(BOLBORHYNCHUS LINEOLA). A CASE REPORT

(BOLBORHYNCHUS LINEOLA). A CASE REPORT

Bull Vet Inst Pulawy 53, 209-212, 2009
MYCOBACTERIOSIS CAUSED BY MYCOBACTERIUM
GENAVENSE IN LINEOLATED PARAKEETS
(BOLBORHYNCHUS LINEOLA). A CASE REPORT
ALEKSANDRA LEDWOŃ, PIOTR SZELESZCZUK, ELŻBIETA MALICKA1 , IZABELLA DOLKA1,
ZOFIA ZWOLSKA2, EWA AUGUSTYNOWICZ- KOPEĆ2, AND ANNA ZABOST2
Avian Diseases Division, 1Division of Animal Pathomorphology, Department of Clinical Sciences,
Faculty of Veterinary Medicine, Warsaw University of Life Sciences, 02–776 Warsaw, Poland
[email protected], [email protected]
[email protected]
2
National Tuberculosis Reference Laboratory,
National Tuberculosis and Lung Diseases Research Institute, 01–138 Warsaw, Poland
[email protected]
Received for publication February 18, 2009
Abstract
Systemic mycobacteriosis caused by Mycobacterium genavense was diagnosed in a 7-year-old captive lineolated parakeet
(Bolborhynchus lineola). About a year before death, proventricular dilatation syndrome (PDS) was suggested, because of persistent
regurgitations and intermittent diarrhoea. Necropsy examination did not show any signs typical of PDS and mycobacterioses. No
caseous necrosis, but focal ulcerated overgrowth in the proventriculus, hypertrophy of intestinal mucosa and splenomegaly, was
found. Primary neoplasia was suspected. The crucial examination was histopathology, which revealed changes typical of
mycobacteriosis and the presence of numerous acid-fast bacilli. A real- time SYBR® Green PCR test was used and Mycobacterium
genavense infection was diagnosed. The mycobacterium was also cultured on BD BACTEC™ 460TB 12B Middlebrook 7H12
medium.
Key words: parrots, Mycobacterium genavense, pathology, real-time PCR.
Mycobacterium genavense is a fastidious
microrganism with special growth requirements and was
first detected in 1990 in a human patient with acquired
immunodeficiency syndrome (1). Since then, it has been
identified as a cause of mycobacteriosis in different
avian species (7, 8, 10, 14, 13). Different data suggest
that 10%–15% of disseminated mycobacterial infections
in AIDS patients may be due to this bacterium (4). In
two surveys conducted on birds, M. genavense was
considered as about 30% to 95% (8, 13) of all
Mycobacterium sp. infections. It indicates a high
significance of that bacterium as an avian pathogen. In
other pet animals, disseminated or local M. genavense
infections were occasionally described (9, 10, 12). In
human AIDS patients, the clinical pattern of infection is
similar to those reported in disseminated MAC
infections, including fever, weight loss, abdominal pain,
hepatosplenomegaly, anaemia and possibly early death
(2, 6, 17). In avian patients, necropsy findings were
pectoral muscle atrophy, hepatomegaly with lack of
visible granulomatous lesions, and small intestinal wall
thickening (7, 10, 13). Severe lesions caused by this
pathogen, observed in the central nervous system, lungs,
cervical air sacs, and adrenal glands without
involvement of the gastrointestinal tract, was described
in European goldfinch (Carduelis carduelis) with
polyoma co- infection (13). Difficulties or inability of
M. genavense to grow on standard solid media delayed
its identification (2, 5, 6, 14, 16). In many cases, the
amplification by PCR or similar techniques represents
the only possibility of detecting and identifying M.
genavense in tissue samples (4). BACTEC 12B broth
and BACTEC 13A (blood, bone marrow) are
recommended media for M. genavense culture. For M.
genavense, the median detection time was 20 d (range, 7
to 54 d) for 13A, 8 d (range, 6 to 40 d) for 12B, and 41 d
(range, 35 to 47 d) for solid media (Löwenstein-Jensen
medium with sodium pyruvate or Middlebrook 7H10
medium) (15).
Material and Methods
Case history. A 7-year-old lineolated parakeet
(Bolborhynchus lineola) was submitted for necropsy.
The owner reported that a pair of parakeets had been
bought six years earlier. They probably came from
imports. Both birds were in a bad condition with signs of
210
diarrhoea and dyspnoea. Enrofloxacin had been used on
setback and then itraconazole was used with recovery
over the remaining five years. About one year before its
death, the bird became less active, with intermittent
diarrhoea and indigested seeds in faeces. Presumptive
diagnosis was proventricular dilatation disease (PDD).
The parakeet showed a decreasing appetite; the owner
fed it Prosobee (Bristol Myers Squibb, USA).
Histopathology. Tissue samples were fixed in
10% buffered formalin and paraffin sections were
prepared. The sections were stained with haematoxylin
and eosin (H&E) or according to the Ziehl-Neelsen (ZN) method.
Culture. Liver, kidney, and intestinal samples
were kept at -20°C for one month before delivering them
to mycobacterial culture. After decontamination, the
samples were cultured for six weeks on BD BACTEC™
460TB 12B Middlebrook 7H12 medium in BACTEC
460 TB system under aerobic conditions (11).
DNA Extraction. DNA was extracted from the
frozen liver, spleen, and lungs (25 mg each) with 5%
Chelex (Bio-Rad Laboratories, Canada) method (18). As
a positive control we used suspensions of M. genavense
strains kindly provided by Prof. Françoise Portaels
(Institute of Tropical Medicine, Antwerp, Belgium).
Mycobacterium genavense DNA was also extracted with
Chelex.
PCR. Chlamydophila psittaci, psittacine beak
and feather disease (PBFD), budgerigar fledgling
disease (BFD), psittacine herpesvirus (PsHV-1), and
psittacine adenovirus PCR tests were done with standard
procedures.
Specific Mycobacterium genavense SYBR®
Green real-time PCR. A selection of specific M.
genavense primers was supported by Bacon Designer
software 7 (PREMIER Biosoft International, Canada).
The
chosen
forward
primer
MG
25-s
(GAATCCGCTGCTGCTCTG)
was
located
at
nucleotides 378 to 395 Mycobacterium genavense
hypothetical 21 kDa protein gene (4) and MG25-as
(TCAATGTAGTCCTGTCCGAAC) corresponded to
nucleotides 313 to 291. Real-time PCR amplification
was carried out in a total-volume 50 µl using Brillant®
SYBR® Green QPCR Master Mix (Stratagene, Canada)
containing 1 µl of each primer and 2 µl of DNA
template. The PCR was performed in the Stratagene®
Mx3005PTM cycler (Stratagene, Canada), with the
following protocol: initial denaturation: 10 min at 95°C
followed by 40 cycles consisting of denaturation at 95°C
for 30 s, annealing at 55°C for 60 s, and elongation 72°C
for 60 s. The fluorescence data were collected during the
elongation step. After termination of the reaction by a
final extension step at 72°C for 5 min, a DNA-melting
curve was generated to verify the correct product by its
specific melting temperature. Melting-curve analysis
was performed by heating at 95°C for 1 min, followed
by cooling to 55°C for 30 s and subsequent heating to
95°C for 30 s. For each real-time PCR reaction, the
software associated with Stratagene® Mx3005PTM
system determined a threshold of cycle number (Ct).
The specific melting temperature value of the real-time
product was about 83°C.
Results and Discussion
The bird was in poor body condition, with
feather depletion around the beak and on its cheeks. The
upper-jaw corneal structure was also damaged. In the
lower ½ of the neck symmetrical lobular “thymus like”
structures bent together in neck lordose area were
observed. The liver was slightly enlarged and tender,
with multifocal grey discoloration. The spleen was
significantly enlarged (12 x 18 mm) and yellowish (Fig.
1). The proventriculus was enlarged (Fig. 1) with an
excess of mucus with little blood stains. In the
proventricular isthmus region irregular, a focallyulcerated outgrowth (10x7x4 mm) was found (Fig. 2). In
the small intestine, a towel-like hypertrophy of mucus
membrane was present
Chlamydophila psittaci, psittacine beak and
feather disease (PBFD), budgerigar fledgling disease
(BFD), psittacine herpesvirus (PsHV-1), and psittacine
adenovirus PCR tests were negative.
No aerobic bacteria were cultured on standard
media.
A histopathological examination revealed brain
congestion, diffuse inflammation cell (macrophages,
giant cells) infiltration of the intestine mucosa, and
numerous acid-fast bacteria (AFB) in infiltrating cells
(Fig. 3). Infiltration of macrophages and giant cells with
numerous AFB were found also in the spleen, liver (Fig.
4), proventriculus, lungs, and thymus-like structure.
Spleen and thymus-like structure constitution was
blurred. In the proventriculus glandular dysplasia and
mucous membrane hypertrophy were present.
The lack of typical caseous changes in the
organs aroused suspicion of Mycobacterium genavense
infection; therefore, mycobacterium identification tests
were performed.
Samples of the liver, spleen, lungs, and kidneys
were examined by real- time PCR (Fig. 5). M.
genavense DNA was amplified in all the tested samples
with the largest quantity in the spleen.
Positive mycobacterium growth on BD
BACTEC™ 460TB 12B Middlebrook 7H12 was after
10 d for the intestines and kidneys
Despite many world reports (7, 8, 10, 13, 14)
describing Mycobacterium genavense as an important
mycobacterial pathogen for birds, this case is the first
documented in Poland. Earlier investigation confirmed
the presence of this bacterium in healthy parrot faecal
samples (11). Probably most cases are unrecognisable,
due to atypical changes, different from most
mycobacterial infections (8, 13, 14). In this case
histopathologic examination was crucial to the diagnosis
of mycobacteriosis, because of the presence of typical
microscopic changes and numerous acid fast bacteria.
The very difficult culture of this microorganism is also
responsible for the extremely rare diagnosis of
Mycobacterium genavense infections before the PCR
test era. The source of these infections remains unknown
- few birds from the same indoor aviary were positive in
M. genavense PCR tests (cloacal swabs) and all 10
parrots were treated for mycobacteria for four months,
and they are under regular veterinary control.
211
Fig. 1. Significantly enlarged spleen next to moderately
distended proventriculus.
Fig. 2. Irregular, outgrowth in lower part of
proventriculus and isthmus with ulcerated bleeding foci.
Fig. 3. Hepatic mycobacteriosis. Multifocal infiltration
with macrophages containing mycobacteria visualised
by acid fast-positive staining (Ziehl- Neelsen, 100x).
Fig. 4. Intestinal mycobacteriosis with mycobacterial
organisms in macrophages demonstrated by acid-fast
staining (Ziehl- Neelsen, 200x).
Fig. 5. A) Thermal profile, B) Amplification plots with standards and examined samples, C) Dissociation curve, D)
Standard curve.
212
References
1.
Böttger E.C.: Infection with a novel, unidentified
mycobacterium. N Engl J Med 1990, 323, 1635–1636.
2. Böttger E.C., Teske A., Kirschner P., Bost S., Chang
H.R.,
Beer
V.,
Hirschel
B.:
Disseminated
"Mycobacterium genavense" infection in patients with
AIDS. Lancet 1992, 11, 76-80.
3. Böttger E.C., Hirschel B., Coyle M.B.: Mycobacterium
genavense sp. nov. Int J Syst Bacteriol 1993, 44, 841-843.
4. Chevrier D., Oprisan G., Maresca A., Matsiota-Bernard
P., Guesdon J.L.: Isolation of a specific DNA fragment
and development of a PCR-based method for the
detection of Mycobacterium genavense. FEMS Immunol
Med Microbiol 1999, 23, 243- 252.
5. Coyle M.B., Carlson L.C., Wallis C.K., Leonard R.B.,
Raisys V.A., Kilburn J.O., Samadpour M., Böttger E.C.:
Laboratory aspects of "Mycobacterium genavense," a
proposed species isolated from AIDS patients. J Clin
Microbiol 1992, 30, 3206-3212.
6. Dumonceau J.M., Fonteyne P.A., Realini L., Van Gossum
A., Van Vooren J.P., Portaels F.: Species-specific
Mycobacterium genavense DNA in intestinal tissues of
individuals not infected with human immunodeficiency
virus. J Clin Microbiol 1995, 33, 2514-2515.
7. Hoop R.K., Böttger E.C., Ossent P., Salfinger M.:
Mycobacteriosis due to Mycobacterium genavense in six
pet birds. J Clin Microbiol 1993, 31, 990-993.
8. Hoop R.K., Böttger E.C., Pfyffer G.E.: Etiological agents
of mycobacterioses in pet birds between 1986 and 1995. J
Clin Microbiol 1996, 34, 991–992.
9. Hughes M.S., Ball N.W., Love D.N., Canfield P.J.,
Wigney D.I., Dawson D., Davis P.E., Malik R.:
Disseminated Mycobacterium genavense infection in a
FIV-positive cat. J Feline Med Surg 1999, 1, 23-29.
10. Kiehn T.E., Hoefer H., Böttger E.C., Ross R., Wong M.,
Edwards F., Antinoff N., Armstrong D.: Mycobacterium
11.
12.
13.
14.
15.
16.
17.
18.
genavense infections in pet animals. J Clin Microbiol
1996, 34, 1840-1842.
Ledwoń A., Szeleszczuk P., Zwolska Z., AugustynowiczKopeć E., Kozak M.: Occurrence of Mycobacterium in
the faeces of parrots kept in zoological gardens and
private aviaries in Poland. Bull Vet Inst Pulawy 2008, 52,
341-346.
Lucas J., Lucas A., Furber H., James G., Hughes M.S.,
Martin P., Chen S.C., Mitchell D.H., Love D.N., Malik
R.: Mycobacterium genavense infection in two aged
ferrets with conjunctival lesions. Aust Vet J 2000, 78,
685-689.
Manarolla G., Liandris E., Pisoni G., Sassera D., Grilli
G., Gallazzi D., Sironi G., Moroni P., Piccinini R.,
Rampin T.: Avian mycobacteriosis in companion birds:
20-year survey. Vet Microbiol 2008, 5, 1-5.
Ramis A., Ferrer L., Aranaz A., Liébana E., Mateos A.,
Domínguez L., Pascual C., Fdez-Garayazabal J., Collins
M.D.: Mycobacterium genavense infection in canaries.
Avian Dis 1996, 40, 246-251.
Thomsen V. Ø., Dragsted U.B., Bauer J., Fuursted K.,
Disseminated J. L.: Infection with Mycobacterium
genavense:
a
challenge
to
physicians
and
mycobacteriologists. J Clin Microbiol 1999, 37, 3901–
3905.
Tortoli E., Simonetti M.T., Dionisio D., Meli M.: Cultural
studies on two isolates of "Mycobacterium genavense"
from patients with acquired immunodeficiency syndrome.
Diagn Microbiol Infect Dis 1994, 18, 7-12.
Wald A., Coyle M.B., Carlson L.C., Thompson R.L.,
Hooton T.M.: Infection with a fastidious Mycobacterium
resembling Mycobacterium simiae in seven patients with
AIDS. Ann Intern Med 1992, 117, 798.
Willard J.M., Lee D.A., Holland M.M.: Recovery of
DNA for PCR amplification from blood and forensic
samples using a chelating resin. Methods Mol Biol 1998,
98, 9-18.