2004]. Z kolei Abu-Romman i in. [2013] podają, że zwięk272
Zastosowanie biostymulatorów w łagodzeniu skutków suszy...
szona zawartość fosforu w pożywce była skuteczna w łagodzeniu
negatywnych skutków zasolenia w badaniach in vitro u ogórka. Zaskakujący był fakt, że obydwa preparaty zawierające fosfor wykazały
przeciwny wpływ na plonowanie soi. Może to wskazywać, że fosfor
zawarty w preparacie OPTYPLUS występował w formie trudniej przyswajalnej w porównaniu z preparatem GROW ON.
WNIOSKI
Bardziej efektywnym stymulatorem w warunkach suszy okazał się
SILVIT, który spowodował zwiększenie liczby strąków, liczby nasion
na roślinę, liczby nasion w strąku oraz średniej masy nasion z rośliny.
Najefektywniejszym stymulatorem plonowania roślin w warunkach polowych był OPTYSIL, który działał przez zwiększenie liczby
strąków oraz wzrost masy nasion z rośliny.
Stymulator OPTYPLUS spowodował zmniejszenie liczby strąków,
liczby nasion, masy nasion na roślinę i liczby nasion na strąk oraz
zasychanie kwiatów na dolnych węzłach.
Bibliografia
Abu-Romman S., Suwwan M., AL-Dein Al-Ramamneh E. 2013. Alleviation
of Salt Stress by Phosphorus in Cucumber Microshoots Grown on Rooting Medium. World Applied Sciences Journal 22 (2): 186-191.
Chen W., Yao X., Cai K., Chen J. 2011. Silicon Alleviates Drought Stress of
Rice Plants by Improving Plant Water Status, Photosynthesis and Mineral Nutrient Absorption. Biological Trace Element Research, Volume
142, Issue 1: 67-76.
Garg B.K., Burman U., Kathju S. 2004. The influence of phosphorus nutrition on the physiological response of moth bean genotypes to drought. Journal of Plant Nutrition and Soil Science. Volume 167, Issue
4: 503–508.
Gawrońska, H., Przybysz, A., Szalacha, E., Słowiński, A., 2008. Physiological
and molecular mode of action of Asahi SL biostymulator under optimal
and stress conditions. p.54–77. In: „Biostimulators in Modern Agriculture. General Aspects” (H. Gawrońska, ed.). Editorial House Wieś
Jutra, Warszawa:, 89.
273
Agnieszka Kalandyk, Piotr Waligórski, Franciszek Dubert
Gong H., Zhuc X., Chend K., Wangb S., Zhanga Ch. Silicon alleviates oxidative damage of wheat plants in pots under drought. 2005. Plant Science
Volume 169, Issue 2, 313–321.
Przybysz, A., Gawrońska, H., Słowiński, A., 2008. The effect of Asahi SL on
growth, efficiency of photosynthetic apparatus and yield of field grown
oil seed rape. Monographs series: Biostimulators In modern agriculture, Field Crops. Wieś Jutra, Warszawa: , 7–17.
Sadowski M., Gworek B. 2013. Opracowanie i wdrożenie Strategicznego
Planu Adaptacji dla sektorów i obszarów wrażliwych na zmiany klimatu Etap III 10. Adaptacja wrażliwych sektorów i obszarów Polski do
zmian klimatu do roku 2070 – Projekt. Instytut Ochrony Środowiska
– Państwowy Instytut Badawczy, Warszawa.
Badania przeprowadzono w ramach projektu „Doctus - Małopolski fundusz
stypendialny dla doktorantów”, we współpracy z Przedsiębiorstwem
INTERMAG Sp. z o.o.
Adres do korespondencji:
mgr Agnieszka Kalandyk
dr Piotr Waligórski
prof. dr hab. Franciszek Dubert
Instytut Fizjologii Roślin im. Franciszka Górskiego
Polskiej Akademii Nauk
ul. Niezapominajek 2, 30-239 Kraków
e-mail: [email protected]
Promotor: prof. dr hab. Franciszek Dubert
274
Anna Lehmann
Wiesław Wojciechowski
Adam Zych, Elżbieta Pytlar
Martyna Szałata
EPISTEME
22/2014, t. III
s. 275–280
ISSN 1895-2241
ROLA MIĘDZYPLONÓW ŚCIERNISKOWYCH
W REGULACJI ZACHWASZCZENIA ŻYTA
THE ROLE OF COVER CATCH CROPS IN WEED
INFESTATION CONTROL OF RYE
Abstrakt. Rośliny międzyplonowe stanowią obecnie ważny element zmianowania, szczególnie w rolnictwie integrowanym. Celem podjętych badań
była ocena wpływu dwóch rodzajów międzyplonów ścierniskowych na skład
gatunkowy, liczbę oraz powietrznie suchą masę chwastów w łanie żyta. Jednoczynnikowe doświadczenie polowe zrealizowano w sezonie wegetacyjnym
2012-2013 w RZD „Swojec” należącym do Uniwersytetu Przyrodniczego we
Wrocławiu. Czynnikiem badawczym był rodzaj przyoranego jesienią, orką
siewną pod żyto, międzyplonu ścierniskowego: A - obiekt kontrolny (bez
międzyplonu), B - międzyplon z gorczycy białej, C - międzyplon z mieszanki
roślin strączkowych (groch pastewny + łubin żółty). Stan zachwaszczenia
oceniono w fazie kwitnienia (BBCH 65) metodą ilościowo-wagową. Stwierdzono ograniczenie liczebności i suchej masy chwastów w uprawie badanej
rośliny po zastosowaniu międzyplonów. Najskuteczniejsza pod tym względem okazała się mieszanka roślin strączkowych w porównaniu do gorczycy
białej i obiektu bez udziału międzyplonu.
Słowa kluczowe: międzyplon ścierniskowy, żyto zwyczajne, zachwaszczenie
Summary. Catch crops are now an important part of crop rotation, particularly in integrated agriculture. The aim of this study was to determine the
effect of two types of catch crops on the species composition, number and
dry weight of weeds in rye. The field experiment was conducted at the Agricultural Experimental Station “Swojec” at Wrocław University of Environmental and Life Sciences in 2012-2013. One-factorial field experiment was
designed as randomized block method with three replications. The factor
was the type of ploughing down stubble catch crop during spring: A - control
treatment (without catch crop), B – white mustard catch crop, C - mixture
catch crop (field pea + lupine). Weed infestation was assessed at the flowering stage (BBCH 65) using the method of weed number and their weight.
The reduction in the number and dry mass of weeds was found in both crops
after the use of catch crops. It was shown that the mixture of pulse crops
was the most effective method.
Keywords: catch crops, rye, weed infestation
275
Anna Lehmann, Wiesław Wojciechowski, Adam Zych, Elżbieta Pytlarz, Martyna Szałata
Wstęp
Częsta rezygnacja z prawidłowego płodozmianu, zwłaszcza na rzecz monokultur, może doprowadzić do stopniowej degradacji gleby. Na skutek
pogorszenia się jej właściwości fizycznych, biologicznych i chemicznych
dochodzi do kompensacji uciążliwych chwastów [Gawęda 2009a]. Jednym z agrotechnicznych sposobów zapobiegania tym niekorzystnym
zmianom jest uprawa międzyplonów. Rośliny te w bezpieczny i przyjazny dla środowiska sposób regulują zachwaszczenie, przez co stanowią
ważny element zmianowania, zwłaszcza w rolnictwie integrowanym.
Ponadto wykazano, iż oddziałują one na glebowy bank diaspor i zachwaszczenie łanu rośliny następczej [Acharya i in. 2002, Kwiatkowski
2004]. Tematyka wpływu międzyplonów na zachwaszczenie opisywana
jest najczęściej w kontekście roślin zbożowych [Kwiatkowski 2004,
Wojciechowski 2009, Gawęda i Kwiatkowski 2013]. Wynika to przede
wszystkim z faktu, że udział wspomnianej grupy w strukturze zasiewów
w Polsce przekracza 70% [Deryło 2006]. Niestety pomimo licznych danych literaturowych wpływ uprawy międzyplonów na zachwaszczenie
zbóż nie został do końca jednoznacznie określony. Najczęściej obserwowanym efektem ich stosowania jest ograniczenie liczby i suchej masy
chwastów, choć wielkość zachwaszczenia, którą modyfikuje wspomniany element zmianowania jest dość różna. O korzystnym działaniu roślin
międzyplonowych w omawianym aspekcie donoszą m.in. Jaskulski
i in. [2000], Kwiatkowski [2004], a także Płaza i Ceglarek [2007] oraz
Gawęda [2009b]. Z kolei Woźniak [2005] oraz Rasmussen i in. [2006]
w swoich badaniach nie stwierdzili znaczącego wpływu międzyplonów
na biomasę chwastów, pomimo że zmniejszeniu uległa ich liczebność.
Podobnego zdania są Kuraszkiewicz i Pałys [2003], Wojciechowski
i Parylak [2004] oraz Gawęda [2009a].
Celem podjętego doświadczenia była ocena wpływu dwóch międzyplonów ścierniskowych uprawianych zgodnie z zasadami programu
rolnośrodowiskowego na zachwaszczenie łanu żyta zwyczajnego.
Materiał i metody
Podstawą badań był eksperyment polowy zrealizowany w sezonie
wegetacyjnym 2012-2013 roku na terenie Rolniczego Zakładu Doświadczalnego „Swojec” należącym do Uniwersytetu Przyrodniczego
276
Rola międzyplonów ścierniskowych w regulacji zachwaszczenia żyta
we Wrocławiu. Jednoczynnikowe doświadczenie założono metodą
losowanych bloków w czterech powtórzeniach na glebie lekkiej klasy
bonitacyjnej IVb, kompleksu żytniego słabego. Czynnikiem badawczym była uprawa międzyplonów ścierniskowych lub ich brak: 1) bez
międzyplonu (obiekt kontrolny), 2) międzyplon z gorczycy białej,
3) międzyplon z mieszanki roślin strączkowych. Rośliny wysiano
w pierwszej dekadzie sierpnia zgodnie z zasadami programu rolnośrodowiskowego, z ich wiosennym przyoraniem. Gorczycę białą odmiany
„Bardena” wysiewano w ilości 20 kg×Wyniki i dyskusja
W literaturze brakuje jednoznacznej oceny międzyplonów
w aspekcie ograniczania zachwaszczenia łanów roślin uprawnych.
Niektórzy donoszą o ich ograniczającym wpływie na wspomniany
element [Płaza i Ceglarek 2007, Gawęda 2009b], inni natomiast
o braku oddziaływania tego elementu zmianowania na zachwaszczenie [Wojciechowski i Parylak 2004, Woźniak 2005 i Gawęda 2009a].
Taka rozbieżność może wynikać z gatunku rośliny, która była uprawiana jako międzyplon. Dowodem tego są badania Jaskulskiego i in.
[2000], którzy dowiedli, że na ograniczenie zachwaszczenia roślin
uprawnych wpływ wywiera rodzaj zastosowanej w międzyplonie rośliny. Podobnego zdania jest również Wojciechowski [2009].
W badaniach własnych wykazano korzystne oddziaływanie międzyplonów ścierniskowych na ograniczenie liczby chwastów w łanie
żyta zwyczajnego. Lepsza pod tym względem okazała się mieszanka
roślin strączkowych niż gorczyca biała co znajduje potwierdzenie
w wynikach Wojciechowskiego [2009]. Po wiosennym przyoraniu mieszanki grochu i łubinu liczba chwastów w łanie żyta w trójpolowym
zmianowaniu była istotnie o 47,9% mniejsza od określonej w uprawie bez międzyplonu i aż o 49,7% mniejsza niż po gorczycy (tab. 1).
W dwupolówce żyta z ziemniakiem oraz żyta z owsem zauważono
podobne tendencje. W pierwszym przypadku liczba chwastów po międzyplonie z mieszanki była o 4,5% mniejsza niż na obiekcie, na którym
nie był on stosowany i aż o 55,7% mniejsza niż po gorczycy. W drugim
ze zmianowań dwupolowych, liczba chwastów po grochu i łubinie była
o 26,1% mniejsza niż stwierdzona dla obiektu bez międzyplonu.
Międzyplony przyczyniły się również do redukcji suchej masy chwastów w łanie żyta. Analogicznie, jak w wypadku liczebności lepszą okazała
się mieszanka strączkowa niż gorczyca. W zmianowaniu trójpolowym su277
Anna Lehmann, Wiesław Wojciechowski, Adam Zych, Elżbieta Pytlarz, Martyna Szałata
Tab. 1. Liczba [szt.m-2] i sucha masa chwastów [g× m-2 ]
Tab. 1. Number of weeds per 1 m2 and dry mass of weeds g•m-2
Obiekt
Treatment
Liczba chwastów
Number of weeds
Sucha masa
Dry mass of weeds
z-o-ż
z-o-ż+gorczyca
z-o-ż+mieszanka
ż-z
ż-z+gorczyca
ż-z+mieszanka
ż-o
ż-o+gorczyca
ż-o+mieszanka
NIR (0,05)
LSD (0.05)
16,7
17,3
8,7
13,3
28,7
12,7
15,3
21,7
11,3
1,3
1,7
1,0
6,4
15,9
7,7
5,1
5,9
3,6
6,3
3,9
Tab. 2. Gatunki chwastów występujące w łanie żyta zwyczajnego [szt.× m-2]
Tab. 2. Weed species in rye No.•m-2
Erodium
cicutarium
Equisetum
arvense
Viola
arvensis
Pozostałe
Other
z-o-ż
z-o-ż+gorczyca
z-o-ż+mieszanka
ż-z
ż-z+gorczyca
ż-z+mieszanka
ż-o
ż-o+gorczyca
ż-o+mieszanka
NIR (0,05)
LSD (0.05)
Liczba chwastów
Number of
weeds [m-2]
Obiekt
Treatment
Liczba gatunków dominujących
Number of dominant weeds
16,7
17,3
8,7
13,3
28,7
12,7
15,3
21,7
11,3
13,3
8,0
1,3
8,0
2,7
6,6
14,0
1,3
0,7
4,7
6,1
2,0
25,3
12,7
4,7
7,0
8,6
1,3
1,3
0,7
2,7
0,7
2,7
3,3
1,3
2,0
1,3
0,7
0,7
6,3
7,2
10,6
r.n.
r.n.
r.n. – różnica nieistotna – not significant difference
Objaśnienie zastosowanych skrótów:
z-o-ż – zmianowanie trójpolowe (ziemiak-owies-żyto)
278
Rola międzyplonów ścierniskowych w regulacji zachwaszczenia żyta
cha masa chwastów po międzyplonie z roślin strączkowych była o 23,1%
mniejsza niż bez wspomnianego elementu i aż o 41,2% mniejsza niż po
gorczycy (tab. 1). Podobne wyniki zaobserwowano w zmianowaniu dwupolowym żyta z owsem, w którym to liczba chwastów była o 29,4% mniejsza niż na obiekcie, na którym nie był on stosowany i o 39% mniejsza niż
po gorczycy. Natomiast odwrotne wyniki uzyskano dla dwupolówki żyta
z ziemniakiem, w którym mniejszą suchą masę chwastów odnotowano
na obiekcie na którym nie stosowano międzyplonów.
W fazie kwitnienia żyta, niezależnie od zmianowania, zaobserwowano dominujące występowanie trzech gatunków chwastów: skrzypu
polnego (Equisetum arvense), iglicy pospolitej (Erodium cicutarium)
oraz fiołka polnego (Viola arvensis) (tab. 2). Uprawa międzyplonów
nie miała wpływu na skład gatunkowy chwastów. O dominującym występowaniu fioka polnego, zwłaszcza w zmianowaniach uproszczonych
na glebie lekkiej donoszą również Wojciechowski i Zawieja [2007].
Wnioski
1. Wpływ międzyplonów ścierniskowych na zachwaszczenie łanu żyta
zależy od rodzaju zastosowanej rośliny międzyplonowej.
2. Mieszanka roślin strączkowych złożona z grochu pastewnego
i łubinu żółtego miała lepszy wpływ na ograniczenie zarówno liczby,
jak i suchej masy chwastów w łanie rośliny uprawnej niż gorczyca
biała, po której każdorazowo odnotowano wzrost zachwaszczenia.
3. Chwastami dominującymi w uprawie żyta zwyczajnego były:
iglica pospolita (Erodium cicutarium), skrzyp polny (Equisetum arvense) oraz fiołek polny (Viola arvensis).
Bibliografia
Acharya B.D., Khattri G.B., Chettri M.K., Srivastava S.C. 2002. Effect of
Brassica campestris var. Toria as a catch crop on Orobanche aegyptiaca
seed bank. Crop Prot. 21: 533–537.
Deryło S. 2006. Kształtowanie się zachwaszczenia żyta ozimego w płodozmianach i monokulturze zbożowej na glebie lekkiej. Pam. Puł., 142: 55–63.
Gawęda D. 2009a. Wpływ międzyplonów ścierniskowych na zachwaszczenie jęczmienia jarego uprawianego w monokulturze. Fragm. Agron., 26 (1): 34–41.
Gawęda D. 2009b. Wpływ międzyplonów ścierniskowych na zachwaszczenie pszenicy jarej uprawianej w monokulturze. Ann. UMCS, Sect. E, 64
(3): 21–28.
279
Anna Lehmann, Wiesław Wojciechowski, Adam Zych, Elżbieta Pytlarz, Martyna Szałata
Gawęda D., Kwiatkowski C. 2013. Plonowanie jęczmienia jarego uprawianego w krótkotrwałej monokulturze w zależności od międzyplonu i sposobu odchwaszczania. Fragm. Agron., 30 (1): 27–35.
Jaskulski D., Tomalak S., Rudnicki F. 2000. Regeneracja stanowiska po
pszenicy ozimej dla jęczmienia jarego przez rośliny międzyplonu ścierniskowego. Zesz. Probl. Post. Nauk Rol., 470: 49–57.
Kuraszkiewicz R., Pałys E. 2003. Wpływ wsiewek międzyplonowych na
zachwaszczenie łanu roślin ochronnych na glebie lekkiej. Ann. UMCS,
Sect. E, 58: 53–68.
Kwiatkowski C. 2004. Wpływ międzyplonu na plonowanie i zachwaszczenie
jęczmienia jarego uprawianego w monokulturze. Ann. UMCS, Sect. E,
59 (2): 809–815.
Płaza A., Ceglarek F. 2007. Rola międzyplonów w regulacji zachwaszczenia
pszenżyta ozimego uprawianego w drugim roku po ich zastosowaniu.
Prog. Plant Protection/ Post. Ochr. Roślin, 47 (3): 238-241.
Rasmussen I.A., Askegaard M., Olesen J.E., Kristensen K. 2006. Effects on
weeds of management in newly converted organic crop rotations in
Denmark. Agric. Ecosyst. Environ., 113: 184–195.
Wojciechowski W. 2009. Znaczenie międzyplonów ścierniskowych w optymalizacji nawożenia azotem jakościowej pszenicy jarej. Wydawnictwo Uniwersytetu Przyrodniczego we Wrocławiu: ss. 122.
Wojciechowski W., Parylak D. 2004. Oddziaływanie międzyplonów ścierniskowych na plonowanie żyta ozimego w płodozmianach
uproszczonych na glebie lekkiej. Pam. Puł., 142: 575–584.
Wojciechowski W., Zawieja J. 2007. Oddziaływanie płodozmianów specjalistycznych na dynamikę zachwaszczenia pól. Pam. Puł., 145: 255–261.
Woźniak A. 2005. Wpływ wsiewek międzyplonowych i nawożenia organicznego na plon i zachwaszczenie pszenicy jarej uprawianej w monokulturze. Ann. UMCS, Sect. E, 60: 33-40.
Adres do korespondencji:
mgr inż. Anna Lehmann, dr hab. inż.Wiesław Wojciechowski
mgr inż. Adam Zych, mgr inż. Elżbieta Pytlarz, mgr inż. Martyna Szałata
Katedra Kształtowania Agroekosystemów i Terenów Zieleni
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
Opiekun naukowy: dr hab. inż. Wiesław Wojciechowski
prof. dr hab. inż. Lesław Zimny, prof. dr hab. inż. Danuta Parylak
280
Rafał Ogórek
Agnieszka Lejman
EPISTEME
22/2014, t. III
s. 281–289
ISSN 1895-2241
ODDZIAŁYWANIA biotyczne między
wybranymi izolatami Epicoccum nigrum
a grzybami z rodzaju Fusarium
Biotic efects between selected isolates
of Epicoccum nigrum and fungi
of the genus Fusarium
Strszczenie. Zbadano in vitro szczepy Epicoccum nigrum jako biologiczne
czynniki mogące potencjalnie ograniczać wzrost Fusarium culmorum, F. graminearum, F. oxysporum, F. poae i F. reticulatum. Indywidualny i ogólny efekt
biotyczny 18 izolatów E. nigrum dla różnych grzybów z rodzaju Fusarium był
określany przy użyciu metody szeregów biotycznych. Wyniki badań wykazały, że tylko 7 szczepów E. nigrum wykazało dodatni ogólny efekt biotyczny
a najwyższy miał izolat 12. Najwyższy dodatni efekt biotyczny dla Fusarium
culmorum, F. graminearum i F. oxysporum był powodowany przez izolat 17 E.
nigrum, z kolei dla F. reticulatum przez izolat 12.
Słowa kluczowe: Epicoccum nigrum, efekt biotyczny, Fusarium spp.
Abstract. Epicoccum nigrum strains were evaluated in vitro as potential biological agents for control of the growth of Fusarium culmorum, F. graminearum, F. oxysporum, F. poae and F. reticulatum. Individual and general biotic
effects of 18 strains of E. nigrum on the various fungi from Fusarium genus
were determined using the biotic series method. Research results show that
only 7 strains of E. nigrum had a positive general biotic effect and the highest had isolate 12. The highest individual biotic effect on Fusarium culmorum, F. graminearum and F. oxysporum was caused by isolate 17 of E. nigrum,
on F. reticulatum by isolate 12.
Key words: Epicoccum nigrum, biotic effect, Fusarium spp.
281
Rafał Ogórek, Agnieszka Lejman
Wstęp
Epicoccum nigrum Link jest gatunkiem grzyba, który został opisany już
w roku 1816 [Pasqualetti i in. 2005]. W przeszłości badacze nadawali
mu różne nawy ze względu na dużą zmienność fenotypową w obrębie
tego gatunku i słabą zdolność do wytwarzania zarodników, dzięki
którym m.in. można ten gatunek oznaczyć metodą mikroskopową.
Najbardziej znanym synonimem nazwy tego gatunku jest E. purpurascens Ehrenb. ex Schlecht.
Gatunek ten należy do grzybów kosmopolitycznych i można go izolować z ziemi, roślin i powietrza [Mallea i in. 1991, Ogórek 2012]. Jest
zdolny do wydzielania różnych metabolitów wtórnych takich jak: barwniki (ß i y-karoten, rhodoxanthin, torularhodin, epicocconone) [Foppen
i Gribanovski-Sassu 1968, Choi i in. 2006] i antybiotyki (epicorazine A
i B, flavipin) [Tuttobello i in. 1969, Deffieux i in. 1976, Baute i in. 1978].
W literaturze E. nigrum jest opisywany jako grzyb antagonistyczny wobec patogenów grzybowych roślin m.in. Leucostoma cincta, Sclerotinia sclerotiorum, Colletotrichum gloeosporioides, C. kahawae, Botrytis
cinerea, Monilinia laxa i Fusarium spp. [Biggs i Alm 1991, Peng i Sutton
1991, Pandey i in. 1993, Pieckenstain i in. 2001, Larena i in. 2004,
Guerra-Guimarães i in. 2007, Ogórek i Pląskowska 2011].
Grzyby z rodzaju Fusarium są najczęściej izolowanymi gatunkami ze
zbóż i mogą być również przyczyną zakażeń oportunistycznych u ludzi
[Guarro i Gené 1995]. U zbóż są przyczyną szczególnie groźnej fuzariozy
kłosów [Champeil i in. 2004] i mogą produkować mikotoksyny m.in.
trichoteceny, fumonizyny, zearalenon oraz moniliformine [Selwet 2010].
Fusarioza kłosów jest ważną chorobą występującą na zbożach
uprawianych na całym świecie. Najważniejszym gatunkiem grzyba
z rodzaju Fusarium przyczyniającym się do wywoływania tej choroby
jest F. graminearum. Mniejszą rolę odgrywają tutaj inne gatunki takie
jak F. avenaceum, F. culmorum oraz F. poae [Stenglein 2009].
Fusarium graminearum dominuje w Europie środkowej i południowo-wschodniej, podczas gdy w chłodniejszym klimacie morskim
występują głównie F. culmorum, F. avenaceum i F. poae [Osborn i Stein 2007]. Rozwojowi tych patogenów szczególnie sprzyja wilgotna
i umiarkowana temperatura powietrza [Rosewich Gale i in. 2002].
Metoda szeregów biotycznych została opracowana przez Karola
Mańkę [Mańka 1974]. Metoda ta pozwala określić potencjalne relacje
282
Oddziaływania biotyczne między wybranymi izolatami epicoccum nigrum...
między grzybami, jakie mogą występować w środowisku. W szczególności metoda ta jest przydatna w badaniach wstępnych w biologicznej
ochronie roślin.
Materiały i metody
Grzyby użyte w doświadczeniu zostały wyizolowane z ziarniaków zbóż
i pochodzą z kolekcji Zakładu Fitopatologii i Mikologii, Uniwersytetu
Przyrodniczego we Wrocławiu. Charakterystykę izolatów użytych
w doświadczeniu zawarto w tabeli 1.
Tab. 1. Charakterystyka izolatów grzybów wykorzystanych w badaniach.
Izolacja
Izolaty Epicoccum nigrum
Gatunek grzyba
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
Fusarium culmorum
Fusarium graminearum
Fusarium oxysporum
Fusarium poae
Fusarium reticulatum
Data
Gatunek rośliny
Odmiana rośliny
13.XI.2009
13.XI.2009
13.XI.2009
13.XI.2009
25.XI.2009
25.XI.2009
30.XI.2009
13.XI.2009
25.XI.2009
25.XI.2009
30.XI.2009
30.XI.2009
11.I.2010
25.XI.2009
11.X.2010
25.XI.2009
11.X.2010
11.X.2010
11.X.2011
11.X.2011
11.X.2011
11.X.2011
10.V.2012
Żyto
Żyto
Żyto
Żyto
Żyto
Żyto
Żyto
Żyto
Żyto
Żyto
Żyto
Żyto
Pszenica ozima
Żyto
Pszenica ozima
Żyto
Pszenica ozima
Pszenica ozima
Pszenica ozima
Pszenica ozima
Pszenica ozima
Pszenica ozima
Kukurydza
Stach
Konto
Konto
Stach
Picasso
Picasso
Dańkowskie
Konto
Picasso
Picasso
Dańkowskie
Dańkowskie
Levis
Picasso
Bogatka
Picasso
Combin
Combin
Combin
Bogatka
Bogatka
Combin
Jawor
283
Rafał Ogórek, Agnieszka Lejman
Interakcje między grzybami testowymi (E. nigrum) i testowanymi (Fusarium spp.) określano metodą szeregów biotycznych według Mańki [1974] oraz Mańki i Mańki [1992]. W centrum płytki
Petriego z pożywką PDA wyszczepiano inokulum grzyba testowego
i w odległości 2 cm inokulum grzyba testowanego (4 powtórzenia).
W kombinacjach kontrolnych wyszczepiano inokulum każdego grzyba
osobno (2 powtórzenia). Po 10 dniach inkubacji w ciemności i temperaturze pokojowej (22oC), oceniano każdą kombinację uwzględniając
trzy parametry: stopień otoczenia kolonii jednego grzyba przez drugiego, strefę inhibicji i zmniejszenie kolonii w stosunku do kontroli.
W przypadku dominacji grzyba testowego przyznawano znak “+”
(efekt pozytywny), natomiast grzyba testowanego znak “-“ (efekt
negatywny). W przypadku braku przewagi jednej z kolonii nad drugą
przyznawano ocenę “0”. Uzyskane oceny dawały łącznie indywidualny
efekt biotyczny (obrazujący wpływ danego izolatu E. nigrum na wzrost
danego izolatu z rodzaju Fusarium) lub ogólny efekt biotyczny (obrazując wpływ danego izolatu E. nigrum na wzrost wszystkich izolatów
z rodzaju Fusarium).
Uzyskane wyniki poddano analizie wariancji (ANOVA), przy
użyciu standardowych metod statystycznych (pakiet ,,Statistica 9.0”).
Średnie porównano za pomocą testu Fishera na poziomie istotności
(LSD), α≤0,01.
Wyniki i dyskusja
W doświadczenie wykorzystano 18 izolatów grzyba testowego (E. nigrum) i 5 gatunków testowanych z rodzaju Fusarium. Spośród grzybów
testowych tylko 7 wykazało dodatni ogólny efekt biotyczny (izolat 3,
7, 10, 12, 14, 17) wobec grzybów testowanych i były to głownie izolaty
z 2009 roku uzyskane z żyta – ryc. 1, tab. 1. Natomiast u pozostałych
izolatów zaobserwowano ujemną wartość ogólnego efektu biotycznego. Potwierdza to doniesienie Ogórka i Pląskowskiej [2010], którzy
badali oddziaływania biotyczne izolatów E. nigrum wobec grzybów z
rodzaju Fusarium i Botrytis. Stwierdzili oni, że grzyb E. nigrum poza
dodatnim ogólnym efektem biotycznym, może wykazywać także
zróżnicowane oddziaływanie biotyczne w zależności od rośliny żywicielskiej z której był on izolowany.
284
Oddziaływania biotyczne między wybranymi izolatami epicoccum nigrum...
ogólny efekt biotyczny
15
10
5
0
-5
-10
-15
-20
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18
Izolaty E. nigrum
Ryc. 1. Ogólny efekt biotyczny między izolatami E. nigrum i grzybami
z rodzaju Fusarium obserwowany w doświadczeniu.
Indywidualny efekt biotyczny między badanymi grzybami był
zróżnicowany i w wielu przypadkach istotny statystycznie – tab. 2.
Najwyższą jego wartość izolaty E. nigrum wykazywały wobec Fusarium oxysporum, a najniższą wobec F. poae. Potwierdza to doniesienie
Ogórka i Pląskowskiej [2010], że izolaty F. oxysporum są najbardziej
wrażliwe na oddziaływania grzybów z gatunku E. nigrum. Inni badacze donoszą, że wzrost gatunku F. oxysporum jest także ograniczany
w testach biotycznych przez inne grzyby takie jak Rizoctonia solani,
Helminthosporium solani [Kurzawińska 2006] oraz Trichoderma hamatum i T. harzianum [Piegza i in. 2009]. Gatunki z rodzaju Trichoderma
są od wielu lat wykorzystywane, jako biofungicydy wobec patogenów
glebowych.
Najwyższy indywidualny efekt biotyczny dla F. culmorum, F. graminearum i F. oxysporum był powodowany przez izolat 17 E. nigrum, dla
F. reticulatum przez izolat 12 a dla F. poae przez izolat 1 i 12. Izolat 17
E. nigrum oddziaływał najmocniej aż na 3 z 5 użytych w doświadczeniu
gatunków z rodzaju Fusarium. Jako jedyny, ze wszystkich izolatów
E. nigrum wykazujących dodatni ogólny efekt biotyczny izolowany
był z pszenicy (tab. 1, 2). Machowicz-Stefaniak i in. [2008] donoszą
że E. nigrum wykazuje także dodatni efekt biotyczny wobec innych
nieużytych w doświadczeniu grzybów np. Septoria carvi.
285
F. culmorum
bcd
0,00
AB
abcd
0,50
AB
bcd
0,25
C
bcd
-0,25
C
abcd
0,50
A
bcde
-0,50
A
ab
2,00
A
ef
-3,00
AB
def
-2,00
C
ab
1,25
AB
ab
2,00
A
abc
1,00
B
g
-6,00
C
ab
2,00
A
fg
-4,00
B
cdef
-1,50
C
a
3,00
B
ef
-3,00
B
Grzyby testowane – izolaty Fusarium spp.
F. graminearum
F. oxysporum
F. poae
bc
bc
a
0,50
1,00
0,00
AB
A
AB
def
bc
cde
-1,00
1,00
-3,00
AB
A
B
bc
bc
ab
0,50
1,25
-0,88
BC
AB
D
bcd
c
cde
0,00
0,50
-3,13
BC
AB
D
bcd
bc
abc
0,00
1,50
-1,50
AB
A
BC
bcd
c
bcd
0,00
0,50
-2,25
A
A
B
ab
ab
de
1,00
3,00
-3,50
A
A
B
bcd
c
ef
0,00
0,00
-4,38
A
A
B
a
bc
bcd
2,00
1,00
-2,00
A
AB
C
bcd
bc
bcd
0,00
2,00
-2,50
B
A
C
def
c
de
-1,00
0,00
-3,50
BC
BC
D
bcd
a
a
0,25
4,50
0,00
C
A
C
f
bc
f
-2,00
1,00
-6,00
B
A
C
bcd
bc
abc
0,25
2,00
-1,50
AB
A
B
bcd
bc
cde
0,00
2,00
-2,75
A
A
B
cde
bc
de
-0,50
1,50
-3,50
BC
A
D
a
a
ab
2,25
4,75
-0,75
B
A
C
ef
c
bcd
-1,50
0,75
-2,00
AB
A
B
F. reticulatum
efg
-1,00
B
i
-3,25
B
b
1,50
A
bc
1,00
A
gh
-2,00
C
hi
-3,00
B
bc
1,00
A
def
-0,50
A
gh
-2,00
C
b
1,25
AB
b
1,25
AB
a
4,25
A
j
-6,00
C
cde
0,00
B
j
-5,00
B
bcd
0,50
AB
fg
-1,25
C
i
-3,50
B
* Wartości oznaczone tą samą literą nie różnią się statystycznie. Małe litery oznaczają efekt biotyczny izolatów E. nigrum w obrębie
danego grzyba testowanego (Fusarium) – wzdłuż kolumn. Duże litery oznaczają efekt biotyczny grzybów testowanych (Fusarium) w
obrębie danego izolatu E. nigrum – wzdłuż wierszy. Test Fishera poziom istotności (LSD), α≤0,01.
Izolaty Epicoccum nigrum
286
Grzyby testowe
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
Tab. 2. Indywidualny efekt biotyczny między izolatami E. nigrum i izolatami grzybów z rodzaju Fusarium obserwowany
w doświadczeniu.
Rafał Ogórek, Agnieszka Lejman
Oddziaływania biotyczne między wybranymi izolatami epicoccum nigrum...
W badaniach własnych F. poae był jedynym gatunkiem patogena
wobec którego izolaty E. nigrum nie wykazywały dodatniego efektu
biotycznego. W porównaniu do F. graminearum i F. culmorum, F. poae
jest patogen słabiej porażającym roślin, jednakże wytwarza on dużą
liczbę mikotoksyn m.in. trichoteceny typu A i B [Stenglein 2009].
Ogórek i Pląskowska donoszą, że ujemny efekt biotyczny E. nigrum
wykazuje także wobec Botrytis cinerea.
Wnioski
1. W puli zastosowanych 90 międzygatunkowych oddziaływań biotycznych stwierdzono w 12 przypadkach ich brak, w 39 dodatnie i 39
ujemne oddziaływania izolatów E. nigrum wobec grzybów z rodzaju
Fusarium.
2. Obserwowane oddziaływania biotyczne były zależne od zastosowanego izolatu grzyba testowego i testowanego.
3. Niektóre badane izolaty Epicoccum nigrum okazały się skutecznym antagonistą in vitro wobec Fusarium culmorum, F. graminearum,
F. oxysporum i F. reticulatum.
4. Wszystkie izolaty E. nigrum wykorzystane w doświadczeniu nie
wykazywały dodatniego efektu biotycznego wobec gatunku F. poae.
5. Potencjalne praktyczne wykorzystanie izolatów E. nigrum jako
antagonistów Fusarium wymaga szczegółowej oceny warunkach in
vitro i in vivo.
Bibliografia
Baute M.A., Deffieux G., Baute R., Neveu A. 1978. New antibiotics from the
fungus Epicoccum nigrum. I. Fermentation, isolation and antibacterial
properties. Journal of Antibiotics, 31(11):1099–1101.
Biggs A.R., Alm G.R. 1991. Response of peach bark tissues to inoculation
with epiphytic fungi alone and in combination with Leucostoma cincta.
Canadian Journal of Botany, 70:186–191.
Champeil A., Fourbet J.F., Doré T., Rossignol L. 2004. Influence of cropping
system on Fusarium head blight and mycotoxin levels in winter wheat.
Crop Protection, 23: 531–537
Choi H.Y., Veal D.A, Karuso P. 2006. Epicocconone, a new cell-permeable
long stokes’ shift fluorescent stain for live cell imaging and multiplexing. Journal of Fluorescence, 16(4):475–482.
287
Rafał Ogórek, Agnieszka Lejman
Deffieux G, Baute M.A., Baute R., Filleau M.J. 1976. New antibiotics from
the fungus Epicoccum nigrum. II. Epicorazine A: Structure elucidation
and absolute configuration. Journal of Antibiotics, XXXI(11): 1102–
1105.
Foppen F.H., Gribanovski-Sassu O. 1968. Lipids Produced by Epicoccum nigrum in Submerged Culture. Biochemical Journal, 106: 97–100.
Guarro J, Gené J. 1995. Opportunistic fusarial infections in humans.
European Journal of Clinical Microbiology & Infectious Diseases., (14): 741–754.
Guerra-Guimarães L., Azinheira H.G., Martins A.C., Silva M.C., Gichuru
E.K., Varzea V., Bertrand B. 2007. Antagonistic interaction between
Epicoccum nigrum and Colletotrichum kahawae, the Causal Agent of Coffee Berry Disease. 21st International Conference on Coffee Science,
Montpellier (France 2006), 1284-1290.
Kurzawińska H. 2006. An interaction of potato crop fungi population on
fungi responsible for tuber superficial diseases. Journal of Plant Protection Research, 46(4):339–346.
Larena I., De Cal A., Melgarejo P. 2004. Solid substrate production of Epicoccum nigrum conidia for biological control of brown rot on stone fruits. International Journal of Food Microbiology, 94:161–167.
Machowicz-Stefaniak Z., Zalewska E., Król E. 2008. Biotic effect of caraway
phyllosphere fungi on the pathogenic fungus Septoria carvi Syd. Herba
Polonica, 54(3):70–80.
Mallea M., Pesando D., Bernard P., Khoulalene B. 1991. Comparison between antifungal and antibacterial activities of several strains of Epicoccum
purpurascens from the Mediterranean area. Mycopathologia, 115:83–88.
Mańka K, Mańka M. 1992. A new method for evaluating interaction between soil inhabiting fungi and plant pathogens. IOBC/WPRS Bull.,
15(1):73–5.
Mańka K. 1974. Zbiorowiska grzybów jako kryterium oceny wpływu środowiska glebowego na choroby roślin. Zeszyty Problemowe Postępu
Nauk Rolniczych, 160:9–23.
Ogórek R. 2012. Fungi in the mountain trails of Czarna Góra Massif. Preliminary study. Mikologia Lekarska, 19(4): 147 – 153.
Ogórek R., Pląskowska E. 2011. Epicoccum nigrum for biocontrol agents in
vitro of plant fungal pathogens. Communications in agricultural and
applied biological sciences, Ghent University, 76(4), 693 – 697.
Osborne L.E., Stein J.M. Epidemiology of Fusarium head blight on smallgrain cereals. International Journal of Food Microbiology, 119 (1-2),
103-108, 2007.
288
Oddziaływania biotyczne między wybranymi izolatami epicoccum nigrum...
Pandey R.R, Arora D.K, Dubey R.C. 1993. Antagonistic interactions between fungal pathogens and phylloplane fungi of guava. Mycopathologia,
124:31–39.
Pasqualetti M., Rambelli A., Mulas B., Tempesta S. 2005. Identification key
and description of Mediterranean maquis litter microfungi. Bocconea
18, 55.
Peng G., Sutton J.C. 1991. Evaluation of microorganisms for biocontrol
of Botrytis cinerea in strawberry. Canadian Journal of Plant Pathology,
13:247–257.
Pieckenstain F.L., Bazzalo M.E., Roberts A.M.I. Ugalde R.A. 2001. Epicoccum
purpurascens for biocontrol of Sclerotinia head rot of sunfower. Mycology Reseaurch, 105 (1):77–84.
Piegza M., Stolaś J., Kancelista A., Witkowska D. 2009. Influence of Trichoderma strains of the growth of pathogenic moulds in biotic test on
untypical karbon sources. Acta Scientiarum Polonorum, Biotechnologia, 8(1):3–14.
Rosewich Gale L., Chen L.F., Hernick C.A., Takamura K., Kistler H.C. 2002.
Population analysis of Fusarium graminearum from Wheat fields in Eastern China. Phytopathology, 12(92): 1315–1322.
Selwet M. 2010. Negatywne aspekty występowania wybranych mikotoksyn
w paszach. Wiadomości Zootechniczne, R. XLVIII, (1): 9–13.
Stenglein S.A. 2009. Offered review Fusarium poae: A pathogen that needs
more attention. Journal of Plant Pathology, 91(1), 25-36.
Tuttobello L., Foppen F.H., Carilli A. 1969. Growth and Pigmentation of Epicoccum nigrum in Submerged Culture. Applied Microbiology, 17(6):847–
852.
Publikacja współfinansowana ze środków Unii Europejskiej w ramach
Europejskiego
Funduszu Społecznego
289
Rafał Ogórek, Agnieszka Lejman
Adres do korespondencji:
mgr inż. Rafał Ogórek
Katedra Ochrony Roślin
Uniwersytet Przyrodniczy we Wrocławiu
Plac Grunwaldzki 24a, 50-363 Wrocław
e-mail: [email protected]
mgr inż. Agnieszka Lejman
Katedra Kształtowania Agroekosystemów i Terenów Zieleni
Uniwersytet Przyrodniczy we Wrocławiu
Plac Grunwaldzki 24a, 50-363 Wrocław
e-mail: [email protected]
Opiekun naukowy:
dr hab. Krzysztof Matkowski
dr hab. Piotr Sobkowicz prof. nadzw.
290
Kalina Orłowska
Monika Mierzwa-Hersztek
Agnieszka Baran
EPISTEME
22/2014, t. III
s. 291–297
ISSN 1895-2241
WPŁYW PRZEKOMPOSTOWANYCH ODPADÓW
Z UBOJU I HODOWLI DROBIU NA WŁAŚCIWOŚCI
WODNO-POWIETRZNE GLEBY
INFLUENCE OF POULTRY WASTE COMPOSTON
THE PHYSICAL PROPERTIES OF THE SOIL
Abstrakt. Od wielu lat w Polsce obserwuje się wzrost spożycia drobiu. Ze
względów ekonomicznych zwiększenie produkcji drobiu wpływa korzystnie
na jej opłacalność, jednak powoduje to także zwiększenie ilości wytwarzanych odpadów. Jednym ze sposobów utylizacji tego typu odpadów jest ich
kompostowanie i użycie w rolnictwie, jako nawozu organicznego. Celem
pracy była analiza zmian wybranych właściwości fizycznych gleby po zastosowaniu kompostów otrzymanych z odpadów z produkcji drobiu. Badania
zostały przeprowadzone w oparciu o doświadczenie polowe. Wprowadzenie do gleby przekompostowanych odpadów spowodowało zmniejszenie
porowatości ogólnej gleby, pomimo zwiększenia porowatości powietrznej.
Zmniejszeniu uległy polowa pojemność wodna, retencja wody użytecznej
oraz wilgotność trwałego więdnięcia.
Słowa kluczowe: odpady przemysłu drobiarskiego, kompost, właściwości fizyczne gleby
Summary. From many years in Poland the consumption of the poultry is
growing. The economic reasons for increasing of poultry branch its profitability, however it is a cause of increasing amount of produced waste. A way
of disposing of such waste is its composting and their use as an agricultural
fertilizer. The aim of this study was to analyze changes in the physical properties of the oil after application of compost from of poultry. Studies were
conducted in the field experiment. The introduction of waste composted to
soil reduced the total porosity of the soil even though air porosity increased.
The water field capacity, water retention and of permanent wilting point
were reduced.
Key words: waste of the poultry industry, compost, physical properties of the
soil
291
Kalina Orłowska, Monika Mierzwa-Hersztek, Agnieszka Baran
Wstęp
Od wielu lat podejmuje się starania mające na celu poprawę właściwości gleby poprzez zastosowanie materiałów zasobnych w materię organiczną, jednak nie zawsze prowadzi to do uzyskania zadowalających
efektów [Drzymała i in. 2007]. Wprowadzenie znacznych uproszczeń
w uprawie roślin np. w zakresie zmianowania (szczególnie na glebach
lekkich) powoduje niekorzystne zmiany właściwości fizykochemicznych gleby i w konsekwencji zmniejszenie jej żyzności [Wojciechowski
2004]. Doglebowa aplikacja materii organicznej ma udział w kształtowaniu właściwości fizycznych gleby. Dodatkowo, wprowadzana
materia organiczna powoduje powstanie związków próchnicznych
gleby, które wraz z wydzielinami bakterii są lepiszczem drobnych
cząstek glebowych, co skutkuje tworzeniem i utrwalaniem struktury
agregatowej gleby [Wacławowicz i Parylak 2004].
W Polsce od wielu lat obserwuje się wzrost spożycia mięsa drobiowego. Przyczynia się to do zwiększenia ilości wytwarzanych odpadów
[Myszograj i Puchalska 2012]. Odpady z uboju drobiu oraz pomiot
kurzy są dobrym źródłem substancji organicznej, wykorzystywanym
do poprawy właściwości fizycznych gleby. Dodatkowo, materiały te
zawierają znaczną ilość składników pokarmowych [Spychaj-Fabisiak
i in. 2007]. Celem badań było określenie wpływu przekompostowanych odpadów po produkcji drobiu na wybrane właściwości wodno-powietrzne gleby: porowatość ogólną, gęstość gleby, porowatość
powietrzną, polową pojemność wodną, retencję wody użytecznej dla
roślin i wilgotność trwałego więdnięcia.
Materiał i metody
Do przeprowadzania doświadczenia wybrano trzy rodzaje odpadów: dwa po produkcji drobiu (mieszaninę tłuszczu i pierza oraz
pulpę tłuszczu, krwi i tkanek zwierzęcych) i pomiot kurzy pochodzący
z fermy. Wybrane odpady zostały poddane procesowi kompostowania
przez okres 100 dni w pojemnikach o wymiarach 1,2x1,0x0,8m, przy
zachowaniu cyklicznego napowietrzania oraz utrzymania wilgotności
na poziomie 50%. Dla prawidłowego przebiegu procesu kompostowania słomę kukurydzianą zmieszano z odpadami w stosunku uwarunkowanym zawartością suchej masy odpadu: pulpa tłuszczu, krwi
292
Wpływ przekompostowanych odpadów z uboju i hodowli drobiu...
i tkanek zwierzęcych 1:0,12, pomiot kurzy 1:1,27, mieszanina tłuszczu i pierza 1:0,40. Procesowi kompostowania poddano również samą
słomę, która stanowiła jeden z obiektów kontrolnych. W kwietniu
2013 r. założono doświadczenie mikropoletkowe metodą losowych
bloków z 6 obiektami w 3 powtórzeniach: A - kontrola, B - nawożenie
NPK, C - przekompostowana słoma kukurydzy, D - przekompostowana pulpa tłuszczu, krwi i tkanek zwierzęcych, E – przekompostowany
pomiot kurzy, F - przekompostowana mieszanina tłuszczu i pierza.
Ilość zastosowanego kompostu oraz poziom nawożenia mineralnego
(obiekt B) ustalono w oparciu o zawartość N ogólnego w przekompostowanych materiałach. Doświadczenie założono na glebie o poziomie
próchniczym Ap (0-33cm) o uziarnieniu gliny lekkiej, o strukturze
średniotrwałej średniej gruzełkowej (s2gr). Rośliną testową była życica trwała odmiany Nira. Materiał glebowy pobrano po zakończeniu
okresu wegetacyjnego. Gęstość objętościową gleby suchej (GG) oznaczono w cylindrach o objętości 100 cm3, a gęstość stałej fazy gleby
metodą piknometryczną. Porowatość ogólną (PO) obliczono z gęstości
stałej fazy gleby i GG. Pojemność wodną (PPW) i wilgotność trwałego
więdnięcia (WTW) wyznaczono metodą płyt porowatych w komorach
ciśnieniowych. Retencję wody użytecznej dla roślin (RWU) obliczono
z różnicy PPW - WTW, a porowatość powietrzną (PP) z różnicy PO –
PPW. Węgiel organiczny oznaczono metodą Tiurina.
Wyniki i dyskusja
Wprowadzenie do gleby przekompostowanych odpadów po produkcji drobiu, oraz zastosowanie nawożenia mineralnego spowodowało
zwiększenie zawartości węgla organicznego w stosunku do gleby
obiektu kontrolnego. Największą zawartością węgla organicznego
(o 36% większą niż w glebie obiektu kontrolnego) charakteryzowała się gleba nawożona przekompostowanym pomiotem (obiekt E)
(tab. 1). Użycie dodatku przekompostowanych odpadów zawierających
pióra w znacznym stopniu wpływa na wzrost zawartości C w glebie,
co potwierdzają badania Spychaj-Fabisiak i in. [2007] powołując się
na Bohacz i Korniłowicz-Kowalską [2005] .
Korzystny wpływ na porowatość ogólną miało zastosowanie przekompostowanej pulpy tłuszczu, krwi i tkanek zwierzęcych (obiekt D).
293
Kalina Orłowska, Monika Mierzwa-Hersztek, Agnieszka Baran
Nawożenie mineralne oraz zastosowanie pozostałych odpadów spowodowało zmniejszenie porowatości ogólnej w stosunku do obiektu
kontrolnego (obiekt A) (tab.1). Na porowatość ogólną mają wpływ
skład mineralny i granulometryczny gleby, zawartość materii organicznej, struktura glebowa oraz zabiegi agrotechniczne [Paluszek
2011]. Paluszek [2011] wyznaczył zakres liczb granicznych dla oceny
porowatości ogólnej poziomów Ap gleb o składzie granulometrycznym
glin. Określono, że gleby obiektów B, F charakteryzowały się małą
porowatością ogólną, gdyż znajdowały się w zakresie 0,261-0,390
m3·m-3, natomiast gleby obiektów A,C,D,E średnią (liczby graniczne
0,391-0,420 m3·m-3).
Tab. 1. Zawartość węgla organicznego i wybrane właściwości fizyczne gleb
po zastosowaniu kompostów.
Właściwości
g·kg-1
F
8,68
±1,32
9,31
±0,79
9,61
±0,15
8,25
±0,74
m3·m-3
E
9,27
±0,17
0,410
±0,02
0,198
±0,02
0,140
±0,03
0,212
±0,00
0,058
±0,00
0,390
±0,01
0,156
±0,04
0,111
±0,04
0,234
±0,05
0,045
±0,00
0,398
±0,02
0,170
±0,01
0,117
±0,01
0,228
±0,02
0,053
±0,00
0,416
±0,02
0,179
±0,01
0,124
±0,01
0,237
±0,02
0,055
±0,00
0,392
±0,01
0,152
±0,03
0,106
±0,03
0,240
±0,02
0,046
±0,00
0,369
±0,02
0,179
±0,01
0,129
±0,01
0,190
±0,03
0,050
±0,00
1,487
±0,05
1,539
±0,03
1,518
±0,06
1,473
±0,04
1,532
±0,03
1,590
±0,04
PPW
PP
WTW
GG
D
7,06
±0,33**
PO
RWU
Obiekt
C
B
Mg·m-3
Corg.
A*
* jak w metodyce; **± odchylenie standardowe
Polową pojemność wodną (PPW) określa się przy potencjale wody
glebowej -15,5 kPa (pF 2,2). Na jej wartość ma wpływ ilość mezoporów
i mikroporów glebowych. Materia organiczna w sposób pośredni wpływa na ten wskaźnik poprzez polepszenie agregacji gleby, zapobieganie
294
Wpływ przekompostowanych odpadów z uboju i hodowli drobiu...
nadmiernemu zagęszczaniu masy glebowej [Walczak i in. 2002, Paluszek 2011]. Każda z zastosowanych form nawożenia spowodowała
zmniejszenie wartości PPW w stosunku do gleby obiektu A. Najmniejszą polową pojemnością wodną charakteryzowała się gleba obiektu E
(tab.1). Opierając się na liczbach granicznych PPW gleby obiektów B,
C, E charakteryzowały się bardzo małą PPW (zakres liczb granicznych
≤170 m3·m-3) , natomiast gleby obiektów A, D, F małą PPW (zakres
liczb granicznych 0,171-0,230 m3·m-3) [Paluszek 2011].
Retencja wody użytecznej (RWU) dla roślin w głównej mierze
uzależniona jest od składu granulometrycznego, zawartości materii
organicznej, zagęszczenia oraz wielkości i wodoodporności agregatów
glebowych. Jest ona ważnym kryterium oceny jakości stanu fizycznego gleby [Paluszek 2011]. Zastosowanie nawożenia mineralnego, jak
i przekompostowanych odpadów spowodowało zmniejszenie RWU
w stosunku do obiektu kontrolnego (tab.1.). Gleby o RWU znajdującej
się w zakresie 0,081-0,120 m3·m-3 określane są jako gleby o małej retencji, zaś w zakresie 0,121-170 m3·m-3 jako gleby o średniej retencji.
Opierając się na wyznaczonych wartościach granicznych gleby obiektów B, C, E charakteryzowały się małą, natomiast gleby obiektów
A, D, F średnią retencją RWU [Walczak i in,. 2002, Paluszek 2011].
Porowatość powietrzna (PP) badanych gleb mieściła się w zakresie
0,19-0,24 cm3·cm-3. Zmniejszenie wartości PP nastąpiło po zastosowaniu przekompostowanej mieszaniny tłuszczu i pierza (obiekt F). Zastosowanie dodatku przekompostowanej słomy kukurydzianej, pulpy
tłuszczu, krwi i tkanek zwierzęcych, odchodów zwierząt do gleby oraz
nawożenia mineralnego spowodowało zwiększenie PP.
Wilgotność trwałego więdnięcia (WTW) określana jest przy
potencjale -1554 kPa (pF 4,2). Gleby z wszystkich obiektów charakteryzowały się bardzo małą WTW [Walczak i in. 2002, Paluszek
2011]. Zastosowane nawożenie spowodowało zmniejszenie wartości
WTW w stosunku do obiektu nienawożonego (A). Najmniejszą wartością charakteryzowała się gleba z obiektu B (nawożenie mineralne)
i E (przekompostowany pomiot) (tab.1).
Wartość gęstości objętościowej gleby (GG) mieściła się w zakresie
1,473-1,590 Mg·m-3 (tab.1) i można ją zakwalifikować do gęstości gleby średniej [Paluszek 2011]. Biorąc pod uwagę fakt, że badana gleba
miała uziarnienie gliny lekkiej gleby z obiektów A i D charakteryzują
295
Kalina Orłowska, Monika Mierzwa-Hersztek, Agnieszka Baran
się małą gęstością (zakres liczb granicznych 1,41-1,50 Mg·m-3), a gleby
obiektów B, C, E, F średnią (zakres liczb granicznych 1,51-1,6 Mg·m-3).
W stosunku do obiektu kontrolnego, tylko w przypadku gleby obiektu
D zanotowano zmniejszenie GG, a w innych obiektach zanotowano
wyraźne jej zwiększenie na skutek zastosowanego nawożenia [Ślusarczyk 1979, Pabin 1999]
Wnioski
Dodatek przekompostowanych odpadów po produkcji drobiu oraz
nawożenia mineralnego wpłynęło na zwiększenie na zawartości węgla
organicznego w glebie.
Zastosowanie dodatku przekompostowanej pulpy tłuszczu, krwi i
tkanek zwierzęcych spowodowało zwiększenie się porowatości ogólnej
gleby, oraz zmniejszenie gęstości gleby
Wprowadzanie do gleby przekompostowanych odpadów po produkcji drobiu powoduje zmniejszenie polowej pojemności wodnej, retencji wody użytecznej dla roślin oraz wilgotności trwałego więdnięcia
Na zwiększenie się porowatości powietrznej gleby ma wpływ
zastosowanie dodatku przekompostowanych odpadów z wyjątkiem
dodatku przekompostowanej mieszaniny tłuszczu i pierza.
Bibliografia
Bohacz J., Korniłowicz-Kowalska T., 2005 Wpływ kompostów keratynowokorowych i keratynowo-koro-słowmowych na właściwości wybranych
gleb. Właściwości chemiczne. Zesz. Probl. Post. Nauko Rol. 506. s: 65-76
Drzymała S., Spychalski W., Rosada J. 2007. Wpływ preparatu ekolator II
na właściwości fizyko-chemiczne gleb w strefie oddziaływania emisji
HM Głogów. Progress in Plant Protection (Postępy w Ochronie Roślin).
47(4). s: 33-37
Myszograj S., Puchalska E. 2012. Odpady z chowu i uboju drobiu- zagrożenie dla środowiska czy surowiec do produkcji energii. Medycyna Środowiskowa. 15(3). s: 106-115
Pabin J., 1999. Wpływ stanu fizycznego gleby w warstwie ornej i podornej
na wegetację i plonowanie roślin. Acta Agrophysica. 23. s: 217-233.
Paluszek J. 2011. Kryteria oceny Jakości Fizycznej Gleb Uprawnych Polski.
ACTA AGROPHYSICA. 191(2). ss: 139
296
Wpływ przekompostowanych odpadów z uboju i hodowli drobiu...
Spychaj-Fabisiak E., Kozera W., Majcherczak E., Ralcewicz M., Knapowski
T. 2007. Oddziaływanie odpadów organicznych i obornika na żyzność
gleby lekkiej. Acta Sci., Agricultura 6(3). s: 69-76
Ślusarczyk E., 1979. An empirical model of the optimal physical properties
of soil for the requirements of field crops. Zesz. Probl. Post Nauk Rol.,
220. s: 327-347.
Wacławowicz R., Parylak D. 2004. Zmiany wybranych właściwości gleby
średniej pod wpływem różnych systemów nawożenia organiczno-mineralnego. Annales UMCS, Sec. E.59,3. s: 1345-1354
Walczak R., Ostrowski J., Witkowska-Walczak B., Sławiński C., 2002. Hydrofizyczne charakterystyki mineralnych gleb ornych Polski. Acta
Agrophysica, 79. s: 1-64.
Wojciechowski W. 2004. Kształtowanie właściwości fizycznych gleby lekkiej
w płodozmianach uproszczonych z różnym udziałem ziemniaka. Annales UMCS, Sec. E 59,3. s:1113-1119
Adres do korespondencji:
mgr inż. Kalina Orłowska
e-mail: [email protected]
mgr inż. Monika Mierzwa-Herszteki
e-mail: [email protected]
dr inż. Agnieszka Barani
e-mail: [email protected]
Katedra Chemii Rolnej i Środowiskowej
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Opiekun naukowy: prof. dr. hab. inż. Michał Kopeć
297
Elżbieta Pytlarz
Danuta Parylak
Martyna Szałata
Anna Lehmann, Adam Zych
EPISTEME
22/2014, t. III
s. 299–306
ISSN 1895-2241
Choroby podstawy źdźbła pszenicy
jarej w monokulturze po zastosowaniu
międzyplonu i biostymulatora
Stem base diseases of spring wheat
in continuous cropping after the use
of stubble crop and biostimulator
Abstrakt. Celem badań była ocena skuteczności różnych zabiegów regeneracyjnych w ograniczaniu występowania chorób podstwy źdźbła na pszenicy
jarej uprawianej w monokulturze w warunkach tradycyjnej lub uproszczonej
uprawy pożniwnej i przedsiewnej. Jednoczynnikowe doświadczenie polowe
zrealizowano w sezonie 2011-2012. Czynnikiem badawczym był system
uprawy pszenicy jarej, na który złożyło się następstwo roślin, zróżnicowanie uprawy pożniwnej i przedsiewnej oraz różne warianty zabiegów regeneracyjnych – przyorywanie międzyplonu ścierniskowego z gorczycy białej,
zaprawianie ziarna biostymulatorem Nano-Gro bądź ich łączne stosowanie.
Oceny porażenia roślin przez agrofagi, wywołujące choroby podsuszkowe,
dokonano w fazie dojrzałości mleczno-woskowej. Wykazano istotnie większe porażenie roślin w monokulturze niż w płodozmianie oraz zróżnicowaną skuteczność biostymulatora i międzyplonu w ograniczaniu występowania chorób podstawy źdźbła.
Słowa kluczowe: pszenica jara, monokultura, biostymulator, międzyplon, choroby podstawy źdźbła
Summary. The objective of the studies was to evaluate the effectiveness of
varying regenerative practices in reducing the stem base diseases occurence
for spring wheat growing in continuous crop under traditional or reduced
post-harvest and pre-sowing tillage. One-factorial field experiment was
conducted in 2011-2012. The factor was a system of cultivation of spring
wheat, including a crop succession, varying post-harvest and pre-sowing tillage and different variants of regenerative practices - stubble catch crop of
white mustard, seed-dressing with of biostimulator Nano-Gro or their com299
Elżbieta Pytlarz, Danuta Parylak, Martyna Szałata, Anna Lehmann, Adam Zych
prehensive application. The assessment of plant infection by pathogens,
triggered stem base diseases off, was made at the maturity milky wax stage.
The significantly higher infection of plants was observed in monoculture
than in crop rotation. Both the effectiveness of biostimulator and stubble
catch crop were varying in the reduction of stem base diseases occurence.
Key words: spring wheat, continuous crop, biostimulator, catch crop, stem base
diseases
Wstęp
Uprawa zbóż po sobie wpływa na wzrost stopnia porażenia roślin
przez patogeny, szczególnie wywołujące choroby podstawy źdźbła,
a w konsekwencji na spadek plonu [Kurowski 2002, Żółtańska 2005,
Wojtala-Łozowska 2012]. Dodatkowo względy ekonomiczne przemawiają za redukcją kosztownej uprawy [Tebrügge i Düring 1999]. Jednak w warunkach uproszczonej uprawy roli może wystąpić zwiększone
ryzyko zainfekowania źdźbeł pszenicy przez patogeny wywołujące
choroby podsuszkowe [Mróz i in. 1990]. W tej sytuacji konieczne jest
poszukiwanie nowych, skuteczniejszych rozwiązań agrotechnicznych
w uprawie pszenicy w monokulturze, pozwalających uzyskać wysoki
i dobrej jakości plon ziarna. Jednym z takich sposobów może być uprawa międzyplonów na przyoranie, które powodują korzystne zmiany
w siedlisku, pozwalając ograniczyć spadek plonów zbóż z dużym ich
udziałem oraz w stanowisku po sobie. Alternatywnym rozwiązaniem
jest wykorzystanie biostymulatorów, zwiększających – zdaniem producenta – odporność roślin na warunki stresowe.
Celem badań była ocena skuteczności różnych zabiegów regeneracyjnych w ograniczaniu występowania chorób podstwy źdźbła na
pszenicy jarej uprawianej w monokulturze w warunkach tradycyjnej
lub uproszczonej uprawy pożniwnej i przedsiewnej.
Materiał i metody
Jednoczynnikowe doświadczenie polowe zrealizowano w sezonie wegetacyjnym 2011-2012 w Rolniczym Zakładzie Doświadczalnym Uniwersytetu Przyrodniczego we Wrocławiu. Eksperyment założono metodą
losowanych bloków w trzech powtórzeniach na poletkach o powierzchni
22 m2 na glebie kompleksu żytniego dobrego (klasa IVa). Czynnikiem
300
Choroby podstawy źdźbła pszenicy jarej w monokulturze po zastosowaniu międzyplonu...
badawczym był system uprawy pszenicy jarej odmiany Tybalt, na który złożyło się następstwo roślin, zróżnicowanie uprawy pożniwnej
i przedsiewnej oraz różne warianty zabiegów regeneracyjnych – przyorywanie międzyplonu ścierniskowego z gorczycy białej, zaprawianie
ziarna biostymulatorem Nano-Gro bądź łączne stosowanie zabiegów.
W przypadku pszenicy nie zaprawianej preparatem Nano-Gro stosowano standardową zaprawę nasienną Raxil Gel 206 GF. Po zbiorze
przedplonu wykonywano podorywkę na głębokość ok. 10 cm albo
kultywatorowanie (10 cm) połączone z bronowaniem pielęgnacyjnym.
Uprawę przedsiewną realizowano wykonując orkę siewną na głębokość
20 cm lub upraszczano ją stosując agregat uprawowy. Obiektem kontrolnym była pszenica uprawiana w płodozmianie (rzepak ozimy – pszenica
ozima – jęczmień jary), a w przypadku monokultury - z zastosowaniem
płużnej uprawy roli bez zabiegu regeneracyjnego.
Zainfekowanie korzeni i podstawy źdźbeł pszenicy jarej przez
patogeny wywołujące kompleks chorób podsuszkowych określono na
30 losowo wybranych roślinach z poletka w fazie dojrzałości mleczno-woskowej. Wydzielono pięć klas porażenia korzeni, gdzie 0 - zdrowe,
1- 1-10% korzeni porażonych, 2- 11-30% korzeni zaatakowanych,
3- 31-60% korzeni zainfekowanych, 4- powyżej 61% korzeni z widocznymi objawami chorób. Dla podstawy źdźbła zastosowano cztery
klasy porażenia: 0- zdrowe, 1- infekcja na odcinku do 1. kolanka,
mniej niż ½ obwodu źdźbła zainfekowana, 2 - zakażenie na odcinku
do 1. kolanka, ponad ½ obwodu źdźbła zainfekowana, 3 - porażenie
wchodzi w kolejne międzywęźle. Indeks porażenia obliczono metodą
Townsenda-Heubergera [1943]. Uzyskane wyniki badań poddano analizie wariancji przy poziomie istotności 0,05. Do określenia związku
pomiędzy stopniem porażenia roślin a plonem ziarna zastosowano
analizę korelacji prostej. Istotność współczynników korelacji testowano na poziomie p < 0,05.
Wyniki
Następstwo roślin istotnie wpłynęło na stopień porażenia podstawy
źdźbła pszenicy jarej przez kompleks grzybów wywołujących choroby
podsuszkowe (tab. 1). Uprawa pszenicy w monokulturze doprowadziła
do potwierdzonej statystycznie niemal 2,5-krotnej zwyżki zainfeko301
Elżbieta Pytlarz, Danuta Parylak, Martyna Szałata, Anna Lehmann, Adam Zych
wania dolnej części źdźbła względem uprawy w płodozmianie. Wykazano również istotne różnice w porażeniu podstawy źdźbła w zależności od zastosowanego systemu uprawy pszenicy w monokulturze.
W systemie płużnym istotny wzrost porażenia źdźbła (o 10,6%) stwierdzono na poletkach z zastosowanym biostymulatorem w porównaniu
z monokulturą bez zabiegów regeneracyjnych. Uproszczenia w uprawie roli spowodowały ograniczenie fitosanitarnej skuteczności wyłącznie międzyplonu. Porażenie podstawy źdźbła po corocznym wprowadzaniu do gleby gorczycy białej było istotnie większe (o 9,8%)
w systemie uproszczonej uprawy roli w stosunku do tradycyjnej.
Rezygnacja ze zmianowania wywołała także istotny wzrost zainfekowania korzeni pszenicy jarej (tab. 1). W przypadku bezpośredniej uprawy pszenicy po sobie porażenie korzeni było 2,5-krotnie
większe w porównaniu z płodozmianem. Również w monokulturze
udowodniono statystycznie wpływ systemu uprawy na zdrowotność
korzeni. Wykorzystanie biostymulatora w warunkach płużnej uprawy
spowodowało wzrost o 21,1% zainfekowania korzeni w stosunku do
poletek pozbawionych zabiegów regeneracyjnych. Nie udowodniono
istotnego wpływu uproszczeń w uprawie roli na stan fitosanitarny
korzeni. Największe porażenie korzeni w warunkach zredukowanej
uprawy odnotowano po użyciu biostymulatora i było ono istotnie
większe względem roślin rosnących po wprowadzanym corocznie do
gleby międzyplonie ścierniskowym o 20,1%.
Stwierdzono istotną korelację między zdrowotnością podstawy
źdźbła a plonem ziarna pszenicy uprawianej w monokulturze (rys.
1). Plon był ujemnie skorelowany ze stopniem porażenia podstawy źdźbła. Wzrostowi wartości indeksu porażenia podstawy źdźbła
o 1% towarzyszył spadek plonu o 0,08 t∙ha-1. Nie wykazano natomiast
istotnej korelacji między stopniem porażenia korzeni a plonem ziarna
(R2=0,2358).
Dyskusja
Wzrost porażenia zbóż przez choroby podsuszkowe pod wpływem
zaniechania płodozmianu potwierdzają inni autorzy [Parylak i Kordas
2001, Woźniak 2001, Kurowski 2002]. Adamiak i in. [2005] stwierdzili
natomiast, że następstwo roślin nie wpływa istotnie na ich zdrowot302
międzyplon
biostymulator
międzyplon + biostymulator
międzyplon
biostymulator
międzyplon + biostymulator
orka
orka
orka
orka
gruberowanie
gruberowanie
gruberowanie
NIR0,05
-
czynnik regeneracyjny
System uprawy
orka
uprawa pożniwna
*rzepak ozimy – pszenica ozima – jęczmień jary;
Monokultura
Płodozmian*
Następstwo
roślin
uprawa agregatem
uprawa agregatem
uprawa agregatem
orka
orka
orka
orka
orka
uprawa przedsiewna
6,2
78,0
82,0
85,0
79,5
84,7
77,4
76,6
32,1
Źdźbła
Tab. 1. Indeks porażenia pszenicy jarej przez grzyby powodujące choroby podsuszkowe [%]
11,7
69,0
72,4
60,3
66,7
74,7
63,0
61,7
24,7
Korzenie
Choroby podstawy źdźbła pszenicy jarej w monokulturze po zastosowaniu międzyplonu...
303
Elżbieta Pytlarz, Danuta Parylak, Martyna Szałata, Anna Lehmann, Adam Zych
Ryc. 1. Korelacja pomiędzy indeksem porażenia źdźbeł a plonem ziarna
pszenicy jarej
ność. W badaniach własnych stwierdzono ujemną korelację między
indeksem porażenia podstawy źdźbła a plonem ziarna. Z kolei Wojtala
i Parylak [2009] wykazały korelację dodatnią między stopniem porażenia źdźbeł a masą ziarna pszenicy ozimej.
Stwierdzono korzystny wpływ przyorywania międzyplonu ścierniskowego na zdrowotność systemu korzeniowego pszenicy jarej. Terapeutyczną funkcję międzyplonu potwierdza Kwiatkowski [2008], który
wykazał, że wymieszana z glebą biomasa gorczycy znacząco poprawia
zdrowotność uprawianego po nim jęczmienia jarego. Wojciechowski
[2009] również wykazał obniżkę porażenia przez choroby podsuszkowe
pszenicy jarej po przyoraniu międzyplonu ścierniskowego. Panasiewicz i
in. [2008] odnotowali jednak znaczącą poprawę zdrowotności pszenicy
twardej po zastosowaniu Asahi SL. Natomiast w badaniach własnych
biostymulator Nano-Gro wpłynął na wzrost porażenia roślin.
System uprawy roli w monokulturze wpłynął w różnym stopniu
na zdrowotność pszenicy. W badaniach własnych stwierdzono większe
porażenie podstawy źdźbła pszenicy na poletkach z uproszczeniami
niż w uprawie tradycyjnej. Zainfekowanie korzeni nie było natomiast
zróżnicowane przez sposób uprawy. Łacicowa [1979] uważa, że ograniczenie uprawek pożniwnych i przedsiewnych może spowodować nagromadzenie się chorobotwórczych grzybów w glebie, w szczególności
tych, które infekują korzenie, a następnie degradują tkanki podstawy
304
Choroby podstawy źdźbła pszenicy jarej w monokulturze po zastosowaniu międzyplonu...
źdźbła pszenicy. Natomiast badania Pląskowskiej i in. [2002] wykazują, że nawet znaczne ograniczenie zabiegów uprawowych w pszenicy
względem uprawy tradycyjnej nie wpływa na wzrost stopnia porażenia
przez patogeniczne grzyby glebowe.
Wnioski
Porażenie pszenicy jarej odmiany Tybalt uprawianej w monokulturze
przez grzyby powodujące kompleks chorób podstawy źdźbła było
istotnie wyższe niż w płodozmianie.
W warunkach tradycyjnej uprawy roli nie stwierdzono korzystnego wpływu zabiegów regeneracyjnych na ograniczenie zainfekowania
korzeni i podstawy źdźbła w porównaniu z monokulturą, w której
takich zabiegów nie stosowano. Po uproszczeniu uprawy roli najmniejsze porażenie podstawy źdźbła stwierdzono po łącznym stosowaniu
Nano-Gro i wprowadzeniu do gleby biomasy międzyplonu z gorczycy
białej, natomiast korzeni - po uprawie międzyplonu.
Plon ziarna pszenicy jarej uprawianej w monokulturze był ujemnie skorelowany tylko ze stopniem porażenia podstawy źdźbła.
Bibliografia
Adamiak E., Adamiak J., Balicki T. 2005. Wpływ wieloletniej monokultury
na występowanie chorób podstawy źdźbła w czterech zbożach. Frag.
Agron. 22 (2): 7-13.
Kurowski T. 2002. Studia nad chorobami podsuszkowymi zbóż uprawianych
w wieloletnich monokulturach. Wyd. UWM Olsztyn, Rozpr. Monog.
56, 86 ss.
Kwiatkowski C. 2008. Architektura łanu i zdrowotność jęczmienia jarego
uprawianego w monokulturze w zależności od regeneracyjnego wpływu
międzyplonów. Fragm. Agron. 25(1): 199-209.
Łacicowa B. 1979. Choroby korzeni i podstawy źdźbła pszenicy powodowane przez grzyby z rodzaju Fusarium. Post. Nauk Rol. 230: 57-68.
Mróz A., Jelinowski S., Kuś J. 1990. Wpływ zmianowania na porażenie pszenicy ozimej przez G. graminis oraz Pseudocerosporella herpotrichoides. Pam. Puł. 97: 55-63.
Panasiewicz K., Sulewska H., Koziara W. 2008. Efficacy of biological and
chemical active compounds in protection of T. durum against fungal
diseases. J. Res. Appl. Agric. Eng 53(4): 30-32.
305
Elżbieta Pytlarz, Danuta Parylak, Martyna Szałata, Anna Lehmann, Adam Zych
Parylak D., Kordas L. 2001. Wpływ czynników agrotechnicznych na porażenie pszenicy ozimej przez zgorzel podstawy źdźbła (G. graminis). Prog.
Plant Prot./ Post. Ochr. Roślin 41: 402-405.
Pląskowska E., Matkowski K., Moszczyńska E., Kordas L. 2002. Zdrowotność
podstawy źdźbła pszenicy jarej w uprawie tradycyjnej i siewie bezpośrednim przy dwóch poziomach nawożenia azotem. Agricultura 1: 131-138.
Tebrügge F., Düring R.A. 1999. Reducing tillage intensity – a review of results from a long-term study in Germany. Soil Till. Res. 53(1): 15-28.
Townsend G., Heuberger J. 1943. Methods for estimating losses caused by
diseases in fungicide exeperiments. Plant Dis. Rep. 27: 340-343.
Wojciechowski W. 2009. Znaczenie międzyplonów ścierniskowych
w optymalizacji nawożenia azotem jakościowej pszenicy jarej, Rozpr.
Monog. 76, UP we Wrocławiu, 122 ss.
Wojtala L., Parylak D. 2009. Skuteczność zapraw nasiennych, międzyplonu
i poziomu nawożenia azotowego w ograniczaniu porażenia pszenicy
ozimej przez patogeny podstawy źdźbła. Prog. Plant Prot./Post. Ochr.
Roślin 49 (2): 769-772.
Wojtala-Łozowska L. 2012. Wpływ wybranych proekologicznych zabiegów
agrotechnicznych na poprawę produkcyjności pszenicy ozimej uprawianej
po sobie. Rozprawa doktorska, Uniwersytet Przyrodniczy we Wrocławiu.
Woźniak A., 2001. Zachwaszczenie jęczmienia jarego uprawianego w płodozmianie i monokulturze. Ann. UMCS, Agricultura 3: 19-27.
Żółtańska E. 2005. The effect of previous crop and weather conditions on
the incidence of stem base diseases in winter wheat. J. Plant Prot. Res.
45(1): 37-40.
Adres do korespondencji:
mgr inż. Elżbieta Pytlarz, prof. dr hab. Danuta Parylak
mgr inż. Martyna Szałata, mgr inż. Anna Lehmann, mgr inż. Adam Zych
Katedra Kształtowania Agroekosystemów i Terenów Zieleni
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
Opiekun naukowy:
prof. dr hab. Danuta Parylak, dr hab. Wiesław Wojciechowski
prof. dr hab. Lesław Zimny
306
Piotr Rezka
Wojciech Balcerzak
EPISTEME
22/2014, t. III
s. 307–313
ISSN 1895-2241
BADANIA WSTĘPNE NAD PRODUKCJĄ K2SO4
Z ODPADOWEGO ROZTWORU
Z PRZEMYSŁU CYNKU
PRELIMINARY STUDY ON THE PRODUCTION OF
K2SO4 FROM WASTE SOLUTION FROM
ZINC INDUSTRY
Abstrakt. Artykuł prezentuje wyniki badań nad otrzymywaniem siarczanu potasu z odpadowego roztworu pochodzącego z przemysłu cynkowego.
Przedstawiono wyniki części doświadczeń przeprowadzonych w celu oceny
możliwości wykorzystania roztworu powstającego podczas otrzymywania
cynku metodą elektrolizy. Przedstawiono dyfraktogramy potwierdzające
otrzymanie siarczanu potasu na drodze krystalizacji. Wskazano powody
obecności domieszek w końcowym produkcie oraz przedstawiono kierunek
planowanych zmian na etapie strącania, które powinny skutkować większą
czystością otrzymanego poprzez krystalizację siarczanu potasu.
Słowa kluczowe: siarczan potasu, odpad, nawozy sztuczne
Abstract. The article presents results of the research on obtaining potassium sulphate from waste solution from zinc industry. Part of experiments
conducted in order to assess the possibilities of using a solution which is
formed during the preparation of zinc by electrolysis is described. The RTG
diffraction patters confirming the obtaining of potassium sulphate by crystallization are presented. The reasons for the presence of impurities in the
final product are indicated as well as the direction of planned changes in
the precipitation stage, which should result in higher purity of potassium
sulphate obtained by crystallization.
Key words: Potassium sulphate, waste, fertilizers
307
Piotr Rezka, Wojciech Balcerzak
WSTĘP
Zarówno względy ekonomiczne, jak i ekologiczne nakazują minimalizację ilości odpadów powstających w procesach technologicznych.
Przykładem uciążliwego odpadu powstającego w procesie hydrometalurgicznego otrzymywania cynku jest odpadowy roztwór poelektrolityczny [Cabała 2010]. Koncentracja metali ciężkich i duża kwasowość
roztworu uniemożliwia jego składowanie na zwykłych składowiskach
jak np. odpady poflotacyjne.
Większość prac dotyczących wykorzystania nadmiarowego
roztworu dotyczyła głównie odzysku związków cynku [PL Patent
1973,1980,1983,1985] i magnezu [Pawłowska-Kozińska i Mazanek 1998]. Obecnie roztwór ten jest poddawany procesom odzysku cynku i magnezu, czego efektem jest produkcja siarczanu sodu
[PL Patent 2007], którego zagospodarowanie może być problemem.
Z tego powodu rozważono wykorzystanie takiego roztworu do produkcji siarczanu potasu na drodze jednoetapowej konwersji z chlorkiem potasu [Grzmil i Kic 2005]. Otrzymanie siarczanu potasu metodą jednoetapową byłoby przesłanką do podjęcia prac nad zastosowaniem metody dwuetapowej z produktem pośrednim w formie
glazerytu, cechującej się wyższą wydajnością w stosunku do metody
jednoetapowej [Konigsberger i Erikkson 1999], [Grzmil i in. 2004].
W przypadku spełnienia wymogów jakościowych, siarczan potasu
mógłby zostać wykorzystany do celów nawozowych.
Celem pracy była wstępna ocena możliwości wykorzystania roztworu poelektrolitycznego z produkcji cynku do otrzymywania siarczanu potasu.
MATERIAŁ I METODY
Przedmiotem badań był odpadowy roztwór, powstający w procesie
elektrolitycznego otrzymywania cynku. W celu wykonania analizy
jakościowej i ilościowej, odważono 5g roztworu, przeniesiono go
ilościowo do kolby miarowej o obj. 250cm3 i dopełniono wodą destylowaną. Tak przygotowana próbka poddana została analizie metodą
spektrometrii mas ze wzbudzeniem w indukcyjnie sprzężonej plazmie
(ICP-MS) (tab. 1). Ilościowe oznaczenie jonów SO42- metodą wagową
wykazało ich zawartość na poziomie 24,3 %mas.
308
Badania wstępne nad produkcją k2so4 z odpadowego roztworu z przemysłu cynku
Tab 1. Skład roztworu wyjściowego
Składnik
Zawartość [% mas]
Zn2+
Mg2+
Mn2+
Fe3+
6,490 %
0,982 %
0,538 %
0,0011 %
W przeliczeniu na sole siarczanowe i wolny kwas siarkowy otrzymany roztwór zawierał 16,02% ZnSO4, 4,86% MgSO4, 1,48% MnSO4
oraz 10,18% H2SO4. Dla uproszczenia obliczeń pominięto znikomą zawartość jonów Fe3+. Zawartość wody w roztworze wyniosła 67,46 %mas.
Do badań przygotowano 100g roztworu odpadowego. Jako
czynnik strącający zastosowano Na2CO3, którego ilość potrzebna do
pierwszego i drugiego etapu strącania została obliczona na podstawie zawartości ZnSO4, MgSO4, MnSO4 oraz wolnego H2SO4. W tab.
2 przedstawiono obliczone ilości węglanu sodu do każdego z dwóch
etapów strącania.
Tab 2. Wyniki obliczeń ilości węglanu sodu wymaganej do strącania
Składnik
Zawartość w
100g roztworu
[g]
ZnSO4
H2SO4
Suma
16,02
10,18
26,2
MgSO4
MnSO4
Suma
4,86
1,48
6,34
Ilość moli w 100g
roztworu
[mol]
Pierwszy etap strącania
161,4
0,0993
98,0
0,1039
0,2032
Drugi etap strącania
120,3
0,0404
150,9
0,0098
0,0502
Masa molowa
[g∙mol-1]
Ilość moli
Na2CO3
[mol]
0,0993
0,1039
0,2032
0,0404
0,0098
0,0502
Na podstawie obliczeń teoretycznych obliczono ilość Na2CO3, potrzebną do przeprowadzenia strącania. Przy założeniu, że nie dojdzie do
wytrącenia soli sodowych podczas strącania związków cynku, magnezu
oraz manganu, ilość moli Na2SO4 obecnych w roztworze wynosić będzie
0,2534 mola. Punkt docelowy składu układu stanowi punkt P0 [Scherzberg i Schmitz 1994]. W układzie tym zawartość składników (wyrażona
309
Piotr Rezka, Wojciech Balcerzak
w % molowych) wynosi: 25% 2Na+, 75% 2K+, 25% SO42-, 75% 2Cl-. Ze
składu układu wynika, iż należy do roztworu zawierającego 0,2534 mola
Na2SO4 dodać 0,7602 mola (113,42g) K2Cl2. Do przygotowanego w zlewce roztworu odpadowego dozowano kroplami wodny roztwór węglanu
sodu cały czas intensywnie mieszając. Po dodaniu całej porcji mieszaninę pozostawiono pod działającym mieszadłem w celu odpędzenia CO2.
Po 30 min odłączono mieszadło i oddzielono osad od roztworu na lejku Buchnera podłączonego do kolby ssawkowej. Następnie fazę stałą
wysuszono, zmielono i poddano analizie rentgenograficznej (PSZ 3.1).
Przesącz w kolbie przelano do zlewki, zainstalowano pod mieszadłem
i intensywnie mieszając dozowano kroplami roztwór węglanu sodu. Po
dodaniu całej porcji mieszano przez 30 min, po czym odłączono mieszadło a mieszaninę rozdzielono na osad i roztwór na lejku Buchnera.
Wysuszony i zmielony osad poddano analizie rentgenograficznej (PSZ
3.2). Do krystalizatora z przesączem dodano obliczoną ilość chlorku
potasu w postaci wodnego roztworu ciągle mieszając. Uzyskaną mieszaninę ogrzewano i odparowano do ściśle określonej zawartości wody,
po czym schłodzono i pozostawiono pod przykryciem do następnego
dnia. Wytrącone kryształy oddzielono od roztworu na lejku Buchnera.
Fazę stałą wysuszono, zmielono i poddano analizie rentgenowskiej
(próbka PSZ 3.3).
WYNIKI
Zidentyfikowane fazy stałe zawarte w uzyskanych próbkach przedstawione zostały w tab. 3, natomiast ich dyfraktogramy zaprezentowano
na ryc. 1–3.
Tab. 3. Wyniki analizy rentgenograficznej doświadczenia PSZ 3
Próbka
Wynik analizy rentgenograficznej
PSZ 3.1
A, B i C
PSZ 3.2
B i domieszka D
PSZ 3.3
E i domieszki F i G
Legenda:
A – Na2Zn3(CO3)4(OH)6 · 3 H2O; B – Na2SO4;
C – Na2Zn(SO4)2 · 4 H2O; D – MgCO3 · 3 H2O;
E – K2SO4; F – K3Na(SO4)2; G - KCl
310
Badania wstępne nad produkcją k2so4 z odpadowego roztworu z przemysłu cynku
B
A
B
C
A
A C
C
A
B
B
A
A
C
A
B
C
Ryc. 1. Dyfraktogram próbki PSZ 3.1
B
B
D
D
D
B
D
B
D
B
Ryc. 2. Dyfraktogram próbki PSZ 3.2
E
F
E
G
E
Ryc. 3. Dyfraktogram próbki PSZ 3.3
311
Piotr Rezka, Wojciech Balcerzak
Na podstawie wyników analizy rentgenograficznej stwierdzono, iż
w wyniku pierwszego etapu strącania uzyskano fazę stałą zawierającą
mieszaninę podwójnych soli sodowo – cynkowych oraz siarczanu sodu
(PSZ 3.1). W wyniku drugiego etapu strącania otrzymano siarczan
sodu z dodatkiem węglanu magnezu (PSZ 3.2). Analiza próbki ostatniego etapu potwierdziła otrzymanie K2SO4 z domieszkami innych
soli (PSZ 3.3). Na podstawie analizy otrzymanych osadów można
stwierdzić, iż rzeczywista zawartość siarczanu sodu w przesączu po
wykonaniu 2 etapów strącania jest niższa niż zakładana, co spowodowało przesunięcie punktu składu układu na prostej Na2SO4-2KCl
z punktu P0 bliżej punktu 2KCl.
Niektóre piki dyfraktogramów próbek PSZ 3.1 i PSZ 3.2 zostały
podpisane wielokrotnie ze względu na nakładanie się ich sygnałów
na siebie. Taka duplikacja sygnału znacząco utrudnia jednoznaczne
przypisanie danego piku konkretnej fazie stałej.
WNIOSKI
Odpadowy roztwór z produkcji cynku, będący obiektem badań, może
być wykorzystany do produkcji siarczanu potasu. Warunkiem powodzenia jest uprzednie usunięcie jonów cynku i magnezu. Brak dodatkowych jonów pozwala w większym stopniu na kontrolowanie składu
roztworu w oparciu o układ 2Na+ – 2K+ – SO42- – 2Cl- – H2O [Scherzberg
i Schmitz 1994]. Spodziewanym skutkiem poprawy skuteczności strącania jonów cynku i magnezu powinno być zmniejszenie zawartości
domieszek w produkcie końcowym.
BIBLIOGRAFIA
Cabała J. 2010. Cynk w technosferze, Górnictwo i geologia, Tom 5 (2),
Zeszyt 4, 63 – 76
Grzmil B. U. Kic B. 2005. Single-Stage Process for Manufacturing of Potassium Sulphate from Sodium Sulphate, Chemical Papers, 59 (6b), 476
– 480
Grzmil B. U. Kic B. Zienkiewicz M. 2004. Utilization of waste sodium
sulphate to produce potassium sulphate, Polish Journal Chemical Technology, Tom 6, Nr 1, 17 – 23
312
Badania wstępne nad produkcją k2so4 z odpadowego roztworu z przemysłu cynku
Konigsberger E. Erikkson G. 1999. Simulation of Industrial Processes Involving concentrated Aqueous Solutions, Journal of Solution Chemistry, Vol. 28, No. 6, 721 – 730
Pawłowska–Kozińska D. Mazanek C. 1998. Problematyka racjonalnego
wykorzystania roztworów odpadowych z elektrolitycznego wydzielania cynku, III Międzynarodowa Konferencja Ochrony Środowiska
w Przemyśle Węglowym i Metali Nieżelaznych
PL Patent 66981. 1973
PL Patent 115121. 1980
PL Patent 118441. 1980
PL Patent 130082. 1983
PL Patent 139241. 1985
PL Patent 195202. 2007
Scherzberg H. Schmitz R. 1994. Potassium Sulphate, Duisburg’s alternative
to Mannheim, Phosphorus & Potassium No. 192, July-August
Adres do korespondencji:
mgr inż. Piotr Rezka
e-mail: [email protected]
dr hab. Wojciech Balcerzak
e-mail: [email protected]
Katedra Technologii Środowiskowych
Instytut Zaopatrzenia w Wodę i Ochrony Środowiska
Wydział Inżynierii Środowiska, Politechnika Krakowska
ul. Warszawska 24, 31-155 Kraków
Opiekun naukowy: dr hab. Wojciech Balcerzak
313
Anna Romanowicz
Roman Prażak
EPISTEME
22/2014, t. III
s. 315–321
ISSN 1895-2241
OCENA TOLERANCYJNOŚCI LINII
MIESZAŃCOWYCH AEGILOPS KOTSCHYI BOISS.
Z TRITICUM AESTIVUM L. NA STRES SOLNY
EVALUATION OF SALT STRESS TOLERANCE
IN AEGILOPS KOTSCHYI BOISS. WITH TRITICUM
AESTIVUM L. HYBRID LINES
Abstrakt. Badano wpływ soli NaCl na kiełkowanie i wzrost siewek pięciu
linii mieszańcowych Aegilops kotschyi Boiss. z Triticum aestivum L. i ich
pszenicznych komponentów rodzicielskich (odmiany Begra, Monopol, Piko,
Rusałka, Turnia). Ziarniaki kiełkowano na bibule, w szalkach Petriego uzupełnionych pełną pożywką Hoaglanda z dodatkiem soli NaCl w stężeniach 0
(kontrola), 50, 100, 150, 200 mM. Określono energię i zdolność kiełkowania ziarniaków, liczbę i maksymalną długość korzeni oraz maksymalną długość liści siewek. Na podstawie pomiarów długości liści 8-dniowych siewek
wyznaczono indeks tolerancji 200 mM soli NaCl według wzoru: (średnia
długość liści siewek na pożywce z NaCl/ średnia długość liści siewek kontrolnych) x 100%. Wysokie stężenia soli NaCl nie wpływały negatywnie na energię i zdolność kiełkowania, natomiast istotnie ograniczały wzrost korzeni
i liści siewek u wszystkich badanych form. Z przeprowadzonych badań wynika, że analizowane linie mieszańcowe Aegilops kotschyi Boiss. z Triticum
aestivum L. charakteryzowały się wyższym indeksem tolerancji soli NaCl
od pszenicznych komponentów rodzicielskich. Najwyższą tolerancyjnością na zasolenie charakteryzowały się linie [(Rusałka x Ae. kotschyi Boiss.)
x Rusałka] x Piko i [(Ae. kotschyi Boiss. x Rusałka) x Begra] x Piko. Najmniej
tolerancyjne okazały się siewki pszenicy odmian Turnia i Begra.
Słowa kluczowe: Aegilops, mieszańce, kiełkowanie, pszenica, tolerancyjność
na zasolenie
Summary. This research investigated the influence of NaCl salt concentrations on seed germination and seedling growth of five Aegilops kotschyi
Boiss. with Triticum aestivum L. hybrid lines. Responses of selected hybrid
lines to NaCl were compared with reactions of wheat parental components.
Seeds were germinated on filter paper in Petri dishes, and moistened in
315
Anna Romanowicz, Roman Prażak
Hoagland medium containing different concentrations of NaCl (0, 50, 100,
150, 200 mM). Percentage of germinated seeds and number and maximal
length of roots and maximal length of leaves were assessed after eight days
of growing. The tolerance index to 200 mM NaCl salt treatment was calculated on the basis of the following formula: (mean leaves length of treated
seedlings/mean leaves length of control) x 100%. High salt concentrations
did not have negative influence on seed germination but led to inhibition
of root and leaf elongation Ae. kotschyi Boiss. with T. aestivum L. hybrid
lines were characterized with higher tolerance index to NaCl salt than their
wheat parental components. Among five hybrid lines [(Rusałka x Ae. kotschyi Boiss.) x Rusałka] x Piko and [(Ae. kotschyi Boiss. x Rusałka) x Begra]
x Piko were characterized by higher tolerance index to 200 mM NaCl salt
than their wheat parental cultivars. Two wheat cultivars Turnia and Begra
were characterized by the lowest NaCl salt tolerance.
Key words: Aegilops, hybrids, germination, wheat, salt tolerance
WSTĘP
Stres solny jest jednym z głównych czynników ograniczających produkcję roślinną [Munns i James 2003, Mguis i in. 2008]. Dzikie gatunki
z rodzaju Aegilops L. mogą być cennym źródłem wielu korzystnych genów tolerancyjności na stresy abiotyczne, w tym na suszę i zasolenie dla
pszenicy zwyczajnej [Farooq i in. 1990, 1992, Colmer i in. 2006]. Shimshi
i in. [1982] oraz Kimber i Feldman [1987] szczególnie wyróżniają gatunek
Aegilops kotschyi Boiss. jako najbardziej odporny na suszę, wysokie temperatury i zasolenie. Gatunek ten występuje w południowo-wschodnim
rejonie Basenu Morza Śródziemnego, m.in. w Libii, Tunezji, Egipcie, na
Bliskim Wschodzie, Azji Mniejszej i Azji Środkowej, często na terenach
zdegradowanych, półpustynnych [Kimber i Feldman 1987].
Celem przeprowadzonych badań była ocena tolerancyjności siewek linii mieszańcowych Aegilops kotschyi Boiss. z Triticum aestivum L.
na stres wywołany przez sól NaCl.
MATERIAŁ I METODY
Obiektem badań było pięć linii mieszańcowych (KRR, KRRM, KRRT,
KRBP, RKRP) otrzymanych w wyniku krzyżowania Aegilops kotschyi
316
Ocena tolerancyjności linii mieszańcowych aegilops kotschyi...
Boiss. (genomy UUSS) z odmianami pszenicy ozimej Triticum aestivum L.
(AABBDD) - Begra, Monopol, Piko, Rusałka i Turnia oraz ich pszeniczne
komponenty rodzicielskie. Mieszańce uzyskano na Wydziale Nauk Rolniczych, Uniwersytetu Przyrodniczego w Lublinie (tab. 1).
Ziarniaki badanych form kiełkowano na bibule, w szalkach Petriego
(10 nasion na szalkę) uzupełnionych pożywką Hoaglanda z dodatkiem
soli NaCl w stężeniach: 0 (kontrola), 50, 100, 150, 200 mM. Od momentu wysiewu do 8-dniowej siewki, kultury prowadzono w termostacie,
w temperaturze 20oC. W każdej kombinacji wykonano po trzy powtórzenia. Zbadano wpływ soli NaCl na energię kiełkowania (po 4 dniach)
i zdolność kiełkowania ziarna (po 8 dniach). Określono również liczbę
i maksymalną długości korzeni oraz maksymalną długość liści siewek.
Wyniki opracowano statystycznie i przedstawiono w tabeli nr 1. Istotność różnic oceniono za pomocą testu Tukeya przy p£ 0,05.
Wzrost części nadziemnej roślin w środowisku zasolonym jest
ogólnie silniej hamowany niż wzrost korzeni (w porównaniu do kontroli) [Kuiper i in. 1990]. Stąd na podstawie zahamowania wzrost części nadziemnej siewek w roztworze soli NaCl w stosunku do kontroli
wyliczono również indeks tolerancji 200 mM NaCl (rys. 1) wg wzoru:
(średnia długość liści siewek na pożywce z NaCl/ średnia długość liści
siewek kontrolnych) x 100% [Prażak 2003].
WYNIKI I DYSKUSJA
Przeprowadzone badania nie wykazały istotnego wpływu soli NaCl
w stężeniach 50-200 mM na energię i zdolność kiełkowania linii mieszańcowych Aegilops kotschyi Boiss. z Triticum aestivum L. oraz ich
pszenicznych komponentów rodzicielskich. Podobnie jak w badaniach
Prażaka [2003] nad mieszańcami pszenicy z Ae. ventricosa Tausch.
i Ae. juvenalis Thell. (Eig.). W badaniach Abdelsalama [2012] poziom
zasolenia wpływał bardziej na kiełkowanie odmian pszenicy zwyczajnej niż gatunków Aegilops L. - Ae. ventricosa Tausch. i Ae. kotschyi
Boiss. Pszenica odmiany Sids 1 (bardziej tolerancyjna na zasolenie)
i gatunki Aegilops L. wytworzyły w kombinacjach z solą NaCl więcej
korzeni niż w kontroli, natomiast odmiana Gemmeiza 9 (wrażliwa)
- mniej niż w kontroli. Autor odnotował znacznie mniejsze zahamowanie wzrostu korzeni i liści siewek gatunków Aegilops L. niż pszenic.
317
318
*
45,1
78,5
36,3
63,8
79,3
52,9
73,0
95,4
73,0
51,9
95,8
58,1
91,3
102,4
58,5
79,0
110,9
91,5
71,9
52,1
48,0
86,1
55,7
42,2*
34,5*
63,6
25,6*
64,0
100
45,0*
42,4
33,7*
80,3
44,1*
37,4*
34,1*
52,4*
24,4*
51,4*
150
22,09 33,32 23,25 15,95
81,9
50
86,1
0
11,00
25,0*
37,3*
27,0*
57,6*
27,6*
27,2*
24,2*
28,4*
12,6*
200
NIRp=0,05
22,5*
Długość korzeni (mm) Rooths length (mm)
NaCl (mM)
- wynik istotnie różny od kontroli (0 mM NaCl)
NIR p£ 0,05
1. (Ae. kotschyi x Rusałka) x
Rusałka - KRR
2. [(Ae. kotschyi x Rusałka) x
Rusałka] x Monopol - KRRM
3. [(Ae. kotschyi x Rusałka) x
Rusałka] x Turnia - KRRT
4. [(Ae. kotschyi x Rusałka) x
Begra] x Piko - KRBP
5. [(Rusałka x Ae. kotschyi) x
Rusałka] x Piko - RKRP
6. Begra
7. Monopol
8. Piko
9. Rusałka
10. Turnia
Analizowane formy
Forms analysed
71,0
128,0
93,2
95,4
84,0
70,7
100
123,9 119,5
100,9 83,0
119,3 91,0
110,6 94,8
101,6 94,8
58,4*
51,8*
62,3*
76,1*
76,1*
89,8*
84,3
77,4*
72,3*
59,1*
150
33,04 33,54 32,50 25,95
173,3
159,0
136,0
139,5
135,3
159,8 116,6 105,3
117,5 109,7
133,6 101,5
127,3 124,5
50
0
17,20
30,8*
40,2*
28,0*
27,2*
24,8*
64,2*
43,3*
36,1*
36,4*
31,0*
200
Długość liści (mm) Leaves length (mm)
NaCl (mM)
Tab. 1. Wpływ soli NaCl na długość korzeni i liści 8-dniowych siewek linii mieszańcowych Aegilops L. z Triticum L.
oraz ich pszenicznych komponentów rodzicielskich
Anna Romanowicz, Roman Prażak
Ocena tolerancyjności linii mieszańcowych aegilops kotschyi...
U linii mieszańcowych Aegilops kotschyi Boiss. z Triticum aestivum
L. oraz odmian pszenicy zwyczajnej Rusałka i Piko liczba korzeni
w kontroli wynosiła 3-6, natomiast w kombinacjach z solą NaCl 3-7.
W liniach KRR i RKRP oraz odmianach Begra, Monopol i Turnia odnotowano podobną liczbę 3-6 korzeni zarówno w kombinacjach z solą
NaCl jak i w kontroli. Większa tolerancyjność na zasolenie badanych
linii mieszańcowych i odmian pszenicy nie zawsze wiązała się z większą liczbą wytworzonych korzeni w kombinacjach z solą NaCl.
W wysokich stężeniach sól NaCl silnie ogranicza rozwój systemu
korzeniowego i części nadziemnej siewek pszenicy [Munns i James
2003, Mguis i in. 2008, Shavruckov i in. 2009]. W badaniach własnych
korzenie i części nadziemne siewek w kombinacjach z wysokimi stężeniami soli 100-200 mM NaCl, były istotnie krótsze od kontroli (tab. 1).
Według Gorhama i in. [1985] tolerancyjność na stres solny
w plemieniu Triticeae jest prawdopodobnie związana z możliwością
preferencyjnego pobierania kationów potasu kosztem sodu nawet jeśli
jony sodu występowałyby w nadmiarze w środowisku zewnętrznym
korzeni. Cecha ta jest w wysokim stopniu skorelowana z tolerancyjnością na zasolenie [Shavruckov i in. 2009]. Według Gorhama [1990a,b]
system ten występuje u pszenic diploidalnych i heksaploidalnych oraz
u gatunków Aegilops L. System preferencyjnego pobierania kationów
45
40
35
30
%
25
20
15
10
5
0
KRR
KRRM
KRRT
KRBP
RKRP
Begra
Monopol
Piko
Rusałka
analizowane formy
Ryc. 1. Indeks tolerancji 200 mM NaCl 8-dniowych siewek linii
mieszańcowych Aegilops kotschyi Boiss. z Triticum aestivum L.
oraz ich pszenicznych komponentów rodzicielskich
319
Turnia
Anna Romanowicz, Roman Prażak
potasu kosztem sodu odkryty u Ae. squarrosa L. (D) jest obecny u
większości gatunków Aegilops L. zawierających genom D, a także M,
U i T [Gorham 1990a]. Wśród badanych linii najwyższą wartością
indeksu tolerancji charakteryzowały się linie [(Rusałka x Ae. kotschyi
Boiss.) x Rusałka] x Piko – RKRP i [(Ae. kotschyi Boiss. x Rusałka) x
Begra] x Piko – KRBP, a wśród odmian pszenicy - Monopol i Piko (rys.
1). Ponieważ kozieńce jako formy mateczne są dawcami cytoplazmy,
może to świadczyć o większym wpływie genów jądrowych niż cytoplazmatycznych na tolerancyjność roślin na stres solny.
WNIOSKI
Wysokie stężenia soli NaCl silnie ograniczały wzrost siewek pszenicy
i linii mieszańcowych Ae. kotschyi Boiss. z T. aestivum L. Natomiast
nie zaobserwowano istotnego wpływu badanych stężeń soli NaCl na
kiełkowanie nasion.
Linie mieszańcowe Ae. kotschyi Boiss. z T. aestivum L. wykazały
się wyższą wartością indeksu tolerancji 200 mM soli NaCl, a tym
samym wyższą tolerancyjnością, od pszenicznych komponentów
rodzicielskich.
LITERATURA
Abdelsalam N. R., 2012. Screening for salt tolerance in common and relatives wheat via multiple parameters. Research Journal of Agriculture
and Biological Sciences, 8(1): 36-44.
Colmer T.D., Flowers T.J., Munns R., 2006. Use of wild relatives to improve
salt tolerance in wheat. Journal of Experimental Botany, 57 (5): 1059–
1078.
Farooq S., Shah T.M., Iqbal N. 1990. Variation in crossability among intergeneric hybrids of wheat and salt tolerant accessions of three Aegilops
species. Cer. Res. Comm., 18/4: 335-338.
Farooq S., Iqbal N., Asghar M., Shah T. M. 1992. Intergeneric hybridization
for wheat improvement – IV. Expression of salt tolerance gene (s) of
Aegilops cylindrica in hybrids with hexaploid wheat. Cer. Res. Comm.,
20/1-2: 111-118.
Gorham J. 1990a. Salt Tolerance in the Triticeae : K / Na discrimination in
Aegilops species. J. Exp. Bot., 41/226: 615 - 621.
320
Ocena tolerancyjności linii mieszańcowych aegilops kotschyi...
Gorham J. 1990b. Salt Tolerance in the Triticeae : K / Na discrimination in
synthetic hexaploid wheats. J. Exp. Bot., 41/226: 623-627.
Gorham J., Wyn Jones R.G., McDonnell E. 1985. Some mechanisms of salt
tolerance in crop plants. Plant and Soil, 89: 15-40.
Kimber G., Feldman M. 1987. Wild wheat: an introduction. College of Agriculture, University of Missouri, Columbia, Special Report, 353: 1-146.
Kuiper D., Suit J., Kuiper P.J.C. 1990. Actual cytokinin concentrations in
plant tissue as an indicator for salt resistance in cereals. Plant and Soil,
123: 243-250.
Mguis K., Ben Brahim N., Albouchi A., Yakkoubi-Tej M., Mahjoub A., Zeineb
Ouerghi Z. 2008. Phenotypic responses of the wild wheat relative Aegilops geniculata Roth and wheat (Triticum durum Desf.) to experimentally imposed salt stress. Genet. Resour. Crop Evol. 55: 665–674. DOI
10.1007/s10722-007-9270-1
Munns R., James R. A. 2003. Screening methods for salinity tolerance:
a case study with tetraploid wheat. Plant and Soil, 253: 201-218.
Prażak R. 2003. Ocena tolerancyjności mieszańców międzygatunkowych
pszenicy (Triticum sp.) na stres solny. Biul. IHAR 230: Cechy morfologiczne i płodność mieszańców niektórych gatunków rodzaj Aegilops sp.
Z pszenicą haksaploidalną Triticum aestivum L. Biul. IHAR, 263: 3-17.
Shavrukov Y., Langridge P., Tester M., 2009. Salinity tolerance and sodium
exclusion in genus Triticum. Breeding Science, 59: 671–678.
Shimshi D., Mayoral M. L., Atsmon D. 1982. Response to water stress in
wheat and related wild species. Crop Sci., 22: 123-128.
Adres do korespondencji:
mgr inż. Anna Romanowicz
dr hab. Roman Prażak
Zakład Biologii Roślin
Wydział Nauk Rolniczych
Uniwersytet Przyrodniczy w Lublinie
Szczebrzeska 102, 22-400 Zamość
e-mail: [email protected]
Opiekun naukowy: dr hab. Roman Prażak
321
Milena Rusin
Janina Gospodarek
Barbara Biniaś
EPISTEME
22/2014, t. III
s. 323–330
ISSN 1895-2241
WPŁYW ZWIĄZKÓW ROPOPOCHODNYCH
NA ENERGIĘ I ZDOLNOŚĆ KIEŁKOWANIA
NASION BOBU ORAZ NA WYBRANE CECHY
MORFOLOGICZNE ROŚLIN
EFFECT OF OIL DERIVATIVES ON ENERGY
AND GERMINATION CAPACITY OF BROAD BEAN
SEEDS AND ON SELECTED MORPHOLOGICAL
CHARACTERISTICS OF PLANTS
Abstrakt. Celem przeprowadzonych badań było określenie oddziaływania
substancji ropopochodnych na energię i zdolność kiełkowania nasion bobu,
odmiany „Windsor Biały” oraz na wybrane cechy morfologiczne kiełkujących siewek. Do analiz wykorzystano nasiona pochodzące z roślin rosnących na terenach sztucznie zanieczyszczonych benzyną, olejem napędowym
i przepracowanym olejem silnikowym, z których połowa została poddana
procesowi bioremediacji. Stwierdzono, że najbardziej niekorzystnie na
energię kiełkowania oddziaływał olej napędowy. Wszystkie zastosowane
substancje nie miały wpływu na zdolność kiełkowania nasion i cechy morfologiczne siewek. Zastosowana bioremediacja w większości przypadków nie
miała wpływu na analizowane cechy.
Słowa kluczowe: związki ropopochodne, zdolność kiełkowania, energia kiełkowania, cechy morfologiczne.
Summary. The aim of this study was to determine the effect of oil derivatives on energy and germination capacity of broad bean seeds (“Windsor Biały” variety) and on selected morphological characteristics of seedlings. The
seeds derived from plants growing on areas artificially contaminated with
petrol, used diesel oil and engine oil were used to analyses and half of them
have undergone a process of bioremediation. The results of the experiment
showed that diesel oil affected germination energy the most adversely. All
of substances used in the experiment demonstrated no effect on the germination of seeds and morphological characteristics of seedlings. In most
cases applied bioremediation had no effect on any analyzed characteristics.
Key words: oil derivatives, germination capacity, germination energy, morphological characteristics.
323
Milena Rusin, Janina Gospodarek. Barbara Biniaś
Wstęp
Bób jest rośliną bogatą w składniki pokarmowe, a w swych nasionach
zawiera: do 7% pełnowartościowego białka, 14% węglowodanów,
znaczne ilości witamin z grupy B i C oraz wiele soli mineralnych (żelaza, fosforu, wapnia) [Borowska i in. 1999]. Można go użytkować
w fazie niepełnej dojrzałości na suche nasiona lub jako warzywo.
Ponadto po zbiorze pozostaje około 80% nadziemnych części roślin
w postaci liści, strączyn i łodyg, które mogą być wykorzystywane jako
wysokowartościowa domieszka do paszy dla zwierząt [Łabuda i Łabuda 1990]. Jest on także ceniony jako przedplon, ponieważ zostawia
po sobie stanowisko o dobrej strukturze, bogate w azot i materię
organiczną, wolne od chwastów, z dużą aktywnością drobnoustrojów
glebowych [Łabuda 2000]. Ponadto, podobnie jak inne motylkowe,
bób zdolny jest do wiązania azotu atmosferycznego i stanowi bardzo ważny element płodozmianu [Jensen 1996, Hauggaard-Nielsen
i Andersen 2000]. Jest on także rośliną przydatną do zmniejszenia
deficytu w produkcji białka paszowego [Jensen i in. 2010].
Celem przeprowadzonych badań było określenie następczego
oddziaływania związków ropopochodnych takich jak: benzyna, przepracowany olej silnikowy i olej napędowy na energię i zdolność kiełkowania nasion bobu oraz na określone cechy morfologiczne roślin
takie jak: długość części nadziemnej, długość korzeni i liczbę korzeni
bocznych dłuższych od 2 mm. Zbadano także wpływ zastosowanej
bioremediacji na wyżej wymienione cechy.
Materiał i metody
Nasiona wykorzystane do analizy pochodziły z roślin rosnących na poletkach znajdujących się na obszarze stacji doświadczalenej Uniwersytetu
Rolniczego w Mydlnikach, położonych niedaleko Krakowa. Jest to obszar,
który w 2010 roku został sztucznie zanieczyszczony następującymi
substancjami ropopochodnymi: benzyną, olejem napędowym i przepracowanym olejem silnikowym (6000 mg substancji ropopochodnej na
1kg s.m. gleby). Znajdowały się tam również poletka kontrolne, które nie
zostały zanieczyszczone. Połowa z obiektów została poddana procesowi
bioremediacji przez dodatek biopreparatu, zawierającego w swym składzie
wyselekcjonowane organizmy prokariotyczne [Gospodarek i in. 2013].
324
Wpływ związków ropopochodnych na energię i zdolność kiełkowania nasion bobu...
Analizy zostały przeprowadzone na nasionach bobu, odmiany
„Windsor Biały”, otrzymanych z roślin, uprawianych na glebie zanieczyszczonej odpowiednimi substancjami ropopochodnymi oraz
na glebie kontrolnej po upływie 3 lat od momentu skażenia. Ocena
energii i zdolności kiełkowania nasion została przeprowadzona w warunkach laboratoryjnych, zgodnie z ogólnie przyjętymi normami. Test
przeprowadzono w szalkach Petriego, a jako podłoże wykorzystano
bibułę. Użyto nasion zdrowych i nieuszkodzonych przez strąkowca
bobowego. Energię kiełkowania określono po sześciu dniach, z kolei
zdolność kiełkowania po dwóch tygodniach. Przy drugiej obserwacji
zmierzono także długość części nadziemnej każdego z nasion, długość
korzeni oraz policzono liczbę korzeni bocznych, których długość była
większa niż 2 mm.
Analizę statystyczną otrzymanych wyników przeprowadzono
przy użyciu programu Statistica 10.0. Istotność różnic między średnimi została zbadana przez przeprowadzenie analizy wariancji dwuczynnikowej, a średnie różnicowano testem NIR Fishera na poziomie
istotności α = 0,05.
Wyniki
Najwyższą energią kiełkowania charakteryzowały się nasiona pochodzące z roślin rosnących na glebie kontrolnej bez zastosowania
prosesu bioremediacji (ryc.1). Najbardziej niekorzystnie na tą cechę
oddziaływał olej napędowy - różnice w odniesieniu do kontroli były
istotne statystycznie, a energia kiełkowania była prawie trzykrotnie
niższa niż w obiekcie kontrolnym.
Zastosowana bioremediacja we wszystkich przypadkach oddziaływała niekorzystnie na energię kiełkowania. Różnice istotne statystycznie odnotowano jednak jedynie w obiekcie kontrolnym, w którym
użycie biopreparatu spowodowało zmniejszenie wartości badanej
cechy ponad dwukrotnie.
Spośród zastosowanych substancji najbardziej niekorzystnie na
zdolność kiełkowania nasion bobu oddziaływała benzyna, jednak
w żadnym obiekcie różnice w odniesieniu do kontroli nie były istotne
statystycznie, a analizowana cecha kształtowała się na poziomie około
80% (ryc. 2).
325
Milena Rusin, Janina Gospodarek. Barbara Biniaś
Ryc. 1. Energia kiełkowania nasion bobu pochodzących z roślin uprawianych na glebie zanieczyszczonej substancjami ropopochodnymi. K
– kontrola, OS – gleba skażona olejem silnikowym, ON – gleba skażona
olejem napędowym, B – gleba skażona benzyną, OR - bez bioremediacji,
R – z bioremediacją. Wartości oznaczone różnymi literami odpowiednio dla
danej cechy różnią się od siebie istotnie przy α = 0,05.
Ryc. 2. Zdolność kiełkowania nasion bobu pochodzących z roślin uprawianych na glebie zanieczyszczonej substancjami ropopochodnymi. Oznaczenia jak na rycinie 1. Wartości oznaczone różnymi literami odpowiednio dla
danej cechy różnią się od siebie istotnie przy α = 0,05.
326
Wpływ związków ropopochodnych na energię i zdolność kiełkowania nasion bobu...
Proces bioremediacji w większości przypadków niekorzystnie oddziaływał na zdolność kiełkowania i tylko w przypadku gleby skażonej
olejem silnikowym odnotowano niewielki wzrost wartości badanej
cechy, jednak różnice także nie były udowodnione statystycznie.
Cechy morfologiczne kiełkujących roślin we wszystkich przypadkach
kształtowały się na podobnym poziomie (ryc.3, ryc.4). Średnia długość
części nadziemnej w obiektach bez zastosowania biopreparatu wahała
się od 0,96 cm w obiekcie zanieczyszczonym olejem silnikowym do 1,46
cm w obiekcie zanieczyszczonym benzyną, z kolei części podziemnej od
6,02 cm do 7,51 cm w tych samych obiektach, które zostały wymienione
wcześniej. Średnia liczba korzeni bocznych, których długość była większa niż 2 mm, najwyższa była w obiekcie zanieczyszczonym benzyną,
a najniższa przy zanieczyszczeniu gleby olejem napędowym jednak różnice
w odniesieniu do kontroli nie były istotne statystycznie.
Ryc. 3. Średnia długość części nadziemnej i podziemnej kiełkujących
nasion pochodzących z roślin uprawianych na glebie zanieczyszczonej
substancjami ropopochodnymi. Oznaczenia jak na rycinie 1. Wartości oznaczone różnymi literami odpowiednio dla danej cechy różnią się od siebie
istotnie przy α = 0,05.
Zastosowany biopreparat w większości przypadków przyczynił się
do skrócenia zarówno części nadziemnej jak i podziemnej roślin i tylko
w obiekcie skażonym olejem silnikowym doprowadził do zwiększenia
długości badanych części roślin, które to różnice jednak nie były udowodnione statystycznie. W przypadku liczby korzeni bocznych zasto327
Milena Rusin, Janina Gospodarek. Barbara Biniaś
sowany proces bioremediacji we wszystkich przypadkach oddziaływał
niekorzystnie na analizowaną cechę, ale różnice istotne statystycznie
odnotowano jedynie w obiekcie zanieczyszczonym benzyną, w którym
zastosowanie biopreparatu przyczyniło się do zmniejszenia liczby
wytwarzanych korzeni bocznych ponad trzykrotnie.
Ryc. 4. Średnia liczba korzeni bocznych u kiełkujących nasion pochodzących z roślin uprawianych na glebie zanieczyszczonej substancjami
ropopochodnymi. Oznaczenia jak na rycinie 1. Wartości oznaczone
różnymi literami różnią się od siebie istotnie przy α = 0,05.
Dyskusja
Na podstawie przeprowadzonych badań stwierdzono, że najbardziej
niekorzystnie na energię kiełkowania nasion bobu oddziaływał olej
napędowy. Do podobnych wniosków, tyle że w odniesieniu do innej
rośliny, doszła Przybulewska [2005], która stwierdziła, że wysokie
stężenie tej substancji może doprowadzić do całkowitego zahamowania kiełkowania ziarniaków jęczmienia. W tym samym doświadczeniu
autorka dowiodła, że benzyna nie wykazuje istotnie negatywnego
wpływu na kiełkowanie siewek, co również pokrywa się z wynikami
niniejszej pracy. Podobnie wyniki otrzymali Rytelewski i in. [1981],
którzy zauważyli, że ziemniaki rosnące na glebie zanieczyszczonej
olejem napędowym najczęściej wcale nie wschodziły. Adam i Duncan
[2002] również stwierdzili, że olej napędowy powodował opóźnienie
lub całkowite zahamowanie kiełkowania roślin, przy czym ich wrażliwość była zależna od gatunku, a nawet podgatunku.
328
Wpływ związków ropopochodnych na energię i zdolność kiełkowania nasion bobu...
Nie stwierdzono negatywnego wpływu związków ropopochodnych na cechy morfologiczne kiełkujących siewek. Inaczej było
w badaniach prowadzonych przez Małachowską-Jutsz i Mikscha
[2004], którzy badali wpływ zużytego oleju silnikowego na żyto, koniczynę czerwoną i gorczycę białą w początkowym okresie wzrostu. Autorzy dowiedli, że zastosowana substancja w istotnym stopniu przyczyniła się do zahamowania przyrostu masy korzeni i łodyg. Podobnie
było w badaniach Wyszkowskiego i in. [2004], którzy stwierdzili, że
olej napędowy oddziałuje niekorzystnie na nadziemne części łubinu
żółtego. Liste i Felgentreu [2006] także stwierdzili, że substancje
ropopochodne mogą powodować zmniejszenie suchej masy zarówno
korzeni jak i łodyg nawet o ponad 50%. Rozbieżności mogą wynikać
z innych gatunków roślin zastosowanych we wszystkich wymienionych doświadczeniach, ale również z faktu, że w niniejszym doświadczeniu analizowano wpływ następczy ropopochodnych (tj. po upływie
3 lat do momentu zanieczyszczenia) oraz analizowano go pośrednio,
tzn. poprzez wpływ na roślinę mateczną, a nie bezpośrednio na kiełkujące nasiona.
W badaniach dotyczących wpływu związków ropopochodnych na
rośliny, należy pamiętać, że duży wpływ na reakcję poszczególnych
roślin mają: stężenie zastosowanej substancji, właściwości gleby, pH,
wilgotność, zawartość materii organicznej, nawożenie oraz gatunek
rośliny [Ziółkowska, Wyszkowski 2010].
Wnioski
Zanieczyszczenie gleby olejem napędowym, po 3 latach od jego przeprowadzenia, przyczyniło się do zmniejszenia energii kiełkowania
nasion bobu, pozyskanych z roślin uprawianych na glebie zanieczyszczonej. Wszystkie zastosowane polutanty nie miały istotnego wpływu
na zdolnosć kiełkowania i cechy morfologiczne kiełkujacych roślin.
Zastosowany proces bioremediacji najczęściej nie wpływał na
analizowane cechy, jedynie w obiekcie zanieczyszczonym benzyną
spowodował zmniejszenie ilości wytwarzanych korzeni bocznych,
a w obiekcie kontrolnym zmniejszenie energii kiełkowania nasion.
Praca finansowana ze środków w ramach Działalności Statutowej
Katedry.
329
Milena Rusin, Janina Gospodarek. Barbara Biniaś
Bibliografia
Adam G., Duncan H. 2002. Influence of diesel fuel on seed germination.
Environmental Pollution, 120(2), 363-370;
Borowska J., Zadernowski R., Markiewicz K., Wierzbicka B. 1999. Zmiany
zawartości składników mineralnych podczas dojrzewania nasion bobu.
Biuletyn Magnezologiczny, 4(1), 27-31;
Gospodarek J., Kołoczek H., Pietryszak P., Rusin M. 2013. Effect of bioremediation of oil derivatives in soil on Pterostichus sp. (Coleoptera, Carabidae)
occurrence. Ecological Chemistry and Engineering A, 20(4-5), 545-554;
Hauggaard-Nielsen H., Andersen M.K. 2000. Intercropping grain legumes
and cereal in organic cropping system. Grain legumes, 30, 18-19;
Jensen E.S. 1996. Grain yield, symbiotic N2 fixation and interspecific competition for inorganic N in pea-barley intercrops. Plant Soil, 182, 25-38;
Jensen E.S., Peoples M.B., Hauggaard-Nielsen H. 2010. Faba bean in cropping systems. Field Crops Research, 115(3), 203-216;
Liste H., Felgentreu D. 2006. Crop growth, culturable bacteria and degradation of petrol hydrocarbons (PHCs) in a long-term contaminated field
soil. Applied Soil Ecology, 31, 43-52;
Łabuda S., Łabuda H. 1990. Chemical composition of faba bean plants at
early – green and green seed stages. FABIS Newsletter, 27, 20-23;
Łabuda H. 2000. Uprawa bobu. Hasło Ogrodnicze, 3. 15-17;
Małachowska-Jutsz A., Miksch K. 2004. Influence of used oil on same plant
species. Archives of Environmental Protection, 30(2), 95-105;
Przybulewska K. 2005. Wpływ zanieczyszczenia gleby pestycydami i związkami ropopochodnymi na wzrost i rozwój siewek jęczmienia jarego.
Roczniki Gleboznawcze, LVI (1-2), 129-135;
Rytelewski J., Przedwojski R., Maćkiewicz J. 1981. Porównanie niektórych
metod rekultywacji gleb skażonych ropą naftową. Zeszyty Naukowe
ART Olsztyn, Rolnictwo, 31, 33-39;
Wyszkowski M., Wyszkowska J., Ziółkowska A. 2004. Effect of soil contaminated with diesel oil on yellow lupine yoeld and macroelements content. Plant Soil Environment, 51(8), 360-367;
Ziółkowska A., Wyszkowski M. 2010. Toxicity of petroleum substances to
microorganism and plants. Ecological Chemistry and Engineering S,
17(1), 73-82;
Adres do korespondencji:
mgr inż. Milena Rusin
dr hab. inż. Janina Gospodarek, mgr Barbara Biniaś
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
[email protected]
330
Ilona Świtajska, Sławomir Szymczyk
Angela Potasznik, Żaneta Banaszek
Cristina Timofte, Ireneusz Cymes
EPISTEME
22/2014, t. III
s. 331–342
ISSN 1895-2241
WPŁYW UPRAWY WIERZBY NA CELE
ENERGETYCZNEJ W WARUNKACH POLSKI
PÓŁNOCNO-WSCHODNIEJ NA JAKOŚĆ WÓD
GRUNTOWYCH
INFLUENCE OF CULTIVATION OF THE WILLOW TO
DESTINATIONS ENERGY IN CONDITIONS OF NORTHEAST POLAND TO THE QUALITY OF GROUNDWATERS
Abstrakt. Celem badań było określenie wpływu uprawy wierzby krzewiastej (Salix viminalis L.) na cele energetyczne w pierwszym roku uprawy na
właściwości chemiczne wód gruntowych z uwzględnieniem sezonu wegetacyjnego i poza wegetacyjnego. Systematycznie raz w miesiącu (2011 rok)
w wodach gruntowych oznaczono: ChZT, węglany, chlorki, siarczany.
Stwierdzono, że na jakość wód gruntowych terenów pofałdowanych wpływa głębokość położenia wód gruntowych. Zasadnicze znaczenie ma także
sposób zagospodarowania terenu oraz warunki meteorologiczne. Wykazano również, że w zbliżonych warunkach dostępności wody dla roślin plantacja wierzby spowodowała ponad 3-krotne zmniejszenie stężenia chlorków
w wodzie gruntowej, ale praktycznie nie wpłynęła na zmiany zawartości
w nich wodorowęglanów, siarczanów i substancji organicznej (wartość ChZT).
Słowa kluczowe: wierzba energetyczna, wody gruntowe, ChZT, węglany,
chlorki, siarczany,
Summary. The aim of the study was to determine the effect of growing
willow (Salix viminalis L.) for energy purposes in the first year of cultivation
on the chemical properties of groundwater, taking into account the growing
season and out of the vegetation. Systematically once a month (2011) in
groundwater were determined: COD, carbonates, chlorides, sulfates. It was
found that the quality of groundwater wrinkled areas affected by depth to
the groundwater. It is also crucial land use and meteorological conditions. It
was also shown that in similar conditions of water availability to plants willow plantation caused more than 3-fold reduction in chloride concentration
in the groundwater, but practically had no effect on their content change
carbonates, sulphates and organic matter (COD value).
Key words: willow (Salix viminalis), groundwater, COD, carbonates, chlorides,
sulphates
331
Ilona Świtajska, Slawomir Szymczyk, Angiela Potasznik, Żaneta Banaszek...
Wstęp
Tereny rolnicze stanowią istotne zagrożenie zanieczyszczeniami wód
gruntowych oraz powierzchniowych. Zanieczyszczenia obszarowe nie
tylko wynikają z produkcji zwierzęcej, ale również roślinnej. Sposób
użytkowania terenu posiada zasadnicze znaczenie w kształtowaniu
jakości wód gruntowych (Świtajska i in. 2013a). Interesujący pod
względem ograniczenia zanieczyszczenia wód gruntowych wydaje
się fakt wprowadzania upraw wierzby na cele energetyczne. Wysoka
wydajność wierzby z 1 ha oraz produktywność z 1 karpy kwalifikuje ją
jako atrakcyjnie finansowo rozwiązanie oraz stanowi alternatywę dla
dotychczasowych upraw rolniczych dając nowe możliwości zagospodarowania terenów niewykorzystanych (Dubas i in. 2004). Dodatkowo wydajność uzależniona jest od roku zbioru biomasy. Najbardziej
atrakcyjnym ze względu na przyrost biomasy jest zbiór w systemie
trzyletnim (Dubas i in. 2004).
Uprawa wierzby energetycznej wymaga określonych warunków
meteorologicznych, takich jak: opady atmosferyczne, temperatura
oraz nasłonecznienie. Do najbardziej optymalnych należą równomiernie rozłożone w okresie wegetacji opady atmosferyczne na poziomie
600 mm rocznie (Dreszer i in. 2003) oraz umiarkowanie wysoka
temperatura w tym okresie. Susza negatywnie wpływa na plonowanie,
obniżając wydajność z jednostki powierzchni nawet o 50% (Szczukowski i in. 2004). Na uprawę ma również wpływ rodzaj gleb (III-IV klasy
bonitacyjnej) oraz rzeźba terenu. Optymalny poziom wód gruntowych
dla wierzby energetycznej to 1-1,5 m (Dreszer i in 2003).
Celem pracy była ocena wpływu wierzby energetycznej w I roku
uprawy na właściwości chemiczne wód gruntowych.
Materiał i metody
Wieloletnia plantacja wierzby uprawianej w celu pozyskania materiału
energetycznego została założona na terenie województwa Warmińsko-Mazurskiego (Polska północno-wschodnia) w III dekadzie kwietnia
2010 roku. Obiekt badawczy położony jest na gruntach wsi Samławki
(teren Stacji Dydaktyczno-Badawczej UWM w Olsztynie z siedzibą
w Łężanach), zlokalizowanej ok. 80 km na północny-wschód od Olsztyna. Plantacja utworzona została na gruntach, których gleby charak332
Wpływ uprawy wierzby na cele energetycznej w warunkach polski północno-wschodniej...
teryzowały się małą przydatnością do tradycyjnej produkcji rolniczej
pod uprawy konsumpcyjne. Zawartość substancji organicznej w glebie
wynosiła 2,98%. Przedplon plantacji stanowiło pszenżyto uprawiane
w płodozmianie. Wierzbę krzewiastą posadzono w zagęszczeniu 11,11
tys. sztuk roślin/ha. Na plantacji zastosowano nawożenie mineralne
w ilościach: N 90 kg∙ha-1, P2O5 30 kg∙ha-1, K2O 60 kg∙ha-1. W tym samym roku, jesienią założono na niej punkty pomiarowo-kontrolne
(piezometry) oddalone od siebie o: 30 m (pomiędzy punktem nr 1
i nr 2 oraz nr 2 i nr 3). Odległość pomiędzy transektem piezometrów
na plantacji wierzby, a punktem pomiarowym nr 4 wynosiła ok. 200
m, zaś pomiędzy punktem nr 5, a transektem leśnym ok. 1000 m.
Jednocześnie w celach porównawczych piezometry założono
również na sąsiednich gruntach ornych i w lesie. Na gruntach ornych
uprawiano pszenicę ozimą dla której zastosowano nawożenie N 150
kg∙ha-1, P2O5 60 kg∙ha-1, K2O 110 kg∙ha-1.. Przedplonem był rzepak
ozimy. Las 51-letni o typie siedliskowym LŚW (las świeży) z przewagą
jaworu (JW). Las pełni funkcję gospodarczą. W pracy przedstawiono
analizę zmienność jakości wód gruntowych w pierwszym okresie badawczym, który był realizowany od stycznia do grudnia 2011 roku.
Obszar badań reprezentuje tereny pojezierne, charakteryzujące się
zróżnicowaną rzeźbą. Na plantacji wierzby i obiektach porównawczych łącznie założono 6 punktów badawczych, których lokalizacja
uwzględniała zarówno ukształtowanie, jak i sposób użytkowania terenu. Trzy z nich umieszczono na plantacji wierzby: wierzchowina (nr
1 – 3,90 m), stok (nr 2 – 3,25 m głębokości) oraz obniżenie terenu (nr
3 – 1,62 m głębokości). Pozostałe punkty zlokalizowano: na gruncie
ornym (nr 4 – 3,07 m głębokości) w pobliżu plantacji, jako przykład
wpływu intensywnego użytkowania gleb oraz w lesie jako odzwierciedlenie terenu seminaturalnego z uwzględnieniem dostępności wody:
wzniesienie (nr 5 - 6,06 m głębokości) oraz obniżenie terenu (nr 6
- 3,45 m). Próby wód gruntowych do analiz chemicznych pobierano
systematycznie raz w miesiącu przy pomocy pompy zanurzeniowej
typu GIGANT. Analizy chemiczne obejmujące: ChZT, HCO3-, Cl-,
SO42-, wykonano w laboratorium Katedry Melioracji i Kształtowania
Środowiska. Stany wód gruntowych zmierzono za pomocą gwizdka
hydrologicznego. Wyniki badań omówiono z uwzględnieniem okresu
wegetacyjnego (półrocze letnie obejmowało miesiące: IV-IX) i poza
333
Ilona Świtajska, Slawomir Szymczyk, Angiela Potasznik, Żaneta Banaszek...
wegetacyjnego (półrocze zimowe obejmowało miesiące: I-III oraz X-XII) oraz uwzględniono średnie dla całego roku.
Wyniki i dyskusja
W okresie badań średnia miesięczna temperatura powietrza morzona
w najbliżej położonej stacji meteorologicznej w Kętrzynie wahała się
od -6,6°C w lutym do 18,5°C w lipcu 2011 roku (średnio w roku 8,4°C).
W tym okresie roczna suma opadów atmosferycznych wyniosła 570
mm (źródło: www.tutiempo.net). Wody gruntowe na plantacji wierzby
krzewiastej w okresie 2011-2012 miały pH średnio od 6,79 (wierzchowina) do 7,17 (obniżenie terenu). Najmniejsze wartości pH w okresie
wegetacyjnym w badanych wodach w latach 2011-2012 stwierdzono
w obniżeniu terenu w lesie (średnio 6,35), co związane było z intensywniejszym pobraniem kationów zasadowych w lepszych warunkach
dostępności wody niż na wzniesieniu terenu. Średnia wartość pH wód
gruntowych pod gruntem ornym wynosiła ponad 6,0 nie przekraczając pH=6,5 (Świtajska i in. 2013b). Nieco większe wartości pH wód
pod gruntem ornym zapewne wynikało ze stosowania nawożenia
mineralnego oraz okresowego wapnowania gleb.
Wykazano, że w zależności od aktualnych warunków meteorologicznych oraz sposobu ukształtowania i zagospodarowania terenu
poziom wód gruntowych wahał się od 134 cm poniżej powierzchni
terenu (p.p.t.) w sezonie wegetacyjnym w obniżeniu pod plantacją
wierzby do 568 cm p.p.t. w sezonie poza wegetacyjnym w lesie na
wierzchowinie. W całym okresie najwyżej położone zwierciadło wód
gruntowych pod plantacją wierzby występowało w obniżeniu (średnio 137cm p.p.t.), zaś najniższy stan obejmował wierzchowinę (357
cm p.p.t ). Zaś na obiektach porównawczych najwyższe stany wód –
średnio 138 cm p.p.t. występował pod gruntami ornymi, a najniższe
– średnio 559 cm p.p.t. pod lasem na wierzchowinie i w jego obniżeniu – średnio 269 cm p.p.t. Takie zależności nie odbiegały zasadniczo
od średnich dla lat 2011-2012 (Świtajska i in. 2013). Poziom wód
gruntowych statystycznie istotnie wpływa na przyrosty wierzby energetycznej. Jak wskazują Juliszewski i in. 2006 największe przyrosty
wystąpiły u roślin dla których średni poziom wód gruntowych wynosił
156,3 cm, zaś przy głębokości 198,9 cm był on najmniej korzystny.
334
Wpływ uprawy wierzby na cele energetycznej w warunkach polski północno-wschodniej...
Wykazano, że w badanych wodach gruntowych większe stężenia
wodorowęglanów występowały pod plantacją wierzby niż pod obiektami
porównawczymi (tab. 1). Pod plantacją wierzby największe ich stężenie
(średnio 275 mg∙dm-3) występowało w wodach gruntowych na wierzchowinie, a najmniejsze w obniżeniu terenu. W zbliżonych warunkach
wilgotnościowych jak w obniżeniu terenu pod wierzbą (podobne stany
i dynamika poziomu wód gruntowych) nieznacznie mniejsze stężenie
wodorowęglanów (średnio o 4,4%) stwierdzono pod gruntami ornymi.
Najmniejsze zawartości węglowodanów występowały w wodzie gruntowej w obniżeniu terenu pod lasem (średnio 41 mg∙dm-3). W obydwu
rozpatrywanych sezonach stężenie w badanych wodach gruntowych
kształtowało się na względnie stałym poziomie. Niemniej stwierdzono, że większą zawartością wodorowęglanów w sezonie wegetacyjnym
odznaczały się wody gruntowe pod plantacją wierzby na stoku i w obniżeniu oraz pod gruntem ornym, zaś odwrotną tendencję obserwowano
w wodach gruntowych pod plantacją stoku oraz pod lasem.
Tab. 1. Zmienność stężenia wodorowęglanów w wodach gruntowych
w okresie od stycznia do grudnia 2011 roku (mgHCO3∙dm-3)
247
157
37
Rozstęp R
216-273
145-172
26-48
Współczynnik
Zmienności
V [%]
4
5
6
14
19
67
5
7
28
44
75
202
38
10
12
16
6
28
127
27
40
Odchylenie
standardowe
S
280
254
267
Styczeń-Grudzień 2011
Średnia
264-304
220-267
216-290
Średnia
Średnia
1
2
3
Sezon poza
wegetacyjny
Min-Max
Min-Max
Stanowisko
Sezon wegetacyjny
Plantacja wierzby
260-277 270 275
238-295 267 260
88-286 212 237
Obiekty porównawcze
146-273 211 229
163-172 167 160
31-66
47 41
Oznaczenia: 1 - Wierzchowina; 2 - Stok; 3 - Obniżenie; 4 - Grunt orny w sąsiedztwie
wierzby; 5 - Las – wierzchowina; 6 - Las – obniżenie
Najmniejsze odchylenie wartości od średniego stężenia wodorowęglanów stwierdzono na obiektach porównawczych w wodach
335
Ilona Świtajska, Slawomir Szymczyk, Angiela Potasznik, Żaneta Banaszek...
gruntowych pod lasem na wierzchowinie (S=10 mg HCO3∙dm-3) oraz
w obniżeniu (S=12 mgHCO3∙dm-3). Na plantacji wierzby podobną zależność wykazały wody gruntowe na wierzchowinie (S=14
mgHCO3∙dm-3) i stoku (S=19 mgHCO3∙dm-3), co wskazuje na względnie
stały poziom zawartości wodorowęglanów i niewielkie zróżnicowanie
ich stężeń w okresie roku. Największe odchylenie standardowe stężenia wodorowęglanów stwierdzono w wodach gruntowych w obniżeniu
terenu (S=67 mgHCO3∙dm-3) pod plantacją wierzby oraz pod gruntem
ornym (S=38 mgHCO3∙dm-3), co wskazuje na dużą dynamikę roczną
wynikającą zapewne z intensywniejszego przemieszczania się składników w profilu glebowym oraz z większego pobrania składników
pokarmowych przez rośliny w sezonie wegetacyjnym, co zapewniała
lepsza dostępność wody (wyższe stany wód gruntowych). Zatem
może mieć to związek z obiegiem wody na stoku, a szczególnie płytkim krążeniem wody zarówno pod plantacją wierzby w obniżeniu jak
i pod gruntami ornymi. Analogicznie wnioski można wysnuć analizując rozstęp uzyskanych wyników. Największe jego wartości
stwierdzono w wodach gruntowych w obniżeniu terenu (R=202
mgHCO 3∙dm -3) pod plantacją wierzby oraz pod gruntem ornym
(R= 127 mgHCO3∙dm-3).
Chemiczne zapotrzebowanie na tlen (ChZT) należące do wskaźników jakości wody decyduje o ilość tlenu, jaka potrzebna jest do
utlenienia zawartych w niej związków organicznych i nieorganicznych.
Badania wykazały, że było ono uzależnione od sposobu zagospodarowania terenu oraz głębokości zalegania wód gruntowych, ściśle
związanego zarówno z aktualnymi warunkami meteorologicznymi jak
i rzeźbą terenu. W wodzie gruntowej pod plantacją wierzby zwiększało
się ono wraz z obniżeniem terenu, osiągając średnio 11,7 mgO2·dm-3
w obniżeniu terenu. Mogło to wynikać z większej zawartości w glebie
materii organicznej, która w skutek rozkładu łatwiej migrowała do
płytko położonych wód gruntowych (tab. 2).
Uruchomienie większych ilości substancji organicznych w okresie po zakończeniu wegetacji potwierdza wystąpienie w tym czasie
większych wartości ChZT w wodzie gruntowej (od 8,8 mg O2∙dm-3 na
wierzchowinie plantacji do 30,5 mg O2∙dm-3 na wierzchowinie w lesie),
co zapewne wynikało z wymywania substancji organicznej w głąb
profilu glebowego podczas odnawiania się zasobów wód gruntowych.
336
Wpływ uprawy wierzby na cele energetycznej w warunkach polski północno-wschodniej...
Tab. 2. Zmienność wartości ChZT na tlen w wodach gruntowych w okresie
od stycznia do grudnia 2011 roku (mgO2∙dm-3)
4
5
6
3,6-19,2
5,2-79,2
3,6-17,6
Odchylenie
standardowe
S
Średnia
Średnia
Min-Max
Styczeń-Grudzień 2011
Plantacja wierzby
5,7 0,8-24,0 8,8 7,2
7,8
11,8 0,8-11,3 6,5 9,2
4,7
11,8 5,0-18,8 11,7 11,7
5,3
Obiekty porównawcze
11,6 4,0-25,2 12,1 11,9
6,3
26,1 8,0-67,0 30,5 27,7 27,5
11,1 5,0-17,1 11,7 11,3
4,6
Rozstęp R
4,5-6,3
4,8-17,6
3,2-20,4
Sezon poza wegetacyjny
Współczynnik
Zmienności
V [%]
1
2
3
Średnia
Min-Max
Stanowisko
Sezon wegetacyjny
107
51
45
23,2
16,8
17,2
53
99
40
21,6
74,0
14,0
Oznaczenia: 1 - Wierzchowina; 2 - Stok; 3 - Obniżenie; 4 - Grunt orny w sąsiedztwie
wierzby; 5 - Las – wierzchowina; 6 - Las – obniżenie
W wodach gruntowych pod lasem zwiększenie się wartości ChZT było
bardziej widoczne na wierzchowinie (od 26,1 mg O2∙dm-3 w sezonie
wegetacyjnym do 30,5 mg O2∙dm-3 w sezonie poza wegetacyjnym),
niż w obniżeniu terenu. Związane było to z niskim poziomem wód
gruntowych występujących na wierzchowinie na dużej głębokości. Na
plantacji wierzby zależność ta, była odwrotna, ponieważ w przypadku
stoku i obniżenia terenu wartość ChZT wynosiła średni od 11,8 mg
O2·dm-3 w sezonie wegetacyjnym, a w sezonie poza wegetacyjnym
6,5 mg O2∙dm-3 na stoku i 11,7 mg O2·dm-3 w obniżeniu. Wynikało
to zarówno z większej zawartości substancji organicznej w glebie jak
również z intensywniejszego podnoszenia się ich poziomu.
Największą roczną dynamikę ChZT stwierdzono w wodach gruntowych pod lasem na wierzchowinie (S=27,5 mgO2∙dm-3), przy jednocześnie wysokim współczynniku zmienności (V=99,1). Pozostałe wody
były bardziej skupione wokół średniej od 4,6 (nr 6) do 7,8 (nr 1). Zróżnicowanie pod kątem ChZT wskazywały wody gruntowe pod plantacją
wierzby na wierzchowinie (V=107,4%), przy jednocześnie największym
rozstępie (R=23,2 mgO2∙dm-3), wskazuje to na duże jego zróżnicowanie.
337
Ilona Świtajska, Slawomir Szymczyk, Angiela Potasznik, Żaneta Banaszek...
Było to zapewne związane z niskim poziomem wód gruntowych, czyli
mało dogodnymi warunkami w przesuszonym profilu glebowym do
intensywnych procesów mikrobiologicznych, w wyniku których powinna być mineralizowana substancja organiczna, która była częściowo
wymywana do wód gruntowych w okresie odnawiania się ich zasobów.
Stężenie siarczanów w badanych wodach gruntowych pod plantacją wierzby było nieco większe w sezonie wegetacyjnym i wahało się
w granicach od 24,6 mg·dm-3 w obniżeniu terenu do 219,4 mg·dm-3
na stoku. W obydwu sezonach największe ich stężenia, średnio ponad 2-krotnie w porównaniu do wierzchowiny i obniżenia terenu,
było również na stoku (tab. 3). Stwierdzono, że były one zbliżone do
stężeń siarczanów w wodzie gruntowej pod gruntem ornym. Można zatem stwierdzić, że w zbliżonych warunkach wilgotnościowych
w porównaniu do wierzby uprawianej na cele energetyczne (obniżenie
terenu) w wodzie pod gruntem ornym występowało ponad 2-krotnie
większe stężenie siarczanów. Jednak największe stężenie siarczanów
(360,7 mg·dm-3) stwierdzono w sezonie poza wegetacyjnym w wodzie
gruntowej na wierzchowinie pod lasem.
Tab. 3. Zmienność stężenia siarczanów w wodach gruntowych w okresie
od stycznia 2011 do października 2011 roku (mg∙dm-3)
Plantacja wierzby
26,3-176,4 97,0 10,3-73,3 42,1 68,5
90,7-219,4 136,2 45,9-186,2 114,8 125,5
24,6-107,7 53,2 45,9-56,1 51,0 52,0
Obiekty porównawcze
80,4-214,7 132,0 44,8-201,3 112,5 122,2
81,4-217,9 154,1 46,4-360,7 203,5 168,2
25,4-54,6 36,3 21,5-81,9 61,91 49,1
Rozstęp R
Średnia
Średnia
Min-Max
Średnia
Styczeń-Grudzień 2011
Współczynnik
zmienności V [%]
4
5
6
Sezon poza
wegetacyjny
Odchylenie standardowe S
1
2
3
Min-Max
Stanowisko
Sezon wegetacyjny
54,3
53,4
20,0
79
43
39
166,2
173,5
83,2
57,8
96,7
22,1
47
57
45
169,8
314,3
60,4
Oznaczenia: 1 - Wierzchowina; 2 - Stok; 3 - Obniżenie; 4 - Grunt orny w sąsiedztwie
wierzby; 5 - Las – wierzchowina; 6 - Las – obniżenie
338
Wpływ uprawy wierzby na cele energetycznej w warunkach polski północno-wschodniej...
W sezonie poza wegetacyjnym w stosunku do sezonu wegetacyjnego w wodach gruntowych pod plantacją wierzby stwierdzono
obniżenie stężenia siarczanów od 4 % w obniżeniu terenu do 57%
na wierzchowinie. Było to zapewne związane z odpływem gruntowym siarczanów wraz z wodami zgodnie ze spadkiem terenu oraz
ze znacznie większym ich rozcieńczeniem w wodzie gruntowej na
wierzchowinie w wyniku większego podniesienia ich niż w obniżeniu
terenu, gdzie amplituda wahań poziomu wody w gruncie była mniejsza. Wpłynęło to na znacznie większą zmienność stężeń siarczanów
w wodzie gruntowej na wierzchowinie (V=79 %; S=54,3; R=166,20),
niż w obniżeniu terenu (V=38 %; S=20,0; R=83,2). Podobna tendencja
występowała w wodzie gruntowej pod lasem.
Stężenie chlorków w badanych wodach gruntowych było również
uzależnione od ukształtowania i sposobu użytkowania terenu, ale
zmienność ich stężeń w roku była znacznie mniejsza niż w przypadku
wodorowęglanów ChZT, czy siarczanów. W wodzie gruntowej pod plantacją wierzby stężenie chlorków zmieniało się w zakresie od 4 mgCl∙dm-3
w obniżeniu terenu w sezonie wegetacyjnym do 31 mgCl∙dm-3 na wierzchowinie i stoku w sezonie poza wegetacyjnym (tab. 4).
33
17
4
Rozstęp R
24-41
14-19
1-10
Współczynnik
zmienności
V [%]
4
5
6
7
2
4
30
9
37
17
9
13
7
5
3
21
28
54
18
18
11
Odchylenie
standardowe
S
22
25
6
Styczeń-Grudzień 2011
Średnia
16-30
22-28
4-8
Średnia
1
2
3
Sezon poza
wegetacyjny
Min-Max
Średnia
Sezon wegetacyjny
Min-Max
Stanowisko
Tab. 4. Zmienność stężenia chlorków w wodach gruntowych w okresie
od stycznia 2011 do października 2011 roku (mg∙dm-3)
Plantacja wierzby
14-31
22 22
27-31
29 27
10-17
13 10
Obiekty porównawcze
24-42
35 34
19-32
25 19
4-12
7
6
Oznaczenia: 1 - Wierzchowina; 2 - Stok; 3 - Obniżenie; 4 - Grunt orny w sąsiedztwie
wierzby; 5 - Las – wierzchowina; 6 - Las – obniżenie
339
Ilona Świtajska, Slawomir Szymczyk, Angiela Potasznik, Żaneta Banaszek...
W wodach gruntowych pod plantacją wierzby większe stężenia
chlorków (średnio od 55% do 64 %) występowały w głębiej zalegających wodach gruntowych. Największe stężenie chlorków w 2011 roku
stwierdzono w wodach pod gruntem ornym (średnio 34 mgCl∙dm-3),
były one ponad 3-krotnie większe niż w obniżeniu pod plantacją
wierzby (średnio 10 mgCl∙dm-3) i ponad 6-krotnie większe niż w
wodzie w obniżeniu pod lasem (średnio 6 mgCl∙dm-3). Pod wpływem
zmiennych warunków meteorologicznych wpływających na intensywność przemieszczania oraz możliwość bioakumulacji składników
w rozpatrywanym okresie najmniejsze zróżnicowanie stężeń chlorków
(V=9 %; S=2; R=9) wykazywało w wodzie gruntowej pod plantacją
wierzby na stoku, zaś największe (S=7; R=18) pod gruntami ornymi oraz (S=7; R=28) pod plantacją wierzby na wierzchowinie, lecz
największą zmiennością stężeń chlorków (V=54 %), pomimo najmniejszych stężeń, charakteryzowała się woda gruntowa w obniżeniu
terenu pod lasem. Mogło być to związane głownie z atmosferycznym
pochodzeniem chlorków oraz ze stosunkowo dużymi wahaniami poziomu wody pod lasem.
WNIOSKI
Zawartość wodorowęglanów, siarczanów i chlorków oraz wartość
ChZT w badanych wodach gruntowych była uzależniona ukształtowania i sposobu zagospodarowania terenu oraz warunków meteorologicznych (opady i temperatura) modyfikujących intensywność procesów fizykochemicznych i biologicznych oraz ruch wody i substancji
w środowisku glebowym, a także bioakumulację składników.
Zmiana sposobu użytkowania gleb, z gruntów ornych na uprawę
wierzby krzewiastej na cele energetyczne w zbliżonych warunkach
dostępności wody gruntowej dla roślin spowodowała ponad 3-krotne
zmniejszenie stężenia chlorków w wodzie gruntowej, ale praktycznie
nie wpłynęła na zmiany zawartości w nich wodorowęglanów, siarczanów i substancji organicznej (wartość ChZT).
O jakości wód gruntowych na terenach pofałdowanych decyduje
głębokość położenia wód gruntowych. Na terenie seminaturalnym
(las) wraz ze zwiększaniem dostępności wody gruntowej dla roślin
(wyższe stany wód gruntowych w obniżeniu terenu) następowało
340
Wpływ uprawy wierzby na cele energetycznej w warunkach polski północno-wschodniej...
zmniejszenie w nich stężeń wodorowęglanów, siarczanów i chlorków
oraz wartości ChZT, a pod uprawą wierzby: wodorowęglanów, siarczanów i chlorków oraz zwiększenie wartości ChZT.
LITERATURA
Dreszer K., Michałek R., Roszkowski A. 2003. Energia odnawialna – możliwości jej pozyskiwania i wykorzystania w rolnictwie. Wyd. PTIR
Kraków-Lublin-Warszawa.
Dubas J. W. Grzybek A. Kotowski W. Tomczyk A. 2004. Wierzba energetyczna – uprawa i technologie przetwarzania. Wyższa Szkoła Ekonomii
i Administracji w Bytomiu. s. 35
Szczukowski S., Tworkowski J., Stolarski M. J. 2004. Wierzba energetyczna.
Wydawnictwo Plantpress. Kraków.
Świtajska I., Szymczyk S., Koc J. 2013a. Wpływ sposobu użytkowania terenu na jakość wód gruntowych. Proceedings of Ecopole 7(1): 259-265.
Świtajska I., Szymczyk S., Potasznik A., Banaszek Ż. 2013b. Wpływ uprawy
wierzby na cele energetyczne na jakość wód gruntowych. EPISTEME.
Kraków, Nr. 18, t. III: 249-258.
Tadeusz Juliszewski, Dariusz Kwaśniewski, Dariusz Bara. 2006. Wpływ
wybranych czynników na przyrosty wierzby energetycznej. Inżynieria
Rolnicza Nr 12: 225-232
Portal internetowy przedstawiające aktualne warunki meteorologiczne –
http:// www.tutiempo.net
Opisane badania były finansowane z budżetu Zadania Badawczego nr 4 pt.
„Opracowanie zintegrowanych technologii wytwarzania paliw i energii z biomasy, odpadów rolniczych i innych” w ramach strategicznego programu badań
naukowych i prac rozwojowych pt.: „Zaawansowane technologie pozyskiwania
energii” realizowanego ze środków NCBiR i ENERGA S.A.
341
Ilona Świtajska, Slawomir Szymczyk, Angiela Potasznik, Żaneta Banaszek...
Adres do korespondencji:
mgr. inż. Ilona Świtajska
e-mail: [email protected]
dr hab. inż. Sławomir Szymczyk
e-mail: [email protected]
mgr. inż. Angela Potasznik
e-mail: [email protected]
mgr. inż. arch. kraj. Żaneta Banaszek
e-mail: [email protected]
mgr. inż. Cristina Timofte
e-mail: [email protected]
dr inż. Ireneusz Cymes
e-mail: [email protected]
Uniwersytet Warmińsko – Mazurski w Olsztynie
Wydział Kształtowania Środowiska i Rolnictwa
Katedra Melioracji i Kształtowania Środowiska
Pl. Łódzki 2 10-719 Olsztyn
Opiekun naukowy: dr hab. inż. Sławomir Szymczyk
342
Martyna Szałata
Wiesław Wojciechowski
Anna Lehmann
Elżbieta Pytlarz
Adam Zych
EPISTEME
22/2014, t. III
s. 343–350
ISSN 1895-2241
Wpływ międzyplonów ścierniskowych
na zachwaszczenie łanu owsa jarego
i żyta ozimego
The effect of stubble catch crops
on weed infestation of spring oats
and winter rye
Abstrakt. Badania przeprowadzono w sezonie wegetacyjnym 2010-2011.
Czynnikiem badań był brak lub udział międzyplonu ścierniskowego w uprawie przedsiewnej owsa jarego i żyta ozimego: A1) bez międzyplonów ścierniskowych, A2) międzyplon z gorczycy białej, A3) międzyplon z mieszanki
roślin strączkowych. Badaniami objęte zostały dwa zboża - owies jary i żyto
ozime, uprawiane w dwóch zmianowaniach: trójpolówce ziemniaka owsa
i żyta oraz w dwupolówce owsa i żyta. Celem badań było określenie oddziaływania międzyplonów ścierniskowych na zachwaszczenie owsa jarego
i żyta ozimego. W fazie kwitnienia owsa jarego międzyplony istotnie zmniejszyły liczbę chwastów od wykazanych w uprawie bez tego elementu zmianowania. Uprawa międzyplonu z mieszanki roślin strączkowych zmniejszyła zachwaszczenie o 89,0% w stosunku do uprawy bez międzyplonu. Nie
udowodniono statystycznie wpływu międzyplonów ścierniskowych na zachwaszczenie żyta ozimego.
Słowa kluczowe: owies jary, żyto ozime, międzyplony ścierniskowe, zachwaszczenie łanu
Summary. One-factorial field experiment was conducted in 2011-2012. The
factor was the lack or the presence of stubble catch crop in the pre-sowing
cultivation of spring oats and winter rye: A1) without stubble catch crop,
A2) white mustard catch crop, A3) stubble catch crop as a mixture of pulse
crops. The purpose of this study was to determine the impact of stubble
catch crops on weed infestation of spring oats and winter rye. It was noted
that at the flowering stage of spring oats the stubble catch crops significantly reduced the number of weeds in comparison with plots with no stubble
343
Martyna Szałata, Wiesław Wojciechowski, Anna Lehmann, Elżbieta Pytlarz, Adam Zych
catch crop. The mixture of pulse crops as the stubble catch crop decreased
weed infestation by 89.0%. There was no significant effect of stubble catch
crops on weed infestation of winter rye. The number of weeds in the crop
succesion oats-rye after ploughing down white mustard was lower by 65.6%
in comparison to plots without stubble catch crop.
Key words: spring oats, winter rye, catch crops, weed infestation
Wstęp
Po wstąpieniu do Unii Europejskiej w polskim rolnictwie większego
znaczenia nabrało gospodarowanie zgodnie z zasadami Kodeksu Dobrej Praktyki Rolniczej. Celem takiego gospodarowania jest zmniejszenie deficytu składników mineralnych w glebie. Sytuacja taka może
zostać ograniczona poprzez uprawę międzyplonów ścierniskowych,
ponieważ pobierają one i gromadzą w biomasie składniki, które są
dostępne w glebie. W ten sposób można zmniejszyć utratę składników
mineralnych [Wilczewski 2007]. Gospodarstwa rolne, w których uprawiane są międzyplony ścierniskowe w ramach programów rolnośrodowiskowych mogą korzystać z dopłat, co powoduje zwiększenie udziału
roślin regenerujących w strukturze zasiewów [Wojciechowski 2008].
Integrowana produkcja rolnicza jest kierunkiem rozwoju rolnictwa konwencjonalnego [Skrzypczak i Pudełko 2003]. Jednym
z elementów agrotechnicznej metody regulacji zachwaszczenia w integrowanej produkcji rolniczej jest stosowanie międzyplonów [Brant
i in. 2006]. Międzyplony ścierniskowe najczęściej powodują ograniczenie zachwaszczenia roślin uprawnych [Dworakowski 1998, Płaza
i Ceglarek 2007, Wojciechowski 2009, Gawęda 2009a, Gawęda 2009b].
Woźniak [2005] uważa jednak, że przyorana masa wsiewki międzyplonowej dwukrotnie zwiększyła liczbę i powietrznie suchą masę chwastów występującą w monokulturze pszenicy w porównaniu z obiektem
kontrolnym. Niektóre gatunki roślin międzyplonowych, a w szczególności z rodziny krzyżowych posiadają właściwości allelopatyczne,
dzięki czemu mogą hamować kiełkowanie chwastów [Piechota 2011].
Celem pracy było określenie oddziaływania międzyplonów ścierniskowych na zachwaszczenie owsa jarego i żyta ozimego. Badania
zostały wykonane ze względu na brak jednoznacznych doniesień
odnośnie wpływu uprawy międzyplonów ścierniskowych na liczbę
chwastów w łanie roślin uprawnych.
344
Wpływ międzyplonów ścierniskowych na zachwaszczenie łanu owsa jarego i żyta ozimego
Materiał i metody
Badania przeprowadzono w Rolniczym Zakładzie Doświadczalnym
Swojec Uniwersytetu Przyrodniczego we Wrocławiu w sezonie wegetacyjnym 2010-2011. Eksperyment wykonano w oparciu o jednoczynnikowe doświadczenie polowe założone metoda losowanych bloków w trzech powtórzeniach. Czynnikiem badań był brak lub udział
międzyplonu ścierniskowego w uprawie przedsiewnej żyta ozimego
i owsa jarego: A1) bez międzyplonu ścierniskowego, A2) międzyplon
z gorczycy białej, A3) międzyplon z mieszanki roślin strączkowych.
Gorczycę białą w międzyplonie wysiano w ilości 20 kg∙ha-1, a mieszankę w składzie: groch pastewny (100 kg∙ha-1) + łubin żółty (100 kg∙ha-1).
Badaniami objęte zostały dwa zboża - owies jary i żyto ozime, uprawiane w dwóch zmianowaniach: trójpolówce ziemniaka, owsa i żyta
oraz w dwupolówce owsa i żyta. Międzyplony ścierniskowe uprawiane
przed owsem jarym uprawiane były zgodnie z zasadami programu
rolnośrodowiskowego, z wiosennym ich przyoraniem, natomiast
przed żytem przyorane zostały jesienną orką siewną. Międzyplon
ścierniskowy z gorczycy białej odmiana Rotha zasiano 16 sierpnia
2010 roku. Również 16 sierpnia wysiano międzyplon z mieszanki
roślin strączkowych: łubin żółty odmiana Dukat oraz groch pastewny
odmiana Roch. Żyto ozime odmiana Dańkowskie Złote zostało zasiane 11 października 2010 roku. Owies jary odmiana Rajtar zasiano
w kwietniu 2011 roku.
Doświadczenie z udziałem owsa jarego i żyta ozimego założono na madzie rzecznej właściwej, wytworzonej z piasku gliniastego
lekkiego, podścielonego piaskiem luźnym, zaliczanej do kompleksu
żytniego słabego, VI klasy bonitacyjnej.
Zachwaszczenie w życie ozimym i owsie jarym zostało określone
w fazie od pełni do końca kwitnienia (BBCH 65-69) metodą ilościowo-wagową. W obydwu roślinach na powierzchni 1 m2 została oceniona
liczba chwastów i ich powietrznie sucha masa. Analizę statystyczną
otrzymanych wyników przeprowadzono w programie AVA.
Wyniki
Wykazano istotne różnice w liczbie chwastów w owsie jarym (tab. 1).
Międzyplony ścierniskowe w zmianowaniu trójpolowym ziemniaka,
345
Martyna Szałata, Wiesław Wojciechowski, Anna Lehmann, Elżbieta Pytlarz, Adam Zych
owsa i żyta zmniejszyły zachwaszczenie w porównaniu do uprawy bez
tego elementu zmianowania. Uprawa międzyplonu z gorczycy białej
zredukowała liczbę chwastów o 85,0%, a z mieszanki roślin strączkowych o 89,0% w porównaniu do uprawy bez międzyplonu. W zmianowaniu dwupolowym różnice wyniosły odpowiednio: 26,3% i 22,9%.
Tab. 1. Zachwaszczenie owsa w fazie kwitnienia
Obiekty
Ziemniak-owies-żyto
Ziemniak-owies-żyto+gorczyca biała
Ziemniak-owies-żyto+mieszanka roślin
strączkowych
Owies-żyto
Owies-żyto+gorczyca biała
Owies-żyto+mieszanka roślin
strączkowych
NIR0,05
Liczba
chwastów
[szt.·m-2]
Powietrznie sucha
masa chwastów
[g·m-2]
22,0
3,3
14,5
4,9
2,3
1,3
38,0
28,0
8,8
15,4
29,3
5,1
18,6
8,6
Zauważono korzystne ograniczające działanie międzyplonów
ścierniskowych na powietrznie suchą masę chwastów. W trójpolówce
(ziemniak­­­­-owies-żyto) przyoranie gorczycy spowodowało zmniejszenie
powietrznie suchej masy chwastów o 66,2%, a mieszanki aż o 91,0%
w porównaniu do uprawy bez międzyplonu. Różnice te były statystycznie istotne. Także w monokulturze zbożowej korzystniej na redukcję
powietrznie suchej masy chwastów wpłynęła mieszanka strączkowa
(o 42,0%), natomiast uprawa gorczycy nieznacznie ją zwiększyła.
Nie wykazano istotnego wpływu międzyplonów ścierniskowych
na zachwaszczenie żyta ozimego (tab. 2). Zauważono, że w zmianowaniu ziemniak-owies-żyto większą redukcję zachwaszczenia w uprawie
żyta spowodowało przyoranie gorczycy niż mieszanki strączkowej.
Również w monokulturze zbożowej gorczyca ograniczyła liczbę chwastów o 65,6% w porównaniu do uprawy bez międzyplonu.
346
Wpływ międzyplonów ścierniskowych na zachwaszczenie łanu owsa jarego i żyta ozimego
Tab. 2. Zachwaszczenie żyta w fazie kwitnienia
Obiekty
Ziemniak-owies-żyto
Ziemniak-owies-żyto+gorczyca biała
Ziemniak-owies-żyto+mieszanka roślin
strączkowych
Owies-żyto
Owies-żyto+gorczyca biała
Owies-żyto+mieszanka roślin
strączkowych
NIR0,05
Liczba
chwastów
[szt.·m-2]
Powietrznie sucha
masa chwastów
[g·m-2]
10,7
21,3
1,4
4,3
35,3
3,7
25,3
8,7
2,2
1,3
33,3
1,9
r.n
r.n
Objaśnienia: r.n. ─
­­ różnice nieistotne
Uprawa międzyplonów ścierniskowych z gorczycy i mieszanki
strączkowej nie wpłynęło istotnie na powietrznie suchą masę chwastów w życie ozimym. W trójpolówce masa chwastów po uprawie
mieszanki strączkowej była mniejsza o 13,9% niż po międzyplonie
z gorczycy białej. Z kolei w dwupolówce owsa i żyta, gorczyca ograniczyła suchą masę chwastów o 40,9%, a mieszanka o 14,6% w porównaniu do uprawy bez międzyplonu.
Dyskusja
W badaniach własnych udowodniono, że wpływ międzyplonów ścierniskowych na zachwaszczenie łanu owsa jarego i żyta ozimego zależy
od gatunku rośliny międzyplonowej. W fazie kwitnienia w zmianowaniu trójpolowym większe oddziaływanie na zmniejszenie liczby
chwastów miała mieszanka roślin strączkowych. Natomiast w zmianowaniu owsa i żyta lepsze wyniki dała gorczyca. Dworakowski [1998]
wykazał zmniejszenie liczby chwastów po przyoraniu gorczycy o około
20%. Gawęda [2010] zaobserwowała, że najgorzej na ograniczenie zachwaszczenia wpływa przyoranie roślin strączkowych. Badania własne
zaprzeczają temu pokazując, że przyoranie tych roślin ograniczyło
zachwaszczenie. Powietrznie sucha masa chwastów w owsie, niezależnie od zmianowania, w którym uczestniczył, została zredukowana
347
Martyna Szałata, Wiesław Wojciechowski, Anna Lehmann, Elżbieta Pytlarz, Adam Zych
poprzez uprawę mieszanki roślin strączkowych, natomiast gorczyca
nie zawsze dawała jednoznaczne wyniki. Jednak Gawęda [2010]
stwierdziła, że przyoranie gorczycy białej zmniejsza masę chwastów.
Nie wykazano istotnych zmian w zachwaszczeniu żyta w fazie kwitnienia po przyoraniu międzyplonu z roślin strączkowych.
Zauważono natomiast wyraźne zmniejszenie liczby chwastów po
przyoraniu gorczycy białej, co uwidoczniło się szczególnie w monokulturze zbożowej owsa i żyta. Biorąc pod uwagę powietrznie
suchą masę chwastów odnotowano, że przyoranie międzyplonów
korzystniej działało w zmianowaniu dwupolowym owsa i żyta niż
trójpolowym ziemniaka, owsa i żyta. Kwiatkowski [2004] wykazał, że
przyoranie międzyplonów powoduje zawsze ograniczenie zachwaszczenia, a gorczyca w większym stopniu zmniejsza liczbę chwastów
niż mieszanka roślin strączkowych. Oba międzyplony w badaniach
tego autora redukowały masę chwastów. Również Wojciechowski
i Parylak [2004] udowodnili w badaniach, że gorczyca biała uprawiana
w międzyplonie ścierniskowym spowodowała ograniczyła zachwaszczenia żyta ozimego.
Wnioski
Gatunek rośliny międzyplonowej i następstwo roślin w zmianowaniu
różnicowało zachwaszczenie łanu żyta i owsa.
Najwyższe ograniczenie zachwaszczenia w owsie w fazie kwitnienia uzyskano w zmianowaniu trójpolowym, po przyoraniu zarówno
międzyplonu z gorczycy białej, jak i z mieszanki strączkowej.
Zachwaszczenie żyta w fazie kwitnienia w uprawie dwupolowej
było mniejsze po przyoraniu gorczycy białej niż mieszanki strączkowej i bez międzyplonu. W zmianowaniu dwupolowym gorczyca biała
ograniczyła masę chwastów o 40,9%, a mieszanka o 14,6%.
Bibliografia
Brant V., Neckář K., Fuksa P., Pivec J., Venclová V. 2006. Entwicklung der Verunkrautung in verschiedenen Beständen von Sommerzwischenfrüchten. Journal of Plant Diseases and Protection, 20: 309–316.
Dworakowski T. 1998. Działanie międzyplonu ścierniskowego w ogniwie
zmianowania zboża ozime–zboża jare. Fragm. Agron., 15 (3): 90–99.
348
Wpływ międzyplonów ścierniskowych na zachwaszczenie łanu owsa jarego i żyta ozimego
Gawęda D. 2009a. Wpływ międzyplonów ścierniskowych na zachwaszczenie
jęczmienia jarego uprawianego w monokulturze. Fragm. Agron., 26 (1):
34–41
Gawęda D. 2009b. Wpływ międzyplonów ścierniskowych na zachwaszczenie
pszenicy jarej uprawianej w monokulturze. Ann. UMCS, Sect. E, 64 (3):
21–28.
Gawęda D. 2010. Zachwaszczenie owsa uprawianego w monokulturze w zależności od międzyplonów ścierniskowych. Ann. UMCS, Sect. EE, 65
(4): 12–19.
Kwiatkowski C. 2004. Wpływ międzyplonu na plonowanie i zachwaszczenie jęczmienia jarego uprawianego w monokulturze. Ann. UMCS, Sect.
E, 59 (2): 809–815.
Piechota T. 2011. Wpływ międzyplonu na zachwaszczenie kukurydzy
w różnych systemach uprawy roli. Prog. Plant Protection/Post. Ochr.
Roślin, 51 (1): 469–472.
Płaza A., Ceglarek F. 2007. Rola międzyplonów w regulacji zachwaszczenia
pszenżyta ozimego uprawianego w drugim roku po ich zastosowaniu.
Prog. Plant Protection/Post. Ochr. Roślin, 47 (3): 238–241.
Skrzypczak G., Pudełko J. 2003. Chwasty i ich zwalczanie – aspekty integrowanej ochrony roślin i zrównoważonego rolnictwa. Zesz. Probl.
Post. Nauk Rol. 490: 227-233.
Wilczewski E. 2007. Wartość wybranych roślin motylkowatych uprawianych w międzyplonie ścierniskowym na glebie lekkiej. Cz. II. Skład
chemiczny i akumulacja makroskładników. Acta Sci. Pol., Agric., 6 (1):
35–44.
Wojciechowski W. 2008. Następczy wpływ międzyplonów ścierniskowych
na zdrowotność pszenicy uprawianej w krótkotrwałej monokulturze.
Prog. Plant Protection/Post. Ochr. Roślin, 48 (1): 381–384.
Wojciechowski W. 2009. Znaczenie międzyplonów ścierniskowych w optymalizacji nawożenia azotem jakościowej pszenicy jarej. Wydawnictwo Uniwersytetu Przyrodniczego we Wrocławiu, ss. 122.
Wojciechowski W., Parylak D. 2004. Znaczenie międzyplonów w regulowaniu zachwaszczenia żyta ozimego w płodozmianach specjalistycznych.
Prog. Plant Protection/Post. Ochr. Roślin, 44 (2): 1216–1219.
Woźniak A. 2005. Wpływ wsiewek międzyplonowych i nawożenia organicznego na plon i zachwaszczenie pszenicy jarej uprawianej w monokulturze. Ann. UMCS, Sect. E, 60, 33–40.
349
Martyna Szałata, Wiesław Wojciechowski, Anna Lehmann, Elżbieta Pytlarz, Adam Zych
Adres do korespondencji:
mgr inż. Martyna Szałata
dr hab. inż. Wiesław Wojciechowski
mgr inż. Anna Lehmann, mgr inż. Elżbieta Pytlarz
mgr inż. Adam Zych
Katedra Kształtowania Agroekosystemów i Terenów Zieleni
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
Opiekunowie naukowi:
dr hab. Wiesław Wojciechowski
prof. dr hab. Danuta Parylak
prof. dr hab. Lesław Zimny
350
Paulina Topolińska
Magdalena Haak
Joanna Marć-Pieńkowska
EPISTEME
22/2014, t. III
s. 351–359
ISSN 1895-2241
WPŁYW DAWEK NAWOZÓW AZOTOWYCH
NA WYDAJNOŚĆ POKOSU ŁĄKOWEGO
ORAZ PRODUKCJĘ BIOGAZU
EFFECT OF NITROGEN FERTILIZER OF DOSES ON
YIELD SWATH MEADOW AND BIOGAS PRODUCTION
Abstrakt. Biogaz składa się z mieszaniny różnych gazów, wśród których
głównym składnikiem jest metan (CH4) i dwutlenek węgla (CO2). Do produkcji biogazu można wykorzystać biomasę różnego pochodzenia np. odpady komunalne, gnojowicę, obornik oraz biomasę z celowo zakładanych
upraw polowych. Podstawowym kryterium doboru roślin jest wydajność suchej masy z jednostki powierzchni, zawartość łatwo fermentujących składników, łatwość magazynowania po zbiorze oraz stosunek C/N. W wyniku
mikrobiologicznego rozkładu materii organicznej, azot uwalnia się w postaci amonowej (NH4+) oraz azotanowej (NO3-) i staje się dostępny dla roślin,
jako nawóz. Przede wszystkim, ważne jest, aby stosować nawóz pod najbardziej odpowiednie dla danego typu uprawy w optymalnym terminie. Celem
doświadczenia było zbadanie wpływu nawożenia azotem na plonowanie
mieszanki traw: kostrzewy łąkowej (Festuca pratensis Huds), wiechliny łąkowej (Poa pratensis L) i lucerny (Medicago L) oraz określenie ich przydatności do produkcji biogazu.
Słowa klucze: biogaz, nawożenie azotowe, efektywność biogazu, mieszanki traw
Summary. Biogas comprises of a mixture of different gases, of which the
main constituent is methane (CH4) and carbon dioxide (CO2). For the production of biogas can be used biomass of various origins such as municipal
waste, slurry, manure and biomass of deliberately assumed field crops. The
primary criterion for the selection of plant dry matter is the performance
per unit area, the contents of easily fermentable ingredients and C / N ratio.
As a result of the microbiological decomposition of organic matter, nitrogen
is released in the form of ammonium (NH4+) and nitrate (NO3-) and becomes
available to plants as a fertilizer. First of all it is important to use the most
suitable fertilizer for the type of fertilizer for growing them in the optimal
351
Paulina Topolińska, Magdalena Haak, Joanna Marć-Pieńkowska
time. The aim of the experiment was to investigate the effect of nitrogen
fertilization on the yield of grasses: fescue (Festuca pratensis Huds), Kentucky bluegrass (Poa pratensis L) and lucerne (Medicago L) and to determine their susceptibility to the production of biogas.
Keywords: biogas, nitrogen fertilizers, efficiency of biogas, swath of meadow
Wstęp
Odnawialne źródła energii są jednym z elementów europejskiego planu ograniczania niekorzystnych zmian klimatu i mają przyczynić się
do wzrostu gospodarczego, zwiększenia zatrudnienia oraz zapewnienia bezpieczeństwa energetycznego. Produkcja biogazu postrzegana
jest jako jedno z istotniejszych źródeł energii odnawialnej, które dodatkowo dostarcza korzyści środowiskowe i może zwiększyć dochody
rolników [Oslaj i in. 2010] . W warunkach Polski rozwój biogazowni
rolniczych został zarysowany w dokumencie pt. Kierunki rozwoju
biogazowi rolniczych w Polsce w latach 2010-2020 [Ministerstwo
Gospodarki 2010]. W rolnictwie polskim stosunkowo łatwo można
znaleźć produkty (pochodzące z zamierzonej działalności lub te będące pozostałościami po produkcji rolniczej lub leśnej), które mogą
być wykorzystane, jako odnawialne źródła energii, w szczególności
do produkcji biogazu [Głaszczka i in. 2010].
Celem doświadczenia było zbadanie wpływu nawożenia azotem
na plonowanie mieszanki traw: kostrzewy łąkowej (Festuca pratensis
Huds), wiechliny łąkowej (Poa pratensis L) i lucerny (Medicago L) oraz
określenie ich przydatności do produkcji biogazu.
Materiały i metody
Doświadczenia polowe: materiał roślinny wykorzystywany do przygotowania kiszonek pozyskano z doświadczenia polowego zlokalizowanego na terenie Ogrodu Botanicznego w Bydgoszczy (53º12’N,
18º01’E) założonego na glebie lekkiej w układzie podbloków losowanych split-plot w 4 powtórzeniach. Doświadczenie wykonano w latach
2012- 2013 z uwzględnieniem warunków pogodowych (tab. 1).
Tab. 1. Charakterystyka warunków klimatycznych występujących podczas
prowadzenia doświadczenia
352
Wpływ dawek nawozów azotowych na wydajność pokosu łąkowego oraz produkcję biogazu
Rok
III
IV
2012
2013
18
16
20
28
2012
2013
8
6
Miesiące
V
VI
VII
Opady (mm)
80
100
140
65
70
130
Średnia Temperatura (ºC)
12
17,5
18
22,6
10,5
16,7
18,5
17,8
VIII
IX
III-IX
Suma
130
80
20
40
508
439
21,4
20,8
16
14,3
----------
Źródło: wyniki własne.
W schemacie doświadczenia czynnikiem był poziom nawożenia
azotem (kg·ha-1): N0-0; N1 - 50; N2 - 100; N3 - 150, N4 -200. Doświadczenie założono na poletkach o wymiarach 20m2. Zawartość przyswajalnego fosforu w glebie wynosiła 14, 9 mg ; potasu 15, 1 mg ; magnezu 2, 5 mg na 100 g gleby. Zawartość próchnicy w glebie wynosiła
1, 6%, a pH 5,6. Stosowano nawożenie mineralne 80 kg·ha-1 fosforu
i 100 kg·ha-1 potasu. Siew nasion w ilości 30 kg/ ha wykonano 5 i 12
maja. Istotne różnice wpływu nawożenia azotem na obserwowane
cechy oceniano za pomocą analizy wariancji, wyznaczając półprzedziały ufności testem NIR na poziomie istotności α = 0,05. Analizy
statystyczne zostały wykonane z użyciem programu Statistica 10.
W badaniach do analizy biogazodochodowości wykorzystano, jako
substrat kiszonki z traw z 2012 roku, których skład był następujący:
kostrzewa łąkowa (Festuca pratensis Huds), wiechlina łąkowa (Poa
pratensis L.) oraz lucerna (Medicago L.). Inokulum stanowił osad pofermentacyjny pochodzący z Biogazowni Rypin Sp. z o.o. W oparciu o
wyniki ze wstępnych badań kiszonek pod kątem suchej masy, suchej
masy organicznej i zawartości pierwiastków: węgla (C) i azotu (N)
dobierano początkowe obciążenie fermentora (tab. 2).
Na początku fermentacji zawartość bioreaktora, analizowano pod
kątem: suchej masy, suchej masy organicznej, wg PN-75 C-04616/01.
Do badań, jako inokulum zastosowano przegłodzony i nieprzystosowany osad beztlenowy otrzymany z pracującego w systemie quasi-ciągłym bioreaktora o pojemności 100 dm3. Podstawą metodyczną była
niemiecka norma DIN 38 414 – S8. Odważoną porcję kiszonki (100g)
wraz z osadem beztlenowym umieszczano w szczelnie zamkniętym
naczyniu fermentacyjnym o pojemności roboczej 1 dm3. Całkowita
353
Paulina Topolińska, Magdalena Haak, Joanna Marć-Pieńkowska
Tab. 2. Właściwości fizykochemiczne kiszonek z doświadczenia polowego
w Bydgoszczy
Substrat
s.m. (%)
s.m.o.(%s.m.)
C:N
N (% s.m.)
C (% s.m.)
Kiszonka z traw
bez nawozu
16,80
82,3
30,75
1,33
45,12
19,38
83,4
31,2
1,35
45,22
21,42
84,6
33,4
1,44
44,90
32,30
87,8
33,7
1,58
45,25
37,21
89,9
38,4
1,67
45,82
Kiszonka z traw
50N
Kiszonka z traw
100N
Kiszonka z traw
150N
Kiszonka z traw
200N
Źródło: wyniki własne.
pojemność pojedynczego reaktora, których łącznie wykonano 10,
wynosiła 900ml. Następnie fermentory umieszczano w łaźni wodnej
z termostatem utrzymującym temperaturę 36,5°C. Aparatura laboratoryjna do określania właściwości wytwarzanego gazu w procesie
fermentacji mokrej składa się z rurki eudiometrycznej o objętości
1200 ml, stopniowanej od góry do dołu (podziałka 5 ml). Rurka
eudiometryczna postawiona jest na butelkę o pojemności 1000 ml.
Z dna rurki eudiometrycznej wychodzi rurka łącząca butelkę z rurką
eudiometryczną. Płyn znajdujący się w eudiometrze jest z niego wypychany, aby zrównoważyć różnicę ciśnień na skutek zwiększenia się
objętości gazu w całym układzie pomiarowym- co pozwala na pomiar
jego objętości. Pomiaru objętości biogazu mierzono, co 24 h i odczytywano jego poziom na eudiometrze. Okresowo analizowano skład
biogazu przy użyciu analizatora składu biogazu Multi-tec 450. Proces
fermentacji beztlenowej prowadzony był przez 21 dni do momentu,
w którym nie stwierdzano istotnych przyrostów objętości biogazu.
Wyniki i dyskusja
W strefie klimatu umiarkowanego, temperatura powietrza i opady
są tymi czynnikami pogody, które wykazują duże zróżnicowanie
354
Wpływ dawek nawozów azotowych na wydajność pokosu łąkowego oraz produkcję biogazu
pomiędzy latami prowadzenia obserwacji [Bac i in. 1993] . Według
[Sosnowskiego i Jankowskiego 2010], wysokość plonu runi łąkowej
zależy nie tylko od ilości składników dostarczanych w nawozach, ale
również od przebiegu warunków atmosferycznych. W tab. 3 przedstawiono porównanie zdolności produkcyjnej traw łąkowych w zależności
od warunków klimatycznych w latach 2012- 2013.
Tab. 3. Porównanie produktywności traw w zależności od warunków
klimatycznych w latach 2012-2013
Substrat
trawy: kostrzewa
łąkowa, wiechlina
łąkowa, lucerna
Rok
2012
2013
Średnia
Plon zielonej masy [dt∙ha-1]
Plon suchej masy [t∙ha-1]
Udział suchej masy %
Plon kiszonki [t∙ha-1]1
76,5**
28,6**
37,4*
57,4**
46,6**
17,8**
32,1 *
35,0**
61,6
23,2
34,7
46,2
Źródło: wyniki własne. *wartości nie różnią się istotnie na poziomie p<0,05
**wartości różnią się istotnie na poziomie p<0,05
1
plon kiszonki określany w oparciu o normatywy (plon zielonki · 0,75)
Uzyskane wyniki wskazują, że plonowanie łąk w zasadniczy sposób uzależnione jest od przebiegu warunków atmosferycznych, w tym
głównie ilości i rozkładu opadów. W 2012 roku odnotowano wyższą
sumę opadów niż w 2013 r., a ich korzystny rozkład spowodował, że
plon zielonej masy był istotnie statystycznie wyższy niż w 2013 roku.
Znacznym zróżnicowaniem cechuje się również plon suchej masy.
Istotnie większe plony suchej masy traw zaobserwowano w 2012 roku
niż w 2013 roku. Wielkość zebranych plonów okazała się w większym
stopniu zbieżna z sumą opadów obserwowanych miesiącach maj
i czerwiec. Istotnie większy plon kiszonki z traw odnotowano w roku
2012, który wynosił 57, 4 t∙ha-1. Natomiast plon kiszonki w 2013
roku kształtował się na poziomie 35 t∙ha-1.W badaniach nad reakcją
użytków zielonych na warunki pogodowe często stwierdza się silniejszy wpływ opadów na wzrost i plonowanie roślin niż temperatury
[Chmura i in. 2009]. Zmienność warunków pogodowych znalazła
odzwierciedlenie w plonowaniu badanych gatunków traw jak i w skutkach nawożenia azotem [Jankowski i Nowak 2001].
Plon świeżej masy zielonki z traw w zależności od poziomu nawożenia wahał się od 80 do 226 dt∙ha-1. (Rys. 1). Analiza statystyczna
otrzymanych rezultatów badań wykazała (F = 0,29; p = 0,91), że naj355
Paulina Topolińska, Magdalena Haak, Joanna Marć-Pieńkowska
Źródło: wyniki własne.
Rys. 1. Zmiany plonu świeżej masy badanych gatunków roślin w zależności
od poziomu nawożenia.
większy plon świeżej masy traw uzyskano w warunkach nawożenia
azotem na poziomie 200 kg∙ha-1.Uzyskane wyniki wykazały, że zwiększenie dawki nawożenia azotem z 50 do 100 kg·ha-1 nie miało istotnego wpływu na plonowanie traw, co potwierdziła wykonana analiza
statystyczna. Plony świeżej masy gatunku trawy mozgi trzcinowatej,
uprawianej na glebie V kompleksu przydatności rolniczej, przedstawione przez [Księżaka i Fabera 2007], były zbliżone do uzyskanych
w badaniach własnych i wynosiły średnio 146 dt/ha. O wykorzystaniu
traw do produkcji biogazu decyduje jednostkowa wydajności metanu
oraz plon biomasy. Jak podają Lemmer i Oechsner [2001], w odniesieniu do 1 kg suchej masy, produkcja metanu z biomasy pochodzącej
ze zbiorowisk trawiastych zlokalizowanych na obszarach chronionego
krajobrazu wynosi 0,08 m3, z kiszonki z runi łąkowej w warunkach
ekstensywnego użytkowania 0,22 m3, runi trawnikowej 0,26 m3, kiszonki z kukurydzy 0,30 m3, a kiszonki z traw w uprawie polowej 0,39
m3. Wyniki badań wskazują, że do produkcji biogazu najlepiej nadaje
się ruń z intensywnie użytkowanych czterokośnych łąk oraz zasiewów
traw na gruntach ornych [Benke 2006; Gröblinghoff i Lütke Entrup
2006; Gröblinghoff i in. 2007]. W tab. 4 zestawiono uzyskane wyniki
dotyczące wydajności oraz efektywności biogazu dla traw o różnym
stopniu nawożenia.
356
Wpływ dawek nawozów azotowych na wydajność pokosu łąkowego oraz produkcję biogazu
Tab. 4. Wydajność i efektywność produkcji biogazu dla traw
o różnym stopniu nawożenia
Wydajność Efektywność
metanu [N- metanu [N/m3]
m3] ∙ha-1
∙ha-1/kgN
Substrat
Biogaz
[dm3]
Wydajność
biogazu
[Nm3]∙ha-1
Kiszonka z traw 50N
Kiszonka z traw 100N
1,79
2,07
1369,8
1732,4
725,9
915,2
14,51
9,14
Kiszonka z traw 150N
2,3
2251,7
1352,1
9,14
Kiszonka z traw 200N
3,1
3035,1
1608,6
8,04
Źródło: wyniki własne.
Znacznym zróżnicowaniem cechuje się produktywność metanu.
Wydajność metanu dla dawki 50 N azotu kształtowała się na poziomie 725,9 [N-m3] ∙ha-1, natomiast dla dawki 200 N wynosiła 1608,6
9 [N-m3] ∙ha-1 . Według [Gröblingoffa i in.2007] produkcja metanu
z ha była większa niż w badaniach własnych i wynosiła 3000 [N-m3]
∙ha-1 .Zgodnie z oczekiwaniami zwiększone nawożenie azotem z 50 do
200 kg∙ha-1 przyczyniło się do wzrostu plonowania. Zależności te nie
potwierdziły się jednak w odniesieniu do efektywności metanu. Okazało się, że zbiór pokosu łąkowego w optymalnym terminie zwiększył
produkcję biogazu, natomiast wzrost dawki azotu był istotnym czynnikiem zmniejszającym jego efektywność (tab. 4).Na tej podstawie
można stwierdzić, że efektywną produkcję metanu z użytków zielonych można uzyskać w warunkach niskich dawek nawożenia azotem.
Największą efektywnością metanu cechowała się kiszonka z traw
nawożona azotem w dawce 50 kg∙ha-1 i wynosiła 14,51 [N-m3]∙ha-1 /
kg N (tab.4). Najmniejszą efektywnością metanu na poziomie 8,04 51
[N-m3]∙ha-1 /kg N cechował się substrat nawożony największa dawką
(200 kg∙ha-1) azotu. Podobne wyniki uzyskano przy nawożeniu azotem
zarówno w dawce 100 jak i 150 kg∙ha-1. Efektywność metanu stanowiła średnio 9,14 [N-m3]∙ha-1 /kg N na 1kg azotu (tab.4). W badaniach
Kacprzak i in. [2012] najmniejszą efektywnością metanu odznaczała
się również kiszonka z traw -mozgi trzcinowatej, nawożona azotem
w dawce 120 kg∙ha-1.
357
Paulina Topolińska, Magdalena Haak, Joanna Marć-Pieńkowska
Wnioski
Większy plon świeżej i suchej masy pokosu łąkowego wynoszący
odpowiednio 76, 6 dt ∙ha-1 i 28,6∙ t ha-1 uzyskano w 2012 roku niż
w kolejnych latach. Uzyskane rezultaty badań wskazują, że w warunkach gleb lekkich, czynnikiem decydującym o możliwości efektywnego
wykorzystania traw określonego gatunku do celów energetycznych,
będzie układ warunków pogodowych, które w istotnym stopniu wpływają na poziom plonowania traw. Największy plon świeżej masy traw
stanowiący odpowiednio 226 dt ∙ha-1 otrzymano w warunkach nawożenia azotem w dawce 200 kg N∙ha-1. Pomimo tego, że produktywność
metanu zwiększała się wraz z dawką nawożenia azotowego i wynosiła
od 725,9 do 1608,6, [N-m3]∙ha-1 /kg N nie odnotowano zwiększenia
efektywności metanu wraz ze wzrostem dawki azotu. Zanotowano
tendencję do zmniejszenia efektywności metanu z kiszonki z traw pod
wpływem zwiększenia nawożenia azotem z 14.51 do 8,04 [N-m3]∙ha-1
/kg N gdy dawka azotu wynosiła 200 kg N∙ha-1.Efektywniejszą produkcję metanu z ha kiszonek z traw zapewniło nawożenie najmniejszą
dawką azotu 50 kg N∙ha-1 niż nawożenie dawką 200 kg N∙ha-1.
Bibliografia
Bac S. Koźmiński C. Rojek M. 1993. Agrometeorologia. PWN. Warszawa.
Benke M. 2006. Erste Ergebnisse zum Anbau von Ackerfuttergräsern zur
Biogaserzeugung.GFP–Workshop „Futterpflanzen – Perspektiven für
die energetische Nutzung“,Freising,http://www.lfl.bayern.de/ipz/gruenland/18480.
Chmura K. Chylińska E. Dmowski Z. Nowak L. 2009. Rola czynnika wodnego w kształtowaniu plonu wybranych roślin polowych. Infrastruktura
i Ekologia Terenów Wiejskich. PAN Kraków, 9: 33-44.
Głaszczka A. Wardal W. J.Romaniuk W. Domasiewicz T. 2010. Biogazownie
rolnicze. Wydawnictwo. Multico. Warszawa.
Gröblinghoff F.F. Lütke Entrup N. 2006. Gräser in Biogasanlagen – erste Ergebnisse aus Nordrhein–Westfalen. GFP–Workshop „Futterpflanzen
–Perspektiven für die energetische Nutzung“, Freising, http://www.lfl.
bayern.de/ipz/gruenland/18480.
Gröblinghoff F.F Lütke Entrup N.Berendonik C. Clemens J. 2007. Biogaserzeugung mit kurzlebigen und ausdauernden Gräsern. Mitteilungen der
AGGF, 8:161-164.
358
Wpływ dawek nawozów azotowych na wydajność pokosu łąkowego oraz produkcję biogazu
Jankowski K. Nowak M.2001. Wpływ zróżnicowanych dawek azotu stosowanych dolistnie i doglebowo na wysokość plonowania łąki oraz
zawartość składników organicznych. Pamiętniki Puławskie, 125: 97–
101.
Kacsprzak A. Mtyka M. Krzystek L.Ledakowicz S.2012. Evaulation of biogas
colletion from reed canary Grass, depening on nitrogen fertilization
levels.Chemical and Process Enginering, 33: 697-701.
Księżak J. Faber A. 2007. Ocena możliwości pozyskania biomasy z mozgi
trzcinowatej na cele energetyczne. Łąkarstwo w Polsce,10:141-148.
Lemmer A. Oechsner H. 2001. Einsatz von Mähgut landwirtschaftlich nach
genutzten Flächen als Kosubstrat in landwirtschaftlichen Biogasanlagen. Tagungsband zur 5. Internationalen Tagung „Bau, Technik und
Umwelt in der landwirtschaftlichen Nutztierhaltung, Hohenheim,
398-401.
Ministerstwo Gospodarki 2010. Kierunki rozwoju biogazowni rolniczych
w Polsce w latach 2010-2020. Warszawa.
Oslaj M. Mursec B. Vindis P. 2010. Biogas production from maize hybrids.
Biomass and Bioenergy, 34: 1538-1545.
Sosnowski J. Jankowski K. 2010. Wpływ użyźniacza glebowego na skład
florystyczny i plonowanie mieszanek Festololium braunii z koniczyną
łąkową i lucerną mieszańcową. Wydawnictwo Łąkarstwo Polskie,
13:157– 166.
Adres do korespondencji:
mgr inż. Paulina Topolińska
Wydział Hodowli i Biologii Zwierząt
Zakład Żywienia Zwierząt i Gospodarki Paszowej
Uniwersytet Technologiczny Przyrodniczy w Bydgoszczy
ul. Mazowiecka 28, 85- 084 Bydgoszcz
e-mail: [email protected]
Opiekun naukowy: Prof. dr hab. inż. Jan Mikołajczak
359
Karolina Trzyniec
Karolina Wietnik
Maria Szczuka
Andrzej Ochrem
EPISTEME
22/2014, t. III
s. 361–368
ISSN 1895-2241
ROZMIESZCZENIE I OZNAKOWANIE URZĄDZEŃ
SYGNALIZACYJNYCH I STEROWNICZYCH
NA CIĄGNIKACH ROLNICZYCH, A ZALECENIA
NORM EUROPEJSKICH
THE LOCATION AND MARKING THE SIGNALING
AND CONTROL DEVICES OF FARM TRACTORS
IN RELATION TO EUROPEAN STANDARDS
Abstrakt. Artykuł prezentuje problem niedostosowania rozmieszczenia
i oznakowania urządzeń sygnalizacyjnych i sterowniczych na ciągnikach rolniczych, do zaleceń zawartych w normach europejskich. Analizę przeprowadzono na przykładach urządzeń sygnalizacyjnych i sterowniczych czterech
ciągników rolniczych marki Massey Ferguson, wykorzystując treści zawarte w dostępnych normach europejskich: PN-EN 894-1:1997, PN-EN 894-2
+ A1:2010P, PN-EN 80416-1:2006P, PN-EN ISO 9241-171:2008E, PN-EN
ISO 12100:2012P. Normy te, w różnym stopniu, definiują zasady ergonomicznego projektowania funkcji i symboli stosowanych na urządzeniach.
Takie projektowanie pozwala zmniejszyć ryzyko popełnienia błędu przez
operatora.
Słowa kluczowe: ciągnik rolniczy, urządzenia sygnalizacyjne i sterownicze
Summary. The article presents the unadjustedness problem of location and
marking the signaling and control devices of farm tractors to the recommendations contained in the European Standards. The analysis was performed on the examples of the signaling and control devices of four farm
tractors (produced by Massey Ferguson). There were used rules contained
in the available european standard: PN-EN 894-1:1997, PN-EN 894-2 +
A1:2010P, PN-EN 80416-1:2006P, PN-EN ISO 9241-171:2008E, PN-EN
ISO 12100:2012P. This standards, in different extend, define the rules of
function or symbol ergonomic designing. This ergonomic designing allows
to decrease the risk of operator’s mistake.
Key words: farm tractors, signaling and control devices,
361
Karolina Trzyniec, Karolina Wietnik, Maria Szczuka, Andrzej Ochrem
Wstęp
Sterowanie wszystkich nowoczesnych ciągników rolniczych opiera się
na sprawnej obsłudze urządzeń sterujących i przyrządów kontrolnych
(w tym także komputerów pokładowych) wchodzących w skład kabiny
pojazdu. Aby obsługa ta przebiegała sprawnie i bezbłędnie, niezbędne
jest zaprojektowanie wyglądu i rozmieszczenia wszystkich urządzeń
sygnalizacyjnych i sterowniczych zgodnie z kryteriami projektowania
ergonomicznego. Ergonomicznie zaprojektowane systemy pracy zwiększają bezpieczeństwo, polepszają warunki pracy ludzi oraz przeciwdziałają
niekorzystnym wpływom na ich zdrowie [PN-EN 614-1 + A1: 2009E].
Ponad to prawidłowo zaprojektowane stanowisko robocze (za które uznać
można również kabinę ciągnika rolniczego) pozwala na szybką i intuicyjną
obsługę, dzięki której zmniejsza się prawdopodobieństwo wystąpienia u
operatora nadmiernego wysiłku psychicznego, spowodowanego nadmiarem informacji lub stopniem ich zmienności i złożoności.
Aby ułatwić prawidłowe projektowanie urządzeń, maszyn i pojazdów, opracowano normy europejskie, dotyczące głównie jednorodności w projektowaniu i stosowaniu symboli graficznych, jednoznaczności w rozumieniu informacji przekazywanych operatorowi przez
urządzenia sygnalizacyjne oraz uwzględniania stereotypów obsługi
podobnych urządzeń, jakie wykształciły się podczas długotrwałej
pracy [Trzyniec i in. 2014].
Celem artykułu była analiza losowo wybranych przykładów symboli stosowanych w kokpitach ciągników rolniczych marki Massey
Ferguson oraz skonfrontowanie ich z zaleceniami zawartymi w normach europejskich.
Materiał i metody
Do analizy wybrano przykłady symboli zastosowanych w kokpitach
sterowniczych następujących ciągników rolniczych:
-Massey Ferguson serii 4400 (dotyczy modeli 4435-4445-4455)
-Massey Ferguson serii 5400 Dyna-4 (dotyczy modeli 5425-54355445-5455-5465 Dyna-4)
-Massey Ferguson serii 6400 (dotyczy modeli 6497-6499 Dyna-6)
-Massey Ferguson serii 8400 (dotyczy modeli 8450-8460-84708480).
362
Rozmieszczenie i oznakowanie urządzeń sygnalizacyjnych i sterowniczych...
Poszczególne modele wybranych serii różnią się przede wszystkim mocami maksymalnymi.
Wszystkie dane pozyskane zostały z instrukcji obsługi wybranych
ciągników rolniczych.
Zakres pracy obejmował analizę następujących norm europejskich:
- PN-EN 894-1:1997 Bezpieczeństwo maszyn -- Wymagania
ergonomiczne dotyczące projektowania wskaźników i elementów sterowniczych -- Część 1: Ogólne zasady interakcji między człowiekiem
a wskaźnikami i elementami sterowniczymi
- PN-EN 80416-1:2006P Podstawowe zasady dotyczące symboli
graficznych stosowanych na urządzeniach -- Część 1: Opracowywanie
oryginałów symboli
- PN-EN ISO 9241-171:2008E Ergonomia interakcji człowieka
i systemu -- Część 171: Wytyczne dotyczące przystępności oprogramowania
- PN-EN 894-2 + A1:2010P Bezpieczeństwo maszyn -- Wymagania ergonomiczne dotyczące projektowania wskaźników i elementów
sterowniczych -- Część 2: Wskaźniki
- PN-EN ISO 12100:2012P Bezpieczeństwo maszyn -- Ogólne
zasady projektowania -- Ocena ryzyka i zmniejszanie ryzyka.
Wyniki i dyskusja
Przeanalizowano wybrane symbole sygnalizujące poszczególne funkcje ciągnika. Poniżej zaprezentowano przykłady niedostosowania
oznaczeń tych funkcji do zaleceń zawartych w normach europejskich.
Rycina pierwsza przedstawia sposób sygnalizowania awarii
w ciągnikach Massey Ferguson serii 4400 i 5400. Oznaczenia użyte na
lampkach kontrolnych znacząco się różnią, nie są spójne i jednoznaczne. Nie uwzględniają również stereotypu obsługi wypracowanego
u operatora jednej z tych maszyn, tak więc przeczą zaleceniom norm
PN-EN 894-1:1997 oraz PN-EN 80416-1:2006P.
Kontrolka oznaczona na rycinie drugiej numerem 3 odpowiada
za sygnalizację niedrożności filtra olejowego wysokiego ciśnienia
w ciągniku Massey Ferguson serii 8400. W jednej z poprzednich serii
tego ciągnika – 6400, zastosowano to samo oznaczenie na kontrolce,
363
Karolina Trzyniec, Karolina Wietnik, Maria Szczuka, Andrzej Ochrem
[źródło: opracowanie własne, na podstawie instrukcji obsługi]
Ryc. 1. Różne rodzaje oznaczeń lampek kontrolnych odpowiadających
za sygnalizację awarii
[źródło: opracowanie własne, na podstawie instrukcji obsługi]
Ryc. 2. Różnice w zastosowaniu oznaczenia jednej z lampek kontrolnych
w dwóch różnych modelach ciągników rolniczych
364
Rozmieszczenie i oznakowanie urządzeń sygnalizacyjnych i sterowniczych...
która nie jest w tym ciągniku używana. Zgodnie z normą PN-EN
ISO 12100:2012P, opracowanej na podstawie norm: PN-EN 614-1,
PN-EN 13861, IEC 61310-1, wszystkie oznaczenia powinny być nie
tylko łatwo zauważalne, ale również jednoznaczne i umożliwiające
współdziałanie między operatorem i maszyną. W sytuacji, w której
zamontowana kontrolka nie ma żadnego zastosowania, powinno się
unikać stosowania na niej jakichkolwiek symboli, w celu ograniczenia
możliwości powstawania błędów sterowniczych.
[źródło: opracowanie własne, na podstawie instrukcji obsługi]
Ryc. 3. Fragment kokpitu sterowniczego odpowiedzialnego za ruch pojazdu
Przycisk oznaczony numerem 12 (ryc. 3) odpowiada za regulację
jazdy. Jednak skrót literowy zastosowany na przycisku – ESC, kojarzony jest jednoznacznie z procedurą wyjścia z danej funkcji (na wielu
różnych urządzeniach). Zastosowanie takiego oznaczenia przeczy
zaleceniom Normy PN-EN ISO 9241-171:2008E o projektowaniu
symboli i oznaczeń jednoznacznie zrozumiałych dla operatorów.
Podsumowanie i wnioski
Nowoczesne ciągniki rolnicze powinny być obsługiwane z zapewnieniem bezpieczeństwa oraz wyeliminowaniem możliwości strat czasu
[PN-EN ISO 12100:2012P]. Możliwe jest to tylko i wyłącznie wówczas, gdy obsługa różnych pojazdów i maszyn rolniczych umożliwiać
będzie postępowanie operatora zgodne z wyuczonymi przez niego
stereotypami [Juliszewski i in. 2012]. W przeciwnym razie, operator
narażony będzie na zmęczenie psychiczne objawiające się wyczerpa365
Karolina Trzyniec, Karolina Wietnik, Maria Szczuka, Andrzej Ochrem
niem zasobów energetycznych, zaburzeniami czynności percepcyjnych
czy zmniejszeniem koncentracji uwagi, a w konsekwencji prowadzące
do spadku jego (tj. operatora) zdolności do pracy [Wykowska 2009].
Analiza rozmieszczenia urządzeń sterowniczych wykazała zgodność z Normą PN-EN 894-2 + A1:2010P – większość istotnych urządzeń znajduje się w zakresie widzenia dokładnego [Wykowska 1994].
Jednak wykazane w artykule różnice w oznaczeniach, a co za tym
idzie, w procedurach obsługi urządzeń sygnalizacyjnych i sterowniczych w ciągnikach rolniczych tego samego producenta powodują
problem niekompatybilności (umowne kody przekazu informacji są
różne) w układzie człowiek - urządzenie techniczne. Niekompatybilność tego układu powoduje problem wydłużania się czasu obsługi oraz
zwiększenia liczby popełnianych błędów. Zaleca się zatem stosowanie
wskazówek i instrukcji zawartych w normach europejskich, w projektowaniu wszystkich składowych urządzeń wchodzących w skład
kabiny każdego ciągnika rolniczego.
Bibliografia:
Juliszewski T., Kiełbasa P., Trzyniec K. 2012. Procedury obsługi urządzeń sygnalizacyjnych i sterowniczych wybranych maszyn rolniczych. Inżynieria Rolnicza. Nr 4 (139). s. 109-122
PN-EN 894-1:1997. Bezpieczeństwo maszyn -- Wymagania ergonomiczne
dotyczące projektowania wskaźników i elementów sterowniczych -Część 1: Ogólne zasady interakcji między człowiekiem a wskaźnikami
i elementami sterowniczymi. Polski Komitet Normalizacyjny
PN-EN 80416-1:2006P. Podstawowe zasady dotyczące symboli graficznych
stosowanych na urządzeniach -- Część 1: Opracowywanie oryginałów
symboli. Polski Komitet Normalizacyjny
PN-EN ISO 9241-171:2008E. Ergonomia interakcji człowieka i systemu -Część 171: Wytyczne dotyczące przystępności oprogramowania. Polski
Komitet Normalizacyjny
PN-EN 614-1 + A1: 2009E. Bezpieczeństwo maszyn -- Ergonomiczne zasady
projektowania -- Część 1: Terminologia i wytyczne ogólne. Polski Komitet Normalizacyjny
PN-EN 614-2 + A1:2010P. Bezpieczeństwo maszyn -- Ergonomiczne zasady
projektowania -- Część 2: Interakcje między projektowaniem maszyn
a zadaniami roboczymi. Polski Komitet Normalizacyjny
366
Rozmieszczenie i oznakowanie urządzeń sygnalizacyjnych i sterowniczych...
PN-EN 894-2 + A1:2010P. Bezpieczeństwo maszyn -- Wymagania ergonomiczne dotyczące projektowania wskaźników i elementów sterowniczych -- Część 2: Wskaźniki. Polski Komitet Normalizacyjny
PN-EN ISO 12100:2012P. Bezpieczeństwo maszyn -- Ogólne zasady projektowania -- Ocena ryzyka i zmniejszanie ryzyka. Polski Komitet Normalizacyjny
Wykowska M. 1994. Ergonomia. Wydawnictwa AGH. Kraków. s.39-42.
Wykowska M. 2009. Ergonomia jako nauka stosowana. Uczelniane Wydawnictwa Naukowo-Dydaktyczne. Kraków. s.258-261.
Trzyniec K., Juliszewski T., Kowalewski A. 2014. Symbols of encoding information on signaling and control devices of tractors and agricultural
machinery. Journal of Research and Applications in Agricultural Engineering. – przyjęte do druku
367
Karolina Trzyniec, Karolina Wietnik, Maria Szczuka, Andrzej Ochrem
Adres do korespondencji:
Karolina Trzyniec
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Inżynierii Produkcji i Energetyki
Instytut Eksploatacji Maszyn
Ergonomii i Procesów Produkcyjnych
ul. Balicka 116B
30-149 Kraków
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. inż. Tadeusz Juliszewski
Karolina Wietnik
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Ogrodniczy
Katedra Dendrologii i Architektury Krajobrazu
e-mail: [email protected]
Maria Szczuka
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Inżynierii Produkcji i Energetyki
Instytut Inżynierii Rolniczej i Informatyki
e-mail: [email protected]
Andrzej Ochrem
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
Wydział Hodowli i Biologii Zwierząt
Katedra Hodowli Bydła
e-mail: [email protected]
368
Katarzyna Wajdzik
EPISTEME
22/2014, t. III
s. 369–378
ISSN 1895-2241
ANALIZA KARIOLOGICZNA FESTUCA DURIUSCULA
L. ZE SKOROCIC
THE KARYOTYPE ANALYSIS OF FESTUCA DURIUSCULA
L. FROM SKOROCICE
Abstrakt. Okazy Festuca duriuscula pochodziły z obszaru skalno-stepowego Skorocice k. Buska Zdroju, z trzech siedlisk: łąka, murawa kserotermiczna i skała gipsowa. Analizę kariologiczną wykonano w oparciu
o metodę Feulgena i barwienie C-prążków. U badanego gatunku stwierdzono występowanie 3 liczb chromosomów: 2n=14, 2n=21 i 2n=28. Diploidalna
liczba 2n=14 występowała u roślin zebranych ze wszystkich 3 siedlisk. Liczba triploidalna 2n=21 charakterystyczna była dla roślin zebranych z murawy i skały gipsowej, nie odnotowano jej u roślin łąkowych. Z kolei liczbę
tetraploidalną 2n=28 zaobserwowano tylko u roślin zebranych z łąki i murawy. Zmiana w obrębie kariotypu może być związana z przystosowaniem do
różnych, zmiennych warunków środowiska, kształtowanych zarówno przez
czynniki biotyczne jak i abiotyczne. Uwzględniając charakterystykę kariotypu należy zastanowić się nad filogenetyczną drogą prowadzącą do powstania zróżnicowania liczb chromosomów w obrębie tego gatunku.
Słowa kluczowe: Festuca duriuscula L., kariotyp, genom, Skorocice, C-prążki
Abstract. The species of Festuca duriuscula L. from the reserve rock and
steppe Skorocice near Busko Zdrój (Poland) were studied. Plants came from
three habitats: meadow, turf grasslands and rock gypsum. The analysis of
karyotype was conducted by using Feulgens’ and C-banding methods. Three
karyological chromosome numbers were found: 2n=14, 2n=21 and 2n=28.
Diploid chromosome number 2n=14 was observed in plants collected from
all three habitats. Triploid chromosome number 2n=21 was typical for
plants collected from turf xerothermic and gypsum rock, but not for herbage. On the other hand, the somatic tetraploid chromosome number 2n=28
occured in meadow plants and turf, but no in rock plants. The rearrangements within the karyotype could be associated with adaptation to changing environmental conditions caused by various biotic and abiotic factors.
Based on karyotype characteristic, it is worthly to consider the path leading
to the diversity in chromosome numbers within F. duriuscula L.
Key words: Festuca duriuscula L., karyotype, genome, C-banding, Skorocice
369
Katarzyna Wajdzik
Wstęp
Trawy (Poaceae) z rodzaju Festuca (Kostrzewa) od dawna cieszą
się sporym zainteresowaniem w śród badaczy, ponieważ rodzaj ten
charakteryzuje się dużą zmiennością morfologiczną (450 gatunków)
i zmiennością występowania [Falkowski 1982, Markgraf–Dannenberg
1980, Frey 1973, Zwierzykowski i Naganowska 1996]. Falkowski
[1982] klasyfikuje rośliny z rodzaju Festuca na trzy sekcje o charakterze podrodzaju: Bovinae, Montanae oraz Ovinae. Analizowany w tej
pracy gatunek należy do podsekcji Ovinae.
Festuca duriuscula stanowi jeden z nielicznych gatunków traw Polski, u których stwierdzono zmienną liczbę chromosomów. Identyfikacja
danego taksonu oraz ewentualnego bliskiego pokrewieństwa z innym
gatunkiem, czy wykazanie polimorfizmu kariotypu, możliwe jest dzięki
wnikliwej analizie morfologicznej, anatomicznej i cytologicznej [Frey
1973, Joachimiak i Kula 2007]. Większość gatunków z rodzaju Festuca,
posiada podstawową liczbę chromosomów x=7, do rzadkości należą
gatunki o liczbie x=5, 6 lub 11 [Markgraf-Dannenberg 1980; Falkowski
1982; Sheidai i in. 2007]. Według wymienionych źródeł liczba chromosomów waha się od 2n=14 do 2n=70. Stwierdzono występowanie
gatunków diploidalnych o liczbie 2n=2x=14, tetraploidalnych 2n=4x=28
[Prokudin 1977], heksaploidalnych 2n=6x=42 [Bolkhovskikh 1969.;
Moore 1973; Auquier i Rammeloo 1973], oktoploidalnych 2n=8x=56
oraz dekaploidalnych 2n=10x=70 [Frey 1973; Falkowski 1982; Mizianty
i Pawlus 1984, Zwierzykowski i Naganowska 1996; Sheidai i in. 2007].
Z terenów Europy zidentyfikowano także rośliny o liczbie 2n=21, 2n=49
[Watson 1956], a nawet 2n=170 [Bolkhovskikh 1969].
W Dolinie Nidy Festuca duriuscula jest trawą o charakterze kserotermicznym, spotyka się ją głownie na wzgórkach gipsowych i wapiennych, głównie w rezerwatach: Skowronno Dolne, Skorocice, Stawiany,
Prześlin, Winary Zagojskie, Winiary i Wymysłów [Łuszczyńska 1998,
2001]. Urozmaicona rzeźba terenu wpływa na zróżnicowanie siedlisk
i zbiorowisk roślinnych [Medwecka-Kornaś 1959]. Badane okazy na
łące tworzą liczne, duże kępy roślin. Mają dorodniejsze liście i łodygi.
Murawa kserotermiczna porośnięta jest nielicznymi kępami F. duriuscula L., ale trawa rośnie w skupiskach. W stosunku do roślin z łąki
okazy te są średniej wielkości. Na skale gipsowej towarzyszą małe,
drobne rośliny, które zawsze występują pojedynczo.
370
Analiza kariologiczna festuca duriuscula l. Ze skorocic
W oparciu o analizę kariologiczną podjęto próbę ustalenia liczby
chromosomów, lokalizację heterochromatyny oraz powiązania liczb
chromosomów z odpowiednim siedliskiem i wykazanie ewentualnego
polimorfizmu kariotypu.
Materiał i metody
Przedmiotem badań były rośliny z gatunku Festuca duriuscula L.
z rezerwatu skalno-stepowego Skorocice, pochodzące z 3 siedlisk:
łąka, murawa kserotermiczna i skała gipsowa. Ustalenie somatycznej
liczby chromosomów i struktury kariotypu dokonano na podstawie analizy płytek metafazowych sporządzonych z merystemów
wierzchołkowych korzeni roślin rosnących w doniczkach. Materiał
barwiono metodą Feulgena z odczynnikiem Schiff’a w celu ustalenia
liczby i morfologii chromosomów, uwzględniając długość całkowitą
chromosomu, indeks ramion, długość chromosomu w %. Metoda
C-prążków z odczynnikiem Giemsy uwidacznia heterochromatynę
konstytutywną [Joachimiak i Kula 2007, Olszewska 2012]. Budowę
kariotypu oraz obrazy graficzne chromosomów przedstawiono przy
użyciu programu Mr Karyo wer. 3.10.
Wyniki
Metoda Feulgena wykazała występowanie zróżnicowanej liczby chromosomów w analizowanych okazach Festuca duriuscula zebranych
w Skorocicach (ryc.1). Diploidalną liczbę chromosomów 2n=14 odnotowano w płytkach metafazowych roślin zebranych ze wszystkich
trzech siedlisk. W tym garniturze chromosomowym wyróżniono 6
par chromosomów prawie metacentrycznych (nomenklatura za Levan
i in. 1964; Olszewska 2012) oraz 1 parę chromosomów SAT (z przewężeniem wtórnym). Liczba 2n=21 obecna była u roślin z murawy
naskalnej oraz skały gipsowej. W oparciu o dokładną analizę kariologiczną wyróżniono 7 par (14 chromosomów) o identycznej morfologii
jak w płytkach 2n=14. Pozostałe 7 chromosomów nie miało swoich
homologów - oznaczono je numerami 1’-7’, przy czym 1 chromosom
był metacentryczny (M), a pozostałe 6 prawie metacentryczne (m).
W tym zespole nie zidentyfikowano chromosomów SAT (ryc. 3b).
371
Katarzyna Wajdzik
Dla roślin zebranych z łąki i murawy kserotermicznej ustalono liczbę
chromosomów 2n=28 identyfikując 13 par chromosomów jako prawie
metacentrycznych i 1 parę-SAT (ryc. 3b, 3ab).
Barwienie różnicujące C-prążków heterochromatynowych
na chromosomach z płytek metafazowych roślin zebranych ze wszystkich siedlisk, pozwoliło na wyróżnienie dwóch grup chromosomów
(genomy D i E) różniących się wzorami prążkowymi (ryc. 2). Każda z grup zawierała 14 chromosomów (7 par) z prawie identyczną
dystrybucją heterochromatyny w każdej parze. W obu genomach
zidentyfikowano heterochromatynę telomeryczną, centromeryczną
i interkalarną. Niemniej polimorfizm dotyczył jedynie zawartości
heterochromatyny (ryc. 3 i 4).
Grupa chromosomów (typ 1-7) określana jako genom D, charakterystyczna była zarówno dla roślin o diploidalnej liczbie 2n=14, jak
również 2n=21 jak i 2n=28 (ryc.3, tab.1 ).
Grupę chromosomów, z układem prążków oznaczonym jako typ
1’-7’ określono jako genom E. Był on charakterystyczny tylko dla
roślin o liczbie 2n=21 (ryc.4 c,4d) i 2n=28 (ryc. 4 a,4b). U okazów o
kariotypie 2n=28 chromosomy stanowiące genom E tworzyły 7 par,
natomiast u roślin o liczbie 2n=21 chromosomy te występowały pojedynczo bez swoich homologów.
Ryc. 1. Festuca duriuscula L.-płytki
metafazowe barwione metodą Feulgena: a) 2n=14 (DD); łąka; b) 2n=21
(DDE); skała; c) 2n=28 (DDEE);
murwa
372
Ryc. 2. Festuca duriuscula L.-płytki
metafazowe barwione metodą
C-prążków : a) 2n=14 (DD); łaka;
b) 2n=21(DDE); murwa c) 2n=21
(DDE); skała; d) 2n=28 (DDEE);
murwawa
M
m
m
m
m
m
m
1’
2’
3’
4’
5’
6’
7’
--------------------------------------------------------
4,29% - 5,61%
------------
5,49% - 21,4%
-------------------------------------------------------5,6%-9%
interkalarnej
--------------------------------------------3,59% - 6,31%
------------
------------
5,49% -11%
-----------9,36%-22,12%
17,97% - 32,86%
14,81% - 16,95%
10,03% - 15,15%
16,47% - 23,14%
18,09% - 23,7%
8,58% - 15,18%
Genom D
-----------7,14% - 22,12%
16,86% - 24,85%
16,67% - 23,67%
7,01% -24,82%
10,38% - 22,66%
5,48% - 12,73%
Genom E
18% -35,75%
Zawartość heterochromatyny:
centromerycznej
telomerycznej
Oba ramiona
HT ramię długie, HT: ramię krótkie
Tylko w genomie E
Oba ramiona
Oba ramiona
Ramię długie
Oba ramiona
HT: oba ramiona
Ram. długie, tylko w genomie D
Ram. długie, tylko w genomie D
Oba ramiona
Oba ramiona
Oba ramiona
Ramię długie
Ram. długie, tylko w genomie D
Uwagi
* Typy morfologiczne chromosomów (M-metacentryczny, m-prawie metacentryczny) wyróżniono na podstawie publikacji Levan i
in. [1964] i Olszewskiej [2012]
m
m
SAT
m
m
m
m
1
2
3
4
5
6
7
Typ chromosomu*
Tab.1. Procentowa zawartość heterochromatyny w poszczególnych typach chromosomów z genomu D i E w płytkach
metafazowych Festuca duriuscula L, po barwieniu odczynnikiem Giemsy (C-prążki).
Analiza kariologiczna festuca duriuscula l. Ze skorocic
373
Katarzyna Wajdzik
Ryc.3. Idiogramy dla typów chromosomów 1-7 (7 par)- genom D
zidentyfikowany u roślin F. duriuscula L.: a) 2n=14, s. łąka b) 2n=28,
s. murawa c) 2n=21, s. skała.
Ryc.4. Idiogramy dla typów chromosomów 1’-7’ (genom E) zidentyfikowany
roślin F. duriuscula L. w kariotypach 2n=28 występujące jako siedem par:
a) 2n=28, s. łąka b) 2n=28, s. murawa kserotermiczna oraz chromosomy
bez swojego homologu w garniturze 2n=21: c) 2n=21, s. murawa d) 2n=21,
s. skała.
Dyskusja
Garnitur 14-sto chromosomowy określony, jako genom DD jest charakterystyczny dla płytek wszystkich trzech kariotypów (2n=14,
2n=21, 2n=28) ze wszystkich siedlisk. U okazów F. duriuscula L. 2n=
21 oprócz 14 chromosomów zaliczanych do genomu D, stwierdzono
obecność 7 chromosomów z genomu E (pełny genotyp DDE). Natomiast rośliny F. duriuscula L. 2n=28 posiadają dwa genomy: zarówno D
374
Analiza kariologiczna festuca duriuscula l. Ze skorocic
i genom E (genotyp DDEE) (ryc.3 a,b,c). Podobne zjawisko zauważono
u bawełny Gossypium hirsutum L. o kariotypie 2n=4x=52 i składzie
genomu CCDD, gdzie genom C pochodzi z G. herbaceum L., a dawcą
genomu D jest tu G.raimondii L. [Olszewska 2012]. Podobne wyniki
otrzymano w badaniach nad pięcioma populacjami Calamagrostis,
gdzie przypuszczalnie jedna populacja, C. hartmaniana niejasnego
pochodzenia, jest mieszańcem (C. canesccens x C. arundinacea). Badania te wykazały również obecność wspólnego genomu [Krawczyk,
Paszko 2005].
Prześledzenie przebiegu mejozy u naturalnych poliploidów, umożliwia dokładne rozpoznanie zachowania się różnych genomów danego
poliploida w sytuacji braku genomów do nich homologicznych [Joachimiak i Kula 2007]. Uwzględniając charakterystykę kariotypu należy
zastanowić się nad procesami mikroewolucyjnymi prowadzącymi do
powstania zróżnicowania liczb w obrębie F. duriuscula L. Obecność
dwóch różnych genomów (D i E) wyklucza drogę autopoliploidyzacji.
Falkowski [1982] zakłada możliwość powstania mieszańców międzyrodzajowych (Lolium perenne L. x Festuca sp.); na tej podstawie podjęto
próbę odtworzenia powstania roślin o 2n=21 i 2n=28. Można zasugerować pogląd, że okazy o kariotypie 2n=21, 2n=28 są alloploidami,
gdzie genom D pochodzi od F. duriuscula L., a dawcą genomu E jest
L. perenne L., która występuje w bezpośrednim sąsiedztwie. Wg Falkowskiego [1982] rośliny o kariotypie 2n=21 są w większości sterylne.
Na dalszej drodze autopoliploidyzacji mogłoby dojść do powstania,
F.duriuscula L. 2n=42. Taka liczba chromosomów dla F.duriuscula L.
podawana jest z terenów Rosji, Belgii i Francji [Bolkhovskikh 1969;
Auquier i Rammeloo 1973].W stanie naturalnym trawy z kompleksu
Lolium sp. i Festuca łatwo się krzyżują i tworzą szeregi poliploidalne
od diploidów, np. F. pratensis 2n=2x=14, poprzez tetraploidy do F.
arundinacea 2n= 6x=42, aż do dekaploidów 2n=10x=70) [Zwierzykowski 1996, Zwierzykowski, Naganowska 1996, Zwierzykowski i in.
2006; Kopecký 2006; Sheidai i in. 2007].
Zmiana w obrębie kariotypu może być związana z przystosowaniem do różnych warunków środowiska, zmiennych czynników
biotycznych jak i abiotycznych. F. duriuscula w rezerwacie Skorocice
występuje na 3 różnych siedliskach. Na łące tworzy gęste dorodne
kępy, które porastają bardzo licznie całą łąkę. Murawa kserotermiczna,
375
Katarzyna Wajdzik
porośnięta jest również dużą ilością kęp, jednak w stosunku do łąki
nie są tak liczne, a rośliny są mniej dorodne. Skała gipsowa stwarza
najbardziej ekstremalne warunki do życia, jednak i tam występują
pojedyncze rośliny F. duriuscula L., które są małe i nigdy nie tworzą
skupisk. Należy dodać, że dopiero dokładna analiza kariologiczna
Lolium perenne L. oraz analiza przebiegu koniugacji chromosomów
w mejozie u F. duriuscula L. o 2n=21 i 2n=28 pozwoli na weryfikację
powyższych hipotez.
Wnioski
1.U gatunku Festuca duriuscula L. stwierdzono występowanie trzech
liczb chromosomów (2n=14=DD ze wszystkich siedlisk, 2n=21=DDE
z murawy i skały gipsowej, 2n=28=DDEE z łąki i murawy) 2.Stwierdzona obecność dwóch różnych genomów (D i E) wyklucza drogę
autopoliploidyzacji. 3. Można zasugerować pogląd, że okazy o kariotypach 2n=21, i 2n=28 są alloploidami, gdzie genom D pochodzi od
Festuca duriuscula L., a dawcą genomu E jest Lolium perenne L., która
występuje w bezpośrednim sąsiedztwie.
Serdeczne podziękowanie dla Pani Doktor Marii Drewniak, za
cenne uwagi oraz okazaną pomoc przy realizacji niniejszej pracy.
Bibliografia
Auquier P., Rammeloo J. 1973. Nombers chromosomiques dans le genre
Festuca en Belgique et dans les régions limitrophes. Bull. Soc. Roy. Bot.
Belg. 106, 317-328.
Bolkhovskikh Z. 1969. Chromosome numbers of flowering plants. Leningrad, Izd. Nauka, 926.
Falkowski M. 1982. Trawy polskie. PWN, Warszawa, 565.
Frey L. 1973. Niektóre problem kariologii i systematyki traw w Polsce. Wiadomości Botaniczne. XVII (3). PWN, Kraków.
Joachimiak A, Kula A. 2007. Cytogenetyka Traw. [W:] Księga Polskich Traw.
Ludwik Frey. Instytut Botaniki PAN im. W. Szafera, Kraków 2007, 109-128.
Kopecký D. Loureiro J., Zwierzykowski Z., Ghesquière M., Doležel J. 2006.
Genome constitution and evolution in Lolium×Festuca hybrid cultivars (Festulolium). TAG, 113 (4), 731-742.
376
Analiza kariologiczna festuca duriuscula l. Ze skorocic
Krawczyk J, Paszko B., 2005. Culm structure of selected Calamagrostis species [W:] Biology of grasses. Frey L. (ed.) W. Szafer Institute of Botany.
235-244.
Levan A., Fredga K., Sandberg A.A. 1964. Nomenclature for centromeric position on chromosomes. Institute of Genetics, Lund, Sweden, Roswell
Park Memorial Institute, 201-220.
Łuszczyńska B. 1998. Kserotermiczna flora naczyniowa wybranych regionów
Niecko Nidziańskiej (Garb Pińczowski, Płaskowyż Szaniecki, wschodnia
część Niecki Sołeckiej). Fragm. Flor. Geobot. Ser. Pol. 5. 55-87.
Łuszczyńska B. 2001. Disstribution of Festuca ovina group (Poaceae) species
in the xerothermic communities of the Pińczów Hump and adjacent
areas (southern Poland). [W:] Studies on grasses in Poland. Ludwik
Frey (ed). Szafer Institute of Botany, Polish Academy of Sciences,
Kraków. 201-209.
Markgraf-Dannenberg I. 1980. Festuca L.- Flora Europea. 5. Alismataceae
to Orchidaceae (Monocotyledones). Univ. Press, Cambridge. 125-153
Medwecka-Kornaś A. 1959. Roślinność rezerwatu stepowego Skorocice
koło Buska. Ochrona Przyrody. 26. 172-251.
Mizianty M., Pawlus M. 1984. Chromosome numbers of some Polish species
from the genus Festuca L., group ovina. Part I. Fragm. Flor. Geobot. 28
(1982): 363-369.
Moore R. J. 1973. Index to plant chromosome numbers 1967-1971. Regn.
Veg. 90: 1-539.
Olszewska M. 2012. Podstawy cytogenetyki roślin. PWN, Warszawa.
Prokudin Y. 1977. Grasses of the Ukraine. Naukova Dumka, Kiev. 518. (in
Russian)
Sheidai. M, Sadat E., Shabestarei B. 2007. Cytotaxonomy of some Festuca
species and populations in Iran. Acta Bot. Croat. 66 (2): 143–151.
Watson P. 1956. Thedistribution in Britain of diploid and tetraploid races
within the Festuca ovina group. The New Phytologist. Vol.57. Blackwell
Scientific Publications, Oxford.
Zwierzykowski Z. 1996. Interspecyfic and intergeneric hybrids of the Lolium-Festuca complex obtained in Poland in the years 1964-1994 and
maintained in the collection at the Institute of Plant Genetics in Poznań. Review article. J. Appl. Genet. 37(1): 79-100.
Zwierzykowski Z., Kosmala A., Zwierzykowska E., Jones N., Jokś W., Bocianowski J.2006. Genome balance in six successive generations of the allotetraploid Festuca pratensis×Lolium perenne. TAG. 113, (3). 539-547.
Zwierzykowski Z., Naganowska B. 1996. Taxonomy, cytogenetics and phylogenetic relationships in the Lolium-Festuca complex (Poaceae).
Fragm. Flor. Geobot. 41 (2): 521-523.
377
Katarzyna Wajdzik
Adres do korespondencji:
mgr Katarzyna Wajdzik
Zakład Biologii Komórki i Genetyki
Instytut Biologii Uniwersytetu Pedagogicznego w Krakowie
e-mail: [email protected]
Promotor: Prof. dr hab. Maria Wędzony
378
Katarzyna Wolny–Koładka
EPISTEME
22/2014, t. III
s. 379–386
ISSN 1895-2241
Występowanie alternariozy ziemniaka
w Małopolsce i rola chrząszczy stonki
ziemniaczanej w jej rozprzestrzenianiu –
badania wstępne
The occurrence of potato alternariosis
in the Lesser Poland and Colorado potato
beetles role in proliferation – preliminary
study
Abstrakt. Celem przeprowadzonych badań było zarówno określenie nasilenia występowania grzybów z rodzaju Alternaria na uprawach ziemniaka jak
i ocena ich zróżnicowania gatunkowego. Dodatkowo, przeprowadzone analizy miały odpowiedzieć na pytanie, czy stonka ziemniaczana może uczestniczyć w rozprzestrzenianiu się alternariozy. Liście ziemniaków z objawami
porażenia pobierane były z terenu 7 powiatów znajdujących się w Małopolsce. Równocześnie odławiano chrząszcze Leptinotarsa decemlineata pokolenia letniego bytujące na roślinach. Szczepy Alternaria spp. wyizolowane
z porażonych liści oraz z powierzchni chrząszczy, policzono oraz zidentyfikowano. Na podstawie badań stwierdzono, że ziemniaki były porażone
grzybami z rodzaju Alternaria w 83%, (w tym 85% stanowił gatunek A. alternata). Ponadto, 58% badanych chrząszczy było zasiedlonych przez Alternaria spp., z czego 90% izolatów stanowił gatunek A. alternata.
Słowa kluczowe: Alternaria alternata, Alternaria solani, ziemniak, stonka
ziemniaczana
Summary. The aim of the study was to determine the severity of Alternaria fungi on potato crops and the assessment of their species diversity.
Moreover, the analyzes aimed a evaluation whether Colorado potato beetle
can be involved in the spreading of alternariosis. Infected potatoe leaves
were collected from 7 poviats located in the Malopolska Region. At the same
time, summer generation beetles of the Leptinotarsa decemlineata species
379
Katarzyna Wolny – Koładka
dwelling on plants were collected. Alternaria spp. strains isolated from the
infected leaves and from the surface of beetles were counted and identified.
The survey revealed that 83% of the potato plants were infected by fungi of
the genus Alternaria, (of which 85% was identified as A. alternata). Furthermore, 58% of the beetles were colonized by Alternaria spp, of which 90% of
isolates represented the A. alternata species.
Key words: Alternaria alternata, Alternaria solani, potato, Colorado potato
beetle
Wstęp
Grzyby z rodzaju Alternaria i choroby przez nie wywoływane z roku
na rok budzą coraz większy niepokój. Alternarioza jest jedną z najgroźniejszych chorób roślin okopowych, ponieważ przyczynia sie do
obniżenia plonu i powoduje wymierne straty ekonomiczne. Występowanie sprzyjających dla rozwoju alternariozy warunków klimatycznych, powszechnej uprawy ziemniaków, a zwłaszcza powiększania
areału upraw odmian bardzo wczesnych i wczesnych powoduje wzrastające znaczenie tej choroby [Osowski i Bernat 2009]. A. alternata
jest sprawcą brunatnej plamistości liści, a A. solani powoduje suchą
plamistość liści ziemniaka. W początkowej fazie choroby makroskopowo można ocenić, który z gatunków jest powodem infekcji.
W miarę rozwoju alternariozy na roślinie nie jest to już możliwe
i dlatego występowanie grzybów z rodzaju Alternaria ocenia się na
ziemniakach łącznie. Gatunki grzyba A. alternata i A. solani różnią się
morfologicznie m.in. pigmentacją grzybni, tempem wzrostu na podłożach mikrobiologicznych, budową zarodników oraz wymaganiami
temperaturowymi [Kapsa 2007].
Obecnie wiemy, że źródłem choroby są pozostawione na polu
resztki pożniwne, sterty odpadowe i zainfekowane bulwy użyte do
sadzenia. Grzyby mogą być także przenoszone przez wiatr i wodę
[Zych 2005], możliwe jednak, iż dzięki podjętym badaniom poznamy
inną drogę ekspansji Alternaria spp. z udziałem owadzich wektorów.
Mając na uwadze jak istotną rolę w rolnictwie odgrywają grzyby
z rodzaju Alternaria, przeprowadzono badania mające na celu określenie nasilenia ich występowania na uprawach ziemniaka znajdujących
się na obszarze 7 powiatów w Małopolsce oraz oceny zróżnicowania
380
Występowanie alternariozy ziemniaka w Małopolsce i rola chrząszczy stonki ziemniaczanej...
gatunkowego. Ponadto, próbowano stwierdzić czy chrząszcze stonki
ziemniaczanej mogą być wektorami rozprzestrzeniania sie alternariozy. Ważnym aspektem poznawczym było zbadanie roli stonki
ziemniaczanej w przenoszeniu grzybni i zarodników Alternaria spp.
Materiał i metody
Zbiór materiału badawczego prowadzony był na obszarze województwa małopolskiego w powiatach: wielickim, brzeskim, proszowickim,
tarnowskim, limanowskim, miechowskim i oświęcimskim. Analizy
prowadzono w sezonie wegetacyjnym w roku 2012, w okresie czerwiec – sierpień. Do badań pobierano zielone, nadziemne części roślin posiadające symptomatyczne objawy alternariozy bezpośrednio
do jałowych woreczków i transportowano do laboratorium celem
przeprowadzenia izolacji Alternaria spp. Równocześnie odławiano
chrząszcze stonki ziemniaczanej, pokolenia letniego, bytujące na
roślinach. Chrząszcze zbierano do jałowych pojemników i podobnie
jak fragmenty liści niezwłocznie przewożono do laboratorium celem
wykonania izolacji szczepów grzybów. W każdym powiecie poszukiwano pól na których uprawiane były ziemniaki z objawami alternariozy,
stąd liczba wytypowanych plantacji w każdym powiecie była inna.
Z każdego pola wybierano jedną roślinę z której pobierano próbkę
liści, którą stanowił jeden porażony liść, zbierano również chrząszcze
(jeśli żerowały na porażonych liściach zebranych do analizy). Liście
odkażano powierzchniowo z użyciem 1% roztworu podchlorynu
sodu a następnie płukano w wodzie destylowanej. Tak przygotowane
liście cięto sterylnymi nożycami na 1 cm fragmenty i wykładano na
podłoże PDA (agar glukozowo – ziemniaczany) w ilości 5 sztuk i inkubowano w 24oC przez 7 dni [Kowalska 2011]. Chrząszcze (uśpione
CO2) umieszczano w kolbach o pojemności 100 cm3 z 20cm3 NaCl
i wytrząsano przez 20 minut. Bazując na tak sporządzonej zawiesinie
wykonywano posiewy na szalki Petriego z podłożem PDA. Inkubację
tak przygotowanych hodowli prowadzono w temperaturze 24oC przez
7 dni. Fragmenty wyrośniętej grzybni przeszczepiano na kolejne szalki
Petriego z podłożem PDA w celu izolacji czystych szczepów [Frączek
i in. 2010]. Szczepy grzybów wyizolowane z porażonych liści oraz
z powierzchni chrząszczy zliczono i zidentyfikowano przy pomocy
381
Katarzyna Wolny – Koładka
obserwacji mikroskopowych, prowadzonych w oparciu o klucze diagnostyczne [Domsch i in. 1980, Gilman 1957, Macura 2008, Marcinowska 2003]. Wykonano także ocenę makroskopową hodowli na
podstawie obserwacji tempa wzrostu strzępek, ich struktury i barwy.
Przeprowadzono analizę statystyczną, mającą na celu ocenę korelacji
pomiędzy liczbą szczepów wyizolowanych z porażonych roślin a liczbą
chrząszczy żerujących na roślinach. Analiza statystyczna została przeprowadzona przy użyciu programu Statistica v. 10 (StatSoft).
Wyniki i dyskusja
Z 182 pól zebrano 182 próbki roślin i 69 sztuk chrząszczy stonki
ziemniaczanej pokolenia letniego. Zidentyfikowano dwa gatunki
grzybów w obrębie wyizolowanych szczepów: A. alternata i A. solani.
W tabeli 1 zamieszczono wyniki dotyczące izolacji grzybów z porażonych liści, oraz wyniki izolacji Alternaria spp. z powierzchni stonki
ziemniaczanej.
wielicki
brzeski
proszowicki
tarnowski
limanowski
miechowski
oświęcimski
suma
Szczepy A.
solani
Szczepy A.
alternata
Szczepy Alternaria spp.
Owady
Szczepy
A. solani
Szczepy
A. alternata
Szczepy Alternaria spp.
Powiat
Pola
Rośliny
Tab.1. Liczba szczepów Alternaria spp. wyizolowana z porażonych
liści ziemniaka i z powierzchni chrząszczy.
17
13
10
3
5
4
4
0
21
18
12
6
7
5
5
0
43
35
27
8
18
12
11
1
18
13
9
4
9
4
3
1
23
20
20
0
10
5
5
0
34
33
33
0
9
6
6
0
26
19
18
1
11
4
2
2
182
151 129
22
69
40
36
4
(100%) (83%) (85%) (15%) (38%) (58%) (90%) (10%)
Wyniki przedstawione w tabeli 1 wskazują, iż porażenie ziemniaka przez grzyby z rodzaju Alternaria na badanym obszarze jest
bardzo wysokie. Częstość izolacji Alternaria spp. została wyznaczona
382
Występowanie alternariozy ziemniaka w Małopolsce i rola chrząszczy stonki ziemniaczanej...
na poziomie 83%. Bardzo zbliżone wyniki otrzymała Kapsa [2007] podając, iż porażenie roślin na polach uprawnych sięgało 86%. Jednakże
należy zwrócić uwagę, iż w pracy Kapsy [2007] w celu izolacji szczepów
Alternaria spp. użyto pułapki Burkarda umieszczonej w sąsiedztwie
pola ziemniaczanego, która wyłapuje zarodniki grzybów unoszące
się w powietrzu. Dominującym gatunkiem okazał się A. alternata,
stanowiąc 85% wszystkich izolatów. W Polsce przyjmuje sie, że to
właśnie A. alternata jest najbardziej rozpowszechnionym gatunkiem
porażającym uprawy ziemniaków [Kapsa i in. 2003, Kuczyńska 1992].
W badaniach Kapsy [2007] występowanie A. alternata i A. solani na
zainfekowanych roślinach wyznaczono w przybliżeniu na poziomie
80% i 20%. Leiminger i Hausladen [2007] zwracają uwagę, że proporcje ilościowe w jakich występują oba gatunki mogą ulegać zmianie
i uzależnione są głównie od warunków meteorologicznych. Podobne
wyniki uzyskali inni autorzy, którzy stwierdzili, iż A. alternata jest
gatunkiem najczęściej porażającym uprawy ziemniaków w Niemczech
[Hausladen i in. 2004, Leiminger i Hausladen 2007].
Jak podaje Fry [1994] wystąpienie alternariozy powoduje straty
plonu rzędu 20-30%, według Dennera i Therona [1999] mogą one sięgać
nawet 50%, w Polsce straty plonu wynoszą od 10 do 32% [Kuczyńska
1992]. Do działań mających na celu zminimalizowanie strat wynikających
z porażenia roślin przez Alternaria spp. należy zaliczyć: sadzenie tylko
w pełni zdrowych sadzeniaków, stosowanie płodozmianu, odpowiednie
nawożenie, zbiór dojrzałych bulw, wprowadzanie odmian odpornych oraz
wykorzystanie fungicydów [Osowski 2004, 2007, Zych 2005].
Na podstawie wyników zaprezentowanych w tabeli 1 można
wnioskować o stosunkowo wysokim, 58% zasiedleniu powierzchni
stonki ziemniaczanej przez grzyby z rodzaju Alternaria. Również
w tym przypadku dominującym gatunkiem okazał sie A. alternata
(90%). Alternaria spp. zwykle atakuje rośliny starsze i osłabione
[Rotem 1966], co tłumaczyłoby zaobserwowany związek pomiędzy
żerowaniem na nich owada a porażeniem przez grzyby. Analiza statystyczna wykazała wysoką (0,707; p<0,05) dodatnią korelację pomiędzy liczbą szczepów wyizolowanych z porażonych roślin a liczbą
chrząszczy żyrujących na roślinach.
W obliczu uzyskanych wyników, niezwykle istotnym zagadnieniem staje się efektywne zwalczanie stonki ziemniaczanej, które
383
Katarzyna Wolny – Koładka
zwykle prowadzi sie z użyciem insektycydów. Należy zwrócić uwagę,
iż skuteczność eliminacji tego szkodnika jest uzależniona zarówno od
warunków agrometeorologicznych, ale także od stadium rozwojowego
stonki. Osobniki dorosłe są o wiele bardziej odporne na wszelkiego
rodzaju środki chemiczne stosowane w rolnictwie [Zych 2005].
Zgromadzone wyniki badań świadczą o dużym porażeniu zebranych roślin przez grzyby Alternaria spp. Badania miały charakter
wstępny i były jednoroczne, stąd nie można wysunąć jednoznacznego
wniosku o roli jaką pełnią chrząszcze w rozprzestrzenianiu się alternariozy. Jednakże zgromadzone informacje są niezwykle interesujące
i skłaniają do kontynuowania badań.
Wnioski
Porażenie badanych upraw ziemniaka przez grzyby z rodzaju Alternaria kształtowało się na wysokim poziomie.
Dominującym gatunkiem izolowanym z roślin i chrząszczy stonki
ziemniaczanej pokolenia letniego jest grzyb A. alternata.
Zasadne jest prowadzenie dalszych badań mających na celu zweryfikowanie hipotezy o związku pomiędzy występowaniem chrząszczy stonki ziemniaczanej na ziemniakach a rozprzestrzenianiem się
alternariozy.
Bibliografia
Denner F. D. N. Theron D. J. 1999. Voorkoms en beheer van swamsiektes by
aartappels s. 17–132. W: „Handleiding vir Aartappelverbouing in South-Africa” (P.J. Steyn, red.). Agric. Res.Council, Roodeplaat, Pretoria.
Domsch K. H. Gams W. Anderson T. H. 1980. Compendium of Soil Fungi.
Londyn.
Frączek K. Ropek D. Ortman A. 2010. Występowanie potencjalnych
wektorów zanieczyszczeń mikrobiologicznych na składowisku odpadów komunalnych w Oświęcimiu. 4(2): 357-362.
Fry W. E. 1994. Role of early and late blight suppression in potato pest management. s. 166–177.W: “Advances in Potato Pest Biology and Management” (G.W. Zehnder, M.L. Powelson,R.K. Jansson, K.V. Raman,
red.). The APS Press, St. Paul, 655 ss.
Gilman J. C. 1957. Manual of Soil Fungi USA.
384
Występowanie alternariozy ziemniaka w Małopolsce i rola chrząszczy stonki ziemniaczanej...
Hausladen H. Bässler E. Asensio N. 2004. Early blight of potato. Special
Report no.10 (2004). Proc. 8th Workshop of an European network for
development of an integrated control strategy of potato late blight.
Jersey, England-France, 31st March-4th April 2004. Eds. C. E. Westerdijk
& H.T.A.M. Schepers, Applied Plant Research Wageningen: 173-177.
Kapsa J. Osowski J. Shevchuk O. 2003. Efficacy of zoxamide/mancozeb mixture against early blight (Alternaria spp.) and late blight (Phytophthora infestans) in Polish experiences. PPO-Special Report no.9 (2003).
Proc. 7th Workshop of an European network for development of an integrated control strategy of potato late blight. Poznań, Poland, 2–6 October 2002. Eds. Schepers H.T.A.M. & Westerdijk C.E., Applied Plant
Research AGV Research Unit, Wageningen: 85-94.
Kapsa J. 2007. Zastosowanie pułapki Burkarda do określania składu gatunkowego rodzaju Alternaria w uprawach ziemniaka. Biuletyn Instytutu Hodowli I Aklimatyzacji Roślin 244: 223-229.
Kowalska J. 2011. Metody zastąpienia miedzi w ochronie warzyw i ziół
uprawianych w rolnictwie ekologicznym Instytut Ochrony Roślin Państwowy Instytut Badawczy w Poznaniu.
Kuczyńska J. 1992. Rola i znaczenie grzybów z rodzaju Alternaria w wywoływaniu alternariozy liści i bulw ziemniaka. Biul. Inst. Ziemn. 41:
51–67.
Leiminger J. Hausladen H. 2007. Early blight: influence of different varieties. Euroblight Workshop, 2–5 may 2007, Bologna, Italy. Presentation:
http:/www.euroblight.net.
Macura A. B. 2008. Diagnostyka grzybów. Część II. Diagnostyka grzybów
pleśniowych. Diagnosta laboratoryjny nr 3 (18): 4–5.
Marcinowska J. 2003. Oznaczanie rodzajów grzybów ważnych w patologii
roślin. Fundacja rozwój SGGW. Warszawa.
Osowski J. 2004. Skuteczność różnych fungicydów zawierających mankozeb
w ograniczaniu rozwoju alternariozy ziemniaka w badaniach polowych
i laboratoryjnych. Biuletyn Instytutu Hodowli i Aklimatyzacji Roślin.
233: 295-302.
Osowski J. 2007. Wpływ stężeń wybranych fungicydów na wzrost grzybni
Alternaria solani i A. alternata w warunkach laboratoryjnych. Biuletyn
Instytutu Hodowli i Aklimatyzacji Roślin. 243: 219-225.
Osowski J. Bernat E. 2009. Skuteczność wybranych fungicydów w ochronie ziemniaka przed alternariozą (Alternaria spp.) w zależności od rejonu Polski.
Progress in Plant Protection/Postępy w Ochronie Roślin, 49 (1) 246-251.
Rotem J. 1966. Variability in Alternaria porri f. solani. Israel. J. Bot. 15:
48 – 57.
385
Katarzyna Wolny – Koładka
Zych A. 2005. Metodyka integrowanej produkcji ziemniaków. Państwowa
Inspekcja Ochrony Roślin i Nasiennictwa Warszawa.
Adres do korespondencji:
dr inż. Katarzyna Wolny – Koładka
Katedra Mikrobiologii, Wydział Rolniczo – Ekonomiczny
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
al. Mickiewicza 24/28, 30 – 059 Kraków
e-mail: [email protected]
386
Adam Zych
Anna Lehmann
Martyna Szałata
Elżbieta Pytlarz
Bartłomiej Glina
EPISTEME
22/2014, t. III
s. 387–392
ISSN 1895-2241
Plonowanie buraka cukrowego
w różnych systemach uprawy
Sugar beet yielding in varying variants
of tillage
Abstrakt. Celem badań było określenie wpływu różnych systemów uprawy
(orka 20 cm, orka 15 cm, uprawa konserwująca z siewem w mulcz z gorczycy
białej oraz uprawa konserwującą z siewem w mulcz ze słomy przy zmiennym
poziomie nawożenia azotowego na plon i obsadę buraka cukrowego. Dwu–
czynnikowe doświadczenie polowe przeprowadzono w Rolniczym Zakładzie
Doświadczalnym „Swojec” Uniwersytetu Przyrodniczego we Wrocławiu
w 2013 roku, metodą losowanych bloków, w trzech powtórzeniach. Statystyczna analiza wykazała istotny wpływ jedynie zastosowanych systemów
uprawy na plon buraka cukrowego oraz nie wykazała wpływu czynników
doświadczalnych na obsadę końcową.
Słowa kluczowe: burak cukrowy, systemy uprawy, nawożenie azotowe
Summary. The aim of the study was to determine the effect of different tillage systems (plowing 20 cm, 15 cm plowing, conservation tillage with white mustard mulch and conservation tillage with straw mulch with varying
levels of nitrogen fertilization on yield and sugar beet plant noumber. A two
factorial field experiment was conducted at the Agricultural Station „Swojec” University of Life Sciences in 2013, a randomized blocks with three replications. Statistical analysis showed a significant effect only applied tillage
systems on the yield of sugar beet and showed no effect of experimental
factors on the final cast.
Key words: sugar beet, cultivation systems, nitrogen fertilization
387
Adam Zych, Anna Lehmann, Martyna Szałata, Elżbieta Pytlarz, Bartłomiej Glina
WSTĘP
Uprawa buraka cukrowego w Polsce prowadzona jest w 16 różnych
systemach uprawy, z których dominującą rolę pełni tradycyjna uprawa
orkowa. Mimo wielu zalet uprawy pasowej i fakt, że nie jest ta technologia nowością nie zyskała w Polsce wielu zwolenników. Aktualnie ten
sposób uprawy wykonywany jest na 1% gruntów, natomiast wszystkie
pozostałe metody konserwujące są wykonywane na 12% pól [Zimny
i Zych 2013]. Według Zimnego [1999] uprawa konserwująca to sposób uprawy z wykorzystaniem mulczowania mający na celu ochronę
przed degradacją gleby. W ostatnich latach w różnych ośrodkach
naukowych prowadzone są liczne badania dotyczące rezygnacji z orki
na rzecz konserwujących systemów uprawy. Mimo to Nowakowski
[2012] podaje, że konserwujące metody uprawy są używane na 20%
plantacji. Wielu autorów twierdzi, że rezygnacja z orki jesiennej, na
rzecz płytkiej uprawy przedsiewnej nie wpływa istotnie na obniżkę
plonu korzeni buraka cukrowego [Rajewski 2009, Kuc i Tendziagolska
2011]. Bardzo ważnym elementem wpływającym na produkcję buraka
cukrowego jest jego opłacalność. Na podstawie badań czeskich [Šařec
i in. 2009] można stwierdzić, że jest ona wyższa w przypadku uproszczonych metod uprawy w stosunku do uprawy płużnej.
Celem badań było sprawdzenie wpływu systemów uprawy oraz
poziomów nawożenia azotowego na obsadę końcową i plon korzeni
buraka cukrowego.
MATERIAŁ I METODY
Doświadczenie polowe przeprowadzono w 2013 roku w stacji doświadczalnej „Swojec” należącej do Uniwersytetu Przyrodniczego
we Wrocławiu na glebie należącej do kompleksu II a). Jest to gleba
zaliczana do gleb ciężkich odpowiednich dla rozwoju korzeni buraka
cukrowego. Należy do kompleksu pszenno-buraczanego. Było to ścisłe
doświadczenie dwuczynnikowe. Pierwszym czynnikiem były systemy
uprawy (orka 20 cm, orka 15 cm, uprawa konserwująca– siew buraka
w mulcz z gorczycy białej, uprawa konserwująca – siew buraka w mulcz
ze słomy. Uprawy orkowe wykonano jesienią. Drugim czynnikiem był
zmienny poziom nawożenia azotowego: 80 kg N . ha-1 (obniżone), 120
kg N . ha-1 (optymalne) oraz 160 kg N . ha-1 . Burak cukrowy uprawiany
388
Plonowanie buraka cukrowego w różnych systemach uprawy
był w płodozmianie: burak cukrowy–pszenica jara–jęczmień jary.
Doświadczenie to jest prowadzone w ramach IOSDV (Internationale
Arbeitsgemeinschaft für Bodenfruchtbarkeit). Takie same badania
prowadzone są w innych europejskich ośrodkach naukowych. W takich
badaniach polowych całość masy organicznej po zbiorze przedplonu
pozostaje na polu. Do badań wybrano odmianę Janosik dostarczoną
przez Kutnowską Hodowlę Buraka Cukrowego w Straszkowie.
Obsadę końcową obliczono na podstawie ilości roślin na odcinku
5,5 m ze środkowych rzędów na poletku w trzech powtórzeniach na
obiekcie. Plon korzeni buraka cukrowego został określony na podstawie obsady końcowej. Z każdego poletka wykopano po 100 buraków,
zważono je i określono średnią masę jednego korzenia.
Na warunki wzrostu buraka cukrowego istotnie wpływała niekorzystny rozkład opadów. W okresie wschodów (przełom kwietnia
i maja) kilkakrotnie odnotowano opady powyżej 30 mm, które utrudniły wzrost roślin przez nadmierne ubicie świeżej gleby po uprawie.
Niestety nadmierne ubicie plantacji utrzymywało się aż do zbioru
i utrudniało pracę kombajnów na części produkcyjnej.
WYNIKI
Zróżnicowany sposób uprawy oraz zmienny poziom nawożenia azotowego nie wpływał istotnie na obsadę końcową buraka cukrowego
(tab. 1). Orka na głębokość 15 cm przyczyniła się do uzyskania największej obsady jednakże nie udowodniono tego statystycznie. Rezygnacja z orki na rzecz płytkiej uprawy kultywatorem (oba obiekty
z uprawą konserwującą) nie przyczyniła się do istotnych zmian obsady. Nie wykazano istotnego statystycznie wpływu dawek azotu na
obsadę końcową, jednakże przy dawce 80 kg N.ha-1 uzyskano najniższą
obsadę.
Na plon korzeni buraka cukrowego największy wpływ miały systemy uprawy. Nie udowodniono statystycznie wpływu zróżnicowanych
dawek zastosowanych nawozów azotowych na ten parametr. Najwyższy plon korzeni uzyskiwano na poletkach na których wykonano orkę
przedzimową na głębokość 15 cm. Spłycenie orki o 5 cm skutkowało
zwyżką plonowania o 16% w stosunku do standardowej orki. Skrajne
uproszczenie jakim można nazwać uprawę konserwującą z siewem
389
Adam Zych, Anna Lehmann, Martyna Szałata, Elżbieta Pytlarz, Bartłomiej Glina
Tab. 1. Obsada końcowa buraka cukrowego (szt.ha-1)
Sposób uprawy
Dawki azotu kg.ha-1
Średnio
80
120
160
Orka 20 cm
100 923
91 223
100 549
97 565
Orka 15 cm
99 893
101 023
100 392
100 436
Uprawa konserwująca– mulcz z
gorczycy
100 234
99 238
100 590
100 021
Uprawa konserwująca– mulcz ze
słomy
90 210
102 100
94 091
95 467
Średnio
97 815
98 396
98 906
–
NIR 0,05 dla systemów uprawy– r.n.
NIR 0,05 dla dawek azotu– r.n.
NIR 0,05 dla interakcji– r.n.
buraka cukrowego w mulcz ze słomy spowodowało uzyskiwanie najniższych plonów jednak uzyskany plon był na podobnym poziomie
statystycznym jak w przypadku orki 20 cm.
Tab. 2. Plon korzeni buraka cukrowego ( t.ha-1)
Sposób uprawy
Dawki azotu kg.ha-1
Średnio
80
120
160
Orka 20 cm
41,0
45,0
43,0
43,0
Orka 15 cm
53,0
49,0
52,0
51,0
Uprawa konserwująca– mulcz z
gorczycy
42,0
46,0
43,0
44,0
Uprawa konserwująca– mulcz ze
słomy
39,0
40,0
42,0
40,0
Średnio
44,0
45,0
45,0
–
NIR 0,05 dla systemów uprawy– 3,0
NIR 0,05 dla dawek azotu– r.n.
NIR 0,05 dla interakcji– r.n.
DYSKUSJA
Uzyskane wyniki potwierdzają wcześniej prowadzone badania prowadzone przez Rajewskiego [2009] oraz Kuca i Tendziagolską [2008].
390
Plonowanie buraka cukrowego w różnych systemach uprawy
W konserwujących systemach uprawy uzyskano plony korzeni buraka
cukrowego na takim samym poziomie jak w przypadku obiektu z orką
na głębokość 20 cm podobne rezultaty osiągnęli [Šařec i in. 2009].
Zdecydowanie większe plony jakie osiągnięto na poletkach z orką 15
cm mogą wynikać z nadmiernej ilości opadów w sezonie wegetacyjnym
i najlepszej reakcji buraków uprawianych tym systemem.
WNIOSKI
Zróżnicowany poziom nawożenia azotem nie wpływa na obsadę końcową
i plon korzeni.
Spośród badanych systemów uprawy najkorzystniejszym dla plonowania
buraka cukrowego jest orka 15 cm.
Rezygnacja z orki 20 cm na rzecz innego systemu uprawy może być wdrażana bez obawy o spadek plonowania.
BIBLIOGRAFIA
Kuc P. Tendziagolska E. 2011. Plonowanie buraka cukrowego w różnych wariantach uprawy roli. Fragmenta Agronomica 28 (3), 63–69.
Nowakowski M. 2012. Przydatność gorczycy białej i rzodkwi oleistej jako
mulczu, nawozu zielonego i czynnika antymątwikowego w uprawie buraka cukrowego. Rozprawa habilitacyjna. Bydgoszcz: 39.
Rajewski J. 2009. Zastosowanie uprawy konserwującej w produkcji buraka
cukrowego. Praca doktorska. Uniwersytet Przyrodniczy we Wrocławiu.
Šařec P., Šařec O., Srb K. Dobek T.K. 2009. Analiza produkcji buraka cukrowego w zależności od różnych technologii przygotowania roli. Inżynieria
Rolnicza 1(110), 273–280.
Zimny L. 1999. Uprawa konserwująca. Postępy Nauk Rolniczych 5, 41–52.
Zimny L., Zych A. 2013. Pługi zdominowały uprawę pól pod buraki. Top
Agrar Polska. 12, 78–81.
391
Adam Zych, Anna Lehmann, Martyna Szałata, Elżbieta Pytlarz, Bartłomiej Glina
Adres do korespondencji:
Adam Zych, Anna Lehmann
Martyna Szałata, Elżbieta Pytlarz
Katedra Kształtowania Agroekosystemów i Terenów Zieleni
Bartłomiej Glina
Instytut Nauk o Glebie i Ochrony Środowiska
Uniwersytet Przyrodniczy we Wrocławiu
Wydział Przyrodniczo–Technologiczny
pl. Grunwaldzki 24 A, 50–363 Wrocław
e-mail: [email protected]
Promotorzy:
prof. dr hab. Lesław Zimny
dr hab. Wiesław Wojciechowski
prof. dr hab. Danuta Parylak
dr hab. Adam Bogacz
392
Dorota Gala-Czekaj
Anna Gorczyca
Andrzej Oleksy
EPISTEME
22/2014, t. III
s. 393-403
ISSN 1895-2241
ZDROWOTNOŚĆ PSZENICY TWARDEJ ODMIANY
KOMNATA W ZALEŻNOŚCI OD DAWKI NAWOŻENIA
AZOTOWEGO
THE HEALTH STATUS OF DURUM WHEAT
OF CULTIVAR KOMNATA DEPENDING ON DOSE
OF NITROGEN FERTILIZATION
Abstrakt. Celem przeprowadzonych badań była ocena wpływu zróżnicowanych dawek nawożenia azotowego na występowanie chorób w uprawie pszenicy twardej odmiany Komnata. Doświadczenie polowe zostało przeprowadzone w warunkach klimatyczno-glebowych wybranego rejonu Małopolski
– w Prusach k. Krakowa. Czynnikiem doświadczalnym było pięć poziomów
nawożenia azotem (45, 90, 135, 180 i 225 kg N·ha-1). Obiekt kontrolny stanowiły poletka bez nawożenia azotem. Doświadczenie założono w układzie
losowanych bloków, w czterech powtórzeniach. Oceny porażenia pszenicy przez patogeny dokonano za pomocą ogólnie przyjętej metodyki skal
graficznych po rozpoznaniu charakterystycznych objawów chorobowych.
Otrzymane wyniki zostały przeliczone na procentowy indeks porażenia.
W istotnym nasileniu na analizowanym materiale stwierdzono występowanie: fuzaryjnej zgorzeli podstawy źdźbła i korzeni, łamliwości źdźbła zbóż,
fuzariozy liści, czerni zbóż, fuzariozy kłosów i septoriozy plew. Najwyższe
porażenie odmiany Komnata przez sprawców fuzaryjnej zgorzeli podstawy
źdźbła oraz septoriozy plew odnotowano dla najwyższej dawki azotu (225
kg N·ha-1). W przypadku łamliwości źdźbła nie stwierdzono istotnych statystycznie różnic w porażeniu pszenicy w zależności od zastosowanej dawki
azotu. Najniższe porażenie liści przez sprawców fuzariozy liści wystąpiło dla
dawki 90 i 180 kg N·ha-1. Również porażenie kłosów przez sprawców septoriozy plew i czerni zbóż było najniższe przy dawce 90 kg N·ha-1.
Słowa kluczowe: pszenica durum, Komnata, azot, nawożenie, choroby
Summary. The aim of the conducted research was to estimate the influence
of different doses of nitrogen fertilization on occurrence of diseases in cultivation of durum wheat cultivar Komnata. A field experiment was carried out
in climatic-soil conditions of selected region of Małopolska – in Prusy near
393
Dorota Gala-Czekaj, Anna Gorczyca, Andrzej Oleksy
Kraków. The experimental factor was five levels of nitrogen fertilization (45,
90, 135, 180 and 225 kg N·ha-1). Control constituted plots without nitrogen
fertilization. The experiment was set in the randomized blocks design with
four replications. The evaluation of infestation of wheat by pathogens was
made by using commonly accepted method of graphic scales after recognizing the characteristic diseases symptoms. The obtained results were converted to percentage index of infestation. On the analyzed plant material,
in the significant severity have been observed: Fusarium foot rot, eyespot,
fusariosis of leaves, sooty molds, Fusarium head blight and Stagonospora
blotch on ears. The highest infestation of cultivar Komnata by pathogens
which cause Fusarium foot root and Stagonospora blotch was observed at
the highest dose of nitrogen (225 kg N·ha-1). In the case of eyespot there
were no significant differences in infestation of wheat, depending on the
dose of nitrogen. The lowest infestation of leaves by pathogens which cause
fusariosis of leaves occurred at a dose of 90 and 180 kg N·ha-1. Also the
infestation of spikes by pathogens which cause Stagonospora blotch and
sooty molds was the lowest at a dose of 90 kg N·ha-1.
Key words: durum wheat, Komnata, nitrogen, fertilization, diseases
WSTĘP
Jakość ziarna pszenicy twardej zależy od genotypu rośliny, warunków klimatyczno-glebowych miejsca uprawy oraz odpowiednio dobranej agrotechniki [Spychaj i in. 2013]. Jednym
z najważniejszych zabiegów agrotechnicznych w uprawie pszenicy
twardej jest nawożenie azotowe [Panasiewicz i in. 2009]. Ze względu na konieczność otrzymania ziarna o bardzo dobrej jakości (duża
zawartość białka, duża szklistość) uprawa pszenicy durum związana
jest z intensywnym nawożeniem azotowym. Zwiększenie nawożenia
azotem aktywizuje wzrost pszenicy. Wraz ze wzrostem dawki azotu
następuje m.in. wzrost zawartości białka, glutenu i wskaźnika sedymentacyjnego [Kulhari i in. 2003; Ciołek i Makarska 2004; Podolska
i Wyzińska 2013]. Jednak nadmiar azotu może być zjawiskiem niepożądanym, a nawet ograniczającym plony ziarna pszenicy [Wojcieska
1994]. Zbilansowane nawożenie azotowe pszenicy oparte na potrzebach roślin oraz zasobności gleby obok właściwego płodozmianu
i starannego przygotowania roli pod uprawę należą do najważniejszych czynników agrotechnicznych w profilaktyce chorób pszenicy
[Korbas i in. 2008]. Oprócz właściwej dawki azotu istotny wpływ na
394
Zdrowotność przenicy twardej odmiany Komnata w zależności...
ilość i jakość plonu ziarna durum ma również termin zastosowania
nawozu. Nawożenie azotowe aplikowane w późniejszych fazach rozwojowych pszenicy efektywniej wpływa na wzrost zawartości białka
w ziarnie niż aplikacja we wczesnych fazach rozwoju [Ottman i in.
2000].
Celem przeprowadzonych badań była ocena wpływu zróżnicowanych dawek i sposobu podziału nawożenia azotowego na występowanie chorób w uprawie pszenicy twardej odmiany Komnata
w warunkach klimatyczno-glebowych wybranego rejonu Małopolski.
MATERIAŁ I METODY
Warunki agronomiczne. Doświadczenie polowe zostało przeprowadzone na terenie Stacji Doświadczalnej Zakładu Szczegółowej Uprawy
Roślin Uniwersytetu Rolniczego w Krakowie w miejscowości Prusy
k. Krakowa (50°06’52”N, 20°05’23”E; 271 m n.p.m.). Badania wykonano w 2010 r. Wielkość poletek do zbioru wynosiła 10 m2. Experyment założono jako doświadczenie jednoczynnikowe, w układzie
losowanych bloków w czterech powtórzeniach. Badanym czynnikiem
był poziom i sposób podziału dawki azotu (tab. 1). Azot stosowano
w formie saletry amonowej.
Pszenicę uprawiano na czarnoziemie zdegradowanym, wytworzonym z lessu, zaliczanym do I klasy bonitacyjnej i 1 kompleksu
przydatności rolniczej. Odczyn gleby był lekko kwaśny (pHKCl – 6,3).
Gleba charakteryzowała się niską zawartością potasu oraz wysoką zawartością fosforu i magnezu. Przedplonem dla Komnaty był
ziemniak uprawiany na oborniku. Po zbiorze rośliny poprzedzającej
wykonano bronowanie. Na dwa tygodnie przed siewem pszenicy twardej wykonano orkę siewną na głębokość 20-25 cm. Przed zabiegami
doprawiającymi rolę do siewu zastosowano nawożenie fosforowe
w ilości 80 kg P2O5·ha-1 (superfosfat potrójny) i potasowe w ilości 150
kg K2O·ha-1 (sól potasowa). Następnie w celu wymieszania nawozów
z glebą i przygotowania roli pod siew został zastosowany agregat uprawowo-siewny, złożony z kultywatora o wąskich łapach i podwójnego
wału strunowego. Ziarno zaprawiono zaprawą nasienną Funaben 480
FS (s.a. tiuram i karbendazym). Siew wykonano pod koniec września
(30.09) za pomocą samojezdnego siewnika poletkowego. Badana
395
Dorota Gala-Czekaj, Anna Gorczyca, Andrzej Oleksy
odmiana została wysiana na głębokość 2–3 cm, w rozstawie rzędów
12,5 cm i w obsadzie 450 szt. kiełkujących ziaren na m2. Chwasty jednoliścienne zwalczano herbicydem Puma Universal 069 EW w dawce
1,2 l·ha-1 (s.a. fenoksaprop-P-etylu), chwasty dwuliścienne herbicydem Lintur 70 WG w dawce 60 g·ha-1 (s.a. dikamba i triasulfuron).
Prowadzono również zabiegi ochrony fungicydowej. Pierwszy oprysk
przeciw chorobom podstawy źdźbła został wykonany preparatem
Tilt Plus 400 EC (s.a. propikonazol i fenpropidyna) w dawce 1 l·ha-1
w fazie strzelania w źdźbło, drugi przeciw chorobom liści i kłosów
Artea 330 EC (s.a. propikonazol i cyprokonazol) w dawce 0,5 l·ha -1
w fazie początku kłoszenia.
Tab. 1. Dawki nawożenia azotowego zastosowane w obiektach
doświadczalnych [kg N·ha-1]
Faza rozwojowa roślin podczas aplikacji
dawki
Obiekt
Dawka łączna
Początek
wegetacji
Pełnia
strzelania w
źdźbło
Kłoszenie
N0
0
0
0
0
N1
45
0
0
45
N2
60
30
0
90
N3
75
45
15
135
N4
90
60
30
180
N5
105
75
45
225
Charakterystyka odmiany Komnata. Komnata to pierwsza polska
odmiana pszenicy twardej. Została wpisana do Krajowego Rejestru
Odmian w 2009 r. Jest to odmiana ozima, oścista i krótkosłoma.
Odporność Komnaty na wyleganie i suszę określono jako wysoką.
Odmiana dobrze zimuje. Wymagania glebowe Komnaty są wysokie
– najlepiej plonuje na glebach I, II i III klasy bonitacyjnej, m.in.: na
czarnoziemach, czarnych ziemiach, madach ciężkich i średnich. Wymagania płodozmianowe odmiany również są wysokie – preferuje
396
Zdrowotność przenicy twardej odmiany Komnata w zależności...
najlepsze przedplony tj.: okopowe na oborniku, motylkowe grubo –
i drobnonasienne. Plonowanie Komnaty na glebach III klasy bonitacyjnej wynosi 4–6 t·ha-1. Ziarno jest duże (MTZ 50–60 g) i szkliste
o wysokiej zawartości białka (ok. 15 %). Zalecana dawka azotu wynosi
od 100 do 150 kg·ha-1 i powinna być podzielona na trzy lub cztery
dawki. Odporność odmiany na mączniaka prawdziwego oraz rdzę
brunatną została określona jako wysoka, odporność na rdzę żółtą,
septoriozę liści i fuzariozę kłosów jako średnia.
Warunki pogodowe. Duże znacznie dla szkodliwości patogenów
chorobotwórczych w uprawie roślin odgrywają warunki pogodowe.
Szczególnie istotne są średnie temperatury powietrza i sumy opadów
atmosferycznych.
350
25,0
300
20,0
250
15,0
200
10,0
[mm]
150
[oC]
5,0
100
0,0
50
-5,0
0
IX
X
XI
XII
I
II
2009 r.
Opady sezon badań
Średnia dobowa temperatura w sezonie badań
III
IV
V
VI
VII
VIII
-10,0
2010 r.
Opady wielolecie
Średnia dobowa temperatura dla wielolecia
Ryc. 1. Warunki pluwio-termiczne w sezonie badań na tle wielolecia
(1977-2007) w Stacji Doświadczalnej w Prusach
Warunki pluwio-termiczne odnotowane w okresie wegetacyjnym
2009/2010 należy ocenić jako sprzyjające rozwojowi chorób grzybowych. Sezon charakteryzował się znacznie wyższą sumą opadów
atmosferycznych w porównaniu do wielolecia (1977–2007) oraz nieznacznie wyższą średnią temperaturą powietrza (ryc. 1). Odnotowana
suma opadów atmosferycznych wyniosła 1052 mm, podczas gdy suma
wieloletnia wynosi 637 mm. Wyższe niż w wieloleciu opady zostały
odnotowane we wszystkich miesiącach, z wyjątkiem marca i kwietnia 2010 r. Szczególnie duża ilość opadów wystąpiła w maju 2010 r.
397
Dorota Gala-Czekaj, Anna Gorczyca, Andrzej Oleksy
Średnia dobowa temperatura powietrza w sezonie badań była wyższa
od wielolecia o 0,2 °C i wynosiła 8,4 °C. Miesiącami cieplejszymi
w porównaniu do lat 1977–2007 były: wrzesień i listopad 2009 r. oraz
kwiecień, czerwiec, lipiec i sierpień 2010 r.
Analizy zdrowotności. Ocena porażenia pszenicy twardej przez
fitopatogeny została wykonana makroskopowo po rozpoznaniu charakterystycznych dla danego gatunku grzyba objawów chorobowych.
Oceniano 10 losowo pobranych roślin z każdego powtórzenia. Analizę
wykonano na początku lipca 2010 r. w fazie wykształcania ziarniaków.
Wykorzystano ogólnie przyjętą metodykę skal graficznych, w której
stopień porażenia określa się na podstawie procentowego pokrycia
ocenianej części rośliny przez zmiany chorobowe. Użyta podczas
badań skala była 9-stopniowa: 1° – oznacza całkowite pokrycie analizowanej części rośliny przez zmiany chorobowe, 9° – oznacza brak
objawów chorobowych. Otrzymane wyniki zostały przeliczone na procentowy indeks porażenia ocenianej części pszenicy, według wzoru:
v – stopień porażenia analizowanej części rośliny w obranej skali,
n – liczba roślin zaliczonych do danego stopnia porażenia,
i – najwyższy stopień porażenia w obranej skali,
N – całkowita liczba badanych roślin.
Statystyczne opracowanie wyników. Statystyczne opracowanie
wyników zostało wykonane przy pomocy jednoczynnikowej analizy
wariancji. Istotność zróżnicowania danych weryfikowano testem Duncana z transformacją Bliss’a na poziomie istotności p=0,05.
WYNIKI I DYSKUSJA
Wykonane analizy wykazały występowanie na pszenicy twardej odmiany Komnata w rejonie badań niektórych chorób podstawy źdźbła
i korzeni, liści oraz kłosów w znaczącym nasileniu. Chorobami tymi
były: fuzaryjna zgorzel podstawy źdźbła i korzeni zbóż oraz fuzarioza
398
Zdrowotność przenicy twardej odmiany Komnata w zależności...
liści i fuzarioza kłosów, których sprawcami jest kompleks grzybów
z rodzaju Fusarium, łamliwość źdźbła zbóż i traw powodowana przez
Oculimacula spp., septorioza plew pszenicy powodowana przez Phaeosphaeria nodorum oraz czerń kłosów wywoływana przez kompleks
grzybów Alternaria spp., Cladosporium spp., Epiccocum spp., Ascochyta
spp. Symptomy pozostałych chorób wystąpiły w śladowym nasileniu.
Tab. 2. Indeks porażenia pszenicy twardej odmiany Komnata przez
sprawców występujących w badaniu chorób podstawy źdźbła i korzeni [%]
Obiekt
Fuzaryjna zgorzel
podstawy źdźbła i
korzeni
Łamliwość źdźbła zbóż
i traw
N0
8,07
a*
27,39
a
N1
8,68
a
36,30
a
N2
8,46
a
26,68
a
N3
8,09
a
41,18
a
N4
10,52
ab
32,69
a
N5
13,00
b
27,22
a
*Średnie oznaczone tymi samymi literami w kolumnie nie różnią się istotnie
według testu Duncana (p=0,05)
Indeks porażenia Komnaty przez sprawców chorób podsuszkowych zawierał się w przedziale od 8,09 do 41,18% (tab. 2). W roku
badań łamliwość źdźbła wystąpiła w większym nasileniu niż fuzaryjna
zgorzel podstawy źdźbła. Mogło to być spowodowane warunkami
pogodowymi, a szczególnie dużą ilością opadów atmosferycznych.
Jak podają Korbas i in. (2008) wysoka wilgotność powietrza jest
czynnikiem koniecznym do rozwoju łamliwości źdźbła. Najwyższe porażenie dla fuzaryjnej zgorzeli podstawy źdźbła stwierdzono
w przypadku najwyższych dawek nawożenia azotem (180 i 225 kg
N·ha-1) w porównaniu do pozostałych obiektów. Porażenie przez
grzyby powodujące łamliwość źdźbła było największe po zastosowaniu
dawki całkowitej 135 kg N·ha-1 (podzielonej na trzy części). Najniższy
indeks porażenia odnotowano w przypadku dawki 90 kg N·ha-1, aplikowanej w dwóch częściach (60+30). Łamliwość źdźbła zbóż i traw
oraz fuzaryjna zgorzel podstawy źdźbła i korzeni są chorobami, które
często współwystępują ze sobą. Taką zależność wykazali w swoich ba399
Dorota Gala-Czekaj, Anna Gorczyca, Andrzej Oleksy
daniach m.in. Nieróbca i in. (2008) oraz Lemańczyk (2012). Damszel
i in. (2010) podają, że w uprawach pszenicy rośnie znaczenie fuzarioz,
a nasilenie objawów łamliwości źdźbła i fuzaryjnej zgorzeli podstawy
źdźbła wzrasta w wyniku łącznej, doglebowo-dolistnej, aplikacji azotu.
Tab. 3. Indeks porażenia pszenicy twardej odmiany Komnata
przez sprawców występującej w badaniu choroby liści [%]
Obiekt
Fuzarioza liści
N0
63,45
ab*
N1
63,41
ab
N2
53,18
a
N3
57,64
ab
N4
54,34
a
63,43
ab
N5
*jak dla Tab. 1
Przeprowadzone analizy wykazały występowanie na istotnym
poziomie w obszarze badań tylko jednej choroby liści – fuzariozy.
Nasilenie pozostałych chorób liści było znikome. Porażenie blaszek
i pochew liściowych przez Fusarium ssp. było bardzo wysokie, o czym
świadczą indeksy porażenia w przedziale od 54,18 do 63,45% (tab.
3). W badaniach przeprowadzonych przez Piekarczyka i Lemańczyka
(2013) koło Bydgoszczy na pszenicy zwyczajnej ozimej stwierdzono
niewielkie znaczenie fuzariozy liści. Średni procent pokrycia liści przez
zmiany chorobowe wyniósł zaledwie 2,5%. Badacze wykazali najniższe porażenie dla dawki azotu 40 i 80 kg N·ha-1 oraz istotnie wyższe
dla dawki 120 i 160 kg N·ha-1. Odnotowano wówczas także wysokie
porażenie przez sprawców septoriozy paskowanej liści i mniejsze
przez grzyby powodujące rdzę brunatną i mączniaka prawdziwego.
W przypadku wszystkich w/w chorób wraz ze wzrostem dawki azotu
istotnie wzrastało porażenie przez grzyby. W doświadczeniu własnym
najniższe porażenie przez sprawców fuzariozy liści odnotowano dla
obiektu N2 (dawka 90 kg N·ha-1, podzielona na dwie części) oraz dla
obiektu N4 (dawka 180 kg N·ha-1, podzielona na trzy części). Inne badania wykonane przez Lemańczyka i Piekarczyka (2013) potwierdziły
znikome znaczenie fuzariozy liści w okolicach Bydgoszczy oraz wpływ
wyższej dawki nawożenia na wzmożone występowanie chorób liści.
400
Zdrowotność przenicy twardej odmiany Komnata w zależności...
Tab. 4. Indeks porażenia pszenicy twardej odmiany Komnata
przez sprawców występujących w badaniu chorób kłosa [%]
Obiekt
Czerń kłosów
Fuzarioza kłosów
Septorioza plew
N0
12,42
ab*
68,41
c
13,64
ab
N1
12,39
ab
57,68
abc
15,86
ab
N2
9,57
a
59,53
bc
6,89
a
N3
11,33
ab
59,24
bc
24,61
ab
N4
12,47
ab
47,20
a
28,25
ab
N5
11,89
ab
53,91
ab
55,88
b
*jak dla Tab. 1
Wykonane badania wykazały, że grzyby z rodzaju Fusarium powodowały także znaczące porażenie kłosów ocenianej odmiany pszenicy
twardej. Średnie indeksy porażenia w przypadku fuzariozy kłosów
wynosiły od 47,20% (najniższe porażenie, dawka 180 kg N·ha-1, aplikowana w trzech częściach) do 68,41% (najwyższe porażenie, brak
nawożenia azotowego). Piekarczyk i Lemańczyk (2013) w swoim
doświadczeniu wykazali śladową szkodliwość tej choroby (średni
procent pokrycia kłosa przez zmiany chorobowe wynosił ok. 1%).
W badaniach tych wraz ze wzrostem dawki nawożenia azotem istotnie
wzrastało porażenie kłosów przez grzyby Fusarium ssp. Czerń kłosów w doświadczeniu własnym wystąpiła w roku badań w nasileniu
wyrażającym się indeksem porażenia od 9,57 do 12,47%. Natomiast
septorioza plew pszenicy od 6,89 do 55,88%. Najniższe porażenie
kłosa przez sprawców zarówno czerni, jak i septoriozy zostało odnotowane dla dawki 90 kg N·ha-1. Lemańczyk i Piekarczyk (2013)
wykazali, że wyższa dawka azotu sprzyja porażeniu kłosów przez
sprawców septoriozy plew. Jak podają Korbas i in. (2008) czerń zbóż
jest chorobą o znaczeniu lokalnym, a fuzarioza i septorioza kłosów
o dużym znaczeniu gospodarczym w uprawach odmian jarych i ozimych pszenicy. Badania własne w wybranym rejonie Małopolski
wykazały istotną rolę czerni, fuzariozy i septoriozy kłosów w uprawie
pszenicy twardej odmiany Komnata.
401
Dorota Gala-Czekaj, Anna Gorczyca, Andrzej Oleksy
WNIOSKI
Chorobami o największej szkodliwości w uprawie pszenicy twardej
odmiany Komnata w warunkach klimatyczno-glebowych przeprowadzonego badania są fuzarioza liści i fuzarioza kłosów.
Najwyższa zastosowana dawka azotu (225 kg N·ha-1) istotnie
sprzyja porażeniu pszenicy twardej odmiany Komnata przez sprawców
fuzaryjnej zgorzeli podstawy źdźbła i korzeni zbóż oraz septoriozy
plew pszenicy.
Porażenie roślin przez grzyby powodujące łamliwość źdźbła zbóż
i traw, fuzariozę liści, czerń kłosów i septoriozę plew pszenicy jest
najniższe dla zastosowanej dawki nawożenia azotowego 90 kg N·ha-1.
Sposób nawożenia azotowego pszenicy twardej jest czynnikiem,
który może wpływać na nasilenie występowania chorób grzybowych
o dużym znaczeniu gospodarczym, w tym fuzarioz stanowiących
o zanieczyszczeniu płodów mikotoksynami.
BIBLIOGRAFIA
Ciołek A., Makarska E. 2004. Wpływ różnicowanego nawożenia azotem
i ochrony chemicznej na wybrane parametry jakościowe ziarna pszenicy
twardej (Triticum durum Desf.). Ann. UMCS, Sect. E Agricultura 59:
777–784.
Damszel M.D., Czajka W., Kosewska A., Laszczak-Dawid A. 2010. Zdrowotność podstawy źdźbła pszenicy ozimej w zależności od sposobu nawożenia
azotem i chemicznej regulacji zachwaszczenia. Prog. Plant Prot./Post.
Ochr. Roślin 50 (2) 625–628.
Korbas M., Mrówczyński M., Paradowski A., Horoszkiewicz-Janka J., Jajor
E., Pruszyński G. 2008. Ochrona roślin w integrowanej produkcji
pszenicy. Prog. Plant Prot./Post. Ochr. Roślin 48 (4):1502–1515.
Kulhari S.C., Sharma S.L., Kantwa S.R. 2003. Effect of varieties, sowing dates
and nitrogen levels on yield, nutrient uptake and quality of durum
wheat (Triticum durum Desf). Ann. Agric. Res. 24: 332–336.
Lemańczyk G. 2012. Chemiczne zwalczanie chwastów a nasilenie chorób korzeni i podstawy źdźbła zbóż jarych. Prog. Plant Prot./Post. Ochr. Roślin
52 (2): 369–376.
Lemańczyk G., Piekarczyk M. 2013. Wpływ nawożenia, chemicznej ochrony
roślin i gęstości siewu na zdrowotność pszenicy ozimej uprawianej w krótkotrwałej monokulturze na glebie lekkiej. Prog. Plant Prot./Post. Ochr.
Roślin 53 (3): 487–493.
402
Zdrowotność przenicy twardej odmiany Komnata w zależności...
Nieróbca A., Pudełko R., Kozyra J. 2008. Nasilenie występowania chorób podstawy źdźbła na pszenicy ozimej w zależności od stanowiska w zmianowaniu. Prog. Plant Prot./Post. Ochr. Roślin 48 (2): 482–486.
Ottman M.J., Doergeand T.A., Martin E.C. 2000. Durum grain quality as affected by nitrogen fertilization near anthesis and irrigation during grain fill.
Agron. J. 92: 1035–1041.
Panasiewicz K., Koziara W., Sulewska H. 2009. Reakcja pszenicy ozimej Triticum durum Desf. odmiany Komnata na gęstość siewu i nawożenie azotem.
Biul. IHAR 253: 125–134.
Piekarczyk M., Lemańczyk G. 2013. Wpływ nawożenia azotem na zdrowotność
wybranych odmian pszenicy ozimej uprawianych na glebie lekkiej. Prog.
Plant Prot./Post. Ochr. Roślin 53 (3): 494–497.
Podolska G., Wyzińska M. 2013. Wpływ nawożenia azotem na niektóre cechy
jakościowe ziarna pszenicy twardej (Triticum durum Desf.) odmiany Komnata. Fragm. Agron. 30 (3): 148–158.
Spychaj R., Gil Z., Bojarczuk J. 2013. Wpływ intensywności uprawy na plonowanie i jakość ziarna nowych linii ozimej pszenicy twardej – wyniki
wstępne. Fragm. Agron. 30 (3): 159–171.
Wojcieska U. 1994. The effect of nitrogen nutrition of wheat on plant growth
and CO2 exchange parameters. Acta Physiol. Plant. 16: 269–272.
Adres do korespondencji:
mgr inż. Dorota Gala-Czekaj,
Katedra Agrotechniki i Ekologii Rolniczej
e-mail: [email protected]
dr inż. Anna Gorczyca,
Katedra Ochrony Środowiska Rolniczego
e-mail: [email protected]
dr inż. Andrzej Oleksy,
Instytut Produkcji Roślinnej
e-mail: [email protected]
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowie
al. Mickiewicza 21
31-120 Kraków
403