Pobierz PDF (Full Text)

Komentarze

Transkrypt

Pobierz PDF (Full Text)
ISSN 1895-4421
EPISTEME
C Z A SOPI S MO NAUKOWO-KU LTU RAL NE
KRAKÓW
Nr 18, t. III/2013
EPISTEME
CZASOPISMO NAUKOWO-KULTURALNE
Redakcja:
Zdzisław Szczepanik (red. naczelny)
Katarzyna Daraż-Duda (sekretarz redakcji)
Piotr Walecki
Grzegorz Chajko
Krzysztof Duda
Roman Turowski (red. techniczny)
Rada Naukowa:
Prof. dr hab. Dariusz Rott
Prof. dr hab. Włodzimierz Sady
Prof. dr hab. Michał Śliwa
Prof. dr hab. inż. Ryszard Tadeusiewicz
Prof. dr hab. Bogdan Zemanek
Ks. Prof., dr hab. Władysław Zuziak
Prof. nadzw. dr hab. Wiesław Alejziak
Prof. Ignatianum i UJ, dr hab. Józef Bremer SJ
Prof. dr przew. kwal. II Paweł Taranczewski
Prof. dr Olga E. Kosheleva
Prof. dr Marko Jacov
Prof. dr Aleksandr Lokshin
Prof. dr Hans Jørgen Jensen
Prof. dr Oleksandr Chyrkov
Prof. dr Iryna Diachuk
Prof. dr Luiza Arutinov
Prof. dr hab. Michaił Pawłowicz Odesskij
Prof. dr hab., dr. phil. Andrzej Wiercinski
Prof. dr eng. Elena Horska
Wydawca:
Stowarzyszenie Twórców Nauki i Kultury „Episteme”
ul. Okólna 28/87
30–669 Kraków
www.episteme-nauka.pl
© Stowarzyszenie Twórców Nauki i Kultury „Episteme” i Autorzy
Szanowni Państwo,
Z wielką radością oddajemy do Państwa dyspozycji następny
numer Episteme, czasopisma naukowo-kulturalnego. Czynimy to
z tym większą przyjemnością, że numer ten posiada trzy tomową
edycję. Zaś zawarte w nim artykuły są niezwykle starannie dobranymi pracami z zakresu nauk przyrodniczych. Badania zaprezentowane w przedstawionych artykułach wnoszą nowe wyniki w dyscypliny, które sobą reprezentują i są następnym przyczynkiem do dalszego rozwoju tak ich autorów, jak i obszaru dociekań naukowych.
Życząc Państwu dobrej lektury zachęcamy do wnikliwych analiz oraz być może odniesienia się do zaprezentowanych wyników lub
ich uzupełnienia własnymi.
Redakcja
SPIS TREŚCI
A. BIOLOGIA I BIOTECHNOLOGIA
Marta Głogowska, Robert Stawarz
WAPŃ – ANTYKANCEROGEN? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
Bartosz Kozak
WYBÓR STARTERÓW ISSR DO KONSTRUKCJI MAPY GENETYCZNEJ
ŁUBINU WĄSKOLISTNEGO (L. ANGUSTIFOLIUS L.) . . . . . . . . . . . . . . . . . . . . . . . 19
Agnieszka Cencora, Magdalena Troć,
Krzysztof Oklejewicz, Andrzej Skoczowski
PORÓWNANIE WYBRANYCH CECH FIZJOLOGICZNYCH ROŚLIN
HIERACIUM AURANTIACUM L. ROSNĄCYCH W OBRĘBIE
ZWARTEGO ZASIĘGU I POZA LOKALNĄ PÓŁNOCNĄ GRANICĄ ZASIĘGU . . . 29
Aleksandra Dubicka-Lisowska
OCENA OPORNOŚCI NA CHROM SZCZEPÓW Z RODZAJU PSEUDOMONAS . 41
Agata Fabiszewska
WSPÓŁZALEŻNOŚĆ POMIĘDZY WYBRANYMI ŹRÓDŁAMI WĘGLA
W PODŁOŻU A WZROSTEM DROŻDŻY YARROWIA LIPOLYTICA . . . . . . . . . . . . 51
Anna Hebda, Marta Kempf, Kinga Skrzyszewska, Dariusz Grzebelus
Analiza zmienności i określenie struktury genetycznej jodły
wybranych pochodzeń przy wykorzystaniu markerów SSR . . . . . 59
Iwona Kozikowska, Katarzyna Suprewicz, Anna Gał, Katarzyna Szczepańska
Zawartość miedzi i cynku w łożysku kobiet, pępowinie
i krwi pępowinowej w zależności od długości trwania ciąży . . 69
Katarzyna Wajdzik, Gabriela Gołębiowska-Pikania, Maria Wędzony
Mapowanie loci cech ilościowych (QTL)
pszenżyta ozimego (x Triticosecale Wittm.) . . . . . . . . . . . . . . . . . . . . . . . . . 81
Katarzyna Wolny-Koładka, Anna Lenart-Boroń
CHARAKTERYSTYKA SZCZEPÓW BAKTERII
Z RODZAJU STAPHYLOCOCCUS IZOLOWANYCH OD PSÓW . . . . . . . . . . . . . . . 89
Michał Kręgielewski, Dorota Blatsios, Ada Biela
Odziedziczalność wybranych cech morfologicznych
dla mieszańców łubinu wąskolistnego
(Lupinus angustifolius L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95
spis treści
Krzelowska Magdalena, Zimak Paulina,
Kurdziel Magdalena, Łabanowska Maria
Wykorzystanie spektroskopii elektronowego rezonansu
paramagnetycznego (EPR) do oceny nasion owsa
Avena sativa pod względem odporności na stresy . . . . . . . . . . . . . . 103
Magdalena Odrzywolska-Hasiec, Magdalena Troć,
Krzysztof Oklejewicz, Andrzej Skoczowski
WPŁYW WYSOKOŚCI NAD POZIOMEM MORZA NA WYBRANE WŁAŚCIWOŚCI FIZJOLOGICZNE LIŚCI OLSZY ZIELONEJ W BIESZCZADACH . . . . 111
Rafał Ogórek, Agnieszka Lejman
Analiza mikoLogiczna powietrza Jaskini
niedźwiedziej w kletnie. Doniesienie wstępne . . . . . . . . . . . . . . . . . . 121
Paulina Topolińska
MIKOLOGICZNA OCENA KISZONEK Z LUCERNY I TRAW SPORZĄDZONYCH Z DODATKIEM INOKULANTÓW BAKTERYJNYCH . . . . . . . . . 131
Daniel Pruchniewicz, Ludwik Żołnierz
Zróżnicowanie wybranych cech biometrycznych
przetacznika ożankowego (Veronica chamaedrys L.)
na łąkach świeżych Sudetów Środkowych . . . . . . . . . . . . . . . . . . . . . . 139
Katarzyna Suprewicz, Iwona Kozikowska, Magdalena Chrobaczyńska-Dyląg
KUMULACJA RTĘCI W ŁOŻYSKU, OWODNI ORAZ WE KRWI
PĘPOWINOWEJ NOWORODKÓW W POSZCZEGÓLNYCH
GRUPACH WIEKOWYCH KOBIET Z GÓRNEGO ŚLĄSKA . . . . . . . . . . . . . . . . . . 147
B. OCHRONA ŚRODOWISKA
Paulina Drożyner, Andrzej Klasa, Krystyna A. Skibniewska, Baryga Andrzej
STUDIA NAD UTYLIZACJĄ ODCIEKU PO PRODUKCJI BIOGAZU . . . . . . . . . . 157
Edyta Kruk, Marek Ryczek
OCENA STRAT MATERIAŁU GLEBOWEGO W SKUTEK EROZJI WODNEJ
ZLEWNI POTOKU PONICZANKA W KARPATACH ZACHODNICH . . . . . . . . . . 165
Agnieszka Hawryło, Małgorzata Leja, Leszek Książek, Maciej Wyrębek
Prognozowanie zmian hydraulicznych parametrów
siedlisk na wybranym odcinku rzeki Wisłoki . . . . . . . . . . . . . . . . . . . 175
Małgorzata Koncewicz-Baran, Kalina Orłowska, Krzysztof Gondek
ZAWARTOŚĆ CHROMU W GLEBIE I ROŚLINACH PO ZASTOSOWANIU
OSADU ŚCIEKOWEGO PRZEKSZTAŁCONEGO BIOLOGICZNIE I TERMICZNIE . . 183
Marcin Czora, Tomasz Czech
FITOTOKSYCZNY WPŁYW PLATYNY NA PIEPRZYCĘ SIEWNĄ . . . . . . . . . . . . 191
spis treści
Mateusz Malinowski
ANALIZA DOSTĘPNOŚCI KOMUNIKACYJNEJ
POWIATÓW WOJEWÓDZTWA MAŁOPOLSKIEGO . . . . . . . . . . . . . . . . . . . . . . . 199
Monika Mierzwa, Krzysztof Gondek, Kalina Orłowska, Małgorzata Koncewicz-Baran
OCENA ZAWARTOŚCI NIKLU I MANGANU W MISZANINIE OSADU
ŚCIEKOWEGO Z RÓŻNYMI MATERIAŁAMI ORGANICZNYMI
PO PRZEKSZTAŁCENIU TERMICZNYM I BIOLOGICZNYM . . . . . . . . . . . . . . . . 209
Kalina Orłowska, Monika Mierzwa
WPŁYW NATURALNEGO WYCIEKU ROPY
NA AKTYWNOŚĆ BIOLOGICZNĄ GLEBY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 217
Angela Potasznik, Marcin Sidoruk, Ilona Świtajska, Żaneta Banaszek
WPŁYW ROLNICZEGO ZAGOSPODAROWANIA ZLEWNI
NA ZAWARTOŚĆ AZOTU W JEZIORZE SYMSAR . . . . . . . . . . . . . . . . . . . . . . . . . 225
Milena Rusin, Janina Gospodarek
WYSTĘPOWANIE ISOPODA, CHILOPODA I DIPLOPODA
W WARUNKACH GLEBY SKAŻONEJ SUBSTANCJAMI
ROPOPOCHODNYMI ORAZ PODDANEJ PROCESOWI BIOREMEDIACJI . . . 233
Krzysztof Stasiak, Karolina Piekarska
PTAKI WODNE STARORZECZA WISŁY ORAZ OCZYSZCZALNI ŚCIEKÓW
DESZCZOWYCH W PUŁAWACH (WSCHODNIA POLSKA) W 2012 R. . . . . . . . 241
Ilona Świtajska, Sławomir Szymczyk, Angela Potasznik, Żaneta Banaszek
WPŁYW UPRAWY WIERZBY NA CELE ENERGETYCZNE
NA JAKOŚĆ WÓD GRUNTOWYCH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
C. VARIA
Jarosław Bielan, Katarzyna Łyduch, Piotr Cymanow
Działania podjęte na etapie reagowania jako
przykład zarządzania kryzysowego podczas
gradacji kornika drukarza (Ips typographus L.) . . . . . . . . . . . . . . . . 261
Mateusz Cuske, Leszek Gersztyn, Bernard Gałka, Ewa Pora
WPŁYW ODCZYNU NA MOBILNOŚC CYNKU
W GLEBACH ZANIECZYSZCZONYCH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 271
Blanka Ćwieluch, Dorota Merta
ZIMOWA DIETA LISA (VULPES VULPES L.)
W NADLEŚNICTWIE RUSZÓW, BORY DOLNOŚLĄSKIE . . . . . . . . . . . . . . . . . . . . . . . 279
Bartłomiej Glina, Adam Bogacz, Oskar Bojko, Magdalena Kordyjarek
Zróżnicowanie gleb z obszaru torfowiska stokowego
okolic Karłowa (Park Narodowy Gór Stołowych) . . . . . . . . . . . . . 287
spis treści
Alexandra Horváth, Blanka Kovács, Géza Nagy
APPLICATION OF MINT AND CINNAMON AGAINST
FUSARIUM DISEASE OF WINTER WHEAT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 297
Katarzyna Łyduch, Piotr Cymanow
PRIORYTETY ZARZĄDZANIA FINANSAMI OSOBISTYMI
GOSPODARSTW DOMOWYCH W DOBIE KRYZYSU . . . . . . . . . . . . . . . . . . . . . . 305
Márton Takács
PRESENTATION OF THE EUROPEAN SWEET
CHESTNUT CULT AND THE GREATEST . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 313
Łukasz Mendyk, Maciej Markiewicz
Wpływ stopnia odwodnienia na właściwości
gleb wytworzonych z osadów jeziornych . . . . . . . . . . . . . . . . . . . . . 321
Adam Michalski
PRoblem ochrony zasobów węgla organicznego
w Glebach ornych Międzywala Dolnej Wisły . . . . . . . . . . . . . . . . . . . 329
Łukasz Musielok
CHEMICZNE I MIKROBIOLOGICZNE WŁAŚCIWOŚCI PRÓCHNIC GLEB
POD RÓŻNOWIEKOWYMI DRZEWOSTANAMI BUKOWYMI
I ŚWIERKOWYMI W POŁUDNIOWEJ CZĘŚCI GÓR STOŁOWYCH (SUDETY) . . . 339
Beata Ochał, Katarzyna Macnar, Marek Grabowski, Jan Błaszczyk
PORÓWNANIE JAKOŚCI WIN WYPRODUKOWANYCH
Z CZTERECH ODMIAN WINOROŚLI UPRAWIANYCH
W WARUNKACH POLSKI POŁUDNIOWEJ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 349
Éva Pájtli, Ágnes Zámbó, László Palkovics
RECOMBINATION STUDIES
ON A HUNGARIAN POTATO VIRUS S (PVS) ISOLATE . . . . . . . . . . . . . . . . . . . . . 357
Ewa Pora, Jarosław Kaszubkiewicz, Mateusz Cuske, Leszek Gersztyn
Wpływ nacisku gleby oraz zasolenia roztworu
glebowego na właściwości retencyjne superabsorbentów . . . 367
Elżbieta Rymar
Ocena odporności na parcha jabłoni wybranych
odmian jabłoni w kontekście ogrodnictwa
ekologicznego na obszarze Podkarpacia . . . . . . . . . . . . . . . . . . . . . . . 375
Annamária Tóth, Marietta Petróczy, László Palkovics
Antifungal activity of essential oils against
the pathogen of sour cherry anthracnose . . . . . . . . . . . . . . . . . . . . . 389
Urszula Waligóra
SYRPHIDAE W SIEDLISKU ŁĄKOWYM GMINY KOZŁÓW . . . . . . . . . . . . . . . . . . 397
spis treści
Karolina Konieczna, Tomasz Olbrycht
PARK PODMIEJSKI JAKO SIEDLISKO WYSTĘPOWANIA
DRAPIEŻNYCH BIEGACZOWATYCH (COL., CARABIDAE) . . . . . . . . . . . . . . . . . . . 407
Leszek Gersztyn, Mateusz Cuske, Anna Karczewska, Bernard Galka
Wpływ zakwaszenia i alkalizacji
na rozpuszczalność cynku w osadach poflotacyjnych . . . . . . . 419
János Ádám, István Tóbiás, Asztéria Almási, Zdeno Šubr
Alžbeta Nagyová, Miroslav Glasa, László Palkovics
The presence of Sharka disease on stone fruit TREES
in the Hungarian-Slovak cross-border region . . . . . . . . . . . . . . . . . . 429
Pelagia Biłka, Magda Pluta, Bartosz Mitka
WYKORZYSTANIE NOWOCZESNYCH TECHNIK POMIAROWYCH
W MONITOROWANIU DUŻYCH OBIEKTÓW HYDROTECHNICZNYCH . . . . . . 437
Mariusz Antolak, Anna Mazur, Marzena Płaza, Katarzyna Ruszczycka
WARMIŃSKIE KAPLICZKI OLSZTYNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 445
Grażyna Kaczyńska, Aneta Lipińska
Wpływ zanieczyszczenia gleby
metalami ciężkimi na drobnoustroje . . . . . . . . . . . . . . . . . . . . . . . . . . . . 453
Aneta Lipińska, Grażyna Kaczyńska
LICZEBNOŚĆ BAKTERII ORGANOTROFICZNYCH W GLEBIE PODDANEJ PRESJI WWA . . . . . . . . . . . . . . . . . . . . . . 463
Katarzyna Olczak, Monika Petrynka, Marek Tischner
WPŁYW PRZERWY W SZKOLENIU PODSTAWOWYM
NA REAKCJE STRESOWE U MŁODYCH KONI HUCULSKICH . . . . . . . . . . . . . . 471
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
UKORZENIANIE KARŁOWYCH ODMIAN
TAWUŁY JAPOŃSKIEJ I BERBERYSU THUNBERGA . . . . . . . . . . . . . . . . . . . . . . . 479
Mariusz Adamski, Katarzyna Pisarska
Ocena zróżnicowania endosymbiotycznych bakterii
zasiedlających komórki boczniaka
Pleurotus (Fr.) P. Kumm) z wykorzystaniem techniki MSSCP . . . . . 491
Agata Fabiszewska, Krystyna Zielińska
WPŁYW OBECNOŚCI OCHRATOKSYNY A
NA WZROST SZCZEPÓW Z RODZAJU LACTOBACILLUS . . . . . . . . . . . . . . . . . . . 499
A. BIOLOGIA I BIOTECHNOLOGIA
Marta Głogowska
Robert Stawarz
EPISTEME
18/2013, t. 3
s. 11–17
ISSN 1895-2241
WAPŃ – ANTYKANCEROGEN?
CALCIUM – ANTI-CANCIROGEN?
Abstrakt. Odpowiednio duże spożycie wapnia może zapobiegać zachorowaniu na raka jelita grubego, bo dociera on zwykle aż do okrężnicy, gdzie
wiąże substancje sprzyjające rozwojowi raka. Materiał badawczy stanowiły
zdrowe tkanki ludzkie, stanowiące grupę kontrolną, pochodzące z żołądka
i jelita grubego oraz tkanki nowotworowe, stanowiące grupę eksperymentalną, pochodzące z tych samych narządów. Zawartość wapnia w badanych
tkankach zmierzono metodą spektrofotometryczną płomieniową FAAS.
Średnia zawartość wapnia jest wyższa w tkankach zdrowych przewodu pokarmowego zarówno u kobiet, jak i u mężczyzn. W przypadku tkanek nowotworowych, większą koncentrację wapnia stwierdzono w tkance guza
żołądka 2185.166±1579.209 µg•g-1s.m., z kolei w jelicie grubym większą
zawartość wapnia stwierdzono w śluzówce przyległej do guza nowotworowego 4305.186±10114.302 µg•g-1s.m. Badania sugerują, iż Ca ma wyraźnie
ochronne działanie na ryzyko wystąpienia raka żołądka i jelita grubego.
Słowa kluczowe: wapń, nowotwór, jelito grube, żołądek, kancerogeneza
Summary. Proper intake of calcium may prevent the cancer of large intestine because it reaches colon where it binds substances supporting the
development of cancer. Research material consisted of healthy human tissues from stomach and large intestine which were the control group and
cancer tissues which were experimental group and they came from the
same organs. The amount of calcium in examined tissues was measured using FAAS method. Average amount of calcium is higher in healthy tissues
of alimentary canal both for men and women. In case of cancerous tissues
the higher concentration of calcium was observed in the tissue of stomach tumor 2185.166±1579.209 µg•g-1s.m. but in large intestine the higher
amount of calcium was observed in mucous membrane adjacent to the tumor 4305.186±10114.302 µg•g-1s.m. The research suggests that Ca has clear
protective impact on the risk of stomach and large intestine cancer.
Key words: calcium, cancer, large intestine, stomach, carcinogenesis
11
Marta Głogowska, Robert Stawarz
Wstęp
Jedno z najwcześniejszych badań na temat hamującego wpływu wapnia na wzrost komórek raka jelita grubego przeprowadzono w Memorial Sloan – Kettering Center w roku 1985. Obserwowano wpływ
podawania wapnia na błonę śluzową jelita grubego u osób rodzinnie obciążonych rakiem jelita grubego. Przed rozpoczęciem badania
stwierdzono u tych osób zwiększoną częstotliwość podziałów komórek. Po zakończeniu doświadczenia wykazano, że komórki jelita grubego zmniejszyły częstość podziałów do poziomu charakterystycznego dla zdrowych osób. Drugie z bardziej interesujących serii badań
wykonano w St. Luke’s – Roosevelt Hospital Center i w Uniwersytecie Columbia w Nowym Jorku. Badacze wykazali, że u osób, które poprzednio miały polipy, zwiększenie dziennej dawki wapnia do
1,2 grama dziennie ogranicza liczbę komórek przedrakowych. Badając związek między przyjmowaniem wapnia a rakiem jelita grubego,
stwierdzono, że zagrożenie rakiem lewej części okrężnicy było mniejsze u osób, które spożywały około 700 lub więcej miligramów wapnia
dziennie, niż u osób, które spożywały 500 miligramów wapnia lub
mniej. Wyniki te wskazują, że nawet niewielka różnica w spożyciu
wapnia ma duże znaczenie w profilaktyce raka. Przypuszcza się, że
sole wapnia łączą się z kwasami żółciowymi i kwasami tłuszczowymi,
przekształcając je w związki nierozpuszczalne. W tej postaci organizm może je bezpiecznie wydalić. Kwasy żółciowe mogą podrażniać
komórki jelita grubego, stymulując ich niekontrolowane podziały
[Bennett i Pochapin 2004]. Odpowiednio duże spożycie wapnia może
zapobiegać zachorowaniu na raka jelita grubego, bo dociera on zwykle
aż do okrężnicy, gdzie wiąże substancje sprzyjające rozwojowi raka.
1. Materiał i metody
Materiał badawczy stanowiły zdrowe tkanki ludzkie (n=26 pacjentów),
stanowiące grupę kontrolną, pochodzące z żołądka (n=17 tkanek) i jelita grubego (n=19 tkanek) oraz tkanki nowotworowe (n=35 pacjentów),
stanowiące grupę eksperymentalną, pochodzące także z żołądka (n=10
tkanek) i jelita grubego (n=25 tkanek). Próbki tkanek nowotworowych
wymienionych narządów były dodatkowo podzielone na dwie klasy:
12
Wapń – antykancerogen?
I – tkanka pochodząca bezpośrednio z guza nowotworowego
II – tkanka przylegająca do guza nowotworowego.
Wiek wszystkich pacjentów mieścił się w przedziale 20–90 lat.
Zdrowe tkanki pobierano w trakcie sekcji zwłok, natomiast tkanki
nowotworowe podczas zabiegów operacyjnych (resekcje częściowe
lub całkowite zajętych procesem nowotworowym narządów).
Materiał do badań pochodził od osób z Krakowa i okolic i był bezpośrednio odbierany z Zakładu Patomorfologii 5 Wojskowego Szpitala
Klinicznego z Polikliniką w Krakowie, Niepublicznego Zakładu Opieki
Zdrowotnej PROSMED w Krakowie i Szpitala Onkologicznego im. Marii Skłodowskiej-Curie w Krakowie. Każdą próbkę poddano procedurom umożliwiającym oznaczanie w tkankach zawartości wapnia. Zastosowano metodę mineralizacji na mokro. W kolbach mineralizatora
umieszczono wysuszony i zważony materiał badawczy. Następnie dodano 1cm3 kwasu azotowego o stężeniu 65%. Próbki ogrzewano przez
około 2 godz., w temperaturze 105°C. Następnie mineralizaty przeniesiono do kolbek miarowych o pojemności 10 cm3 i dopełniono wodą
destylowaną. Uzyskane roztwory posłużyły do analizy zawartości wapnia metodą spektrofotometryczną płomieniową FAAS. W ten sposób
oznaczono absorbancję dla wapnia, a wartości absorbancji przeliczone
zostały na zawartość metalu w próbkach. Wynik wyrażono w mikrogramach na gram suchej masy tkanki (µg•g-1 s.m).
2. Wyniki
W opisie statystycznym badanych cech wykorzystano następujące statystyki: średnią arytmetyczną, odchylenie standardowe, błąd
standardowy średniej. Za pomocą testu W Shapiro-Wilka określono
normalność rozkładu w poszczególnych grupach badawczych. Ponieważ stwierdzono występowanie licznych rozkładów nienormalnych
w celu zbadania, które z porównywanych średnich różnią się istotnie,
a które nie, stosowano test Kruskala-Wallisa dla prób niezależnych.
Po odrzuceniu hipotezy zerowej stosowano właściwy dla tego testu
test wielokrotnych porównań. Wszystkie hipotezy zerowe były falsyfikowane na poziomie istotności α=0.05.
W opracowaniu wyników, oprócz narządu, uwzględniono płeć
i wiek osób, od których zostały pobrane tkanki. Dzięki temu moż13
Marta Głogowska, Robert Stawarz
na prześledzić jak zmienia się zawartość wapnia w żołądku i jelicie
grubym, w zależności od stanu zdrowia i wieku badanych pacjentów.
W obliczeniach statystycznych posłużono się testem U Manna Whitney’a, w celu sprawdzenia różnic między dwoma próbami.
Średnia zawartość wapnia jest wyższa w tkankach zdrowych
przewodu pokarmowego zarówno u kobiet, jak i u mężczyzn, w porównaniu do tkanek nowotworowych (wykres 1).
Wyk. 1. Średnie stężenie wapnia w przewodzie pokarmowym kobiet
i mężczyzn zdrowych i chorych (µg•g-1 s.m.).
Średnie stężenie wapnia w tkankach przewodu pokarmowego jest
wyższe u kobiet zdrowych z przedziału wiekowego 20–60 lat, w porównaniu do kobiet powyżej 60 roku życia, gdzie stężenie wapnia jest
nieznacznie wyższe u pacjentek chorych. W przypadku mężczyzn,
średnie stężenie wapnia jest wyższa także u pacjentów zdrowych, z grupy wiekowej 20–60 lat (wykres 2). Analiza statystyczna polegała na
zastosowaniu testu U Manna-Whitney’a, w celu sprawdzenia różnic
w średniej zawartości badanych pierwiastków pomiędzy dwoma grupami wiekowymi osobno dla kobiet zdrowych i chorych i dla mężczyzn zdrowych i chorych.
Średnie stężenie wapnia w tkance guza żołądka wyniosło
2185.166±1579.209 µg•g-1s.m., a w przylegającej do niego tkance
14
Wapń – antykancerogen?
zdrowej 999.885±39.006 µg•g-1s.m. Dla jelita grubego średnia stężenie wapnia w guzie wyniosło 3611.241±8451.231 µg•g-1s.m., a w przylegającej do niego tkance zdrowej 4305.186±10114.302 µg•g-1s.m.
Omówione wyniki zilustrowano na wykresie 3.
Wyk. 2. Średnie stężenie wapnia w tkankach zdrowych i nowotworowych
przewodu pokarmowego kobiet i mężczyzn w wieku 20–60 i 61–90 lat
(µg•g-1 s.m.).
Wyk. 3. Średnie stężenie wapnia w tkankach nowotworowych i przylegających tkankach zdrowych żołądka i jelita grubego człowieka
(µg•g-1s.m.).
15
Marta Głogowska, Robert Stawarz
3. Dyskusja i wnioski
Śluzówka zdrowego żołądka zawiera średnio 2991.688 µg•g-1 s.m.
wapnia, co znacznie przewyższa średnią zawartość Ca w śluzówce
zdrowej przylegającej do guza żołądka (999.885 µg•g-1 s.m.) i prawdopodobnie świadczy o jego kumulacji bezpośrednio w tkance guza.
Wchłanianie wapnia w jelitach jest ułatwione dzięki obecności białka, hamowane jest natomiast w obecności fosforanów i szczawianów, ponieważ te aniony tworzą w jelicie z jonem Ca2+ nierozpuszczalne sole [Lachowicz 1994]. Śluzówka jelita grubego ma najwyższą
średnią zawartość wapnia (29922.583 µg•g-1 s.m) w porównaniu do
zawartości Ca w śluzówce żołądka, co popiera fakty o hamującym
wpływie Ca na karcynogenezę w komórkach jelita grubego (duża zawartość Ca w śluzówce osób zdrowych zapobiega powstaniu zmian
nowotworowych).
Rola wapnia i witaminy D w profilaktyce raka jelita grubego jest
dokładnie zbadana [Wargovich i Lointier 1987]. Niedobór wapnia
przyczyniający się do procesu nowotworzenia w żołądku i jelicie grubym, jest nie tylko wynikiem jego słabej podaży wraz z dietą, ale także podatności na interakcje z innymi metalami. Glin zastępuje wapń
w tkankach miękkich, częściowo w kościach i jest toksyczny dla komórek [Severson i in. 1992]. Średnia zawartość wapnia jest wyższa
w tkance guza żołądka (2185.166 µg•g-1 s.m.), w porównaniu do marginesu śluzówki zdrowej otaczającej guz (999.885 µg•g-1 s.m.). Świadczy to o zbyt małej zawartości tego pierwiastka w zdrowych tkankach
osób chorych, co może indukować karcynogenezę w żołądku, tym
bardziej, że badania sugerują, iż Ca ma wyraźnie ochronne działanie na ryzyko wystąpienia raka żołądka [Yang i in. 1998]. W przypadku jelita grubego średnia zawartość wapnia jest z kolei wyższa
w śluzówce otaczającej guz (4305.186 µg•g-1 s.m.), w porównaniu
do tkanki nowotworowej (3611.241 µg•g-1 s.m.). Wartości te jednoznacznie wskazują na ochronne działanie wapnia, o czym świadczy średnie stężenie wapnia w śluzówce osób zdrowych (29922.583
µg•g-1 s.m). Wyższy poziom Ca jest związany z obniżonym ryzykiem
raka okrężnicy [Kampman i in. 2000]. Z badań wynika, że im więcej
wapnia spożywamy, tym mniejsze prawdopodobieństwo zachorowania na raka jelita grubego, być może dlatego, że wapń hamuje wzrost
16
Wapń – antykancerogen?
komórek nowotworu. Również osoby, u których stwierdzono polipy
jelita grubego, i które spożywają suplementy wapnia, obciążone są
mniejszym ryzykiem nawrotu polipów, co w efekcie daje mniejsze ryzyko rozwoju raka jelita grubego [Pressmann i Buff 2006].
literatura
1. Bennett M., Pochapin M. D. 2004. Rak jelita grubego. Poznań. Dom Wydawniczy REBIS. 65–170.
2. Kampman E., Slattery M. L., Caan B., Potter J. D. 2000. Calcium, vitamin
D, sunshine exposure, dairy product and colon cancer risk (United States).
Cancer Causes and Control. 11, 459–466.
3. Lachowicz L. 1994. Czynność układu trawiennego. W: GANONG, W. F.: Fizjologia-podstawy fizjologii lekarskiej. Warszawa. Wydawnictwo Lekarskie PZWL, 565–578.
4. Pressman A. H., Buff S. 2006. Witaminy i minerały. Przewodnik dla każdego.
Warszawa. KDC. 219–294.
5. Severson A. R., Haut C. F., Firling C. E., Huntley T. E. 1992. Influence of
short-term aluminum exposure on demineralized bone matrix induced bone
formation. W: Archives of Toxicology. 66, 706–712.
6. Wargovich M. J., Lointier P.H. 1987. Calcium and vitamin D modulate
mouse colon epithelial proliferation and growth characteristics of a human colon tumor cell line. W: Canadian Journal of Physiology and Pharmacology. 65, 472–7.
7. Yang Ch. Y., Cheng M.F., Tsai S. S., Hsieh Y. L. 1998. Calcium, Magnesium,
and Nitrate in Drinking Water and Gastric Cancer Mortality. 89, 124–130.
mgr Marta Głogowska
Zakład Zoologii Kręgowców i Biologii Człowieka
Uniwersytet Pedagogiczny w Krakowie
e-mail: [email protected]
dr hab. Robert Stawarz, prof. UP
Zakład Zoologii Kręgowców i Biologii Człowieka
Uniwersytet Pedagogiczny w Krakowie
Opiekun naukowy: dr hab. Robert Stawarz prof. UP
17
Bartosz Kozak
EPISTEME
18/2013, t. 3
s. 19–28
ISSN 1895-2241
WYBÓR STARTERÓW ISSR DO KONSTRUKCJI
MAPY GENETYCZNEJ ŁUBINU WĄSKOLISTNEGO
(L. ANGUSTIFOLIUS L.)
ISSR PRIMERS SELECTION FOR GENETIC LINKAGE
MAPS CONSTRUCTION OF NARROW-LEAFED LUPINE
(Lupinus angustifolius L.)
Abstrakt. W przeprowadzonych badaniach analizowano polimorfizmy uzyskiwane przy zastosowaniu 100 starterów ISSR z listy UBC#9 (University
of British Columbia). Badano dwa genotypy łubinu wąskolistnego (Lupinus
angustifolius L.), odmianę ‘Emir’ oraz ród LAE-1, formy rodzicielskie populacji mapującej, na podstawie której tworzona jest mapa genetyczna. ISSR-PCR przeprowadzono w optymalnej temperaturze (ustalonej eksperymentalnie) dla każdego startera na matrycy genomowego DNA obydwu form
rodzicielskich. Procedurę ISSR-PCR przeprowadzono według Ziętkiewicz
i in. 1994 (zmodyfikowany). Rozdział produktów amplifikacji wykonano
z wykorzystaniem urządzenia Quiaxcel (Qiagen, Niemcy). Z przetestowanych 100 starterów ISSR do dalszych prac związanych z genotypowaniem
populacji mapującej wytypowano 78 generujących polimorficzne i powtarzalne produkty amplifikacji u form rodzicielskich.
Słowa kluczowe: Łubin wąskolistny, ISSR, DNA fingerprinting, genotypowanie
Summary. In this study number of polymorphisms obtained by using 100
ISSR primers from the list # 9 UBC (University of British Columbia) was
analyzed. The study was conducted on two genotypes of narrow-leafed lupin
(Lupinus angustifolius L.), cv ‘Emir’ and the breeding line LAE-1 a parental
forms of mapping population on which the genetic map is created. ISSRPCR was carried out at optimal temperature for each primer (experimentally established) on template of genomic DNA both of the parents. ISSR-PCR
was performed according to the Ziętkiewicz et al. (1994) modified method.
Separation of the amplification products was performed using the Quiaxcel
(Qiagen, Germany) by conducting capillary electrophoresis. Among 100 of
tested ISSR primers 78 generated polymorphic and reproducible amplification products in the parental form were selected for performing the genetics
map in the mapping population.
Key worlds: Narrow-leafed lupine, ISSR, DNA fingerprinting, genotyping
19
Bartosz Kozak
Wstęp
Wśród roślin motylkowatych łubin wąskolistny (Lupinus angustifolius
L.) wzbudza coraz szersze zainteresowanie hodowców i rolników ze
względu na jego zdolność adaptacji na glebach lekkich i zakwaszonych oraz wysoką zawartość białka w nasionach (31–34%) [Galek
i Sawicka-Sienkiewicz 2001; Sujak i in. 2006]. W stosunku do dwóch
pozostałych gatunków łubinu uprawianych w Polsce (łubinu żółtego
i białego) łubin wąskolistny odznacza się wyższą polową odpornością na antraknozę, chorobę powodowaną przez Colletotrichum lupini [Nirenberg 2003; Thomas i Sweetingham 2004.]. Ponadto, łubin
wąskolistny dzięki wyhodowaniu odmian o zdeterminowanym typie
wzrostu (tzw. samokończących) oraz tolerancji na opóźnienie siewu
(odmiany termoneutralne) charakteryzuje się najkrótszym okresem
wegetacji. [Boersma 2005]. Dzięki tym cechom łubin wąskolistny
może stać się alternatywą dla importowanej z zagranicy soi szczególnie do produkcji paszy treściwej. Areał zasiewu łubinu wąskolistnego nadal jednak pozostaje niski (według danych GUS ok. 36 tys. ha),
między innymi dlatego, że obecne odmiany nadal posiadają pewne
niekorzystne cechy, których jak dotąd nie wyeliminowano w procesie hodowlanym. Należy tu wymienić: nierównomierne dojrzewanie
strąków i nasion u form o niezdeterminowanym typie wzrostu, pękające strąki oraz osypywanie się nasion. Odporność na choroby jest
także cechą, na którą należy zwrócić uwagę w dalszych pracach hodowlanych [Sawicka–Sienkiewicz i in. 2007].
Dla gatunku tego opracowane zostały już mapy genetyczne [Boersma i in. 2005, Nelson i in. 2006, Nelson i in. 2010], jednak przy
wykorzystaniu, jako rodziców prymitywnej formy z terenów Maroka
i australijskiego rodu. Dla polskich materiałów dotychczas nie została
opracowana mapa genetyczna tego gatunku. Co więcej na opracowanych do tej pory mapach z ważnych dla hodowców cech zmapowano
niemal wyłącznie cechy dziedziczone monogenicznie. Brak natomiast informacji o cechach poligenicznych takich jak: plon (wierność
plonowania), wczesność, wysokość roślin, zawartość białka, tłuszczu oraz alkaloidów [Nelson i in. 2010]. Ponadto kilka ważnych cech
dziedziczonych jednogenowo takich jak np. typ wzrostu (tradycyjny/
zdeterminowany) nadal nie zostały zmapowane. W związku z tym
20
Wybór starterów issr do konstrukcji mapy genetycznej łubinu wąskolistnego...
istnieje potrzeba opracowania mapy genetycznej dla łubinu wąskolistnego z wykorzystaniem polskich materiałów hodowlanych oraz
naniesienie na niej cech ilościowych – QTL. Stworzenie takiej mapy
mogłoby znacznie przyspieszyć prace hodowlane.
Do tworzenia map genetycznych wykorzystuje się wiele systemów markerów, ale jednym z najczęściej stosowanych jest ISSR (ang.
Inter Simple Sequence Repeat). Wykorzystując technikę ISSR można
otrzymać bardzo dużą liczbę polimorficznych markerów DNA, przy
stosunkowo niskim nakładzie pracy i środków finansowych. Technika ISSR jest stosunkowo prosta i tania podobnie jak RAPD, ale jednocześnie dużo bardziej powtarzalna [Ziętkiewicz i in 1994]. Technika
ISSR wielokrotnie była już wykorzystywana do tworzenia map genetycznych u roślin [Kojima i in. 1998, Casasoli i in. 2001].
Celem niniejszej pracy było przetestowanie 100 starterów ISSR
z listy UBC#9 (University of British Columbia), dla wyboru tych, które generują powtarzalny polimorfizm w badanym materiale. Badania
prowadzono na dwóch genotypach łubinu wąskolistnego (Lupinus angustifolius L.): odmianie ‘Emir’ i rodzie LAE-1. Genotypy te były formami rodzicielskimi otrzymanych 148 linii typu RIL’s (ang. Recombinant Inbred Lines), stanowiących populację mapującą do opracowania
mapy genetycznej z wykorzystaniem między innymi markerów ISSR.
Materiały i metody
DNA wyizolowano według metody Doyl i Doyl 1987 (zmodyfikowany) z użyciem CTAB. Ok. 100 mg św. m. liści rozcierano w buforze
ekstrakcyjnym z użyciem urządzenia TissiuLyse (Qiagen, Niemcy),
po czym inkubowano w buforze ekstrakcyjnym przez godzinę. Następnie dodawano mieszaninę chloroform izoamyl (24:1), mieszano
10 min i wirowano 10 min. Fazę wodną (górną) po wirowaniu przenoszono do nowej próbówki i dodawano 2/3 objętości izopropanolu.
DNA wytrącano w temperaturze -20°C przez 30 min. Próbki wirowano w 4°C przez 30 min, płukano etanolem i ponownie wirowano
przez 5 min. Po zlaniu etanolu próbki suszono próżniowo przez 10
min i zawieszano w wodzie MQ. Po izolacji ilość i jakość DNA sprawdzano elektroforetycznie i spektrofotometrycznie. Do dalszych analiz przygotowano roztwory DNA o stężeniu 30 ng * ml-1.
21
Bartosz Kozak
PCR wykonywano na termocyklerze Biometria. W reakcji amplifikacji wykorzystano 100 starterów ISSR z listy UBC#9 (University of
British Columbia), tabela 1. PCR przeprowadzono w objętości 15 ml,
a mieszanina reakcyjna zawieraBa: 7,5 ml 2xPCR Master Mix Plus
(AA Biotechnology, Polska), 0,53 mM startera oraz 36 ng matrycowego DNA. Profil termiczny: wstpna denaturacja: 94°C przez 5 min,
40 cykli denaturacja: 94 °C 30 sek, przyBczanie starterów: optymalna temperatura dla danego startera (tabela 1) 30 sek, amplifikacja: 72 °C 45 min, koDcowa amplifikacja: 72 °C przez 7 min. Optymaln temperatur dla ka|dego startera ustalono we wcze[niejszych
badaniach przeprowadzajc PCR w gradiencie temperatury (dane
nieopublikowane). ISSR-PCR dla ka|dego startera przeprowadzono
w dwóch powtórzeniach. Produkty amplifikacji rozdzielano z wykorzystaniem urzdzenia Qiaxcel (Qiagen, Niemcy). Do rozdziału używano zestawu Screening Kit (Qiagen, Niemcy) czas poboru próbki 10
s, czas rozdziału 420 s, alligment 15 bp – 3 kbp, marker wielkości 100
bp – 2,5 kbp. Do analizy danych po rozdziale na urządzeniu Qiaxcel
wykorzystano oprogramowanie QIAxcel ScreenGel (Qiagen, Niemcy). Za polimorficzne uznawano prążki, które były obecne w dwóch
powtórzeniach u jednego z badanych genotypów, a nie były obecne
w dwóch powtórzeniach u drugiego z badanych genotypów.
Wyniki i dyskusja wyników:
Tab. 1. Zestawienie starterów użytych w badaniach, 1 – brak produktów
amplifikacji z użyciem tego startera, R – puryna; Y – pirymidyna;
N dowolny nukleotyd; B zawiera C, G lub T; D jako A, G, lub T;
H jako A, C, lub T; i V jako A, C, lub G.
Numer
UBC
801
802
803
804
22
Sekwencja 5' do 3'
ATA TAT ATA TAT ATA TT
ATA TAT ATA TAT ATA TG
ATA TAT ATA TAT ATA TC
TAT ATA TAT ATA TAT AA
Optymalna
temperatura
amplifikacji
[°C]
45–50
45–50
45–50
45–50
Liczba poliNumorficznych
mer
produktów
UBC
amplifikacji
-1
-1-1
-1
851
852
853
854
Wybór starterów issr do konstrukcji mapy genetycznej łubinu wąskolistnego...
Numer
UBC
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
Sekwencja 5' do 3'
TAT ATA TAT ATA TAT AC
TAT ATA TAT ATA TAT AG
AGA GAG AGA GAG AGA GT
AGA GAG AGA GAG AGA GC
AGA GAG AGA GAG AGA GG
GAG AGA GAG AGA GAG AT
GAG AGA GAG AGA GAG AC
GAG AGA GAG AGA GAG AA
CTC TCT CTC TCT CTC TT
CTC TCT CTC TCT CTC TA
CTC TCT CTC TCT CTC TG
CAC ACA CAC ACA CAC AT
CAC ACA CAC ACA CAC AA
CAC ACA CAC ACA CAC AG
GTG TGT GTG TGT GTG TA
GTG TGT GTG TGT GTG TC
GTG TGT GTG TGT GTG TT
TCT CTC TCT CTC TCT CA
TCT CTC TCT CTC TCT CC
TCT CTC TCT CTC TCT CG
ACA CAC ACA CAC ACA CT
ACA CAC ACA CAC ACA CC
ACA CAC ACA CAC ACA CG
TGT GTG TGT GTG TGT GA
TGT GTG TGT GTG TGT GC
TGT GTG TGT GTG TGT GG
ATA TAT ATA TAT ATA TYA
ATA TAT ATA TAT ATA TYC
ATA TAT ATA TAT ATA TYG
AGA GAG AGA GAG AGA GYT
Optymalna
temperatura
amplifikacji
[°C]
45–50
45–50
52–53
52–53
50–52
46,548,5
52–53
43
43–45
43–46,5
45–46,5
48–50
48–50
48–50
50
41,5–43
46,5–50
50–52
50–52
41,5–43
48–52
50–54,5
48,5–53,5
48,5
48,5–53
45–50
45–50
45–50
45–50
54,5
Liczba poliNumorficznych
mer
produktów
UBC
amplifikacji
-1
-1
2
2
3
3
4
3
4
6
2
2
8
1
1
1
6
2
2
1
0
4
6
2
3
-1
-1
-1
6
1
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
23
Bartosz Kozak
Numer
UBC
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
24
Sekwencja 5' do 3'
AGA GAG AGA GAG AGA GYC
AGA GAG AGA GAG AGA GYA
TAT ATA TAT ATA TAT ART
TAT ATA TAT ATA TAT ARC
TAT ATA TAT ATA TAT ARG
GAG AGA GAG AGA GAG AYT
GAG AGA GAG AGA GAG AYC
GAG AGA GAG AGA GAG AYG
CTC TCT CTC TCT CTC TRA
CTC TCT CTC TCT CTC TRC
CTC TCT CTC TCT CTC TRG
CAC ACA CAC ACA CAC ART
CAC ACA CAC ACA CAC ARC
CAC ACA CAC ACA CAC ARG
GTG TGT GTG TGT GTG TYA
GTG TGT GTG TGT GTG TYC
GTG TGT GTG TGT GTG TYG
TCT CTC TCT CTC TCT CRA
TCT CTC TCT CTC TCT CRT
TCT CTC TCT CTC TCT CRG
ACA CAC ACA CAC ACA CYT
ACA CAC ACA CAC ACA CYA
ACA CAC ACA CAC ACA CYG
TGT GTG TGT GTG TGT GRT
TGT GTG TGT GTG TGT GRC
TGT GTG TGT GTG TGT GRA
ACC ACC ACC ACC ACC ACC
AGC AGC AGC AGC AGC AGC
AGT AGT AGT AGT AGT AGT
ATG ATG ATG ATG ATG ATG
Optymalna
temperatura
amplifikacji
[°C]
48,5–50
48,5–50,2
45–50
45–50
45–50
45–50
50
43–46,5
46,5–48,5
45–48,5
43–45
45–50
45–46,5
45–46,5
41,5–43
41,5–43
43
43–45
45–46,5
45–46,5
53,5
53,5
53,5
52–53,5
52–53,5
52–53,5
45–46,5
46,5
43–46,5
48,5–50
Liczba poliNumorficznych
mer
produktów
UBC
amplifikacji
6
1
-1
-1
-1
-1
0
4
2
2
2
3
2
3
3
4
3
3
3
1
2
1
3
2
1
3
3
4
1
2
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
851
852
853
854
855
856
857
858
859
860
861
862
863
864
Wybór starterów issr do konstrukcji mapy genetycznej łubinu wąskolistnego...
Numer
UBC
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
Sekwencja 5' do 3'
CCG CCG CCG CCG CCG CCG
CTC CTC CTC CTC CTC CTC
GGC GGC GGC GGC GGC GGC
GAA GAA GAA GAA GAA GAA
GTT GTT GTT GTT GTT GTT
TGC TGC TGC TGC TGC TGC
TAT TAT TAT TAT TAT TAT
GAT AGA TAG ATA GAT A
GAC AGA CAG ACA GAC A
CCC TCC CTC CCT CCC T
CTA GCT AGC TAG CTA G
GAT AGA TAG ACA GAC A
TGC ATG CAT GCA TGC A
GGA TGG ATG GAT GGA T
CTT CAC TTC ACT TCA
GGA GAG GAG AGG AGA
GGG TGG GGT GGG GTG
VBV ATA TAT ATA TAT AT
BVB TAT ATA TAT ATA TA
HBH AGA GAG AGA GAG AG
BHB GAG AGA GAG AGA GA
VDV CTC TCT CTC TCT CT
DVD TCT CTC TCT CTC TC
BDB CAC ACA CAC ACA CA
DBD ACA CAC ACA CAC AC
VHV GTG TGT GTG TGT GT
HVH TGT GTG TGT GTG TG
TAG ATC TGA TAT CTG AAT TCC C
NNN NNN NNN NNN NNN
TGG TAG CTC TTG ATC ANN NNN
Optymalna
temperatura
amplifikacji
[°C]
48–52
48–52
48–53,5
46,5–50
50
50
50–52
50–52
46,5–50
48–52
48–52
46,5–48,5
45–46,5
45–46,5
45–48,5
45–46,5
46,5–50
43–46,5
48–52
50–52
50–54,5
48–50
46,5–50
43–45
41,5–43
41,5–43
41–45
41,5–45
45–50
45–50
Liczba poliNumorficznych
mer
produktów
UBC
amplifikacji
4
4
2
6
1
3
7
6
6
1
1
1
2
2
2
3
3
3
4
3
0
1
4
2
2
2
3
4
-1
0
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
25
Bartosz Kozak
Numer
UBC
Sekwencja 5' do 3'
Optymalna
temperatura
amplifikacji
[°C]
895
896
897
898
899
900
AGA GTT GGT AGC TCT TGA TC
AGG TCG CGG CCG CNN NNN NAT G
CCG ACT CGA GNN NNN NAT GTG G
GAT CAA GCT TNN NNN NAT GTG G
CAT GGT GTT GGT CAT TGT TCC A
ACT TCC CCA CAG GTT AAC ACA
45–50
45–50
45–50
45–50
45–46,5
45–46,5
Liczba poliNumorficznych
mer
produktów
UBC
amplifikacji
0
0
1
0
1
0
895
896
897
898
899
900
Ze stu przetestowanych starterów ISSR 14 nie dawało żadnych
produktów amplifikacji. Z 86 starterów generujących produkty amplifikacji 72 produkowało od jednego do ośmiu powtarzalnych i polimorficznych produktów na matrycy genomowego DNA odmiany
‘Emir’ oraz rodu LAE-1, (tabela1). Pozostałe 8 starterów generowało
produkty nie polimorficzne. Łączna liczba otrzymanych polimorficznych produktów wynosiła 223, a średnia na jeden starter generujący produkty amplifikacji wynosiła 2,6. Otrzymane wyniki pozostają
zgodne z doniesieniami innych autorów, którzy uzyskiwali podobną
średnią liczbę produktów amplifikacji na jeden starter [Fernández
i in. 2002].
Przy założeniu, że markery te będą równomiernie rozłożone w genomie, z doniesień innych autorów wynika, że liczba uzyskanych
w ten sposób polimorficznych markerów powinna być wystarczająca
do utworzenia szkieletu przygotowywanej mapy [Nelson i in. 2006].
Ostateczną weryfikacją tego założenia będzie jednak dopiero wykreślenie genetycznej mapy sprzężeń.
Wnioski
Po przetestowaniu 100 starterów ISSR stwierdzono, że:
1. Analizowane startery generowały zróżnicowany polimorfizm
u badanych genotypów.
2. Przebadane startery wygenerowały łącznie 234 polimorficzne
i powtarzalne produkty amplifikacji.
26
Wybór starterów issr do konstrukcji mapy genetycznej łubinu wąskolistnego...
3. Startery generujące powtarzalny polimorfizm w obrębie form
rodzicieliskich odmiany ‘Emir’ oraz rodu LAE 1 wykorzystane zostaną przy genotypowaniu populacji mapującej łubinu wąskolistnego.
literatura
1. Boersma J. G., Pallotta M., Li C., Buirchell B. J., Sivasithamparam K.
i Yang H. 2005. Construction of a genetic linkage map using MFLP and
identification of molecular markers linked to domestication genes in narrow-leafed lupin (Lupinus angustifolius L.). Cellular and Molecular Biology Letters 10: 331–344.
2. Casasoli M., Mattioni C., Cherubini M., Villani F. 2001. A genetic linkage
map of European chestnut (Castanea sativa Mill.) based on RAPD, ISSR and
isozyme markers. Theoretical and Applied Genetics 102: 1190–1199.
3. Doyle J. J., Doyle J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19(1): 11–15.
4. Fernández M., Figueiras A., Benito C. 2002. The use of ISSR and RAPD
markers for detecting DNA polymorphism, genotype identification and genetic diversity among barley cultivars with known origin. Theoretical and
Applied Genetics 104: 845–851.
5. Galek R., Sawicka-Sienkiewicz E. 2001. Ocena form kolekcyjnych łubinów
pochodzących z rożnych warunków geograficzno-klimatycznych, pod względem wybranych cech morfologicznych. Zeszyty Naukowe Akademii Rolniczej we Wrocławiu 427: 31–49.
6. Kojima T., Nagaoka T., Noda K., Ogihara Y. 1998. Genetic linkage map of
ISSR and RAPD markers in Einkorn wheat in relation to that of RFLP markers. Theoretical and Applied Genetics 96: 37–4 5.
7. Nelson M. N., Phan H. T. T., Ellwood S. R., Moolhuijzen P. M., Hane J.,
Williams A., O‘Lone C. E., Fosu-Nyarko J., Scobie M., Cakir M., Jones M. G. H., Bellgard M., Ksiarkiewicz M., Wolko B., Barker S. J.,
Oliver R. P., Cowling W. A. 2006. The first gene-based map of Lupinus angustifolius L. – location of domestication genes and conserved synteny with
Medicago truncatula. Theoretical and Applied Genetics 113: 225–238.
8. Nelson M., Moolhuijzen P. M., Boersma J. G., Chudy M., Lesniewska K.,
Bellgard M., Oliver R. P., Święcicki W., Wolko B., Cowling W. A. i Ellwood S. R. 2010. Aligning a new reference genetic map of Lupinus angustifolius with the genome sequence of the model legume, Lotus japonicus. DNA
Research 17: 73–83.
9. Nirenberg H. I., Feiler U., Hagedorn G. 2002. Description of Colletotrichum
lupine comb. nov. in modern terms. Mycologia 94: 307–320.
27
Bartosz Kozak
10. Sawicka-Sienkiewicz E., Galek R., Zalewski D. 2007. Zmienność wybranych cech u mutantów odmiany Emir łubinu wąskolistnego (Lupinus angustifolius L.). Zeszyty Problemowe Postępu Nauk Rolniczych 522: 39–54.
11. Sujak A., Kotlarz A., Strobel W. 2006. Compositional and nutritional evaluation of several lupin seeds. Food Chemistry 98: 711–719.
12. Zietkiewicz E., Rafalski A., Labuda D. 1994. Genome fingerprinting by
simple sequence repeat (SSR) – anchored polymerase chain reaction amplification. Genomics 20: 176–183.
mgr inż. Bartosz Kozak
Katedra Genetyki, Hodowli Roślin i Nasiennictwa
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
Opiekun naukowy: Prof. dr hab. Ewa Sawicka-Sienkiewicz
28
Agnieszka Cencora, Magdalena Troć
Krzysztof Oklejewicz, Andrzej Skoczowski
EPISTEME
18/2013, t. 3
s. 29–39
ISSN 1895-2241
PORÓWNANIE WYBRANYCH CECH
FIZJOLOGICZNYCH ROŚLIN HIERACIUM
AURANTIACUM L. ROSNĄCYCH W OBRĘBIE
ZWARTEGO ZASIĘGU I POZA LOKALNĄ PÓŁNOCNĄ
GRANICĄ ZASIĘGU
COMPARISON OF SELECTED PHYSIOLOGICAL
PROPERTIES OF HIERACIUM AURANTIACUM
L. BETWEEN PLANTS GROWING IN COMPACT RANGE
AND OUTSIDE OF LOCAL NORTHERN BORDER
OF ITS OCCURRENCE
Abstrakt. Hieracium aurantiacum L. jest gatunkiem o Alpejsko – północnoeuropejskim typie zasięgowym. Mapy rozmieszczenia ogólnego pokazują, że
w Karpatach Polskich przebiega jego lokalna północna granica zasięgu i dopiero po dużej dysjunkcji gatunek ten pojawia się w Skandynawii i krajach
bałtyckich. O rozprzestrzenianiu się jastrzębca pomarańczowego świadczą
stanowiska położone poza tą granicą. Celem badań jest określenie fizjologicznych różnic pomiędzy osobnikami rosnącymi w obrębie populacji zasięgu
zwartego, a tymi na stanowiskach oderwanych poza lokalną północną granicą
zasięgu. W latach 2011–2012 prowadzono analizy aktywności fotochemicznej PSII, zawartości chlorofilu a i b oraz flawonoidów w epidermie liści, analizy
podobieństwa składu chemicznego liści przy użyciu spektroskopii FT-ramanowskiej oraz wyznaczono wartości indeksu azotowego. Wykazano, że badane populacje różnią się istotnie pod względem analizowanych parametrów.
Słowa kluczowe: aktywność fotochemiczna PSII, Hieracium aurantiacum,
Spektroskopia FT-ramanowska, zawartość chlorofilu, flawonoidy
Summary. Hieracium aurantiacum L. is a species-wide Alps – North Europe.
Distribution maps show that in the Polish Carpathians runs his local northern boundary of the range and only after a large disjunction of this species occurs in Scandinavia and the Baltic countries. Aim of this study was
to determine the physiological differences between plants growing in the
29
Agnieszka Cencora, Magdalena Troć, Krzysztof Oklejewicz, Andrzej Skoczowski
population local dense coverage, and those in positions outside the northern boundary of the discrete range. In the years 2011–2012 were analyzed:
PSII photochemical activity, contentent of chlorophyll a, b and flavonoids
in leaves, chemical composition of leaves using FT-Raman spectroscopy and
determined value of nitrogen index. It has been shown that the examined
populations differ significantly with respect to the parameters analyzed.
Key words: PSII photochemical activity, Hieracium aurantiacum, FT-Raman
spectroscopy, chlorophyll content, flavonoids
30
Porównanie wybranych cech fizjologicznych roślin hieracium aurantiacum l....
Wstęp
W Polsce jastrzębiec pomarańczowy występuje w Karpatach i Sudetach. Na terenach położonych na północ od Karpat znane są liczne
stanowiska zasiedlone przez ten gatunek [Szeląg 2001]. Także mapy
zamieszczone w pracach Zająca [1996] oraz Zająca i Zając [2001]
pokazują stanowiska karpackie oderwane od głównego zasięgu oraz
liczne stanowiska antropogeniczne położone na północ od Karpat. Jasiewicz [1980] charakteryzuje występowanie jego naturalnych stanowisk w Polsce – gatunek rośnie na górskich łąkach oraz
w murawach bliźniczkowych i ziołoroślach w Sudetach i Karpatach
w przedziale wysokościowym od 900 m w Bieszczadach do 1844 m
w Tatrach, choć z nowszych publikacji np. w Bieszczadzkim Parku
Narodowym [Zemanek i Winnicki 1999] wiadomo, że spotykano
jego stanowiska położone znacznie niżej, bo już na wysokości 650 m
n.p.m. O rozprzestrzenianiu się tego gatunku na tereny niżej położone mogą świadczyć stanowiska odnalezione w Beskidzie Niskim i na
Pogórzu Przemyskim oraz na Przedgórzu Rzeszowskim. Tendencje
do powiększania zasięgu potwierdza także odnalezione w roku 2011
nowe (liczące kilka okazów) stanowisko w północnej części Dołów
Jasielsko-Sanockich. Na wszystkich stanowiskach odnalezionych na
północ i północny zachód od Bieszczadów Hieracium aurantiacum
spotykano na terenach porolnych lub łąkach użytkowanych rolniczo,
co może wskazywać na zajmowanie przez ten gatunek kolejnych siedlisk, co z kolei może stanowić np. początek rozprzestrzeniania się
gatunku na tereny niżowe Polski.
Celem badań jest określenie fizjologicznych różnic pomiędzy
osobnikami rosnącymi w obrębie populacji zasięgu zwartego (Bieszczady), a tymi na stanowiskach oderwanych poza lokalną północną
granicą zasięgu.
Materiały i metody
Badania prowadzono na liściach jastrzębca pomarańczowego w latach
2011–2012. Stanowiska badawcze w obrębie zasięgu zwartego znajdują się w Bieszczadzkim Parku Narodowym w miejscowości Brzegi
Górne (N 49° 08,515’; E 022° 32,916’; 866 m n.p.m.) oraz na Poło31
Agnieszka Cencora, Magdalena Troć, Krzysztof Oklejewicz, Andrzej Skoczowski
ninie Wetlińskiej (N 49° 09’ 26,1”; E 022° 32’ 57,4”; 1183 m n.p.m.).
Stanowiska oderwane, poza lokalną północną granicą zasięgu umiejscowione są: w Beskidzie Niskim „Biskupi Łan” w pobliżu miejscowości Wola Niżna (N 49° 29,61’ ; E 021° 51,628’; 517 m n.p.m.),
na Pogórzu Przemyskim w miejscowości Kuźmina (N 49° 08,515’;
E 022° 32,916’; 539 m n.p.m.), na Pogórzu Dynowskim w miejscowości Końskie (N 49° 39’09,4”; E 022° 12’ 0,85”; 377 m n.p.m.) oraz na
Podgórzu Rzeszowskim w miejscowości Bystrowice (N 49° 56,667’;
E 022° 34,738’; 210 m n.p.m.). Na liściach roślin rosnących na wymienionych stanowiskach porównano całkowitą zawartość chlorofilu
oraz stosunek zawartości chlorofilu a:b metodą spektrofotometryczną [Barnes i in. 1992]; dokonano pomiarów zawartości flawonoidów
w epidermie liści (nieinwazyjne pomiary przyrządem DUALEX®
4 firmy FORCE A); określono sprawność fotochemiczną fotosystemu
II (PSII) w liściach Hieracium aurantiacum L. na podstawie parametrów fluorescencji chlorofilu a (fluorymetr PEA, Hansatech Instruments); porównano zmiany składu karotenoidowego liści metodą
spektrometrii FT-ramanowskiej [Skoczowski i in. 2011]. Uzyskane
wyniki opracowane zostały przy użyciu jednoczynnikowego testu
ANOVA/MANOVA, testu Tukey’a oraz analizy podobieństwa metodą
Warda (pakiet Statistica 10 dla Windows).
Wyniki
Zawartość chlorofilu. Całkowita zawartość chlorofilu mierzona
spektralnie u roślin na wszystkich stanowiskach była zbliżona (Ryc.
1A). Największą zawartość chlorofilu a zanotowano dla roślin rosnących na stanowisku Kuźmina, natomiast najniższą dla roślin ze
stanowiska w Bystrowicach. Na pozostałych stanowiskach różnice nie były istotne statystycznie (Ryc. 1B). W przypadku chlorofilu
b nie stwierdzono statystycznie istotnych różnic pomiędzy roślinami rosnącymi na badanych terenach (Ryc. 1C). Natomiast stosunek
chlorofilu a:b był największy u roślin rosnących na stanowiskach
w Brzegach Górnych i Kuźminie. Wartości tego stosunku są szczególnie wysokie (Ryc. 1D), biorąc pod uwagę, że typowa wartość tego
stosunku u większości roślin wynosi około 3:1.
32
Porównanie wybranych cech fizjologicznych roślin hieracium aurantiacum l....
Ryc. 1. Zawartości chlorofilu (A), chlorofilu a (B), chlorofilu b (C)
oraz stosunku zawartości chlorofilu a:b (D) w liściach jastrzębca
pomarańczowego w zawartości od stanowiska.
33
Agnieszka Cencora, Magdalena Troć, Krzysztof Oklejewicz, Andrzej Skoczowski
Zawartość flawonoidów. Największą ilość flawonoidów stwierdzono w górnej części blaszki liściowej jastrzębca na stanowiskach na
Biskupim Łanie i w Końskich natomiast najmniejszą na Połoninie
Wetlińskiej i w Bystrowicach (Ryc. 2).
Ryc. 2. Zawartości flawonoidów w górnej części blaszki liściowej jastrzębca
pomarańczowego w zawartości od stanowiska.
Zawartość flawonoidów w liściach roślin była skorelowana
z ekspozycją badanych stanowisk na słońce, tj. była wyższa na stanowiskach lepiej oświetlonych. Potwierdza to rolę tych związków
w ochronie aparatu fotosyntetycznego roślin. Z drugiej strony wysoka zawartość flawonoidów może wskazywać na złe warunki glebowe
(głównie niedostatek azotu).
Sprawność fotochemiczna PS II. Sprawność fotochemiczną PSII
oceniano na podstawie wartości współczynnika Fv/Fm [Björkman
i Demmig 1987]. Wartości maksymalnej fotochemicznej wydajności
kwantowej wskazują, że na Połoninie Wetlińskiej i w Brzegach Górnych sprawność fotochemiczna PSII w liściach jastrzębca jest niższa
niż na pozostałych stanowiskach (Ryc. 3).
34
Porównanie wybranych cech fizjologicznych roślin hieracium aurantiacum l....
Ryc. 3. Zmiany wartości współczynnika Fv/Fm w liściach roślin jastrzębca
pomarańczowego w zawartości od stanowiska.
Analiza składu karotenoidowego liści. Widma ramanowskie
wykonane w zakresie tj. 950–1702 cm-1, wykazały zróżnicowanie
składu karotenoidowego liści w zależności od zajmowanego stanowiska (Ryc. 4A). Analiza podobieństwa widm ramanowskich
pozwala na wyróżnienie trzech grup stanowisk na których skład
karotenoidowy liści roślin jastrzębca pomarańczowego był zbliżony. I tak największe różnice w składzie karotenoidowym wystąpiły
pomiędzy roślinami rosnącymi w Kuźminie i Bystrowicach w porównaniu z tymi z Połoniny Wetlińskiej i Brzegów Górnych oraz
ze stanowiska w Końskich i na Biskupim Łanie (Ryc. 4B).
35
Agnieszka Cencora, Magdalena Troć, Krzysztof Oklejewicz, Andrzej Skoczowski
Ryc. 4. Widma FT-ramanowskie liści roślin jastrzębca pomarańczowego
rosnących na różnych stanowiskach (A) oraz dendrogram podobieństwa
widm w zakresie karotenoidowym (B).
36
Porównanie wybranych cech fizjologicznych roślin hieracium aurantiacum l....
Dyskusja i wnioski
Do tej pory nie prowadzono badań stanu fizjologicznego populacji jastrzębca pomarańczowego w Polsce. Na świecie roślina ta stanowi duże
zagrożenie dla lokalnej i ogólnej różnorodności gatunkowej np. Australii czy USA, gdzie jest to gatunek uznany za bardzo szkodliwy chwast
i prowadzi się szeroko zakrojone badania nad sposobami usunięcia jastrzębca z populacji roślin [McDougall i in. 2010, Loomis 2007, Beaumont i in. 2009]. Natomiast rodzaj jastrzębiec jest częstym obiektem
badań nad apomiksją, dlatego najszerzej zakrojone badania prowadzone są właśnie nad sposobem rozmnażania Hieracium sp. [Bicknel i in.,
2003, Koltunow i in. 2011]. Uzyskane wyniki pozwalają na stwierdzenie, iż w wypadku zawartości karotenoidów badane populacje w obrębie
zasięgu zwartego różnią się istotnie od populacji rosnących poza lokalną północną granicą zasięgu. Również wydajność PSII jest najsłabsza
dla dwóch populacji położonych w Bieszczadach. Badania zawartości
flawonoidów w liściach Hieracium aurantiacum wykazały, że populacje
rosnące na stanowiskach lepiej oświetlonych zawierają więcej flawonoidów w liściach niż populacje na stanowiskach bardziej zacienionych.
Natomiast analiza zawartości chlorofilu a i b, stosunek chlorofilu a:b
oraz całkowita zawartość chlorofilu (a+b) w liściach jastrzębca nie dały
jednoznacznej odpowiedzi co do zróżnicowania badanych populacji
pod względem tych cech.
literatura
1. Barnes J. D., Balaguer L., Manrique E., Elvira S., Davidson A. W. 1992. Are
appraisal of the use the use of DMSO extraction and determination of chlorophylls a and b lichens and higher plants. Environmental and Exp. Bot., 32.
2. Bicknell R. A., Lambie S. C., Butler R. C. 2003. Quantification of progeny
classes in two facultatively apomictic accessions of Hieracium. Hereditas,
Volume 138, Issue 1, 11–20.
3. Björkman O., Demmig B. 1987. Photon yield of O2 evolution and chlorophyll
fluorescence characteristics at 77 K among vascular plants of diverse origins. Planta 170: 489–504.
4. Beaumont L. J. Gallagher R. V. Downey P. O. Thuiller W. Leishman M. R. Hughes L. 2009 Modelling the impact of Hieracium spp. on protected areas in
Australia under future climates. Ecography. Volume 32, Issue 5, 757–764.
37
Agnieszka Cencora, Magdalena Troć, Krzysztof Oklejewicz, Andrzej Skoczowski
5. Hultén E. & Fries M. 1986. Atlas of north European vascular plants. North of
the tropic of cancer. Volume 1: XVIII, 498 pp., Volume 2: XIV, 499–968 pp.,
Volume 3: 969–1149. Koeltz Scientific Books, Köenigstein.
6. Jasiewicz A. 1980. Hieracium L., Jastrzębiec. [w:] Jasiewicz A. (red.) Flora
polska. Rośliny naczyniowe Polski i ziem ościennych. 199–335.
7. Koltunow A. M. G. i in. 2011. Sexual reproduction is the default mode in apomictic Hieracium subgenus Pilosella, in which two dominant loci function to
enable apomixis. The Plant Journal. Volume 66, Issue 5: 890–902.
8. Loomis, E. 2007. Sex and diversity in the invasive plant Hieracium aurantiacum, The University of Montana, Missoula, MT. 49.
9. Meusel H., Jäger E. J. 1992. Vergleichende Chorologie der Zentraleuropäischen
Flora. 3. Karten, pp. IX, 422–688. Veb Gustav Fischer Verlag, Jena.
10. McDougall K. L., Alexander J. M., Haider S. , Pauchard A., Walsh N. G.,
Kueffer C. 2011. Alien flora of mountains: global comparisons for the development of local preventive measures against plant invasions. Blackwell
Publishing Ltd. Volume 17, Issue 1, 103–111.
11. Skoczowski A., Troć M., Baran A., Baranska M. 2011. Impact of sunflower
and mustard leave extracts on the growth and dark respiration of mustard
seedlings. J. Therm. Anal. Calorim. 104: 187–192.
12. Szeląg Z. 2001. Mapa autorska Hieracium aurantiacum L. [w:] Zając A., Zając M. (red.) 2001. Atlas rozmieszczenia roślin naczyniowych w Polsce. Pracownia Chorologii Komputerowej, Instytut Botaniki UJ, Kraków, 1–714.
13. Zając A., Zając M. 2001. (red.) 2001. Atlas rozmieszczenia roślin naczyniowych w Polsce. Pracownia Chorologii Komputerowej, Instytut Botaniki
UJ, Kraków, 1–714.
14. Zając M., Zając A. 2009. Elementy geograficzne rodzimej flory Polski. – The
geographical element sof native flora of Poland. Nakładem Pracowni Chorologii Komputerowej Instytutu Botaniki Uniwersytetu Jagiellońskiego. – Edited by Laboratory of Computer Chorology, Institute of Botany,
Jagiellonian University, Kraków, 1–94.
15. Zemanek B., Winnicki T. 1999. Vascular plant of the Bieszczady National
Park. Monografie Bieszczadzkie 3: 9–249.
38
Porównanie wybranych cech fizjologicznych roślin hieracium aurantiacum l....
mgr Agnieszka Cencora
Zakład Botaniki, Uniwersytet Rzeszowski
Wydział Biologiczno-Rolniczy
ul. Zelwerowicza 4, 35–959 Rzeszów
e-mail: [email protected]
dr Maddalena Troć
Instytut Fizjologii Roślin Polskiej Akademii Nauk
ul. Niezapominajek 21, 30–239 Kraków
e-mail: [email protected]
dr hab. prof. UR Krzysztof Oklejewicz
Zakład Botaniki
Uniwersytet Rzeszowski,
Wydział Biologiczno-Rolniczy
ul. Zelwerowicza 4, 35–959 Rzeszów
e-mail: [email protected]
prof. dr hab. Andrzej Skoczowski
Instytut Fizjologii Roślin Polskiej Akademii Nauk
ul. Niezapominajek 21, 30–239 Kraków
e-mail: [email protected]
Opiekun naukowy:
prof. dr hab. Andrzej Skoczowski, dr hab. prof. UR Krzysztof Oklejewicz
39
Aleksandra Dubicka-lisowska
EPISTEME
18/2013, t. 3
s. 41–50
ISSN 1895-2241
OCENA OPORNOŚCI NA CHROM SZCZEPÓW
Z RODZAJU PSEUDOMONAS
EVALUATION OF CHROMATE TOLERANCE
IN PSEUDOMONAS SP. STRAINS
Abstrakt. Chrom (Cr) to metal ciężki, który głównie w formie Cr (VI) jest przemysłowym produktem ubocznym o wysokiej szkodliwości. Badano dwa szczepy bakteryjne z rodzaju Pseudomonas pod kątem oporności na chrom obecny
w podłożu hodowlanym w postaci chromianu potasu. Według wskazań literaturowych szczepy Pseudomonas sp. wykazują oporność na chrom oraz zdolność
aktywnej bioremediacji Cr (VI). Wyniki testów żywotności wykazały toksyczny
wpływ Cr (VI) na komórki bakteryjne oraz pozwoliły określić stężenia subletalne. Ponadto, wykreślono krzywe wzrostu badanych szczepów hodowanych
w obecności subletalnych stężeń Cr (VI). Badając wpływ Cr jako stresora komórkowego, wykonano wstępne analizy proteomiczne, porównując profile białkowe szczepów poddanych działaniu chromianu. Stwierdzono istotne różnice
w badanych proteomach, przejawiające się w postaci zmian ilościowych, zależnych od rosnących stężeń Cr, a niekiedy jako zmiany o charakterze progowym,
indukowane chromianem potasu w stężeniach od 0,1 mM.
Słowa kluczowe: analiza proteomu, metale ciężkie, chrom, oporność, bakterie,
Pseudomonas
Summary. Chromium (Cr) is a heavy metal widely used in industry, toxic for
organisms especially in the form of Cr (VI). Two bacterial strains Pseudomonas
sp. were studied to assess their resistance to chromium supplemented as potassium chromate to the growth medium. Literature shows that Pseudomonas
sp. strains reveal tolerance to chromium and ability to bioremediate Cr (VI)
actively. Results of survivability tests indicated toxic Cr (VI) effect on bacterial cells. Sublethal amounts of Cr (VI) were determined and growth curves
were constructed for strains cultivated at these concentrations of Cr(VI). Preliminary proteomic analysis was done to compare proteome profiles of the examined strains growing under cellular stress. The results indicate significant
differences between the respective proteomes. Some of the proteins appeared
at the threshold of 0,1 mM concentration of potassium chromate, whereas
the other showed altered synthesis dependent upon Cr concentration.
Key words: proteomic analysis, heavy metals, chromium, resistance, bacteria,
Pseudomonas
41
Aleksandra Dubicka
Introduction
Chromium (Cr) is considered a serious environmental pollutant. It is
widely used in industrial processes such as leather tanning, electroplating, pigment and alloy production (Cervanteset al. 2001). Cr occurs at
several oxidation states, but the forms of trivalent Cr(III)and hexavalent Cr(VI) are the most stable ones. Cr (VI) is considered the most toxic
(Cervantes et al. 2001) and it appears in an oxyanionic form (CrO42-),
that is structurally analogous to phosphate and sulfate ions. Therefore,
it can be easily transported across biological membranes into bacterial
and eukaryotic cells (Desai et al. 2008). Cr (VI)was shown to cause cancer in animals and humans (Costa 1997). Cr(III) is less toxic because of
its lower solubility and mobility (Daulton et al. 2007).
Due to great chromium importance in industry, there is a necessity to remediate environmental pollution with this metal. In decontamination efforts various microorganisms may be applied since
they have developed diverse Cr-resistance mechanisms: biosorption,
precipitation, diminished accumulation, chromate efflux and bioreduction of Cr (VI) to Cr (III) (Cervantes et al. 2001). Some of these
mechanisms are based on cell biological structure and chemical content whereas the other ones require active metabolism (Tabak et al.
2005).In bacteria such as Pseudomonas aeruginosa and Cupriavidus
metallidurans, transmembrane efflux of chromate was reported to be
related with ChrA protein presence. ChrA functionsas a chemiosmotic pump that causes Cr efflux from the cytoplasm (Ramirez-Diaz et
al. 2008). Biological reduction of Cr (VI) has been shown for various
bacterial species such as Bacillus sp. (Desai et al. 2008), Pseudomonas sp. (Ackerley et al. 2004), Escherichia coli (Ackerleyet al. 2004)
and Streptomyces sp. (Colin et al. 2012). Chromate-reducing bacteria
were proposed as potential tools for Cr bioremediation (Cervantes
et al. 2001). Microorganisms have developed diverse strategies of Cr
(VI) reduction which may be associated with chemical reactions with
amino acids, nucleotides, glutathione, sugars, vitamins, and organic
acids,or as a result of the activity of the soluble enzymes under aerobic conditions, i.e. NADHor NADPH-dependent chromate reductases
(Ramirez-Diaz et al. 2008). Chromate reductase in P. putida (ChrR)
is a soluble flavin mononucleotide-binding (Park et al. 2000), 50-kDa
dimer, NADH-dependent enzyme (Ackerley et al. 2004). Desai et al.
42
Ocena oporności na chrom szczepów z rodzaju Pseudomonas
(2008) characterizeda cytosolic NADH-chromate reductase activity in a chromate-resistant Pseudomonas sp. G1DM21 isolated from
a landfill long-term contaminated with Cr (VI) (Desai et al. 2008). In
a recent work, Bramhachari et al. (2012) showed the altered protein
expressionof P. stutzeri exposed to Cr. The protein analysis with the
SDS PAGE indicated a decreased number of proteins synthesized in
the presence of Cr as well as revealed the inductionof specific stress
proteins (Bramhachari et al. 2012).
The present study evaluates bacterial resistance to chromate
supplemented to the growth medium. Two environmental strains of
the genus Pseudomonas were examined. Preliminary proteomic analysis was used as a tool to reveal the cell response to chromate stressand to indicate the proteins involved in this process.
1. Material and methods
Two Pseudomonas sp. strains were studied. Both, the strain no. 18
and 19 are the environmental isolates obtained from the microflora
of the soil polluted with oil derivatives.
1.1. Survivability tests
Bacterial culture suspensions were inoculated into 50 mL of the standard nutrient broth (SNB) in 250 mL Erlenmeyer flasks and treated
with 0,1, 0,25, 0,5, 0,75 and 1,0 mM Cr (VI) supplemented as potassium chromate (K2CrO4). The control cultures were not treated. The
cultures were cultivated on a rotary shaker (40 rpm) at 25o C for 24
h. Then, serial dilutions of culture suspensions were made (10-1–10-8)
and 25 µL of the appropriate suspension dilution were plated on the
Nutrient Agar and incubated for 24 h. The numberof colony forming
units (c.f.u.) was counted.
1.2. Growth curves
Growth kinetics of Pseudomonas sp. cultures were monitored by means of the optical density (OD600) turbidimetric measurement (Hach-Lange Q5000 UV-VIS Spectrophotometer). Bacteria were inoculated
into 50 mL of the SNB medium in 250 mL Erlenmeyer flasks, supplemented with 0,5, 0,75, and 1,0 mM of Cr(VI), and cultivated on a rotary shaker at 25oC. At each time interval a 1mL sample of a culture
43
Aleksandra Dubicka
was diluted with 5 mL distilled water and the OD600 was determined.
The measurements were carried out till the late post-logarithmic phase
(36 hours). Then, the growth curves were constructed.
1.3. Preparation of cell-free extracts
Cell-free extracts were prepared by disrupting whole bacterial cells
using an ultrasonic probe (UP 50H sonicator, dr Hielsher GmbH, Germany). Cell suspensions were obtained based on two experimental
models. In model I, bacterial cells were inoculated into 100 mLof the
SNB medium and treated with different concentrations of chromate.
After 24 h of the incubation time, bacterial biomass was harvested
(see below). In model II, Cr (VI) was supplemented into cultures at
a log growth phase (growth time of 16 hours). From these cultures,
30 mL samples were collected after 6, 12 and 24 h of incubation. Bacterial suspensions were harvested by centrifugation at 5533×g for
15 minutes. Then, each amount of 250 mg of culture pellet was suspended in 250 µL extraction buffer (Tris HCl 25 mM pH 7,0; 6 mM
DTT; 0,05 mM EDTA) containing a protease inhibitor solution and
sonicated at optimized conditions (amplitude of 75% and 0,5 s pulse
for 10 min. in an ice bath). The sonicated cell suspensions were then
centrifuged at 18894×g for 30 min at 4oC. The cell-free supernatants
were assumed to contain total protein extracts of the strains studied.
1.4. Protein assay
The total protein concentration was assayed with a Bradford method
(Bradford, 1976). A volume of 50 µL of ten-times diluted protein extract
was mixed with 1,5 mL of the Bradford Reagent. The absorbance at 595
nm was measured after five-minute incubation period and the protein
concentration was determined upon a 6-point standard curve.
1.5. Proteomic analyses
Protein profiling was done employing the SDS-PAGE electrophoresis
with the use of 10% separating and 4% stacking polyacrylamide gels.
The samples were denatured with a loading buffer (0,5 M Tris-HCl,
pH 6,8, 10% SDS, 10% β-mercaptoethanol, 20% glycerol, 0,05% bromophenol blue) at 100oC for 5 minutes. The total of 30 µg of protein
was loaded per well. After electrophoreses, the proteins in gels were
stained with Coomasie Brillant Blue.
44
Ocena oporności na chrom szczepów z rodzaju Pseudomonas
2. Results
2.1. Survivability tests
Survivability tests were done to establish the toxic effect of chromate
on bacterial cells. The data indicate a significant negative effect dependent on chromium concentration. Figs 1 and 2 show the graphical representation of the number of living cells per mL. These results enabled
to assess chromate sublethal concentrations to be used in constructing
bacterial growth curves and inducing proteome changes.
Fig. 1. Survival of Pseudomonas sp. 18 at diverse Cr concentrations.
Fig. 2. Survival of Pseudomonas sp. 19 at diverse Cr concentrations.
45
Aleksandra Dubicka
2.2. Growth curves
To determine the differences in bacterial growth in the presence of
variant Cr concentrations appropriate cell culture growth curves
were constructed as presented in figs 3 and 4.
As it can be seen, 0,75 mM and 1,0 mM Cr (VI) caused a pronounced growth inhibition in both cases of the tested strains.
Fig. 3. Growth curve of the culture of Pseudomonas sp. 18.
Fig. 4. Growth curve of the culture of Pseudomonas sp. 19.
2.3. Proteomic analysis
The SDS PAGE analysis showed differences in bacterial proteomes
under stress conditions caused by the Cr(VI) treatment. Both the induction and repression as well as the altered synthesis of certain pro46
Ocena oporności na chrom szczepów z rodzaju Pseudomonas
teins were observed. Figs 5–8 illustrate the protein profile changes as
observed for both experimental models.
Fig. 5. Protein profile of Pseudomonas
sp. 18 exposed to 0,1, 0,25, 0,5,
0,75 mM Cr in model I.
Fig 6. Protein profile
of Pseudomonas sp. 19 exposed
to 0,1, 0,25, 0,5 mM Cr in model I.
Fig. 7. Protein profile of Pseudomonas sp. 18 exposed to 0,1, 0,25, 0,5,
0,75 mM Cr in model II. Lane ST: protein molecular weight marker,
Lane ST: protein molecular weight marker, Lane K: protein profile of the
cells untreated with chromate (control). Lanes 0,1 mM, 0,25 mM, 0,5 mM
and 0,75 mM: profiles of the cells grown in the presence of Cr(VI) applied
at the given concentration. Black arrows: proteins suppressed,
white arrows: proteins induced.
47
Aleksandra Dubicka
Fig. 8. Protein profile of Pseudomonas sp. 19 exposed to 0,1, 0,25, 0,5,
0,75 mM Cr in model II. Lane ST: protein molecular weight marker,
Lane ST: protein molecular weight marker, Lane K: protein profile of the
cells untreated with chromate (control). Lanes 0,1 mM, 0,25 mM, 0,5 mM
and 0,75 mM: profiles of the cells grown in the presence of Cr(VI) applied
at the given concentration. Black arrows: proteins suppressed,
white arrows: proteins induced.
Lane ST: protein molecular weight marker, Lane K: protein profile of the cells untreated with chromate (control). Lanes 0,1 mM,
0,25 mM, 0,5 mM and 0,75 mM: profiles of the cells grown in the
presence of Cr(VI) applied at the given concentration. Black arrows:
proteins suppressed, white arrows: proteins induced, grey arrows:
protein synthesis altered as dependent on Cr concentration.
Most of the Cr-induced proteins became visible in gels at the
threshold of 0,1 mM Cr(VI). Protein repression was observed at
0,25–0,75 mM Cr(VI). The altered protein synthesis could be observed at high chromate concentrations as compared to the control.
3. Discussion
Both of the examined Pseudomonas sp. strains 18 and 19 showed the
ability to grow in the presence of chromate up to 1,0 mM, however,
a significant growth inhibition was pronounced at concentrations of
0,75 mM and 1,0 mM. Note that the results obtained by Bramhachari et al. (2012) on Pseudomonas stutzeri strain VKM014 were similar
(Bramhachari et al.2012). Pseudomonas sp. strains exhibited high resi48
Ocena oporności na chrom szczepów z rodzaju Pseudomonas
stance to chromate, which supports other findings proving the Cr (VI)
resistance in various bacterial species (Ramirez-Diaz et al. 2008).
Proteome analyses showed differences in protein profiles under
chromate treatment. Proteome changes reflect the cell response to
stress conditions. Bramhachari et al. (2012) observed the inhibition of synthesis of some proteins at 0,75–1,0 mM Cr (VI) as well as
the induction of the other ones at 0,2–0,5 mM Cr. The presence of
chromium may induce the production of metallothionein-like polypeptides (Bramhachari et al.2012). Desai et al. (2008) characterized
a chromate reductase isolated from Pseudomonas sp. G1DM21, the
protein that plays a role in Cr(VI) bioreduction (Desai et al. 2008).
Finally, it appears that out of the two models employed for this study, Model I enabled to reveal more significant differences in bacterial
proteomes under the cellular stress when compared to the Model II.
4. Final conclusions
The examined Pseudomonas strains were able to grow in the presence
of chromate up to 1,0 mM.
Proteomic analysis showed significant differences in bacterial
proteomes under chromate treatment.
The experimental Model I demonstrated more significant differences in proteomesunder the cellular stress when compared to the
Model II.
References
1. Ackerley D. F., Gonzalez C. F., Park C. H., Blake R., Keyhan M., Matin A.
2004. Chromate-reducing properties of soluble flavoproteins from Pseudomonas putida and Escherichia coli. Applied and Environmental Microbiology, 70 (2): 873–882.
2. Bradford M. M. 1976. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Analytical Biochemistry 72,248–254.
3. Bramhachari P. V., Ravichand J., Deepika K. V., Yalamanda P., Chaitanya K.
V. 2012. Differential responses of marine sediment bacteria Pseudomonas
49
Aleksandra Dubicka
stutzeri VKM014 to chromate exposures. Research Journal Of Microbiology, 7(2): 114–122.
4. Cervantes C., Campos-Garcia J., Devars S., Gutierrez-Corona F., Loza-Tavera H., Torres-Guzman J. C., Moreno-Sanchez R. 2001. Interactions of
chromium with microorganisms and plants. FEMS Microbiology Reviews,
25: 335–347.
5. Colin V. L., Villegas L. B., Abate C. M. 2012. Indigenous microorganisms
as potential bioremediators for environments contaminated with heavy metals. International Biodeterioration & Biodegradation, 69: 28–37.
6. Costa M. 1997. Toxicity and carcinogenicity of Cr (VI) in animal models and
humans. Critical Reviews in Toxicology, 27 (5): 431–442.
7. Desai C., Jain K., Madamwar D. 2008. Evaluation of in vitro Cr(VI) reduction potential in cytosolic extracts of three indigenous Bacillus sp. isolated
from Cr (VI) polluted industrial landfill. Bioresource Technology, 99:
6059 – 6069.
8. Park C. H., Keyhan M., Wielinga B., Fendorf S., Martin A. 2000. Purification
to homogeneity and characterization of a novel Pseudomonas putida chromate reductase. Applied and Environmental Microbiology, 66: 1788–1795.
9. Ramirez-Diaz M. I., Diaz-Perez C., Vargas E., Riveros-Rosas H., Campos-Garcia J., Cervantes C. 2008. Mechanisms of bacterial resistance to chromium compounds. Biometals, 21: 321–332.
mgr inż. Aleksandra Dubicka-Lisowska
Institute of Plant Biology and Biotechnology
Faculty of Horticulture
University of Agriculture in Krakow
e-mail: [email protected]
Opiekun naukowy: dr hab. Paweł Kaszycki
Praca wykonana w ramach tematu badawczego nr 3500,
finansowanego z dotacji na naukę przyznanej przez MNiSW.
50
Agata Fabiszewska
EPISTEME
18/2013, t. 3
s. 51–58
ISSN 1895-2241
WSPÓŁZALEŻNOŚĆ POMIĘDZY WYBRANYMI
ŹRÓDŁAMI WĘGLA W PODŁOŻU A WZROSTEM
DROŻDŻY YARROWIA LIPOLYTICA
CORRELATION BETWEEN SELECTED CARBON
SOURCES IN MEDIA AND GROWTH OF YARROWIA
LIPOLYTICA YEAST
Abstrakt. Celem pracy była ocena korelacji pomiędzy czasookresem adaptacyjnej fazy wzrostu oraz fazy wzrostu stacjonarnego w hodowli drożdży
Yarrowia lipolytica KKP 379, a wybranymi źródłami węgla (glukozą, oliwą
z oliwek oraz glicer lem), obecnymi w podłożu hodowlanym. Wzrost komórek drożdży oceniano za pomocą automatycznego systemu analizy wzrostu Bioscreen C (Oy Growth Curves, Helsinki, Finlandia). Przeprowadzono doświadczenia, stosując trójskładnikowe plany dla mieszanin oraz
analizę korelacji, oceniając, czy badane kompozycje składników w podłożu
wpływają na czasokres faz wzrostu drożdży. Na podstawie uzyskanych
wyników stwierdzono, że istnieje korelacja pomiędzy zawartością glicerolu
w podłożu, a czasokresem fazy wzrostu logarytmicznego (silna zależność)
jak również długością fazy adaptacyjnej (słaba zależność).
Słowa kluczowe: Yarrowia lipolytica, analiza korelacji, plany dla mieszanin,
glicerol, faza wzrostu
Summary. The aim of the study was to describe a correlation between the
length of lag and log phases of yeast Yarrowia lipolytica KKP 379 and the
selected carbon sources (glucose, glycerol and olive oil), present in growth
medium as monocultures and in mixture. The growth of yeast cultures was
performed in Bioscreen C (Oy Growth Curves, Helsinki, Finlandia) – a computer-controlled incubator. There was performed a 3-component mixture
experiment and a correlation analysis to determine if mixed blends lead
to any changes in length of yeast growth phases in comparison to monocultures. It was proved that there is an important correlation between the
amount of glycerol in medium and the length of log phase (strong dependence) as well as lag phase (weak correlation).
Key words: Yarrowia lipolytica, design of experiment, mixture design, glycerol,
growth phase
51
Agata Fabiszewska
Wstęp
Mikrobiologiczna produkcja lipaz jest silnie związana z określoną
fazą wzrostu mikroorganizmu [Pereira-Meirelles i in. 2000]. Czasokres kolejnych faz wzrostu i ich przebieg determinowany może być
przez wiele czynników, w tym przede wszystkim przez skład podłoża
hodowlanego i rodzaj obecnego w podłożu źródła węgla [Corzo, Revah, 1999; Dalmau i in. 2000, Fickers i in. 2004, Sharma i in. 2001].
Ważnym problemem badawczym w optymalizacji składu podłoża
pod kątem produkcji enzymów lipolitycznych jest zatem dokładne
poznanie profilu ich syntezy, a następnie określenie optymalnego
czasu hodowli drobnoustrojów we wszystkich badanych podłożach,
tak aby komórki drobnoustrojów lipolitycznych znajdowałyby się
w tej samej fazie wzrostu, optymalnej dla aktywności lipaz.
Glukoza stanowi źródło węgla standardowo wykorzystywane
w podłożach do hodowli mikroorganizmów, ale znany jest jej represyjny wpływ na aktywność drożdży lipolitycznych, np. Yarrowia lipolytica
[Fickers i in. 2003]. Poza typowymi źródłami węgla drożdże z rodzaju
Yarrowia mogą wykorzystywać octany, glicerol oraz związki o charakterze lipidowym [Barth, Gaillardin, 1997]. Glicerol, jako uboczny produkt
w przemyśle tłuszczowym, alkoholowym i paliwowym [Makri i in. 2010],
mógłby stanowić alternatywę dla wykorzystania glukozy w podłożach
stymulujących produkcję lipaz. Jednakże jego obecność także hamuje
produkcję lipaz przez drożdże Y. lipolytica, najprawdopodobniej wskutek zwiększonej produkcji kwasów organicznych [Fabiszewska i in., wyniki niepublikowane]. Najbardziej znanym induktorem aktywności lipolitycznej jest oliwa z oliwek [Barth, Gaillardin, 1997, Darvishi i in. 2009].
Cenne zatem byłyby badania zmierzające do skomponowania podłoża
stymulującego produkcję lipaz i zawierającego minimalną ilość oliwy
z oliwek oraz maksymalną ilość glukozy i/lub glicerolu. Ze względu na
konieczność wykonania szeregu kombinacji wymienionych trzech źródeł węgla pomocne w przeprowadzeniu takiej optymalizacji mogą być
metody statystycznego planowania eksperymentu (DoE – ang. design of
experiment) [Mason i in. 1989, Pietraszek 2004].
Celem niniejszej pracy było zatem określenie zależności pomiędzy długością adaptacyjnej (lag) i logarytmicznej (log) fazy podczas
wzrostu Yarrowia lipolytica KKP 379, a obecnością w podłożu glu52
Współzależność pomiędzy wybranymi źródłami węgla w podłożu...
kozy, oliwy z oliwek i/lub glicerolu. Uzyskane wyniki pracy posłużą
w dalszym etapie badań nad optymalizacją składu podłoża hodowlanego stymulującego aktywność lipolityczną drożdży Y. lipolytica.
Materiały i metody
Badania prowadzono z użyciem szczepu drożdży Yarrowia lipolytica
KKP 379, należącego do Kolekcji Kultur Przemysłowych Instytutu
Biotechnologii Przemysłu Rolno-Spożywczego w Warszawie. Podłoża mikrobiologiczne zawierały w 100 cm3: 2 g peptonu, 1 g ekstraktu
drożdżowego oraz substraty pełniące rolę źródła węgla: glukozę, oliwę
z oliwek oraz glicerol wg tabeli nr 1. pH podłoża wynosiło 5,0 ± 0,1.
Krzywe wzrostu badanego szczepu drożdży wyznaczano na podstawie
pomiarów gęstości optycznej przy długości fali 600 nm za pomocą automatycznego systemu analizy wzrostu Bioscreen C w 96-godzinnej
hodowli wstrząsanej, w mikropłytkach (Oy Growth Curves, Helsinki,
Finlandia), rejestrując wartość absorbancji co 1 h. Do każdej celki na mikropłytce dodawano 0,3 cm3 podłoża zaszczepionego 24-godzinną hodowlą inokulacyjną, prowadzoną w podłożu YPG (2 g peptonu, 1 g ekstraktu drożdżowego, 2 g glukozy w 100 cm3). Doświadczenia przeprowadzono w 5 powtórzeniach. Wykonano dodatkowo próby kontrolne
– podłoża nie zaszczepione hodowlą drożdży, w celu uwzględnienia
w pomiarach absorbancji klarownego podłoża. Skład źródeł węgla w podłożu optymalizowano metodą teorii eksperymentu (ang. DoE – design
of experiment) dostępną w ramach pakietu oprogramowania STATISTICA 10.0, stosując plany sympleksowo-centroidowe dla mieszanin
trójskładnikowych. Wykonano także analizę korelacji. Założony poziom istotności wynosił 0,05.
Wyniki i dyskusja
Do najistotniejszych czynników decydujących o rezultatach doświadczenia, zaprojektowanego z użyciem planów dla mieszanin, należy
wybór maksymalnych wartości dla każdego z trzech składników
mieszaniny. Z tego też powodu przygotowano dwa niezależne plany,
w których wybrano dwa różne założenia co do maksymalnych ilości
w 100 cm3 podłoża dla każdego ze źródeł węgla, odpowiednio dla glu53
Agata Fabiszewska
kozy – 2 i 3 g, dla oliwy z oliwek 2,4 i 3,6 cm3 oraz glicerolu 15 i 22,5 g.
Wybrane plany sympleksowo-centroidowe zakładały przygotowanie
po 7 podłoży dla każdego z dwóch przyjętych maksymalnych poziomów źródeł węgla. Wpływ każdego z trzech składników badano na
czterech różnych poziomach (100%, 50%, 33,3% oraz 0% maksymalnej założonej ilości). Krzywe wzrostu wykreślone z zastosowaniem
systemu analizy wzrostu mikroorganizmów Bioscreen C pozwoliły
na wyznaczenie długości fazy adaptacyjnej oraz fazy wzrostu logarytmicznego drożdży Y. lipolytica KKP 379 w każdym z 14 badanych
podłoży. Wyniki zaprezentowano w tab. 1.
Tab. 1. Skład podłoży oraz czasokres adaptacyjnej (lag) i logarytmicznej
(log) fazy wzrostu w hodowli drożdży Yarrowia lipolytcia KKP 379.
Oliwa
Glicerol
Czasokres lag
Nr
Glukoza
fazy [h]
podłoża [g/100 cm3] [cm3/100 cm3] [g/100 cm3]
1
3
0
2
0
3
0
4
Czasokres
log fazy [h]
0
8,4
27,2
3,6
0
10,4
28,8
0
22,5
62,8
--
1,5
1,8
0
8
43
5
1,5
0
11,25
28,2
45,8
6
0
1,8
11,25
27
45,8
7
1
1,2
7,5
24,6
60,8
8
2
0
0
6
33,6
9
0
2,4
0
11,2
32,2
10
0
0
15
28
--
11
1
1,2
0
15,8
34,8
12
1
0
7,5
10,6
58,2
13
0
1,2
7,5
14,8
65,8
14
0,7
0,8
5
13
51
Podłoża zawierające glukozę oraz oliwę z oliwek jako jedyne źródło węgla wpływały korzystnie na skrócenie zarówno lag jak i log
fazy, niezależnie od przyjętego maksymalnego ich poziomu w podłożu. Jedynie w przypadku podłoża nr 3 (zawierającego 22,5 g gli54
Współzależność pomiędzy wybranymi źródłami węgla w podłożu...
cerolu/100 cm3) i podłoża nr 10 (zawierającego 15 g glicerolu/100
cm3) nie udało się określić czasokresu fazy wzrostu logarytmicznego
w czasie 96-godzinnej hodowli ze względu na znaczną długość lag
fazy. Czasokres fazy adaptacyjnej w podłożach z glicerolem jako jedynym źródłem węgla był najwyższy i wynosił odpowiednio 62,8 h oraz
28 h dla podłoży nr 3 i 10. Tym samym można zauważyć, że obecność
glicerolu jako jedynego źródła węgla w podłożu istotnie wpływała na
wydłużenie adaptacyjnej fazy wzrostu (ryc. 1). Jednocześnie glukoza
i oliwa z oliwek wpływały porównywalnie na czasokres lag fazy, przy
czym w podłożu z glukozą uzyskano najkrótszy czas trwania fazy
adaptacyjnej (6 h w podłożu nr 8).
Uzyskane wyniki potwierdzają także, jak istotny w stosowaniu
planów dla mieszanin jest dobór maksymalnych wartości składników mieszaniny. Nie zawsze założone przedziały wartości zmiennych wejściowych pozwalają na uzyskanie modelu o zadawalającym
współczynniku determinacji. W przeprowadzonych badaniach wybrano podłoża od 1 do 7 w celu zbudowania wykresu poziomicowego
prezentującego zależność pomiędzy zawartością trzech składników
podłoża, a czasokresem lag fazy (ryc. 1).
Ryc. 1. Wykres poziomicowy przedstawiający długość fazy adaptacyjnej [h]
w hodowli drożdży Y. lipolytica KKP 379, w zależności od składu źródła
węgla w podłożu przy maksymalnym poziomie glukozy równym
2 g/100 cm3, oliwy z oliwek 2,4 cm3/100 cm3 oraz glicerolu 15 g/100 cm3.
Uwzględniono wyniki uzyskane dla podłoży 1–7 wg tab. 1.
55
Agata Fabiszewska
Analiza danych doświadczalnych (tab. 2) wykazała istotną korelację pomiędzy zawartością glicerolu, a czasokresem trwania log
(wysoka) i lag fazy (bardzo wysoka), a także istotnej słabej korelacji
pomiędzy ilością glukozy, a czasokresem trwania fazy wzrostu logarytmicznego. Potwierdza to zatem duży wpływ obecności glicerolu
w podłożu na wydłużenie czasu trwania pierwszych dwóch faz wzrostu drożdży Y. lipolytcia KKP 379. Jednocześnie wyniki badań wskazują na podobny czasokres lag i log fazy w podłożach zawierających
glukozę i/lub oliwę z oliwek jako źródło węgla (podłoża 1,2,4 oraz
8,9,11), choć obecność glukozy w podłożu może dodatkowo skracać czasokres log fazy. Optymalny czas hodowli, który umożliwiłby
porównanie aktywności lipolitycznej w podłożach przygotowanych
wg planu dla mieszanin, nie może być zatem dowolny i zasadniczy
wpływ na jego wybór powinny mieć wyniki dla podłoży zawierających glicerol (podłoża nr 3,5,6,7 oraz 10, 12, 13, 14).
Tab. 2. Współczynniki korelacji pomiędzy długością fazy adaptacyjnej
oraz fazy wzrostu logarytmicznego drożdży Y. lipolytcia KKP 379,
a wybranymi źródłami węgla w podłożu: glukozą, oliwą z oliwek oraz
glicerolem.
Źródło węgla w podłożu
glukoza
oliwa z oliwek
glicerol
Długość fazy adaptacyjnej
-0,251443
-0,035348
0,733172(*)
Długość fazy wzrostu logarytmicznego
-0,277410(*)
-0,213988
0,633936(*)
(*) korelacje istotne statystycznie
Wnioski
1. Istnieje istotna korelacja pomiędzy zawartością glicerolu w podłożu, a czasokresem fazy adaptacyjnej i fazy wzrostu logarytmicznego,
a także istotna słaba korelacja pomiędzy ilością glukozy w podłożu
hodowlanym, a czasokresem fazy wzrostu logarytmicznego drożdży
Yarrowia lipolytica KKP 379. Tym samym rodzaj źródła węgla obecnego w podłożu hodowlanym w dużym stopniu może determinować
przebieg faz wzrostu mikroorganizmów.
56
Współzależność pomiędzy wybranymi źródłami węgla w podłożu...
2. Obecność glicerolu w podłożu istotnie wpływa na wydłużenie
fazy adaptacyjnej i fazy wzrostu logarytmicznego w hodowli drożdży
Y. lipolytica KKP 379.
Praca naukowo-badawcza wykonana w ramach grantu wewnętrznego Wydziału Nauk o Żywności Szkoły Głównej Gospodarstwa Wiejskiego
w roku 2012 pt.: ”Próba zagospodarowania glicerolu w pożywkach stosowanych w mikrobiologicznej produkcji enzymów lipolitycznych”.
Bibliografia
1. Barth G., Gaillardin C. (1997): Physiology and genetics of the dimorphic fungus Yarrowia lipolytica. FEMS Microbiol. 19 (4), 219–237.
2. Corzo, G. and Revah, S. (1999): Production and characteristics of the lipase
from Yarrowia lipolytica 681, Bioresour. Technol., 70, 173–180.
3. Dalmau, E., Montesinos, J. L., Lotti, M. and Casas, C. (2000): Effect of different carbon sources on lipase production by Candida rugosa. Enz. Microb.
Technol. 26, 657–663.
4. Darvishi F., Nahvi I., Zarkesh-Esfahani H., Momenbeik F. (2009): Effect of
plant oils upon lipase and citric acid production in Yarrowia lipolytica yeast.
J. Biomed. Biotechnol. 1–7.
5. Fickers P., Nicaud J. M., Destain J., Thonart P. (2003): Over-production
of lipase by Yarrowia lipolytica mutants. Appl. Microbiol. Biotechnol. 63,
136–142.
6. Fickers P., Nicaud J. M., Gaillardin C., Destain J., Thonart P. (2004): Carbon and nitrogen sources modulate lipase production in the yeast Yarrowia
lipolytica. J. Appl. Microbiol. 96, 742–749.
7. Mason R. L., Gunst R. F., Hess J. L. (1989): Statistical Design and Analysis
of Experiments, Wiley.
8. Pereira-Meirelles, F. V., Rocha-Leao, M. H. M., Sant’ Anna Jr,. G. L. (2000):
Lipase location in Yarrowia lipolytica cells, Biotechnol. Lett. 22, 71–75.
9. Pietraszek J. (2004): Planowanie doświadczeń – możliwość czy konieczność. www.statsoft.pl/ czytelnia/jakosc/doe.pdf.
10. Sharma, R., Chisti, Y. And Banerjee, U.Ch. (2001): Production, purification, characterization and application of lipases. Biotechnol.
Adv. 19, 627–666.
57
Agata Fabiszewska
mgr inż. Agata Fabiszewska
prof. dr hab. Ewa Białecka-Florjańczyk
Katedra Chemii, Wydział Nauk o Żywności
Szkoła Główna Gospodarstwa Wiejskiego
ul. Nowoursynowska 159, 02–776 Warszawa
e-mail: [email protected]
58
Anna Hebda, Marta Kempf
Kinga Skrzyszewska, Dariusz Grzebelus
EPISTEME
18/2013, t. 3
s. 59–67
ISSN 1895-2241
Analiza zmienności i określenie struktury
genetycznej jodły wybranych pochodzeń
przy wykorzystaniu markerów SSR
Evaluation of diversity and genetic
structure of selected silver fir populations
on the basis of SSR markers
Abstrakt. Jodła pospolita spotykana jest w Polsce głównie na terenie Karpat, gdzie jej udział szacuje się na ok. 25%. Wartość hodowlana drzewostanów jodłowych określona jest na podstawie doświadczeń proweniencyjnych
i testów potomstwa, a zróżnicowanie i struktura genetyczna głównie na poziomie białek izoenzymowych. W celu oszacowania zmienności genetycznej
wybranych pochodzeń charakteryzujących się różnymi wartościami indeksu
genetyczno-hodowlanego przetestowano dziewiętnaście markerów mikrosatelitarnych jądrowego DNA dla 180 drzew jodły pospolitej. W analizach
wykorzystano metody elektroforezy poliakrylamidowej oraz genotypowanie
drzew poprzez rozdział produktów amplifikacji w automatycznym sekwenatorze. Otrzymane wyniki pokazały przydatność niektórych z badanych
markerów SSR do określenia zróżnicowania i struktury genetycznej wybranych pochodzeń oraz wyraźne zróżnicowanie populacji o wysokim i niskim
indeksie, które tworzyły dwie odrębne grupy w analizie PCoA. Oprócz walorów naukowych wyniki te mogą być przydatne w opracowaniu genetycznych
podstaw przebudowy rozpadających się drzewostanów beskidzkich.
Słowa kluczowe: jodła pospolita, indeks genetyczno-hodowlany, zmienność,
markery molekularne
Abstrakt. Silver fir encounters in Poland, mainly in the Carpathian Mts.
where it constitutes about 25% of the total forest. Breeding value of fir
stands is determined based on provenance and progeny tests, whereas
diversity and genetic structure is mainly estimated by means of izozyme
assays. In order to estimate the genetic variability of selected populations
characterized by different values of genetic and breeding index, 180 fir trees
were tested with nineteen nuclear DNA microsatellite markers. PCR products were separated using polyacrylamide gel electrophoresis or an auto59
Anna Hebda, Marta Kempf, Kinga Skrzyszewska, Dariusz Grzebelus
mated DNA sequencer. The results showed the usefulness of selected SSR
markers tested to determine diversity and genetic structure of the screened
populations and they clearly differentiated populations of high and low index, forming two separate groups in PCoA. It addiction to their scientific
value, the results may be useful in the development of the genetic basis of
rebuild crumbling stands in Beskids Mts.
Key words: Silver fir, breeding and genetic index, diversity, molecular markers
60
Analiza zmienności i określenie struktury genetycznej jodły wybranych...
Wstęp
Drzewostany jodły pospolitej (Abies alba Mill.) w polskich Karpatach
zajmują 25,7% powierzchni, tworząc po buczynach, najliczniejszą
populację drzew leśnych. Ze względu na swój lasotwórczy charakter
w tym regionie, zajmują szczególne miejsce w programie Karpackiego Banku Genów (KBG). Program ten zakłada ochronę oraz weryfikację wartości genetyczno-hodowlanej drzewostanów poprzez
testowanie ich potomstwa na uprawach zachowawczych. Stanowi on
również jeden z elementów długofalowej strategii realizowanej w Lasach Państwowych związanej z ochroną leśnej zmienności genetycznej [Kempf, Sabor 2009].
Przedstawiona praca jest kontynuacją badań nad oceną zmienności jodły pospolitej (Abies alba Mill.) pochodzeń objętych ochroną
w KBG [Kempf, Sabor 2009, Kempf i in 2003]. Celem badań było określenie zróżnicowania genetycznego oraz ocena struktury genetycznej
wybranych proweniencji jodły, przy użyciu markerów mikrosatelitarnych jądrowego DNA (SSR – Simple Sequence Repeats). Markery
te, dziedziczone kodominująco, identyfikują zmienność na poziomie
pojedynczych nukleotydów. Jak dotąd poziom zmienności drzew leśnych, w tym jodły pospolitej analizowany był przy użyciu różnych
typów markerów takich jak izoenzymy [Mejnartowicz 1979, 2003,
Lewandowski i in. 2001, Mejnartowicz i Bergmann 2003, Longauer
i in. 2003, Kempf 2007], AFLP (Amplified Length Fragment Polymorphism) [Tang i in. 2008] i mikrosatelity chloroplastowe spSSR [Vendramin i Ziegenhagen 1997, Ziegenhagen i in. 2005, Konnert i Behm
2006]. Mikrosatelity jądrowego DNA, chociaż identyfikują większą
liczbę alleli w locus w stosunku do markerów organellowych, wykorzystywane były w nielicznych badaniach [Ziegenhagen i in. 2005,
Cremer i in. 2006, Hansen i in. 2005]. Ponieważ dodatkowym celem
pracy była weryfikacja zmienności genetycznej dwóch grup populacji
cechujących się różnymi wartościami genetyczno-hodowlanymi do
badań wybrano bardziej zmienne markery jądrowe SSR.
Materiał i metody
Analizie zróżnicowania struktury genetycznej metodą markerów mikrosatelitarnych SSR poddano potomstwo sześciu wybranych pocho61
Anna Hebda, Marta Kempf, Kinga Skrzyszewska, Dariusz Grzebelus
dzeń jodły pospolitej, charakteryzujących się najwyższą i najniższą
wartością indeksu genetyczno-hodowlanego na wszystkich uprawach
zachowawczych KBG. Ich charakterystykę przedstawia (tab. 1).
12
Brzozów 28 Nowiny
Lesko
Grusz32
ka-2
Baligród
35 Kalnica
Krasiczyn
37 Olszany
38 Cisowa
803
852
806
138d
9,3
84
139b 15,55 89
dług.
szer.
Wartość indeksu
gen.-hod.
ha
Współrzędne
geograficzne
Wyso-kość n.p.m.
Odział
Regiony poch. (mateczne i zwykłe)
Nazwa poch.
Chełmiec
Pow. Wiek
1999r.
Stary
Sącz
Nr. poch.
Nadleśni-ctwo
Tab. 1. Charakterystyka wybranych drzewostanów macierzystych jodły
pochodzeń Karpackiego Banku Genów objętych badaniami DNA
[Kempf i in. 2010].
20o36’ 49o30’ 616 6,341
89b
3,0
112 22o01’ 49o48’ 379 7,353
120b
10,0 107 22o18’ 49o27’ 449 3,800
206c 43,31 107 22o11’ 49o19’ 621 -6,841
804
154b
6,61 100 22o39’ 49o43’ 357 -6,958
172Ab 9,84 103 22o36’ 49o42’ 396 -6,971
Materiał do analiz (igły) pozyskano z 30 losowo wybranych drzew
w pochodzeniu, łączenie 180 prób. Całkowite DNA izolowano przy
użyciu zestawu DNasy Plant Mini Kit (Qiagen). Przetestowano 19
loci mikrosatelitarnych jądrowego DNA [Cremer i in. 2006, Hansen
i in. 2005] na próbie testowej 20 drzew. Mieszaninę reakcyjną o objętości 10µl przygotowano z ok. 20ng DNA, 0,8mM MgCl2, 0,25mM
dNTP, po 0,5µM startera F (forward) i R (reverse) SSR i 0,1 jednostki polimerazy Hot Star (Fermentas). Reakcję PCR przeprowadzono
w termocyklerze „Mastercycler Gradient” (Eppendorf) zaprogramowanym na 40 cykli amplifikacji DNA. Każdy cykl obejmował cztery
etapy: denaturację (94ºC/30”), hybrydyzację starterów (odpowiednio
53ºC, 56ºC, 58ºC) oraz wydłużanie nici (68ºC/5”). Produkty reakcji
PCR denaturowano (95ºC/5”) i rozdzielano w denaturującym żelu
poliakrylamidowym pod napięciem 3000 V. Po zakończonej elektro62
Analiza zmienności i określenie struktury genetycznej jodły wybranych...
forezie żel wybarwiano metodą barwienia srebrowego. Na podstawie
wszystkich analizowanych starterów wybrano 5 polimorficznych
(SF324, SFb4, SFb5, SF50, SF1), które posłużyły do oceny zmienności i określenia struktury genetycznej 180 drzew jodły pospolitej.
Całkowite DNA badanych drzew poddano następnie reakcji amplifikacji przy użyciu wyznakowanych fluorochromami D2, D3 lub D4
sekwencji faga M13 (αM13) oraz z zastosowaniem pary starterów
F z dołączoną sekwencją do końca 5’ komplementarną do faga M13
(M13-F) i R bez zmian. Genotypowanie drzew przeprowadzono poprzez rozdział produktów amplifikacji w automatycznym sekwenatorze CEQ 8000 (Beckman-Coulter) wg techniki rozdziału typu FRAG-3
dostosowanej do rozdziału próbek do 400 pz. Wyniki genotypowania
analizowano w programie CEQ System, a analizy statystyczne wykonano w programie GenAlex 6.5.
Wyniki i dyskusja
Tradycyjne metody oceny zmienności genetycznej, związane z badaniem cech fenotypowych w doświadczeniach proweniencyjnych,
wymagają wielu lat badań [Nowakowska 2007]. Testy potomstwa
dostarczają cennych informacji o zdolnościach przystosowawczych
populacji do panujących warunków klimatycznych i środowiskowych
na danym terenie. Do określenia zmienności i struktury genetycznej
drzewostanów na poziomie DNA przydatne są markery DNA, co potwierdziły niniejsze badania.
Spośród dziewiętnastu starterów mikrosatelitarnych jądrowego
DNA pięć: SF324, SFb4, SFb5, SF50, SF1 generowało wyraźne profile elektroforetyczne różnicujące badane osobniki. Pozostałe startery
nie dały się amplifikować lub dawała produkty monomorficzne. Ze
względu na fakt, że niektóre osobniki lub loci wciąż budziły wątpliwości interpretacyjne przy ostatecznej ocenie genetycznej wzięto
pod uwagę cztery pochodzenia (Chełmiec, Gruszka-2, Kalnica, Olszany) i dwa loci polimorficzne (SFb5, SF1). Dla locus SFb5 otrzymano
9 różnych fragmentów DNA o wielkości od 157 do 173 par zasad.
Natomiast locus SF1 miał 3 allele o wielkości 128, 239 i 242pz, które
występowały w populacjach Kalnica i Olszany. Dla pochodzeń Chełmiec i Gruszka-2 locus ten był monomorficzny. Oba analizowane loci
63
Anna Hebda, Marta Kempf, Kinga Skrzyszewska, Dariusz Grzebelus
charakteryzowały się niskim współczynnikiem wsobności Fis na poziomie -0,028 dla SFb5 i –0,105 dla SF1. Wartości tych parametrów
wskazują na niewielki stopień przewagi heterozygot w stosunku do
homozygot. Współczynnik heterozygotyczności Fit kształtował się
na poziomie odpowiednio 0,065 i 0,450. Na podstawie parametru
Fst stwierdzono, że w zależności od locus różny procent całkowitej
zmienności przypada na zróżnicowanie wewnątrz badanych populacji (Fst = 0,091 dla SFb5 i 0,502 dla SF1).
Obserwowana liczba alleli w locus (Na), efektywna liczba alleli (Ne), indeks Shannona (I), heterozygotyczność oczekiwana (He)
i obserwowana (Ho) oraz współczynnik wsobności (F) dla poszczególnych loci w populacjach przedstawia tab. 2. Heterozygotyczność
obserwowana i oczekiwana kształtuje się na podobnym poziomie, co
wskazuje na stan zbliżony do równowagi Hardy-Weinberga.
Tab. 2. Charakterystyka parametrów zmienności genetycznej
jodły pospolitej.
Populacja
Chełmiec
Gruszka-2
Kalnica
Olszany
Locus l. drzew
SFb5
SF1
SFb5
SF1
SFb5
SF1
SFb5
SF1
10
10
7
7
6
6
12
6
Na
Ne
I
Ho
6,000 3,226 1,400 0,800
monomorficzny
6,000 3,769 1,537 0,714
monomorficzny
3,000 1,946 0,824 0,667
3,000 1,946 0,824 0,333
7,000 3,310 1,531 0,500
3,000 2,323 0,960 0,833
He
F
0,690 -0,159
0,735 0,028
0,486
0,486
0,698
0,569
-0,371
0,314
0,284
-0,463
Dystans genetyczny pomiędzy badanymi pochodzeniami wykonano metodą analizy głównych współrzędnych (PCoA) (ryc. 3). Na tej
podstawie wyodrębnione zostały dwie grupy populacji: 1) Chełmiec
i Gruszka-2 oraz 2) Kalnica i Olszany. Pierwsze dwie współrzędne
reprezentowały ponad 74% całkowitej zmienności. Wszystkie pochodzenia pierwszej grupy znalazły się w II i IV ćwiartce, a znaczna większość populacji grupy drugiej w I i III. Pochodzenia charakteryzujące się wysoką wartością indeksu genetyczno-hodowlanego (tab. 1)
grupowały się razem i wykazywały wyższą zmienność genetyczną.
Pochodzenia o niskich wartościach indeksowych cechowało niższe
64
Analiza zmienności i określenie struktury genetycznej jodły wybranych...
zróżnicowanie genetyczne. Tworzyły one jedną grupę podobną pod
względem genetycznym. Znaczenie wysokiej heterozygotyczności
dla zdolności adaptacyjnych i przeżywalności drzew leśnych nie jest
jednoznaczne [Kempf 2007]. Jedna z hipotez zakłada, że im bardziej
zróżnicowana jest pula genowa gatunku, tym większe istnieje prawdopodobieństwo wystąpienia korzystnej kombinacji alleli, gwarantującej przeżywalność i przystosowanie do fluktuacji klimatu [Eriksson
i Ekberg 2001]. Prezentowane badania wykazały powiązanie struktury genetycznej z wartością genetyczno-hodowlaną co dobrze rokuje dla programów selekcji opartych do tej pory głównie na wynikach
doświadczeń proweniencyjnych.
Ryc. 3. Wyniki analizy głównych współrzędnych.
Wnioski
1. Stosowane markery mikrosatelitarne jądrowego DNA (SFb5, SF1)
są przydatne do określenia zmienności genetycznej populacji jodły
pospolitej.
2. Badane populacje charakteryzuje wysoki poziom całkowitego
zróżnicowania genetycznego w locus SF1 i niski w locus SFb5.
3. Wykorzystane markery różnicują populacje w zależności od
ustalonej wartości genetyczno-hodowlanej. Pochodzenia o wysokim
i niskim indeksie tworzą dwie odrębne grupy.
65
Anna Hebda, Marta Kempf, Kinga Skrzyszewska, Dariusz Grzebelus
4. Populacje o wysokiej wartości indeksu genetyczno-hodowlanego wykazują wyższy poziom zmienności genetycznej niż populacje
o niskim indeksie.
Przedstawione badania realizowane były częściowo w ramach Programu
POMOST (C_27) Fundacji Nauki Polskiej współfinansowanego ze środków
strukturalnych w ramach Działania 1.2 „Wzmocnienie potencjału kadrowego nauki” POIG 2007–2013 oraz badań zleconych przez Generalną Dyrekcję Lasów
Państwowych (OP/2710-21/U/09).
Bibliografia
1. Cremer E., Liepelt S. Sebastiani F., Buonamici A., Michalczyk I. M., Ziegenhagen B., Vendramin G.G. 2006. Identification and characterization
of nuclear microsatellite loci in Abies alba Mill. Molecular Ecology Notes
6 (2): 374–376.
2. Eriksson G., Ekberg I.. 2001. An Introduction to Forest Genetics. Swedish
University of Agricultural Sciences, Uppsala, 166.
3. Hansen O. K., Vendramin G. G., Sebastiani F., Edwards K. J. 2005: Development of microsatellite markers in Abies nordmanniana (stev.) Spach and
cross-species amplification in the Abies genus. Molecular Ecology Notes
5,784–787.
4. Kempf M. 2007. Ocena wybranych cech adaptacyjnych i morfologicznych oraz
analiza polimorfizmu izoenzymowego populacji cząstkowych jodły, świerka
i buka objętych ochroną w Karpackim Banku Genów. Rozprawa doktorska.
Maszynopis KNSiSDL UR Kraków.
5. Kempf M., Sabor J. 2009. Ocena zmienności cech adaptacyjnych pięcioletniej
jodły pospolitej pochodzeń objętych ochroną na powierzchniach zachowawczych Karpackiego Banku Genów. Sylwan 153 (10): 651–661.
6. Kempf M., Sabor J., Skrzyszewska K., Banach J. 2010: Określenie wartości
genetyczno-hodowlanej jedlin karpackich w ramach regionów pochodzenia
i stref wysokościowych z uwzględnieniem dotychczas założonych powierzchni zachowawczych Karpackiego Banku Genów (KBG). (W:) Red. J. Sabor:
Określenie i zachowanie bazy nasiennej dla potrzeb nadleśnictw beskidzkich z uwzględnieniem gatunków domieszkowych. Sprawozdanie etapowe.
Maszynopis. KGNiSzL.
7. Kempf M., Sabor J., Stanuch H. 2003. Ocena cech adaptacyjnych i morfologicznych potomstwa drzewostanów jodłowych objętych ochroną
w Karpackim Banku Genów. Sylwan, 147(10), 3–15.
66
Analiza zmienności i określenie struktury genetycznej jodły wybranych...
8. Konnert M., Behm A. 2006. Proof of identity of forest reproductive material
based on reference samples. Mitteilungen der Bundesforschungsanstalt.
r Forst – u. Holzwirtschaft (BFH), 221: 61–71.
9. Lewandowski A., Filipiak M., Burczyk J. 2001. Genetic variation of Abies alba
Mill. in Polish part of Sudety Mts. Acta Soc.Bot. Poloniae 70 (3).
10. Longauer R., Paule L., Andonoski A. 2003. Genetic diversity of southern
populations of Abies alba Mill. Forest Genetic 10 (1): 1–9.
11. Mejnartowicz L. 1979. Polymorphism at the LAP and GOT loci in Abies
alba Mill. populations. Bulletin de l’Academie Polon. des Scie. 27 (12):
1063–1070.
12. Mejnartowicz L. 2003. Genetic analysis of silver-fir populations in the Beskides. Acta Soc.Bot. Poloniae: 72(2): 115–119.
13. Mejnartowicz L., Bergmann F. 2003. Mode of Inheritance of Aspartate
Aminotransferase in Silver Fir (Abies alba Mill.). Silvae Genetica 52 (1):
15–18.
14. Nowakowska J. 2007. Zmienność genetyczna polskich wybranych populacji sosny zwyczajnej (Pinus sylvestris L.) na podstawie analiz polimorfizmu
DNA. Rozpr. Habilit., IBL Warszawa 2007, 118.
15. Tang S., Dai W., Li M. Zhang Y., Geng Y., Wand L. Zhong Y. 2008. Genetic
indiversity of relictual and endangered plant Abies ziyanensis (Pinaceae)
reveald by AFLP and SSR markers. Genetica 133: 21–30.
16. Vendramin, G. G., and Ziegenhagen, B. 1997. Characterisation and inheritance of polymorphic plastid microsatellites in Abies. Genome, 40:
857–864.
17. Ziegenhagen B., Fady B., Kuhlenkamp V., Liepelt, S. 2005. Differentiating
Groups of Abies species with a simple molecular marker. Silvae Genetica,
54(3): 123–126.
mgr inż. Anna Hebda
dr inż. Marta Kempf, dr inż. Kinga Skrzyszewska
Katedra Genetyki, Nasiennictwa i Szkółkarstwa Leśnego
dr inż. Dariusz Grzebelus, prof. UR
Katedra Genetyki, Hodowli i Nasiennictwa
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
Opiekun naukowy: Dr hab. inż. Dariusz Grzebelus, prof. UR
67
Iwona Kozikowska, Katarzyna Suprewicz
Anna Gał, Katarzyna Szczepańska
EPISTEME
18/2013, t. 3
s. 69–79
ISSN 1895-2241
Zawartość miedzi i cynku w łożysku
kobiet, pępowinie i krwi pępowinowej
w zależności od długości trwania ciąży
Content of copper and zinc in human
placenta, umbilical cord and cord blood
depending on gestational age
Abstrakt. Do badań wykorzystano materiał pochodzący z tkanki krwi pępowinowej, pępowiny oraz łożysk zdrowych kobiet z Bytomia i jej okolic. Pacjentki uczestniczące w badaniu (n=175) zostały podzielone ze względu na
tydzień ciąży w chwili porodu na dwie grupy badawcze: kobiety z ciążą donoszoną (poród powyżej 37 tygodnia ciąży) oraz kobiety z ciążą niedonoszoną (poród w 37 lub przed 37 tygodniem ciąży). Celem badań było określenie
stopnia kumulacji cynku oraz miedzi we krwi pępowinowej, pępowinie oraz
łożyskach kobiet w zależności od tygodnia ciąży w chwili porodu. Stężenie
metali w tkankach została oznaczona metodą płomieniowej absorpcyjnej
spektrometrii atomowej (FAAS). Przeprowadzona analiza wykazała obecność zarówno cynku, jak i miedzi we wszystkich badanych tkankach. Kumulacja Zn w badanych tkankach znacznie przewyższa średnią zawartość Cu.
Najwięcej cynku stwierdzono w łożyskach kobiet z ciążą donoszoną (38,696
mg×kg-1 s.m), natomiast miedź w największym stopniu kumuluje się w łożyskach kobiet, które urodziły przed 38 tygodniem ciąży.
Słowa kluczowe: pępowina, łożysko, krew pępowinowa, cynk, miedź
Summary. For the purpose of this study, material taken from cord blood,
umbilical cord and placenta of healthy women from Bytom (Poland) and surrounding areas was used. Patients who took part in this study (total number
was 175) were divided into two groups, taking into account gestational age.
Women, who born a baby on time, that means after 37 week of pregnancy
(gestational age in delivery time is after 37 week) were in the first group and
women who born baby before time (gestational age in delivery time equal 37
week and before 37 week) were in the second group. The main aim of this
study was to assess the average content of zinc and copper in cord blood,
69
Iwona Kozikowska, Katarzyna Suprewicz, Anna Gał, Katarzyna Szczepańska
umbilical cord and placentas taken from women in different gestational age.
Concentrations of elements in all samples were measured using Flame Atomic
Absorption Spectrometry (FAAS). The conducted study demonstrates that
zinc and copper were accumulated in all tissues. It was observed that medium
level of Zn in researches tissues was higher than average content of Cu in the
same tissues. The maximum concentration of Zn was observed in the placentas taken from women after 37 gestational week (38,696 mg×kg-1 d.m). The
maximum level of copper was observed in the placentas taken from woman
who gave birth to child before 38 gestational week.
Key words: umbilical cord, placenta, cord blood, zinc, copper
70
Zawartość miedzi i cynku w łożysku kobiet, pępowinie i krwi pępowinowej...
Wstęp
Okres ciąży związany jest ze zwiększonym zapotrzebowaniem na
wszystkie składniki odżywcze i mineralne, w tym cynk i miedź. Niedobór tych pierwiastków może negatywnie wpływać na cały przebieg
oraz wynik ciąży (Upadhyaya i in. 2004). Zmniejszona zawartość Zn
i Cu w organizmie w okresie ciąży oraz rozwoju płodu może wpływać
na pojawienie się wad wrodzonych noworodków, poronień, (Black
2001), nadciśnienie ciążowe, odklejanie łożyska, przedwczesne pęknięcie błon płodowych oraz niską masę urodzeniową dziecka (Pathak
and Kapil 2004).
Miedź jest pierwiastkiem odgrywającym duże znaczenie zwłaszcza we wczesnym etapie rozwoju człowieka, odpowiadając za jego
prawidłowy rozwój i sprawne funkcjonowanie osłonek mielinowych
komórek nerwowych (Yasodhara, Ramaraju i Raman 1991). Pierwiastek ten stanowi niezbędny składnik licznych enzymów, a także
katalizuje wiele procesów biochemicznych (Pasterniak i Floriańczyk
1995). Cynk jest mikroelementem niezbędnym w embriogenezie,
a w organizmie spełnia szereg funkcji wliczając syntezę enzymów
i kwasów nukleinowych (WHO 1996). Pomiędzy 24 a 34 tygodniem
ciąży, średnie dzienne zapotrzebowanie na ten metal wynosi około
850 mg×kg-1, a najbardziej istotne zwiększone zapotrzebowanie na
Zn następuje w ostatnim trymestrze ciąży (Caulfield i in. 1998).
Celem badań było określenie stopnia kumulacji cynku oraz miedzi we krwi pępowinowej, pępowinie oraz łożyskach kobiet w zależności od tygodnia ciąży w chwili porodu, a także sprawdzenie
wzajemnych korelacji pomiędzy zawartościami Zn, Cu we krwi pępowinowej, pępowinie i łożyskach kobiet z ciążą donoszoną oraz ciążą
niedonoszoną.
Materiał i metody
Do badań wykorzystano materiał pochodzący z krwi pępowinowej,
pępowiny oraz łożysk kobiecych pobranych bezpośrednio w czasie
oraz tuż po porodzie. Materiał został pozyskany z Kliniki Położnictwa i Ginekologii Onkologicznej w Bytomiu od 175 kobiet. Pacjentki
uczestniczące w badaniu zostały podzielone ze względu na tydzień
71
Iwona Kozikowska, Katarzyna Suprewicz, Anna Gał, Katarzyna Szczepańska
ciąży w chwili porodu na dwie grupy badawcze: kobiety z ciążą donoszoną (poród powyżej 37 tygodnia ciąży) oraz kobiety z ciążą niedonoszoną (poród w 37 lub przed 37 tygodniem ciąży). Wszystkie
kobiety od których pobrano materiał mieściły się w przedziale wiekowym 17–43 lat i wszystkie pochodziły z terenu Górnego Śląska. Na
badania uzyskano pisemną zgodę komisji bioetycznej (Nr 75/KBL/
OIL/2010).
Koncentrację cynku oraz miedzi w tkankach oznaczono stosując mineralizację na mokro. Wysuszona i zważona krew pępowinowa, fragmenty pępowiny oraz tkanki łożyska umieszczono w kolbach
mineralizatora a następnie zalano 2cm3 kwasu azotowego o stężeniu
65%. Przygotowane w ten sposób próbki ogrzewano w temperaturze
105 °C przez około 2 godziny. Następnie mineralizaty przeniesiono
do kolbek miarowych o pojemności 10 cm3 i dopełniono wodą redestylowaną. W celu oznaczenia średniej zawartości Zn i Cu w analizowanych tkankach zastosowano metodę płomieniowej atomowej
spektrometrii absorpcyjnej (FAAS) przy użyciu spektrometru Cole-Palmer model BUCK 200A.
Założenia testu parametrycznego zostały sprawdzone testem
Shapiro Wilka (test na normalność). Ponieważ założenia normalnego rozkładu nie zostały spełnione, dalsze statystyki oparte były na
testach U Manna-Whitneya oraz analizie korelacji Spearmana. We
wszystkich analizach poziom istotności statystycznej ustalono na
poziomie 0.05. Wszystkie obliczenia i analizy zostały przeprowadzone w programie Microsoft Excel 2010 oraz Statistica 10.
Wyniki
Analiza statystyczna wykazała obecność zarówno cynku jak i miedzi
w tkankach krwi pępowinowej, pępowinie oraz łożyskach. Porównując oba metale zauważono, iż cynk jest metalem, który w znacznie
większym stopniu niż miedź kumuluje się we wszystkich badanych
tkankach. Spośród trzech analizowanych tkanek, zaobserwowano, że
tkanka łożyska w największym stopniu kumuluje Zn oraz Cu.
Zawartość miedzi w badanych tkankach pobranych od kobiet
z ciąża donoszoną oraz ciążą niedonoszoną ilustruje ryc.1. Zaobserwowano różnice pomiędzy średnią zawartością Cu w tkankach w ob72
Zawartość miedzi i cynku w łożysku kobiet, pępowinie i krwi pępowinowej...
rębie grupy kobiet które urodziły po 37 tygodniu ciąży a grupą kobiet
rodzących przed tym terminem. Matki z ciążą donoszoną miały w łożysku, pępowinie oraz we krwi pępowinowej istotnie mniejsze stężenie Cu niż kobiety, które urodziły w 37 lub przed 37 tygodniem ciąży.
Analiza statystyczna wykazała występowanie statystycznie istotnych
różnic pomiędzy średnią zawartością miedzi w pępowinie (p=0.000),
krwi pępowinowej (p=0.000) oraz w łożysku (p=0.000) kobiet z ciążą
donoszoną a średnią zawartością miedzi w grupie kobiet, które urodziły przed 38 tygodniem ciąży. W łożyskach kobiet, które nie doniosły ciąży do końca wyznaczonego terminu, odnotowano największe
stężenie miedzi (6.938±0.738 mg×kg-1 s.m.). W tej grupie pacjentek
pośród analizowanych tkanek najmniejszą zawartość Cu odnotowano w pępowinie (2.362±0.162 mg×kg-1).
Ryc. 1. Średnia zawartość miedzi (Cu) we krwi pępowinowej, pępowinie
i łożyskach kobiet z ciąża donoszoną (>37 tydzień ciąży) oraz ciążą
niedonoszoną (≤37 tydzień ciąży). Wyniki wyrażono w mg×kg-1 s.m.±Std. Err.
Porównując kumulację cynku w tkankach krwi pępowinowej,
pępowinie oraz w łożyskach kobiet z ciążą donoszoną oraz kobiet
z ciążą niedonoszoną można stwierdzić, iż średnia ich zawartość
w obu grupach występuje na zbliżonym poziomie (ryc. 2.). Analiza
statystyczna wykazała brak istotnych statystycznie różnic pomiędzy
średnią zawartością Zn we wszystkich badanych tkankach w grupie
kobiet rodzących 37 tygodnia ciąży lub przed tym terminem a średnią zawartością tego metalu w grupie kobiet z ciążą zakończoną terminowo.
73
Iwona Kozikowska, Katarzyna Suprewicz, Anna Gał, Katarzyna Szczepańska
Ryc. 2. Średnia zawartość cynku (Zn) we krwi pępowinowej, pępowinie
i łożyskach kobiet z ciąża donoszoną (>37 tydzień ciąży) oraz ciążą
niedonoszoną (≤37 tydzień ciąży). Wyniki wyrażono w mg×kg-1 s.m.±Std. Err.
Zaobserwowano, iż najmniejsze ilości cynku są kumulowane we
krwi pępowinowej noworodków (grupa matek z ciążą niedonoszoną
16.464±1.626 mg×kg-1; grupa matek z ciążą donoszoną 16.394±0.749
mg×kg-1), ponad dwukrotnie większą zawartość Zn zaobserwowano
w łożyskach kobiet u obu grup.
Dodatkowe informacje dotyczące pacjentek i ich dzieci uczestniczące w badaniu prezentuje tabela 1. Spośród wszystkich noworodków, ich masa ciała mieściła się w przedziale 1550–4450g. Najmłodsza matka miała 17 lat, a najstarsza – 43 lata i należała do grupy
kobiet z ciążą donoszoną. Obwód głowy noworodków był zbliżony
w obu analizowanych grupach.
Wykonując analizę R. Spearmana, zbadano korelacje jakie występują pomiędzy średnią zawartością cynku oraz miedzi w pępowinie a zawartościami tych pierwiastków w łożysku, pomiędzy zawartościami obu metali we krwi pępowinowej a zawartościami Zn, Cu
w łożysku a także pomiędzy pępowiną a krwią pępowinową w grupie
kobiet z ciążą donoszoną oraz rodzących przed 38 tygodniem ciąży.
W każdym przypadku postawiano hipotezę, że nie istnieje korelacja
między zawartościami obu pierwiastków z badanymi tkankami. Wyniki testu przedstawiono odpowiednio w tabeli 2 (wyniki statystycznie istotne).
74
Zawartość miedzi i cynku w łożysku kobiet, pępowinie i krwi pępowinowej...
Tab. 1. Dane matek i ich dzieci, które uczestniczyły w badaniu z Bytomia
w latach 2010–2012.
Ciąża niedonoszona
(≤37 tydzień ciąży)
Ciąża donoszona (>37
tydzień ciąży)
N=47
N=128
średnia
min/max
średnia
min/max
Wiek kobiet [lat]
30
17/42
28
17/43
Skala Apgar
9
6/10
9,7
8/10
Waga noworodków [g]
2700
1550/4450
3313
1990/4200
Długość ciała noworodków [cm]
51
44/56
54
46/60
34,5
27/37
34,4
30/38
Obwód głowy noworodków [cm]
Tab. 2. Korelacje pomiędzy: zawartościami Zn i Cu we krwi pępowinowej,
pępowinie i łożyskach kobiet z ciążą donoszoną
oraz ciążą niedonoszoną (wyniki testu R Spearmana, p≤0.05).
Ciąża niedonoszona (≤37 tydzień ciąży)
Ciąża donoszona (>37 tydzień ciąży)
PORÓWNYWANE TKANKI Wartość p PORÓWNYWANE TKANKI Wartość p
Zn Krew pępowinowa/Zn
Łożysko
0.0001 Zn Krew pępowinowa/Zn
Łożysko
0.0000
Zn Pępowina/Zn Łożysko
0.0001 Zn Pępowina /Zn Łożysko 0.0000
Cu Pępowina/Cu Łożysko
0.0327 Cu Pępowina/Cu Łożysko
0.0000
Zn Krew pępowinowa/Cu
Krew pępowinowa
0.0141
Wszystkie otrzymane korelacje były korelacjami dodatnimi.
Istnienie wysoce statystycznie istotnych korelacji stwierdzono pomiędzy zawartością cynku we krwi pępowinowej a zawartością Zn
w łożyskach kobiet, które urodziły w 37 lub przed 37 tygodniem ciąży
oraz w grupie kobiet rodzących po 37 tygodniu ciąży (odpowiednio:
p=0.0001; p=0.0000). W grupie kobiet z ciążą niedonoszoną zaobserwowano umiarkowaną korelację pomiędzy zawartościami miedzi
w pępowinie a zawartościami miedzi w łożysku (p=0.0327), co zostało
75
Iwona Kozikowska, Katarzyna Suprewicz, Anna Gał, Katarzyna Szczepańska
również zaobserwowane w obrębie kobiet, których poród nastąpił po
37 tygodniu ciąży (p=0.0000). We krwi pępowinowej w grupie matek
z ciążą donoszoną wystąpiły statystycznie istotne umiarkowane korelacje pomiędzy zawartością cynku a zawartością miedzi (p=0.0141).
Dyskusja i wnioski
Mikroelementy takie jak cynk oraz miedź mogą łatwo przenikać poprzez łożysko do płodu, wpływając przy tym na jego kondycję oraz
funkcjonowanie (Singh i in. 2010). Dane dotyczące wpływu wieku
ciążowego na kumulację miedzi w łożysku, pępowinie i krwi pępowinowej nie są zgodne. Zaobserwowano, iż kumulacja tego metalu
we krwi pępowinowej zwiększa się wraz ze wzrostem wieku ciążowego, jak również masą urodzeniową dziecka, jednoznacznie wskazując
w ten sposób dodatkowe korzyści płynące w redukcji porodów przedwczesnych (Wells i in. 2011). Perveen i inni (2002) nie zauważyli
jednak żadnej zależności pomiędzy wpływem wieku ciążowego na
kumulacje Cu we krwi pępowinowej. Wyniki własne wykazały, że noworodki z Bytomia (Polska) urodzone w 37 lub przed 37 tygodniem
ciąży charakteryzowały się niższą masą urodzeniową niż dzieci, które
urodziły się w wyznaczonym, końcowym terminie ciąży. Ponadto stężenie miedzi tak we krwi pępowinowej, jak i w łożysku oraz pępowinie
w grupie kobiet z ciążą niedonoszoną znacznie przewyższała średnie stężenie tego metalu w badanych tkankach pobranych od kobiet
z ciążą donoszoną (ryc. 1). Bazując na wynikach Wells i inni (2011)
średnia zawartość miedzi we krwi pępowinowej noworodków to
wartość 38.62 mg·dL -1. Wśród noworodków z Azji odnotowano 21%
większą zawartość miedzi we krwi pępowinowej niż u noworodków
z Kaukazu. Ponieważ transport pierwiastków dwuwartościowych
z organizmu matki do dziecka jest konkurencyjny, niemowlęta urodzone przedwcześnie mogą gromadzić większe ilości Cu niż noworodki donoszone do końca ciąży. Transport mikroelementów od matki do
płodu może się różnić w różnych etapach ciąży (Perveen i in. 2002).
Niewiele badań zostało przeprowadzonych w celu określenia
wzajemnych powiązań między średnią zawartością cynku we krwi
pępowinowej a tygodniem ciąży w chwili porodu. Kantola i inni
(2000) zauważyli, iż średnia zawartość cynku w łożyskach kobiet
w pierwszym trymestrze ciąży (77.14 µg×g-1) przewyższa średnią za76
Zawartość miedzi i cynku w łożysku kobiet, pępowinie i krwi pępowinowej...
wartość Zn w łożyskach niepalących kobiet w końcowym etapie ciąży (62.60 µg×g-1), jednakże, różnice te nie były statystycznie istotne.
W badaniach prowadzonych na Śląsku nie zaobserwowano różnicy
pomiędzy średnią zawartością Zn w łożyskach kobiet w zależności od
tygodnia ciąży (ryc. 2). Na zawartość cynku w łożysku duży wpływ
wywiera palenie papierosów przez ciężarne kobiety (Kuhnert i in.
1993) Jak pokazują wyniki badań, zawartość cynku we krwi pępowinowej przewyższa średnią zawartość tego metalu we krwi matczynej i zwiększa się wraz z wiekiem ciążowym (Wasowicz i in. 1993).
Z kolei Custódio i inni (2005) zauważyli zmniejszenie stężenia tego
metalu w osoczu krwi pępowinowej wraz ze wzrostem tygodnia ciąży
w chwili porodu. Frković i inni (1996) zaobserwowali również wyższą koncentrację Zn we krwi pępowinowej u dzieci, które urodziły się
przedwcześnie, jednakże różnice te nie były statystycznie istotne, co
zostało również potwierdzone w badaniach własnych. Kantola i inni
(2000) stwierdzili, iż koncentracja Zn oraz Cu w łożyskach kobiet jest
silnie powiązana z zanieczyszczeniem środowiska, paleniem papierosów, liczbą porodów oraz wiekiem matki. Wyniki badań ze Śląska
dowiodły, że wiek ciążowy nie ma wpływu na zawartość cynku w łożysku, pępowinie oraz krwi pępowinowej. Świadczy to o stabilności
transportu tego metalu przez łożysko na różnych etapach ciąży.
Wysoce istotna, negatywna korelacja pomiędzy zawartością miedzi w łożysku a masą urodzeniową noworodków została wykazana
w badaniach Kantola i innych (2000). We krwi pępowinowej odnotowano słabą korelacje pomiędzy zawartością cynku a masą ciała noworodka i obwodem jego głowy (Frković i in. 1996). Ponadto, badania
wykazują zależność między stężeniem kadmu zawartego w łożysku
z cynkiem oraz miedzią (Kuhnert i in. 1993). W łożyskach kobiet ze
Śląska odnotowano wzrost średniej zawartości cynku wraz ze zwiększeniem stężenia tego metalu w pępowinie oraz krwi pępowinowej,
zarówno u matek rodzących przed wyznaczonym terminem, jak i kobiet z ciążą donoszoną. Z kolei Wells i inni (2011) zaobserwowali we
krwi pępowinowej korelacje, pomiędzy cynkiem i selenem.
Metale w organizmie człowieka mogą wzajemnie ze sobą oddziaływać, nadmiar lub niedobór jednego pierwiastka może wpływać na
zawartość innego pierwiastka. Ponadto długość trwania ciąży istotnie wpływa na zawartość miedzi w łożysku, pępowinie i krwi pępowinowej noworodków.
77
Iwona Kozikowska, Katarzyna Suprewicz, Anna Gał, Katarzyna Szczepańska
Bibliografia
1. Black, R. E. 2001. Micronutrients in pregnancy. British Journal of Nutrition 85 (Suppl.: 193–197.
2. Caulfield, L. E., N. Zavaleta, A. H. Shankar, and M. Merialdi. 1998. Potential contribution pf maternal zinc supplementation during pregnancy to
maternal and child survival. pl. The American Journal of Clinical Nutrition 68, Suppl.: 499–509.
3. Custódio, P. J., Maria Luisa Carvalho, F. Nunes, S. Pedroso, and
A. Campos. 2005. Direct analysis of human blood (mothers and newborns)
by energy dispersive X-ray fluorescence. Journal of Trace Elements in Medicine and Biology : organ of the Society for Minerals and Trace Elements (GMS) 19 (2–3): 151–8.
4. Frković, A., B. Medugorac, and A. Alebić-Juretić. 1996. Zinc levels in human milk and umbilical cord blood. The Science of the Total Environment
192(2): 207–12.
5. Kantola, M, R. Purkunen, P. Kröger, A. Tooming, J. Juravskaja,
M Pasanen, S Saarikoski, and T Vartiainen. 2000. Accumulation of cadmium, zinc, and copper in maternal blood and developmental placental
tissue: differences between Finland, Estonia, and St. Petersburg. Environmental Research 83(1): 54–66.
6. Kuhnert, B. R., P. M. Kuhnert, N. Lazebnik, and P. Erhard. 1993. The relationship between placental cadmium, zinc, and copper. Journal of the
American College of Nutrition 12: 31–35.
7. Pasterniak, K., and B. Floriańczyk. 1995. Metale życia. Wybrane metale i ich
rola w funkcjonowaniu organizmu człowieka. Wydawnictwo FOLIUM Lublin.
8. Pathak, P., and U. Kapil. 2004. Role of trace elements zinc, copper and magnesium during pregnancy and its outcome. Indian Pediatric Journal 71:
1003–1005.
9. Perveen, Shahana, Waseem Altaf, Nidhi Vohra, Maria Lourdes Bautista,
Rita G Harper, and Raul a Wapnir. 2002. Effect of gestational age on cord
blood plasma copper, zinc, magnesium and albumin. Early human development 69 (1–2): 15–23.
10. Singh, J., V. K. Singh, M. Anand, P. Kumar, and M.K.J. Siddiqui. 2010.
Placental lead and its interaction with some essential metals among women
from Lucknow, India. Asian Journal of Medical Sciences 1: 32–36.
11. Upadhyaya, C., S. Mishra, P. Ajmera, and P. Sharma. 2004. Serum iron,
copper and zinc status in maternal and cord blood. Indian Journal of Clinical Biochemistry 19: 48–52.
12. Wasowicz, W., P. Wolkanin, M. Bednarski, J. Gromadzinska, and K.
Sklodowska, M., Grzybowska. 1993. Plasma trace element (Se, Zn, Cu)
78
Zawartość miedzi i cynku w łożysku kobiet, pępowinie i krwi pępowinowej...
concentrations in maternal and umbilical cord blood in Poland. Biological
Trace Elements Research 38: 205–15.
13. Wells, Ellen M., Jeffery M Jarrett, Yu Hong Lin, Kathleen L Caldwell, Joseph R Hibbeln, Benjamin J Apelberg, Julie Herbstman, Rolf U Halden,
Frank R Witter, and Lynn R Goldman. 2011. Body burdens of mercury,
lead, selenium and copper among Baltimore newborns. Environmental Research 111(3): 411–7.
14. WHO. 1996. Zinc. In: Trace elements in human nutrition and health. World
Health Organization, Geneva, Switzerland: 72–104.
15. Yasodhara, P., L. A. Ramaraju, and L. Raman. 1991. Trace minerals in
pregnancy: copper and zinc. Nutrition Research 11: 15–21.
mgr Iwona Kozikowska, mgr Katarzyna Suprewicz
mgr Anna Gał, lek. Katarzyna Szczepańska
Uniwersytet Pedagogiczny w Krakowie
Instytut Biologii
Zakład Zoologii Kręgowców i Biologii Człowieka
ul. Podbrzezie 3, 31–054 Kraków
e-mail: [email protected]
Opiekun naukowy: prof. nadzw. dr hab. Robert Stawarz
79
Katarzyna Wajdzik
Gabriela Gołębiowska-Pikania
Maria Wędzony
EPISTEME
18/2013, t. 3
s. 81–88
ISSN 1895-2241
Mapowanie loci cech ilościowych (QTL)
pszenżyta ozimego (x Triticosecale Wittm.)
Quantitative trait loci (QTL) in winter
triticale (x Triticosecale Wittm.)
Abstrakt. Rosnące znaczenie gospodarcze pszenżyta (x Triticosecale,
Wittm.) sprawia, że ten gatunek pochodzenia mieszańcowego jest interesującym obiektem badań genetycznych. Celem badań było ustalenie rejonów
genomu (QTL), w których zlokalizowane są geny związane z determinacją
wybranych cech morfologicznych i analiza sposobu współpracy genomów
składowych w ich determinacji. Populację mapującą 92 linii DH otrzymano z mieszańca F1 między odmianami ’Hewo’ i ’Magnat’. Dla populacji tej
opracowano mapę genetyczną markerów DArT i SSR. Fenotypowanie roślin
przeprowadzono w 3 sezonach wegetacyjnych. Analizy QTL dla liczby pędów
siewki, stosunku długości blaszki liściowej do długości pochwy liścia, procentu osadzenia i masy ziaren z kłosa, dokonano metodami regresji liniowej
(SMA) i złożonego mapowania interwałowego (CIM), programem WinQTLCartographer 2.5. Dla badanych cech struktury plonu (CIM, LOD>2) zlokalizowano 20 QTL we wszystkich trzech składowych genomach (A, B i R),
co wskazuje na to, że homeologiczne genomy pszenicy i żyta biorą udział
w determinowaniu cech morfologicznych u pszenżyta.
Słowa kluczowe: pszenżyto ozime, fenotypowanie, genotypowanie, morfologia
rośliny, analiza QTL
Summary. Increasing economic importance of triticale (x Triticosecale,
Wittm.) makes this man-made cereal an interesting object of genetic studies. The aims of this study were to determine regions of the genome (QTL)
associated with the determination of selected morphological traits and
analysis of cooperation of genomic components in the traits determination.
Mapping population of 92 DH lines were obtained from F1 hybrid between
varieties ‘Hewo’ and ‘Magnat’. The genetic map of SSR and DArT markers
were developed for the population. Plant phenotyping was carried out in
three growing seasons. In the experiment, number of seedlings shoots, leaf
81
Katarzyna Wajdzik, Gabriela Gołębiowska-Pikania, Maria Wędzony
length compared to the length of the leaf sheath, the spike filling and weight
of grains per spike were established. QTL were identified by single-marker
analysis (SMA) and composite interval mapping (CIM) methods with Windows QTLCartographer 2.5 software. Twenty QTL for the studied traits
(CIM; LOD> 2) were located in all 3 components of triticale genome (A, B,
and R), indicating that homeologous genomes of wheat and rye are involved
in determining the morphological characteristics of triticale.
Key words: winter triticale, phenotyping, genotyping, plant morphology, QTL
analysis
82
Mapowanie loci cech ilościowych (QTL) pszenżyta ozimego (x Triticosecale Wittm.)
Wstęp
Pszenżyto (´Triticosecale Wittm.) jest mieszańcem międzyrodzajowym, alloheksaploidem, otrzymanym w warunkach laboratoryjnych.
Forma heksaploidalna powstała w wyniku krzyżowania pszenicy
(Triticum aestivum L.) o składzie genomowym AABBDD z żytem (Secale cereale) – RR. Genom D pszenicy ulega spontanicznej eliminacji
w trakcie hodowli. Niekiedy jego fragmenty obecne są jako translokacje. Wszystkie trzy genomy maja charakter homeologiczny –
są spokrewnione. W pszenżycie zgromadzone są w nowym układzie
niespotykanym w przyrodzie, w związku z tym jest interesujące,
w jaki sposób te trzy składowe genomy, A,B i R ze sobą współpracują.
Uprawa każdej rośliny rolniczej wymaga prowadzenia równoczesnej selekcji pod względem wielu cech. Identyfikacji loci cech ilościowych można dokonać przy użyciu odpowiednich markerów genetycznych za pomocą obliczania położenia QTL (QuantitativeTrait
Loci – locus cechy ilościowej). QTL to dające się zlokalizować markery
genetyczne, które są ściśle sprzężone z genami kontrolującymi interesujące nas cechy.
Materiał i metody
Badania przeprowadzono w trzech cyklach doświadczeń, obiekty roślinne testowano w układzie całkowicie losowym. Fenotypowanie przeprowadzono dla roślin hartowanych na chłód w fazie
7-tygodniowej siewki (sezony-S1S, S2S) oraz roślin niehartowanych
na chłód w fazie 4-tygodniowej siewki (sezon-S3S). Oceny morfologii
rośliny dojrzałej dokonano po osiągnięciu jej pełnej dojrzałości. Eksperymenty S1S, S2S, S3S i S1 przeprowadzono w warunkach kontrolowanych (komora izolowana/ szklarnia), S2 i S3 w warunkach polowych (doświadczenie poletkowe w dwóch sezonach wegetacyjnych).
Prehartowanie i hartowanie na chłód: wstępną wegetację roślin
prowadzono w izolowanej komorze fitotronowej w temperaturze
16°C/ 12°C (d/n) przy fotoperiodzie 8 h/ 16 h (d/n) przez 2 tygodnie.
Następnie prehartowano je przez 14 dni (T=12°C d/n) po czym rozpoczęto hartowanie (T=4°C; 8 h/ 16 h -d/n) [Gołębiowska i Wędzony
2009]. Po 8 tygodniach od rozpoczęcia hartowania siewki przesa83
Katarzyna Wajdzik, Gabriela Gołębiowska-Pikania, Maria Wędzony
dzono do wazonów Mitscherlich’a i prowadzono kultury wazonowe,
aż do uzyskania dojrzałości (wykształcenia nasion), w warunkach
szklarniowych (T=20°C/25°C; fotoperiod 6h/18h – d/n).
Wegetacja roślin niehartowanych na chłód: początkowy wzrost
siewek odbywał się w izolowanej komorze fitotronowej w temperaturze 16°C/12°C (d/n) przy fotoperiodzie 8h/16h (d/n). Po tym okresie
rośliny przeniesiono do szklarni gdzie kontynuowano dalszy wzrost
siewek.
Do lokalizacji istotnych markerów na mapie sprzężeń genetycznych (721 markerów DArT i SSR) użyto metody SMA, na podstawie
danych dla wszystkich środowisk.
W przeprowadzonym eksperymencie QTL identyfikowano za
pomocą programu WinQTLCartographer 2.5 metodą SMA i CIM,
gdzie QTL identyfikowano w regionie wyznaczonym przez pik krzywej LOD =3. Zastosowano podstawowe statystyki w tym ANOVA
(Statistica 9.0).
Wyniki
W przeprowadzonych badaniach, w ramach projektu N N310 778640,
podjęto próbę określenia prawdopodobnej liczby QTL wybranych
cech morfologicznych siewki tj.: oceny stopnia rozkrzewienia (TN),
stosunku długości blaszki liściowej do długość pochwy liściowej liścia
drugiego(BSS) oraz wagi ziaren z dojrzałego kłosa pędu głównego
(WGS) i stopnia wypełnienia kłosa (FS).
Analiza SMA, dla wszystkich badanych cech, lokalizowała istotne markery prawdopodobnie sprzężone z genami determinującymi
badane cechy, we wszystkich składowych genomach A, B i R.
TN: SMA dla S1S i S2S wyznaczyła 21 markerów (p≤0,05; chromosom 1A) oraz 26 markerów (p≤0,05 i p≤0,01; chromosom 7B).
Mapowanie CIM zidentyfikowało 4 prawdopodobne loci warunkujące tą cechę: dwa loci (chromosom 4A) i po jednym na chromosomach
7B, 3R. Wszystkie wpływają na fenotypowy obraz tej cechy w różnym stopniu ( od 8,40% do 14,93%). QTL na chromosomie 7B w największym stopniu determinuje cechę, gdyż został wytypowany także
w metodzie SMA (S1 i S3, p≤0,05). Tłumaczy on 12,09% zmienności.
W przypadku QTL na wszystkich chromosomach (poza 3R) fenotyp
84
Mapowanie loci cech ilościowych (QTL) pszenżyta ozimego (x Triticosecale Wittm.)
dominujący pochodził od odmiany Hw (więcej pędów), dla pozostałych od odmiany Mg (mniej pędów).
BSS: Na chromosomie 4R/7A, SMA wskazała 2 powtarzające się
w S1S, S2S i S3S markery (p≤0,05 i p≤0,01) i 1 marker dla danych
z pomiarów S2S i S3S, także na 4R/7A. 11 oraz 7 markerów powtórzyło się dla chromosomów 7A i 6R(p≤0,05 i p≤0,01). Mapowanie CIM
zidentyfikowało 5 loci przypuszczalnie warunkujących badaną cechę:
na chromosomach 4R/7A (2 QTL) oraz 7A, 6R, 7R (po jednym QTL).
Loci te wpływają na fenotypowy obraz tej cechy w różnym stopniu
( od 11,22% do 20,95% ) Największy zakres determinacji (20,95%)
uzyskało jedno locus na chromosomie 4R/4A, dla niego dominujący
fenotyp pochodził od odmiany Hw (długa pochwa, długi liść), dla pozostałych loci od odmiany Mg (krótka pochwa, krótki liść).
WGS: Dla S1 i S3 SMA odnotowała 18 kolejnych istotnych markerów (p≤0,05 i p≤0,01), (chromosom 4R/7A) oraz 5 markerów
(p≤0,001; chromosom 5A) dla danych z pomiarów S3. W mapowaniu CIM wytypowano 5 loci przypuszczalnie warunkujących badaną
cechę, po jednym na chromosomach 3A, 5A, 7A, 1R i 4R/7A. Loci te
wpływają na fenotypowy obraz tej cechy w zróżnicowanym stopniu
( od 12,26% do 20,16%). Największy zakres zmienności (20,16%)
wyjaśniał locus na chromosomie 5A. Dla QTL na chromosomach 1R,
4R/7A, 5A efekt fenotypowy pochodził od odmiany Hw (niska waga),
a dla 3A i 7A od odmiany Mg (duża waga).
FS: Dla S1 i S3 SMA ustalała 3 istotne markery (p≤0,05;chromosom
4R/7A) oraz 3 markery (p≤0,05 i p≤0,01; chromosom 5B) dla danych
z pomiarów S1 i S3. W mapowani interwałowym scharakteryzowano 8 loci warunkujących tą cechę. Loci te wytypowano na chromosomach 4A, 5A, 6A, 5B, 4R/7A (po jednym QTL) oraz 6R ( 3 QTL),
które wpływają na fenotypowy obraz tej cechy w różnym stopniu (od
9,08% do 27,8%). Największą zmienności (27,8%) wyjaśniał locus na
chromosomie 4A, dla którego SMA wskazała 5istotnych markerów
(p≤0,001 i p≤0,0001). QTL na chromosomie 4R/7A potwierdzony
analizą SMA (S1 i S3, p≤0,05) objaśniał 11,6% zmienności. W przypadku QTL na chromosomach 5B i 6R dominujący fenotyp pochodził
od odmiany Hw (niskie/średnie wypełnienie), dla pozostałych od odmiany Mg (średnie wypełnienie).
85
Katarzyna Wajdzik, Gabriela Gołębiowska-Pikania, Maria Wędzony
Dyskusja i wnioski
Pszenżyto ozime dzięki postępowi w hodowli jest od kilku lat najwyżej plonującym zbożem w doświadczeniach COBORU [Labudda
i in. 2011]. Wszelkie badania, także na poziomie molekularnym,
stwarzają realne szanse na odmian dalsze doskonalenie odmian. Odmiana ♀ ‘Hewo’ (Hw) i ♂ Magnat (Mg) wykazują znaczne różnice
pod względem morfologii siewki i struktury plonu, co jest kluczowe
w przypadku prowadzonych badań oraz mapowaniu i analizie QTL.
Dla powtarzających się rejonów QTL wynik LOD w granicy 2,0 uznawano za znaczący, podobnie jak w pracach innych autorów [Krzewska
i in. 2012, Wang i in. 2007].
W literaturze odnotowano obecność loci związanych z morfologią kłosa pszenicy (Triticum aestivum L.) na chromosomach 4A,
6A, 7A i 1B [Jantasuriyarat i in. 2004]. Zidentyfikowano także loci
powiązane z genetyczną kontrolą WGS na chromosomach 1A, 7A
i 3B [Cuthbert i in. 2008]. W niniejszych badaniach pszenżyta uzyskano loci na chromosomach 3A, 5A, 7A, 1R i translokowanym 4R/7A.
Najbardziej efektywne QTL związane z kontrolą WGS może znajdować się na chromosomie 7A, opisane również dla pszenicy [Cuthbert
i in. 2008] oraz na rekombinowanym chromosomie 4R/7A obecnym
w populacji Hw´Mg. Z wypełnieniem kłosa u pszenżyta powiązane
są chromosomy 4A, 6A, 5B, 4R/7A i 6R. Najbardziej efektywne locus
związane z wagą nasion znajduje się na chromosomie 4R/7A. Wyniki
wymagają potwierdzenia w dalszych badań, gdyż niekorzystne warunki pogodowe panujące w okresie doświadczeń (susza) wpłynęły
na słabe wypełnienie kłosów i rozmiar ziarna [Rudnicki i in. 1999].
TN badano również u pszenicy. QTL wykazano na chromosomach 1A, 6A, 7A, 1B, 2B, 3B i 4B [Snape i in. 2007, Narasimhamoorthy i in. 2006]. U pszenżyta loci NT zaobserwowano we wszystkich
genomach składowych (4A, 7B, 3R). Być może allele na chromosomach 7A, 4B pszenicy, związane z kontrolą TN, są homeologiczne
z allelami na chromosomach 7B, 4A w pszenicznych genomach pszenżyta. W analizie QTL dla BSS pszenżyta stwierdzono loci na chromosomach 7A, 7B, 4R/7A, 6R i 7R.
Wszystkie loci, które nie mają na tym etapie badań powtórzenia bądź potwierdzenia w SMA można uznać za potencjalne loci dla
badanych cech, ale ich obecność należy zweryfikować w dalszych do86
Mapowanie loci cech ilościowych (QTL) pszenżyta ozimego (x Triticosecale Wittm.)
świadczeniach. Fenotypowanie i genotypowanie populacji Hw´Mg
pszenżyta ozimego ma charakter pionierski. Analiza fenotypów dla
rośliny dojrzałej napotkała na trudności z powodu warunków pogodowych w sezonach, kiedy prowadzono doświadczenia. Zdobyte
doświadczenia mogą posłużyć przy dalszych pracach nad poznaniem
genomu tego młodego gatunku zboża.
Z przeprowadzonych badań nasuwają się następujące wnioski:
1. Wszystkie trzy homeologiczne genomy A, B i R pszenicy i żyta
biorą udział w determinowaniu cech morfologicznych u pszenżyta.
2. Ekspresja genów w genomie B, dla badanych cech, była znikoma w porównaniu z ekspresją genów w genomach A i R.
3. Obserwowana ekspresja genomu wymaga potwierdzenia w dalszym toku badaniach.
Bibliografia
1. Cuthbert J. L., Somers D.J, Brûlé-Babel A. L., Brown P. D., Crow G. H.
2008. Molecular mapping of quantitative trait loci for yield and yield components in spring wheat (Triticum aestivum L.). Theor Appl Genet, 117:
595–608.
2. Gołębiowska G., Wędzony M. 2009. Cold-hardening of winter triticale
(x Triticosecale Wittm.) results in increased resistance to pink snow mould Microdochium nivale (Fr., Samuels & Hallett) and genotype-dependent chlorophyll fluorescence modulations. Acta Physiologiae Plantarum
31(6): 12–19.
3. Han Y., Li D., Zhu D., Li H., Li X., Teng W., Li W. 2012. QTL analysis of
soybean seed weight across multi-genetic backgrounds and environments.
Theor Appl Genet (2012) 125: 671–683.
4. Jantasuriyarat C., Vales M. I., Watson C. J. W., Riera-Lizarazu O. 2004.
Identification and mapping of genetic loci affecting the free-threshing habit
and spike compactness in wheat (Triticum aestivum L.). Theor Appl Genet,
108: 261–273.
5. Krzewska M., Czyczyło-Mysza I., Dubas E., Gołębiowska-Pikania G.,
Golemiec E., Stojałowski S., Chrupek M., Żur I., 2012. Quantitative trait loci associated with androgenic responsiveness in triticale (xTriticosecale
Wittm.) anther culture. Plant Cell Reports (2012) 31: 2099–2108
6. Labudda M., Machczyńska J., Woś H., Bednarek P. 2011. Wybrane aspekty postepu biologicznego w hodowli pszenżyta (xTriticosecale Wittm. Ex A.
Camus). Postępy Nauk Rolniczych 4/2011: 3–10.
87
Katarzyna Wajdzik, Gabriela Gołębiowska-Pikania, Maria Wędzony
7. Narasimhamoorthy B., Gill B.S., Fritz A. K., Nelson J. C., Brown-Guedira
G. L. 2006. Advanced backcross QTL analysis of a hard winter wheat synthetic wheat population. Theor Appl Genet 112: 787–796.
8. Snape J., Foulkes J., Simmonds J., Leverington M., Fish L. J., Wang Y.,
Ciavarrella M. 2007. Dissecting gene x environmental effects on wheat
yields via QTL and physiological analysis. Euphytica, 154:401–408.
9. Rudnicki F., Jaskulski D., Dębowski G., 1999. Reakcje odmian pszenicy jarej
na termin siewu i nawożenie azotem w warunkach posusznych. Rocz. Nauk
Rol. A 114 (3–4), 97–108.
10. Wang S., Basten C. J., Zeng Z.B. 2007. Windows QTL Cartographer 2.5.
Department of Statistics, North Carolina State University, Raleigh,
NC. http://statgen.ncsu.edu/qtlcart/WQTLCart.htm
mgr Katarzyna Wajdzik
Instytut Biologii Uniwersytetu Pedagogicznego w Krakowie
e-mail: [email protected]
prof. dr hab. Maria Wędzony
Instytut Biologii Uniwersytetu Pedagogicznego w Krakowie
Instytut Fizjologii Roślin Polskiej Akademii Nauk w Krakowie
e-mail: [email protected]
dr Gabriela Gołębiowska-Pikania
Instytut Biologii Uniwersytetu Pedagogicznego w Krakowie
Instytut Fizjologii Roślin Polskiej Akademii Nauk w Krakowie
e-mail: [email protected]
Promotor: Prof. dr hab. Maria Wędzony
88
Katarzyna Wolny-Koładka
Anna Lenart-Boroń
EPISTEME
18/2013, t. 3
s. 89–94
ISSN 1895-2241
CHARAKTERYSTYKA SZCZEPÓW BAKTERII Z RODZAJU
STAPHYLOCOCCUS IZOLOWANYCH OD PSÓW
CHARACTERISTICS OF STAPHYLOCOCCUS SPP.
STRAINS ISOLATED FROM DOGS
Abstrakt. Celem niniejszej pracy była izolacja i ogólna charakterystyka
szczepów gronkowców dominujących u psów, a także ocena ich profilu lekooporności. Pobrany materiał biologiczny od psów domowych poddano standardowym procedurom diagnostycznym w celu izolacji czystych kultur bakterii i identyfikacji gatunkowej zgromadzonych szczepów. Lekowrażliwość
wyizolowanych gronkowców oceniono przy pomocy metody dyfuzyjno –
krążkowej. Ogółem wyizolowano 95 szczepów z rodzaju Staphylococcus. Gatunkiem dominującym wśród zgromadzonych izolatów był S. intermedius
(44%). Szczepy wykazywały zróżnicowaną oporność na zastosowane antybiotyki w tym średnią oporność na ampicylinę, klindamycynę i erytromycynę oraz całkowitą wrażliwość na doksycyklinę. Na podstawie uzyskanych
wyników uznano że konieczne jest dalsze prowadzenie badań mających na
celu poszerzenie wiedzy na temat kolonizacji, a także lekooporności szczepów izolowanych od zwierząt domowych.
Słowa kluczowe: Staphylococcus spp., psy, lekooporność
Summary. The purpose of this study was isolation and general characteristics of Staphylococcus spp. isolated from dogs, as well as evaluation of their
drug resistance profile. Biological material obtained from domestic dogs
subjected to standard diagnostic methods for the isolation of pure cultures
of bacteria and species identification of collected strains. Drug resistance of
isolates was assessed by using the disc-diffusion method. Overall, 95 strains
from the genus Staphylococcus were isolated. S. intermedius was the predominant species among the isolates (44%). The strains presented varying
resistance to antibiotics, the average resistance to ampicillin, clindamycin
and erythromycin, and the total sensitivity to doxycycline. Based on the
results, it appears that there is a need to continue further research aimed
at increasing knowledge about colonization, as well as drug resistance of
strains isolated from domestic animals.
Key words: Staphylococcus spp., dogs, drug resistance
89
Katarzyna Wolny-Koładka, Anna Lenart-Boroń
Wstęp
Bakterie należące do rodzaju Staphylococcus są rozpowszechnione na całym świecie. Najczęściej zasiedlają skórę oraz błony śluzowe ludzi i zwierząt, ale można je również znaleźć w powietrzu, wodzie, kurzu, na przedmiotach codziennego użytku, a także w glebie
i produktach spożywczych. Gronkowce są Gram(+) ziarenkowcami,
o regularnym, kulistym kształcie, rozmiarem nie przekraczającymi
zwykle 1µm. Bakterie z rodzaju Staphylococcus są nieruchliwe, należą do względnych beztlenowców i nie wytwarzają przetrwalników
[Schlegel 2005].
Połowa spośród wszystkich znanych gatunków gronkowców kolonizuje zarówno człowieka jak i zwierzęta, stanowiąc ich naturalną mikroflorę. Najczęściej izolowanymi gatunkami są: S. xylosus, S. epidermidis,
S. cohnii urealyticum, S. aureus, S. haemolyticus, S. saprophyticus [Zaremba
i Borowski 2005]. Obecnie znanych jest 41 gatunków gronkowców,
z których S. intermedius uważany jest za wiodący czynnik etiologiczny
zapalenia skóry u psów. Wiadomo powszechnie, iż jest przyczyną występowania chorób bakteryjnych u tych zwierząt, aczkolwiek S. intermedius stanowi także część fizjologicznej mikroflory skóry, nosa, uszu,
okolic odbytu i powierzchni dziąseł [Talan i in. 1989].
Wraz ze wzrostem świadomości właścicieli zwierząt domowych
i rozwojem medycyny weterynaryjnej dostrzeżono, że badania dotyczące bakterii z rodzaju Staphylococcus występujących u psów są
słabo zaawansowane. Dlatego celem niniejszej pracy była izolacja
i ogólna charakterystyka szczepów gronkowców dominujących
u psów domowych a także ocena ich profilu lekooporności.
Materiał i metody
Materiał do badań pobierano od 25 psów domowych przy użyciu jałowych wymazówek nawilżonych roztworem soli fizjologicznej. Od każdego osobnika pobrano wymazy z nosa (przewód nosowy lewy i prawy), ucha (ucho lewe i prawe), pachwiny (lewa i prawa) oraz grzbietu.
Materiał posiano na podłoża: agar Columbia + 5% krwi baraniej [bioMerieux, Francja], agar Baird Parkera [bioMerieux, Francja] a także
Candida ID [bioMerieux, Francja] i inkubowano w temperaturze 37oC
90
Charakterystyka szczepów bakterii z rodzaju staphylococcus izolowanych od psów
przez 48h. Po okresie inkubacji izolowano kolonie czarne, błyszczące,
wypukłe, o wyglądzie charakterystycznym dla rodzaju Staphylococcus.
Przeprowadzono szczegółową identyfikację gatunkową, która obejmowała: sporządzanie preparatów mikroskopowych i barwienie metodą
Grama, testy na obecność koagulazy, czynnika CF (clumping factor),
białka A oraz testy biochemiczne (ID 32 STAPH, bioMerieux, Francja).
W dalszej części pracy oceniano lekowrażliwość wyizolowanych szczepów należących do gatunku dominującego, przy pomocy metody dyfuzyjno – krążkowej. Zastosowano następujące krążki antybiotykowe:
ampicylina, erytromycyna, klindamycyna, ciprofloksacyna, tetracyklina, doksycyklina, chloramfenikol. Korzystano z metodyki zalecanej
przez Krajowy Ośrodek Referencyjny ds. Lekowrażliwości Drobnoustrojów (KORLD) [Hryniewicz i Żabicka 2010].
Wyniki i ich omówienie
Ogółem wyizolowano 95 szczepów z rodzaju Staphylococcus należących do gatunków: S. intermedius (42), S. xylosus (15), S. epidermidis
(10), S. aureus (6), S. haemolyticus (17), S. saprophyticus (5). Podobne
wyniki uzyskali także inni autorzy, którzy wśród najczęściej izolowanych od psów gronkowców wymieniają m.in. S. intermedius, S. xylosus, S. aureus, S. haemolyticus i S. saprophyticus [Lilenbaum i in. 2000,
Nagase i in. 2002].
Gatunkiem dominującym wśród wyizolowanych szczepów był S.
intermedius (44%). Jak pokazują wyniki uzyskane przez innych autorów gatunek ten jest najliczniej kolonizującym skórę psów gronkowcem [Cox i in. 1988].
Wyznaczono częstość izolacji S. intermedius z wybranych rejonów
na ciele psów, z których pobierany był materiał do badań (tab. 1.).
Tab. 1. Częstość izolacji S. intermedius z wybranych rejonów
nosicielstwa u psów.
Miejsce izolacji
Liczba szczepów (n=42)
Nos
45% (19)
Ucho
15% (6)
Pachwina
18% (8)
Grzbiet
22% (9)
91
Katarzyna Wolny-Koładka, Anna Lenart-Boroń
Wszystkie przebadane osobniki nie wykazywały objawów chorobowych. Ponadto, w żadnym wypadku podczas badań nie prowadzono jakiejkolwiek terapii antybiotykowej. Uzyskane wyniki pokazują,
że miejscem najbardziej skolonizowanym przez S. intermedius był
nos. Nosicielstwo jest zjawiskiem powszechnie występującym i dobrze opisanym u ludzi. Niestety w przypadku psów domowych doniesienia na ten temat są niezwykle skromne, dlatego tym bardziej
istotne wydają się uzyskane w pracy wyniki.
Szczepy S. intermedius wykazywały zróżnicowaną oporność na
zastosowane antybiotyki, lekowrażliwość na poszczególne antybiotyki przedstawiono w tabeli 2.
Tab. 2. Lekooporność szczepów S. intermedius (n=42)
izolowanych od psów.
Antybiotyk
Szczepy wrażliwe
Szczepy oporne
Ampicylina
58%
42%
Erytromycyna
57%
43%
Klindamycyna
60%
40%
Ciprofloksacyna
91%
9%
Tetracyklina
73%
27%
Doksycyklina
100%
0%
Chloramfenikol
94%
6%
Analizowane szczepy wykazały całkowitą wrażliwość na doksycyklinę, oraz wysoką wrażliwość na chloramfenikol i ciprofloksacynę. Całkowitą wrażliwość S. intermedius na doksycyklinę i wysoką
na chloramfenikol oraz ciprofloksacynę wykryli także naukowcy
z SGGW w Warszawie [Chrobak i in. 2011]. Badania własne pokazują,
iż mniej niż połowa badanych gronkowców była oporna na antybiotyki makrolidowe (erytromycyna i klindamycyna). Uzyskane wyniki
potwierdzają badania innych autorów u których oporność S. intermedius na makrolidy nie przekraczała 50% [Hauschild i Wójcik 2006].
Na podstawie uzyskanych wyników uznano że konieczne jest
dalsze prowadzenie badań mających na celu poszerzenie wiedzy na
temat kolonizacji a także lekooporności szczepów izolowanych od
zwierząt domowych.
92
Charakterystyka szczepów bakterii z rodzaju staphylococcus izolowanych od psów
Wnioski
1. W kontaktach ze zwierzętami domowymi należy zwrócić szczególną uwagę na zachowanie zasad higieny
2. Psy są kolonizowane przez różne gatunki gronkowców, w tym
chorobotwórcze i nie jest to zawsze spowodowane występowaniem
stanu chorobowego
3. Konieczne jest pogłębianie świadomości społeczeństwa na temat potencjalnej transmisji zakażeń odzwierzęcych a także badanie
lekooporności szczepów izolowanych od zwierząt domowych
Bibliografia
1. Chrobak D., Kizerwetter-Świda M., Rzewuska M., Binek M. 2011.
Antibiotic resistance of canine Staphylococcus intermedius group
(SIG)-practical implications. Pol J Vet Sci; 14(2): 213–8.
2. Cox H. U., Hoskins J. D., Newman S. S., Foil C. S., Turnwald G. H.,
Roy A.F. 1988. Temporal study of staphylococcal species on healthy dogs.
American Journal of Veterinary Research 49, 747–751.
3. Hauschild T., Wójcik A. 2007. Species distribution and properties of staphylococci from canine dermatitis. Research in Veterinary Science 82: 1–6.
4. Hryniewicz W., Żabicka D. 2010. Rekomendacje doboru testów do oznaczania wrażliwości bakterii na antybiotyki i chemioterapeutyki. Oznaczanie
wrażliwości ziarniaków Gram-dodatnich z rodzaju Staphylococcus ssp.
KORLD.
5. Nagase N., Sasaki A., Yamashita K., Shimizu A., Wakita Y., Kitai S., Kawano J. 2002. Isolation and species distribution of staphylococci from animal
and human skin. J Vet Med Sci; 64(3): 245–50.
6. Lilenbaum W., Veras M., Blum E., Souza G. 2000. Antimicrobial susceptibility of staphylococci isolated from otitis externa in dogs. Letters in Applied
Microbiology 31, 42–45.
7. Schlegel H. G. 2000. Mikrobiologia ogólna. Wydawnictwo Naukowe PWN,
Warszawa.
8. Talan D. A., Staatz D., Staatz A., Goldstein E. J., Singer K., Overturf G. D.
1989. Staphylococcus intermedius in canine gingiva and canine-inflicted
human wound infections: laboratory characterization of a newly recognized
zoonotic pathogen. J. Clin Microbiol; 27(1): 78–81.
9. Zaremba M. L., Borowski J. 2005. Podstawy Mikrobiologii Lekarskiej, PZWL
Warszawa.
93
Katarzyna Wolny-Koładka, Anna Lenart-Boroń
mgr inż. Katarzyna Wolny-Koładka
dr inż. Anna Lenart-Boroń
Katedra Mikrobiologii, Wydział Rolniczo-Ekonomiczny
Uniwersytet Rolniczy w Krakowie
al. Mickiewicza 24/28, 30–059 Kraków
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. Wiesław Barabasz
94
Michał Kręgielewski
Dorota Blatsios, Ada Biela
EPISTEME
18/2013, t. 3
s. 95–101
ISSN 1895-2241
Odziedziczalność wybranych cech
morfologicznych dla mieszańców łubinu
wąskolistnego (Lupinus angustifolius L.)
Variability and heritability of
morphological traits of selected genotypes
of Lupinus angustifolius L.
Abstrakt. W przeprowadzonym badaniu przeanalizowano zmienność roślin łubinu wąskolistnego pokolenia F2, uzyskanych ze skrzyżowania linii
Au 11257-19 oraz odmiany ‘Emir’. Analizę zmienności przeprowadzono pod
względem cech morfologicznych jak: wysokość rośliny, liczba rozgałęzień
bocznych pierwszego rzędu oraz długość kwiatostanu pędu głównego. Do oceny wykorzystano takie parametry jak: odchylenie standardowe, współczynnik
zmienności, a także oszacowano współczynnik odziedziczalności na podstawie wzoru Mahmuda i Kramera. Współczynniki odziedziczalności dla cech:
wysokość rośliny oraz długości kwiatostanu pędu głównego nie przekroczyły
50%, co oznacza, że ekspresja tych cech zależna jest od środowiska. Współczynnik odziedziczalności dla liczby rozgałęzień bocznych pierwszego rzędu
osiągnął wartość 66%, a zatem ekspresja tej cechy zależna jest od genotypu.
Słowa kluczowe: współczynnik odziedziczalności, łubin wąskolistny (Lupinus
angustifolius L.)
Summary. In the present study calculated variation in Lupinus angustifolius
L. plants of the F2 generation obtained from crossing the line Au 11257-19
and of ‘Emir’. Variability analysis was performed in terms of morphological
traits such as: plant height, number of branches the side of the first row and
the length of the inflorescence main offshoot. The analysis was based on
statistical parameters: standard deviation, coefficient of variation and heritability coefficient and estimated using the formula Mahmud and Kramer.
Coefficients of heritability for traits: plant height and the length of the inflorescence main offshoot not exceed 50%, which means that the expression
of these traits is dependent on the environment. Heritability coefficient for
the number of side branches of the first row has reached the value of 66%,
and thus the expression of this trait is dependent on genotype.
Key words: Lupinus angustiolius L., heritability
95
Michał Kręgielewski, Dorota Blatsios, Ada Biela
Wstęp
Łubin wąskolistny (Lupinus angustifolius L.) należy do rodziny Fabaceae, charakteryzuje się nasionami przepuszczalnymi dla wody.
Odgrywa on dużą rolę w rolnictwie tradycyjnym i ekologicznym terenów klimatu umiarkowanego (Sawicka-Sienkiewicz 1997). Łubin
nie wymaga stosowania nawożenia azotowego, żyje on w symbiozie
z bakteriami brodawkowymi z rodzaju Bradyrhizobium lupini, które
wiążą wolny azot z atmosfery. Ważną cechą łubinu jest uwalnianie
organicznego fosforu do gleby (Sawicka-Sienkiewicz 1997). Roślina
ta zwiększa żyzność gleby, utrzymuje dodatni bilans materii organicznej w glebie (Harasimowicz-Hermann 1998). Łubin wąskolistny
odznacza się najkrótszym okresem wegetacji spośród innych łubinów, od 110 do 120 dni. Możliwe jest to dzięki wąskiej budowie liści,
co umożliwia równomierną penetrację światła (Sawicka-Sienkiewicz
i in. 2007).
Aktualnie obserwuje się ponowny wzrost znaczenia nie tylko
Lupinus angustifolius L., ale i innych roślin strączkowych ze względu
na wysoką zawartość białka (32–40%), czy też aminokwasów egzogennych (Pete i in. 1985). Łubin wąskolistny może stać się rośliną
alternatywną dla soi, zwłaszcza przy aktualnej sytuacji na rynku
rolnym. Unia Europejska tworzy specjalne programy rozwojowe dla
rozpowszechnienia wiedzy na temat roślin motylkowych (Chudy i in.
2007). Odziedziczalność głównie wykorzystywana jest przy doborze
sztucznym (Łomnicki 2009). Powodem wyliczania odziedziczalności,
jest poznanie zmienności fenotypowej, genetycznej danej populacji
oraz ich zróżnicowania pod względem cech użytkowych (Kadłubiec
i in. 2007). Porównując zmienność między rodzicami i dziećmi oraz
między rodzeństwem, możemy ustalić jak duża frakcja zmienności
ma podłoże genetyczne, a 1jak duża jest efektem wpływu środowiska
(Łomnicki 2009). Współczynnik odziedziczalności można wyliczyć
na podstawie wzoru Mahmuda i Kramera (Mahmud i Kramer 1951,
Silezin i in. 2004).
96
Odziedziczalność wybranych cech morfologicznych dla mieszańców łubinu...
Celem pracy było przeanalizowanie zmienności roślin łubinu
wąskolistnego pokolenia F2 (Au 11257-19 x ‘Emir’) uzyskanych po
skrzyżowaniu odmiany ‘Emir’ oraz linii hodowlanej Australia o numerze 11257-19 (Au 11257-19).
Materiał i metodyka
Materiał badawczy stanowiły formy rodzicielskie, polska odmiana o tradycyjnym typie wzrostu ‘Emir’, zarejestrowana 1981 roku,
charakteryzująca się małym stopniem wylegania do końca kwietnia,
w fazie kwitnienia i przed zbiorem oraz linia hodowlana o numerze
11257-19 pochodząca z kolekcji australijskiej, została oznaczona,
jako Au 11257-19. W Katedrze Genetyki, Hodowli Roślin i Nasiennictwa Uniwersytetu Przyrodniczego we Wrocławiu znajduje się ona
od 2007/08 r. Charakteryzuje się ona w warunkach Polski, jak i Australii cienką okrywą nasienną (Mera i in. 2011). Materiał badawczy
stanowiły również rośliny pokolenia F2
(Au 11257-19 x ‘Emir’). Doświadczenie zostało założone 8 kwietnia 2010 w Rolniczym Zakładzie Doświadczalnym Swojec. W 2008
roku zostały skrzyżowane odmiany ‘Emir’ oraz linia hodowlana
11257-19 (Au 11257-19). Zbiór nasion pokolenia F3 miał miejsce 15
sierpnia 2010 roku. Dokonano oceny pokolenia osobników F2 pod
względem: wysokości rośliny, liczby rozgałęzień bocznych pierwszego rzędu oraz długości kwiatostanu pędu głównego. Każda populacja
form rodzicielskich ‘Emir’ i linia Au 11257-19, zawierała po 80 osobników, natomiast w populacji F2 (Au 11257-19 x ‘Emir’) znajdowało
się 200 osobników. Dla oceny zmienności otrzymanego potomstwa
F2 obliczono parametry statystyczne: średnią wartość, wartość maksymalną, wartość minimalną, wariancję, odchylenie standardowe,
współczynnik zmienności. Obliczono współczynniki odziedziczalności dla analizowanych cech.
Wyniki
Wysokość rośliny. Średnia wysokość rośliny analizowanej polskiej
odmiany ‘Emir’ wynosiła 56,9 cm, przy odnotowanych wartościach:
minimalnej 40 cm, maksymalnej 70 cm. Współczynnik zmienności
97
Michał Kręgielewski, Dorota Blatsios, Ada Biela
dla P1 wyniósł 11,6% (Tab. 1). Wysokość roślin linii hodowlanej mieściła się w zakresie od 37 do 82 cm, średnia wysokość to 52,6 cm.
Współczynnik zmienności dla P2 miał wartość 16,4% (Tab. 1). Populacja F2 (Au 11257-19 x ‘Emir’), różniła się zakresem zmienności od
form rodzicielskich. Wartość minimalna spadła do 21 cm. Wartość
maksymalna wyniosła 79 cm. Współczynnik zmienności dla tej grupy roślin osiągnął wartość 17,8%. Odziedziczalność ukształtowała
się na poziomie 43 %. Oznacza to, że ekspresja tej cechy w znacznym
stopniu zależna jest od środowiska, a nie od genotypu (Tab.1).
Liczba rozgałęzień bocznych pierwszego rzędu. Rośliny formy
matecznej ‘Emir’ wykształciły średnio 3,4 rozgałęzień bocznych.
Odnotowana wartość minimalna to 1, a maksymalna 6 rozgałęzień.
Współczynnik zmienności dla tej formy rodzicielskiej uklasyfikował
się na poziomie 36% (Tab. 1). U formy rodzicielskiej linii Au 1125719 zauważono dużo większą zmienność, ponieważ rośliny miały od
1 do 9 rozgałęzień. Średnia liczba rozgałęzień ukształtowała się na
poziomie 3,4 rozgałęzień. Współczynnik zmienności dla linii hodowlanej Au 11257-19 osiągnął wartość 49,2 % (Tab. 1). Zakres zmienności w pokoleniu F2 (Au 11257-19 x ‘Emir’) z porównaniem do form
rodzicielskich uległ zwiększeniu, największa liczba rozgałęzień, jaka
występowała u mieszańców to 11, a niektóre osobniki nie wykształciły ich wcale. Średnia liczba rozgałęzień uklasyfikowała się na poziomie 4,4 rozgałęzienia. Współczynnik zmienności dla tej grupy wynosił 56,9%. Odziedziczalność dla tej populacji ukształtowała się na
poziomie 66%. Oznacza to, że ekspresja tej cechy w znacznym stopniu zależna jest od genotypu, a nie od środowiska (Tab. 1).
Długość kwiatostanu pędu głównego. Średnia długość kwiatostanu pędu głównego P1 wynosiła 11,3 cm, przy odnotowanej wartości minimalnej 4 cm, wartości maksymalnej 26,6 cm. Współczynnik zmienności dla odmiany ‘Emir’ osiągnął wartość 31,8% (Tab.
1). Rośliny linii hodowlanej miały od 2 do 22 cm. Średnia wysokość
wynosiła 11,63 cm. Współczynnik zmienności dla analizowanej linii (Au 11257-19) wyniósł 42,84% (Tab. 1). Stwierdzono wyraźne
przesunięcie zakresu zmienności i odnotowano zwiększenie wartości maksymalnej u potomstwa, z porównaniem do form rodzicielskich, linii hodowlanej (Au 11257-19) i odmiany ‘Emir’, gdzie naj98
Odziedziczalność wybranych cech morfologicznych dla mieszańców łubinu...
większe osobniki miały 55 cm, Współczynnik zmienności dla tej
grupy roślin uklasyfikował się na poziomie 47,4%. Współczynnik
odziedziczalności wyliczony na podstawie wzoru Mahmuda i Kramera dla tej formy potomnej osiągnął wartość 19%. Oznacza to, że
ekspresja tej cechy w znacznym stopniu zależna jest od środowiska,
a nie od genotypu (Tab. 1).
Odziedziczalność
(h2)
Min
Współczynnik
zmienności
Max
Odchylenie standardowe
Zakres
zmienności
Wariancja
Formy rodzicielskie
oraz pokolenie F2
Średnia
Tab. 1. Charakterystyka form rodzicielskich oraz pokolenia F2,
mieszańca uzyskanego po skrzyżowaniu linii hodowlanej Au
11257-19 oraz odmiany ‘Emir’, pod względem wybranych cech,
parametrów statystycznych oraz współczynnika odziedziczalności.
Wysokość całej rośliny
56,98 70,00 40,00
44,05
6,63
11,60
P2 (Au 11257-19) 52,65 82,00 37,00
P1 (‘Emir’)
75,14
8,66
16,40
F2 (Au 11257-19
x ‘Emir’)
56,45 79,00 21,00 101,00 10,05 17,80 0,43
Liczba rozgałęzień bocznych I-go rzędu
P1 (‘Emir’)
3,41
6,00
1,00
1,51
1,23
36,02
P2 (Au 11257-19)
3,40
9,00
1,00
2,80
1,67
49,22
F2 (Au 11257-19
x ‘Emir’)
4,35
11,00
0
6,12
2,47
56,85 0,66
Długość kwiatostanu pędu głównego
P1 (‘Emir’)
11,26 25,50 4,00
12,84
3,58
31,83
P2 (Au 11257-19) 11,63 22,00 2,00
24,83
4,98
42,84
F2 (Au 11257-19
x ‘Emir’)
25,24
4,72
47,35 0,19
9,96
55,00 1,00
99
Michał Kręgielewski, Dorota Blatsios, Ada Biela
Wnioski
Odziedziczalność wysokości roślin i długości kwiatostanu pędu głównego jest niewielka, zatem zmienność tych cech w dużym stopniu
modyfikowana jest przez czynniki środowiska
Zmienność liczby rozgałęzień bocznych pierwszego rzędu w dużym stopniu warunkowana jest czynnikami genetycznymi. Świadczy
o tym wysoka wartość współczynnika odziedziczalności.
Bibliografia
1. Chudy M., Leśniewska K., Święcicki W., Wolko B., Pawłowicz I., Gawłowska M., Boersma J. G. 2007. Mapowanie genomu łubinu wąskolistnego
(Lupinus angustifolius L.) z wykorzystaniem markerów STS z Medicago
truncatula Gaertn. i Pisum sativum L. Zeszyty Problemowe Postępów
Nauk Rolniczych. z. 517: 215–223.
2. Harasimowicz-Hermann G. 1998. Wartość następcza łubinów, ich miejsce
w zmianowaniu oraz w siedliskach pozarolniczych. Mat. Konf. Nauk. PTŁ
Przysiek, Łubin w rolnictwie ekologicznym. „Łubin – Białko – Ekologia”. 31–40.
3. Kadłubiec W., Lewandowska S., Kuriata R. 2007. Zmienność i odziedziczalność cech użytkowych linii wsobnych kukurydzy (Zae mays L.). Zeszyty
problemowe postępów nauk rolniczych. z.517: 355–360.
4. Łomnicki A. 2009. Dobór naturalny. Kosmos – Problemy Nauk Przyrodniczych. tom 58. nr 3–4: 323–328.
5. Mahmud I., Kramer H. M. 1951. Segregatiom for yield, height and maturity
following a soybean cross. Agron. J. 43: 605–609.
6. Mera M., Alvarez N., Sepulveda N., Miranda H., Almar D. 2011. Heritability of Barrow leafed lupin seed coat proportion estimated by parent-offspring
regression. Lupin crops – an opportunity for today, Promise for the future.
13th International Lupin Conference.
7. Pete J. S., Williams W., Farrington P. 1985. Lupin (Lupinus ssp.). In: Grain
Legume Crops. (R. J. Summerfield, E. H. Rberts, eds.) Collins, London, 91:
723–880.
8. Sawicka-Sienkieiwcz E. J. 1997. Hodowla Łubinów w Polsce i na świecie.
Mat. konf. Olsztyn-Korytowo, Łubin we współczesnym rolnictwie. „Łubin
– Białko – Ekologia”. 37–57.
9. Sawicka-Sienkiewicz E. W., Galek R., Zalewski D. 2007. Zmienność wybranych cech u mutantów odmiany Emir łubinu wąskolistnego (Lupinus angustifolius L.). Zeszyty problemowe postępów nauk rolniczych. z.522: 39–54.
100
Odziedziczalność wybranych cech morfologicznych dla mieszańców łubinu...
10. Silezin G., Szwed-Urbas K. 2004. Zmienność i odziedziczalność cech ilościowych w populacji mieszańcowej wyki siewnej Alba × Kamiko. Annales Universitatis Mariae Curie– Skłodowska LUBLIN – POLONIA. Vol.
59. nr 4: 2061–2070.
mgr inż. Michał Kręgielewski
Katedra Genetyki, Hodowli Roślin i Nasiennictwa
Zakład Genetyki i Biotechnologii Roślin
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
Promotor: dr hab. Henryk Bujak, prof. nadzw.
101
Krzelowska Magdalena1, Zimak Paulina3,
Kurdziel Magdalena2, Łabanowska Maria2
EPISTEME
18/2013, t. 3
s. 103–110
ISSN 1895-2241
Wykorzystanie spektroskopii
elektronowego rezonansu
paramagnetycznego (EPR) do oceny
nasion owsa Avena sativa pod względem
odporności na stresy
The evaluation of oat Avena sativa seeds
in terms of resistance to stress by using
of electron paramagnetic resonance
spectroscopy (EPR)
Abstrakt. Do badań wykorzystano nasiona pięciu genotypów owsa Avena
sativa. Zastosowanie techniki elektronowego rezonansu paramagnetycznego
(EPR), umożliwiło ocenę zawartości stabilnych (tzw. „długo-żyjących”) rodników, szczególnie rodnika semichinonowego, obecnego w okrywie nasiennej
oraz rodników węglowodanowych w pozostałych częściach nasion. Genotypy
bardziej wrażliwe (Siwek, Promyk) charakteryzowała obecność większej ilości
stabilnych rodników niż odmiany tolerancyjne (Bingo, Celer). Genotyp Kasztan
wykazywał wartości pośrednie. Badania biochemiczne umożliwiły ocenę poziomu węglowodanów, tłuszczy i białek. Sugeruje się, że obecność „długożyjących”
rodników w nasionach, może być markerem wrażliwości roślin na stres.
Słowa kluczowe: „długo-żyjące” rodniki, nasiona, owies, stres oksydacyjny
Summary. Seeds of five genotypes of oat were chosen for investigation.
Electron paramagnetic resonance (EPR) allowed us to examine stable (“longlived”) radicals, especially semiquinone radical, detected in seed coats, as well
as carbohydrates radicals in inner parts of seed. The number of stable radicals was higher in sensitive genotypes (Siwek, Promyk) than in tolerant ones
(Bingo, Celer). Kasztan genotype exhibited the intermediate amount of this
species. Contents of carbohydrates, lipids and proteins have been determined
by biochemical analyses. It has been suggested that some long lived radicals
present in seeds could be indicators of stress resistance of oat plants.
Key words: “long-lived” radicals, seeds, oat, oxidative stress
103
Krzelowska Magdalena, Zimak Paulina, Kurdziel Magdalena, Łabanowska Maria
Wstęp
Wzrastające potrzeby gospodarki żywnościowej stawiają przed
współczesnym rolnictwem coraz większe wymagania pod względem
jakości i wielkości plonu. Jednakże występujące coraz powszechniej
anomalia klimatyczne stanowią czynnik stresowy, ograniczający
plonowanie poprzez aktywację reaktywne rodników tlenu, które
produkowane w nadmiarze, uczestniczą w dezaktywacji ważnych
metabolitów komórkowych. Badania wykorzystujące technikę elektronowego rezonansu paramagnetycznego (EPR), wykazały możliwość stabilizacji tych rodników na cząsteczkach organicznych [Łabanowska i in. 2012]. Sugeruje się, że powstanie stabilnych, pod
względem chemicznym, form rodnikowych może stanowić ważny
mechanizm obronny komórki w warunkach stresowych [Filek i in.
2012].
Celem pracy były badania ilościowe oraz charakterystyka rodników organicznych w nasionach owsa techniką EPR oraz określenie
zależności pomiędzy nimi a tolerancją roślin na stres. Wyniki tych
badań oprócz celu poznawczego mogą mieć również znaczenie aplikacyjne do selekcji nasion owsa pod względem odporności na czynniki stresowe. Przeprowadzono również pomiary zawartości węglowodanów, białek i tłuszczów dla oceny jakości nasion pod względem
użyteczności dla potencjalnych odbiorców.
Materiał i metody
Do badań wykorzystano nasiona pięciu genotypów owsa Avena
sativa uzyskanych z Hodowli Roślin w Strzelcach: Bingo, Celer,
Kasztan, Promyk, Siwek – podane w kolejności od odpornych do
wrażliwych, zgodnie z wstępnymi informacjami uzyskanymi od hodowców. Pomiary EPR wykonano przy użyciu spektrometru Elexsys
500 firmy Bruker, pracującym w paśmie X. Parametry widm EPR:
wartość czynnika g, stała rozszczepienia spektroskopowego A, szerokość linii DBpp wyznaczono za pomocą symulacji widm, wykorzystując program SIM32 [Spałek i in., 2005]. Zawartość tłuszczów
oznaczano wagowo wg. Bligh–Dyer [1959]. Stężenie białek i cukrów
104
Wykorzystanie spektroskopii elektronowego rezonansu paramagnetycznego (EPR)...
określano spektrofotometrycznie wg. Bradford’a [1976] oraz Dubois i in. [1956]. Statystycznie zróżnicowanie średnich, po sprawdzeniu istotności, ustalono na podstawie jednokrotnego testu Duncana (P ≤ 0,05).
Wyniki
Widma EPR całych ziaren wszystkich badanych genotypów w zakresie 5mT miały podobny kształt, różniły się jednak intensywnością sygnałów (ryc. 1, tab. 1). Procedura symulacji wykazała, że każde widmo składa się z dwóch sygnałów o charakterze Gaussa: główny sygnał
o g = 2.0048 i pojedynczej linii (sygnał I) (ryc. 1) oraz sygnał II o
czynniku g = 2.0063, rozszczepiony na dwie linie o stałej A w zakresie
od 0.4 mT do 0.7 mT. Porównanie pola powierzchni pod krzywymi
absorpcji sygnałów EPR z polem powierzchni pod krzywą absorpcji
wzorca o znanej liczbie spinów (DPPH), pozwoliło obliczyć zawartość rodników w 1 g ziaren. Najwyższą zawartość rodników wykazały
ziarna odmian Siwek i Promyk, natomiast najniższy – genotypy Bingo i Celer (tab. 1).
Ryc. 1. Eksperymentalne (eksp) i symulowane (sym) widmo EPR całego
ziarna owsa Siwek zarejestrowane w 293 K w zakresie 5mT. Sygnały I i II –
sygnały składowe użyte do symulacji.
Fig. 1. The experimental (eksp) and simulated (sym) EPR spectra of whole
grains Siwek registered at 293 K, in the range of 5 mT. Signals I and II have
been used to simulation procedure.
105
Krzelowska Magdalena, Zimak Paulina, Kurdziel Magdalena, Łabanowska Maria
Tab. 1. Liczba rodników w całych ziarnach różnych genotypów owsa.
The number of radicals in the whole grains of different genotypes of oat.
Odmiana
Cultivar
Liczba rodników/g
Liczba centrów I/g
Liczba centrów II/g
Number of radicals/g Number of centers I/g Number of centers II/g
Bingo
2.6 x 1014 ± 0.1 x 1014 1.9 1014 ± 0.1 x 1014
0.7 1014 ± 0.1 x 1014
Celer
4.7 x 1014 ± 0.9 x 1014 3.4 1014 ± 0.1 x 1014
1.3 1014 ± 0.9 x 1014
Kasztan
6.5 x 1014 ± 0.1 x 1014 5.3 1014 ± 0.9 x 1014
1.3 1014 ± 0.1 x 1014
Promyk
7.2 x 1014 ± 0.1 x 1014 5.5 1014 ± 0.1 x 1014
1.7 1014 ± 0.1 x 1014
Siwek
8.6 x 1014 ± 0.1 x 1014 6.7 1014 ± 0.9 x 1014
1.9 1014 ± 0.1 x 1014
Wartości średnie ± SD
Mean values ± SE
Analiza widma wnętrza ziarna odmiany Siwek (w zakresie 10
mT) ujawniła obecność czterech sygnałów: sygnał W – o największym udziale w widmie (82%) i czynniku g = 2.0050, który był rozszczepiony na dwie linie (A = 0.4 mT); sygnały X i Y o 6% udziale (X: g =
2.0049, A1 = 1.0 mT, A2 = 3.6 mT oraz Y: g = 2.0033, A1 = 1.3 mT, A2 =
7.7 mT), składały się z 4 linii (rys. 2) oraz słaby sygnał Z o czynniku
g = 2.0029 (dwie linie, A = 2.0 mT).
Ryc. 2. Eksperymentalne (eksp) i symulowane (sym) widmo EPR ziarna
owsa genotypu Siwek bez okrywy nasiennej, zarejestrowane w 293 K
w zakresie 10 mT. Sygnały W-Z – sygnały składowe użyte symulacji.
Fig. 2. The experimental (eksp) and simulated (sym) EPR spectra of of
grains without seed coat (Siwek) registered at 293 K , in the range 10 mT.
Signals W-Z have been used to simulation procedure.
106
Wykorzystanie spektroskopii elektronowego rezonansu paramagnetycznego (EPR)...
Tab. 2. Zawartość białek [mg/g], lipidów [mg/g], cukrów rozpuszczalnych [mg/g]
i skrobi [mg/g] w ziarnach bez okrywy nasiennej.
The content of proteins [mg/g], lipids [mg/g], soluble carbohydrates [mg/g]
and starch [mg/g], in the whole grains of different genotypes of oat.
Odmiana
Cultivar
Cukry rozpuszSkrobia
czalne [mg/g]
Białka [mg/g] Tłuszcze [mg/g]
[mg/g] Starch
Soluble carbohyProteins [mg/g] Lipids [mg/g]
[mg/g]
drates [mg/g]
Bingo
28.9 ± 0.03a
377 ± 0.03 a 107 ± 0.05 a
83.67 ± 0.01 a
Celer
28.7 ± 0.02 a
378 ± 0.05 a 102 ± 0.04 a
67.67 ± 0.04 a
Kasztan 27.2 ± 0.01 a
369 ± 0.03 a 104 ± 0.04 a
80.22 ± 0.01 a
Promyk
27.6 ± 0.04 a
370 ± 0.01 a 105 ± 0.01 a
65.54 ± 0.04 a
Siwek
27.0 ± 0.02 a
379 ± 0.03 a 101 ± 0.02 a
63.67 ± 0.01 a
Wartości stanowią średnią (±SD). Takie same litery wskazują, iż uzyskane wyniki nie są
istotne statystycznie w odniesieniu do testu Duncana; P≤0,05 (n=5)
Mean values ( ± SD). The same letters indicate statistically no significant differences,
on the basis of Duncan test; P≤0,05 (n=5)
Analizy biochemiczne zawartości węglowodanów, białek oraz
tłuszczów przedstawiono w tabeli 2 (tab. 2). Uzyskane wartości badanych metabolitów dla poszczególnych genotypów nie były istotne
statystycznie w obrębie każdej substancji. Jednakże dla genotypu Siwek odnotowano najniższy średni poziom cukrów rozpuszczalnych
a dla odmian Bingo i Celer – wyższą koncentrację sumy cukrów rozpuszczalnych i skrobi. Średnie stężenia białek oraz tłuszczów były
najwyższe dla genotypu Bingo oraz Kasztan, a najniższe dla genotypu Siwek.
Dyskusja
Rejestracja widm EPR całych ziaren umożliwiła analizę sygnałów
rodników organicznych. Parametry dominującego sygnału I były charakterystyczne dla rodnika semichinonowego, natomiast struktura
nadsubtelna sygnału II była specyficzna dla rodników węglowodanowych [Łabanowska i in. 2012]. W widmie EPR ziarna odmiany Siwek,
bez okrywy nasiennej, nie zaobserwowano sygnału I co wskazuje, że
rodnik semichinonowy występuje głównie w zewnętrznych częściach
107
Krzelowska Magdalena, Zimak Paulina, Kurdziel Magdalena, Łabanowska Maria
ziarna. Rodnik ten pojawia się w roślinach poddanych suszeniu
i prawdopodobnie jest wynikiem zaburzenia równowagi redoksowej
w układzie chinon-semichinon. W prezentowanych badaniach intensywność sygnału tego rodnika była znacznie większa u genotypów
wrażliwych. Wydaje się, że monitorowanie zmian poziomu rodnika
semichinonowego może służyć jako ważny „marker” odporności roślin na stres.
Analiza widma EPR ziarna pozbawionego okrywy nasiennej,
wykazała obecność sygnałów (W-Z), które posiadały parametry charakterystyczne dla rodników zlokalizowanych na atomach węgla
grup cukrowych. Najbardziej intensywny sygnał „W” można przypisać rodnikowi zlokalizowanemu na cząsteczce skrobi [Łabanowska
in. 2011]. Parametry pozostałych sygnałów (X – Z) były zbliżone do
parametrów sygnałów, które przypisano również rodnikom lokalizowanym na różnych grupach węglowodanowych. Nie udało się jednak
w sposób jednoznaczny określić rodzaju tych cukrowców. Niemniej,
wykazane podobieństwa pomiędzy charakterem widm pszenicy
i owsa sugerują, że w nasionach owsa występują również tzw. „długo-żyjące” rodniki, które są lokalizowane na tych samych cząsteczkach
organicznych jak u nasion pszenicy.
Wyniki analiz biochemicznych nasion owsa wykazały, iż badane
genotypy nie różnią się istotnie pod względem poziomu głównych
metabolitów (cukry, tłuszcze, białka), a zawartość tych substancji
była zbliżona do stężenia charakterystycznego dla nasion tych roślin
[Biel i in. 2010].
Wnioski
Podsumowując można wnioskować, iż pomiary zawartości „długożyjących” rodników w nasionach zbóż (w tym owsa) mogą stanowić
precyzyjny wskaźnik odporności roślin na warunki stresogenne,
pozwalając wykazać różnice pomiędzy genotypami, nawet o bardzo
zbliżonych parametrach biochemicznych.
Badania wykonano w ramach projektu: NCM nr: 2011/03/B/
MZ9/00074
108
Wykorzystanie spektroskopii elektronowego rezonansu paramagnetycznego (EPR)...
Literatura
1. Biel W., Szołkowska A., Bobko K., Jaskowska I. 2010. Skład chemiczny
i jakość białka ziarna owsa brązowo i żółtoplewkowego. Folia Pomer. Univ.
Technol. Stetin. Agric., Aliment., Pisc., Zootech. 278: 39–48.
2. Bligh E. G., Dyer W. J. 1959. A rapid method for total lipid extraction and
purification. Can. J. Biochem. Physiol. 37: 911–917.
3. Bradford M. M. 1976. A rapid and sensitive method for the quantitation of
microgramquantities of protein utilizing the principle of protein-dye binding. Analyt. Biochem., 72: 248–254.
4. Dubois M., Gilles K. A., Hamilton J. K., Rebers. P. A., Smith F. 1956. Calorimetric method for determination of sugars and related substances. Anal.
Chem. 28: 350–356.
5. Filek M., Walas S., Mrowiec H., Rudolphy-Skórska E., Sieprawska A., Biesaga-Kościelniak J. 2012. Membrane permeability and micro– and macroelement accumulation in spring wheat cultivars during the short-term
effect of salinity – and PEG-induced water stress. Acta Physiol. Plant. 34:
985–995.
6. Łabanowska M., Bidzińska E., Pietrzyk S., Juszczak L., Fortuna T., Błoniarczyk K. 2011. Influence of copper catalyst on the mechanism of carbohydrate radicals generation in oxidized potato starch. Carbohydrate Polymers. 85: 775–785.
7. Łabanowska M., Filek M., Kurdziel M., Bednarska E., Dłubacz A., Hartikainen H. 2012. Electron paramagnetic resonance (EPR) spectroscopy characterization of wheat grains from plants of different water stress tolerance.
J Plant Physiol. 13: 1234–42.
8. Spałek T., Pietrzyk P., Sojka Z. 2005. Application of genetic algorithm joint
with Powell method to non linear least squares fitting of powder EPR spectra. J. Chem. Inform. Model. 45: 18–29.
109
Krzelowska Magdalena, Zimak Paulina, Kurdziel Magdalena, Łabanowska Maria
Krzelowska Magdalena
Instytut Biologii, Uniwersytet Pedagogiczny w Krakowie
ul. Podchorążych 2, 30–084 Kraków
Zimak Paulina
Intsytut Fizjologii Roślin PAN
ul. Niezapominajek 21, 30–239 Kraków
Kurdziel Magdalena, Łabanowska Maria
Wydział Chemii, Uniwersytet Jagielloński
ul. Ingardena 3, 30–060 Kraków
Promotor: Prof. dr hab. Maria Filek
110
Magdalena Odrzywolska-Hasiec
Magdalena Troć, Krzysztof Oklejewicz
Andrzej Skoczowski
EPISTEME
18/2013, t. 3
s. 111–119
ISSN 1895-2241
WPŁYW WYSOKOŚCI NAD POZIOMEM MORZA
NA WYBRANE WŁAŚCIWOŚCI FIZJOLOGICZNE
LIŚCI OLSZY ZIELONEJ W BIESZCZADACH
EFFECT OF ALTITUDE ON THE SELECTED
PHYSIOLOGICAL PROPERTIES OF THE LEAVES
OF GREEN ALDER IN THE BIESZCZADY
Abstrakt. Olsza zielona (Alnus viridis DC.) – to wschodniokarpacki gatunek,
który w Bieszczadach Zachodnich osiąga północną i północno-zachodnią
granicę zasięgu. Naturalnie występuje przede wszystkim na bieszczadzkich
połoninach ale powiększając swój zasięg – schodzi w doliny górskie, na tereny porolne tworząc stanowiska antropogeniczne. Celem badań jest poznanie aspektów fizjologii taksonu na różnych wysokościach. Badaniami objęto
cztery stanowiska: Łobozew – 568 m n.p.m., Brzegi Górne – 980 m n.p.m,
Połonina Wetlińska – 1215 m n.p.m. oraz Tarnica – 1320 m n.p.m. Dotychczas wykazano występowanie istotnych różnic pomiędzy poszczególnymi stanowiskami w zawartości chlorofilu w liściach oraz sprawności fotochemicznej
fotosystemu II (PS II). Potwierdzono także przydatność metody spektroskopii
FT-ramanowskiej do porównania składu chemicznego tkanek roślinnych.
Słowa kluczowe: Alnus viridis DC., aktywność fotochemiczna PSII, olsza zielona, spektroskopia FT-ramanowska, zawartość chlorofilu
Summary. Green alder (Alnus viridis DC.) – this east-genre, which reaches
in the Western Bieszczady northern and north-western border of the range.
Naturally occurs on the Bieszczady Poloniny. The aim of the study was to understand the impact of altitude on physiology of the taxon. The studies included four localities: Łobozew – 568 m above sea level, Brzegi Górne – 980
m above sea level, Połonina Wetlińska – 1215 m above sea level, Tarnica –
1320 m above sea level. So far demonstrated the influence of altitude on the
chlorophyll content in leaves and photochemical efficiency of photosystem
II (PS II). Usability of the FT-Raman spectroscopy for analysis the chemical
composition of plant tissues was confirmed.
Key words: Alnus viridis DC., PSII photochemical activity, FT-Raman spectroscopy, chlorophyll content
111
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
Wstęp
Alnus viridis jest gatunkiem o Alpejsko-środkowoeuropejskim typie
zasięgu [Zając i Zając 2009]. Występuje w górach środkowej Europy od Francji przez Szwajcarię, Włochy i Niemcy po Ukrainę, Rumunię i Bułgarię [Browicz i Kaczmarek 1972, Gostyńska-Jakuszewska
1992]. W Polsce osiąga północno-zachodnią granicę swojego karpackiego zasięgu i ma charakter gatunku wschodniokarpackiego,
subalpejskiego [Gostyńska-Jakuszewska 1992, Zemanek i Winnicki
1999]. Stanowiska naturalne ma wyłącznie w Bieszczadach. Po raz
pierwszy została odkryta na Połoninach Waryńskiej i Wetlińskiej
w drugiej połowie XIX wieku [Knapp 1869], a następnie na Haliczu,
Krzemieniu i Tarnicy [Kotula 1883, Wołoszczak 1894]. Olsza zielona została w Bieszczadach Zachodnich odkryta po raz drugi na początku drugiej połowy XX wieku [Lisowski 1955, Jasiewicz i Zarzycki
1956, Fabijanowski 1956, Pałczyński 1958]. Jasiewicz [1965] podał
wykaz 117 stanowisk (61 na połoninach i 56 w reglu dolnym). Uważa
on, że naturalne stanowiska Alnus viridis grupują się w głównym paśmie Bieszczadów od Kończyka Bukowskiego po Połoninę Wetlińską
i Dział w przedziale wysokościowym 850-1348 m n.p.m., a pozostałe
są wynikiem stosunkowo niedawnego zawlekania. Większość z nich
znajduje się poniżej 800 m n.p.m.. Browicz i Kaczmarek [1972] piszą
o rozszerzaniu przez Alnus viridis swojego zasięgu, w tym pojawianiu
się jej w niższych położeniach na terenach porolnych. Potwierdzają
to Zemanek i Winnicki [1999], natomiast Zemanek [1989] uznaje
wszystkie stanowiska Bieszczadów Niskich i Otrytu za wtórne. Znane są także stanowiska antropogeniczne w innych pasmach Karpat
[Browicz i Kaczmarek 1972, Gostyńska-Jakuszewska 1992]. Występowanie Alnus viridis na stanowiskach naturalnych w Polsce związane jest z siedliskami świeżymi i wilgotnymi powyżej górnej granicy
lasu, gdzie krzewy te są składnikiem zubożałej formy endemicznego
wschodniokarpackiego zespołu Pulmonario filarszkyanae-Alnetum.
Niższe stanowiska to wynik ekspansji na tereny porolne [Jasiewicz
1965, Zemanek i Winnicki 1999].
Zmiany w sposobie gospodarowania gruntami oraz powiększanie się zasięgu Alnus viridis na północ i zachód wskazują, iż gatunek
może stać się ekspansywnym i odgrywać istotną rolę w zarastaniu
terenów porolnych. Wkraczanie na inne siedliska skorelowane z roz112
Wpływ wysokości nad poziomem morza na wybrane właściwości...
szerzeniem w dół pionowego zasięgu występowania stanowi przesłankę dla wielopłaszczyznowej analizy problemu. Najistotniejsze
wydaje się poznanie fizjologii gatunku na różnych wysokościach
n.p.m., co w korelacji z innymi czynnikami środowiska (np. antropogenicznym charakterem siedlisk) może przyczynić się do wyjaśnienia
problemów chorologicznych i być pomocne w wyjaśnieniu ekspansji
tego taksonu i sprecyzowaniu płynących z tego faktu zagrożeń dla
biocenoz roślinnych niższych położeń górskich.
Celem prowadzonych badań było poznanie wybranych właściwości fizjologicznych taksonu na różnych wysokościach tj. zbadanie
wpływu wysokości nad poziomem morza na sprawność fotochemiczną fotosystemu II (PSII) oraz na zawartość barwników fotosyntetycznych (chlorofili i karotenoidów) w liściach olszy zielonej.
Materiał i metody
Po dokonaniu weryfikacji botanicznej gatunku wyznaczono cztery
stanowiska do badań na terenie Bieszczadzkiego Parku Narodowego.
Najwyżej położone to Tarnica – 1320 m n.p.m., Połonina Wetlińska –
1215 m n.p.m i niżej Brzegi Górne – 980 m oraz najniżej położone
stanowisko (poza Parkiem na terenach porolnych) Łobozew – 568 m
n.p.m. Sprawność fotochemiczną PSII badano nieinwazyjnie na podstawie fluorescencji chlorofilu a (fluorymetr Handy PEA, Hansatech
Instruments) natomiast zawartość chlorofilu a i b określono metodą
spektrofotometryczną [Barnes i in. 1992]. Analizy składu chemicznego liści (głównie zmian zawartości karotenoidów) wykonano metodą spektrometrii FT-ramanowskiej [Skoczowski i in. 2011]. Uzyskane wyniki opracowane zostały przy użyciu jednoczynnikowego
testu ANOVA/MANOVA, testu Tukey’a oraz analizy podobieństwa
metodą Warda (pakiet Statistica 10 dla Windows).
Wyniki i dyskusja
Zawartość chlorofilu liściach Alnus viridis w zależności
od wysokości n.p.m. Całkowita zawartość chlorofilu była
najmniejsza w liściach roślin Alnus viridis na stanowisku położonym
najniżej natomiast na wyższych stanowiskach liście olszy zielonej
113
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
Ryc. 1. Zmiany zawartości chlorofilu (A), chlorofilu a (B), chlorofilu b (C)
oraz stosunku zawartości chlorofilu a:b (D) w liściach Alnus viridis
rosnących na różnych wysokościach n.p.m.
114
Wpływ wysokości nad poziomem morza na wybrane właściwości...
charakteryzowały się zbliżoną zawartością chlorofilu liczoną w mg
na cm2 (Ryc. 1A). Obserwacja ta jest nieco zaskakująca bowiem niska
zawartość chlorofilu wynika zazwyczaj z wysokiej intensywności
światła docierającego do roślin, natomiast stanowisko w Łobozowie
wydawało się być intensywnie zacienione. Dla wyjaśnienia tego
zjawiska konieczne będą zatem pomiary dobowej ekspozycji na
światło poszczególnych stanowisk. Uzyskane wyniki można jednak
uznać za zgodne z obserwacjami poczynionymi przez Benecke
[1972] dla roślin Alnus viridis rosnących na różnych wysokościach
nad poziomem morza w górach północnego Tyrolu. Stwierdził on,
że koncentracja chlorofilu zmniejszała się wraz ze zwiększającą się
wysokością nad poziomem morza. Zawartość chlorofilu a w liściach
olszy była na wszystkich stanowiskach bardzo zbliżona (Ryc. 1B).
W przypadku chlorofilu b najmniejszą jego zawartość stwierdzono
w liściach olszy na najniżej położonym stanowisku w Łobozowie (568
m n.p.m.), natomiast najwyższą na stanowisku w Brzegach Górnych
tj. na wysokości 980 m n.p.m. Na najwyżej położonych stanowiskach
tj. na Połoninie Wetlińskiej oraz na Tarnicy zawartość chlorofilu b była
zbliżona i przyjmowała wartości pośrednie w porównaniu do niżej
położonych stanowisk (Ryc. 1C). Konsekwencją niskiej zawartości
chlorofilu b w liściach olszy na najniżej położonym stanowisku
w Łobozowie jest wysoki stosunek chlorofilu a:b w porównaniu
z wyżej położonymi stanowiskami (Ryc. 1D). Zaskakująca jest
natomiast wartość tego stosunku we wszystkich badanych obiektach.
Zazwyczaj stosunek ten wynosi około 3 [Hall i Rao 1999], natomiast
w liściach olszy nie przekracza wartości 2,4.
Sprawność fotochemiczna PS II w liściach Alnus viridis
w zależności od wysokości n.p.m. Sprawność fotochemiczną PSII
oceniano na podstawie wartości współczynnika Fv/Fm [Björkman
i Demmig 1987]. Najwyższe wartości Fv/Fm stwierdzono w liściach
roślin rosnących na najniżej położonych stanowiskach. Sprawność
fotochemiczna PSII była natomiast niska na stanowiskach położonych
wysoko, a niskie wartości współczynnika Fv/Fm wskazują na
upośledzone działanie PSII. Przyjmuje się bowiem, że wartości
współczynnika Fv/Fm, dla roślin rosnących w optymalnych warunkach,
powinny wynosić ponad 0,800 [Björkman i Demmig 1987].
115
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
Ryc. 2. Zmiany wartości współczynnika Fv/Fm w liściach roślin Alnus viridis
rosnących na różnych wysokościach n.p.m.
Analiza składu chemicznego liści (zmiany zawartości
karotenoidów). Widma ramanowskie w zakresie 150-3560 cm-1
pokazały zróżnicowanie składu chemicznego liści olszy zielonej
w zależności od zajmowanego stanowiska (dane nie pokazane).
Widma ramanowskie liści w tzw. zakresie karotenoidowym
przedstawiono natomiast na Ryc. 3A. Analiza chemometryczna
wskazuje, że liście Alnus viridis rosnącej na Tarnicy są najbardziej
różne pod względem składu karotenoidowego od tych rosnących na
niższych stanowiskach. Zaskakujące jest duże podobieństwo składu
karotenoidowego liści olszy ze stanowisk na Połoninie Wetlińskiej
i w Łobozowie, tj. stanowisk znacznie różniących się położeniem
n.p.m. i, jak się wydaje, również stopniem nasłonecznienia (Ryc. 3B).
116
Wpływ wysokości nad poziomem morza na wybrane właściwości...
Ryc. 3. Widma FT-ramanowskie liści Alnus viridis rosnścych na różnych
wysokościach n.p.m. (A); dendrogram podobieństwa widm w zakresie
karotenoidowym (B).
117
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
Wnioski
1. Wysokość nad poziomem morza istotnie wpływa na zawartość
chlorofilu w liściach olszy zielonej.
2. Sprawność fotochemiczna PSII liści olszy zielonej ulega obniżeniu wraz z wysokością nad poziomem morza.
3. Spektrometria FT-ramanowska umożliwia porównania wpływu warunków wzrostu na skład chemiczny tkanek roślinnych.
Bibliografia
1. Barnes J. D., Balaguer L., Manrique E., Elvira S., Davidson A.W. 1992. Are
appraisal of the use the use of DMSO extraction and determination of chlorophylls a and b lichens and higher plants. Environmental and Exp. Bot., 32.
2. Benecke U. 1972. Wachstum, CO2 – Gasweschel und Pigmentgehalt einiger
Baumarten nach Ausbringung in verschiedene Höhenlagen. Angewangte
Botanik 46 (1/2): 117–135.
3. Björkman O., Demmig B. 1987. Photon yield of O2 evolution and chlorophyll
fluorescence characteristics at 77 K among vascular plants of diverse origins. Planta 170: 489–504,
4. Browicz K., Kaczmarek Cz. 1972. 20. Alnus viridis DC. – Olsza zielona.
[w:] Browicz K. Atlas Rozmieszczenia Drzew i Krzewów w Polsce, z. 11.
5. Fabijanowski 1956. Na marginesie artykułu Stanisława Lisowskiego pt.
„O występowaniu kosej olchy (Alnus viridis DC.) w Bieszczadach”. Chrońmy Przyrodę Ojczystą 12(1): 33–34.
6. Gostyńska-Jakuszewska M. 1992. I. Betulaceae, Brzozowate. [w:] Jasiewicz A. (red.) Flora Polski. Rośliny naczyniowe, 3: 7–18. Polska Akademia Nauk. Instytut Botaniki im. W. Szafera, Kraków.
7. Hall D. O., Rao K.K. 1999. Fotosynteza. WNT. Warszawa.
8. Jasiewicz A. 1965. Rośliny naczyniowe Bieszczadów Zachodnich. Monographiae Botanice, 20: 1–338.
9. Jasiewicz A., Zarzycki K. 1956. Carex rupestris Bell. ex All. i Aconitum tauricum Wolf. Subsp. nanum (Baumg.) Gáy., dwie nowe dla flory polskiej rośliny z
Bieszczadów Zachodnich. Fragmenta Floristica Geobotanica 2(2): 24–27.
10. Knapp J. A. 1869. Przyczynek do flory obwodów jasielskiego i sanockiego.
Sprawozdania Komisji Fizjograficznej AU 3: 74–109.
11. Kotula B. 1883. Spis roślin naczyniowych z okolic górnego Strwiąża
i Sanu z uwzględnieniem pionowego zasięgu gatunków. Sprawozdanie Komisji Fizyograficznej AU 17: 105–243.
118
Wpływ wysokości nad poziomem morza na wybrane właściwości...
12. Lisowski S. 1955. O występowaniu olszy kosej (Alnus viridis DC.)
w Bieszczadach Zachodnich. Chrońmy Przyrodę Ojczystą 11 (4): 16–23.
13. Pałczyński A. 1958. Wstępne badania geobotaniczne i florystyczne użytków
zielonych w Bieszczadach. Zeszyty Naukowe Wyższej Szkoły Rolniczej
we Wrocławiu. III. Rolnictwo 12: 93–120.
14. Skoczowski A., Troć M., Baran A., Baranska M. 2011. Impact of sunflower
and mustard leave extracts on the growth and dark respiration of mustard
seedlings. J. Therm. Anal. Calorim. 104: 187–192.
15. Wołoszczuk E. 1894. O roślinności Karpat między górnym biegiem Sanu
i Osławy. Sprawozdania Komisji Fizjograficznej AU 19: 39–69.
16. Zając M., Zając A. 2009. Elementy geograficzne rodzimej flory Polski. Nakładem Pracowni Chorologii Komputerowej Instytutu Botaniki Uniwersytetu Jagiellońskiego, ss. 1–94, Kraków.
17. Zemanek B. 1989. Rośliny naczyniowe Bieszczadów Niskich i Otrytu (polskie Karpaty Wschodnie). Zeszyty Naukowe Uniwersytetu Jagiellońskiego. Prace Botaniczne, 20: 1–185.
18. Zemanek B. & Winnicki T. 1999. Rośliny naczyniowe Bieszczadzkiego Parku Narodowego. Monografie Bieszczadzkie, 3: 1–249.
119
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
mgr inż. Magdalena Odrzywolska-Hasiec
Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy
ul. Zelwerowicza 4, 35–959 Rzeszów
e-mail: [email protected]
dr Magdalena Troć
Instytut Fizjologii Roślin Polskiej Akademii Nauk
ul. Niezapominajek 21, 30–239 Kraków
e-mail: [email protected]
dr hab. prof. UR Krzysztof Oklejewicz
Uniwersytet Rzeszowski, Wydział Biologiczno-Rolniczy
ul. Zelwerowicza 4, 35–959 Rzeszów
e-mail: [email protected]
prof. dr hab. Andrzej Skoczowski
Instytut Fizjologii Roślin Polskiej Akademii Nauk
ul. Niezapominajek 21, 30–239 Kraków
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. Andrzej Skoczowski,
dr hab. prof. UR Krzysztof Oklejewicz
120
Rafał Ogórek
Agnieszka Lejman
EPISTEME
18/2013, t. 3
s. 121–130
ISSN 1895-2241
Analiza mikoLogiczna powietrza
Jaskini niedźwiedziej w kletnie.
Doniesienie wstępne
the Mycological air analysis of Niedźwiedzia
(bear) cave in kletno. PRELIMINARY study
Abstrakt. Celem pracy była ocena stanu mikologicznego powietrza w Jaskini Niedźwiedziej (Kletno). Próby powietrza zostały pobrane 12 września 2011 roku z trzech stanowisk badawczych zlokalizowanych w Jaskini
Niedźwiedziej: Sala Lwa, Sala Pałacowa, Korytarz Człowieka Pierwotnego.
Z powietrza zostały wyizolowane grzyby z rodzajów: Acremonium, Aspergillus, Cladosporium, Penicillium, Sordaria, Trichoderma oraz drożdżaki z rodzaju
Candida i Rhodotorula.
Słowa kluczowe: grzyby, powietrze, jaskinia
Summary. The aim of study was to evaluate mycological air in Niedźwiedzia
(Bear) Cave, Kletno. Air samples were taken in the 12th September 2011
from 3 location of Niedźwiedzia (Bear) Cave: Cave Lion Hall, The Palace Hall,
Primitive Human Corridor. From the air were isolated fungi of the genus:
Acremonium, Aspergillus, Cladosporium, Penicillium, Sordaria, Trichoderma
and yeasts of the genus Candida and Rhodotorula.
Key words: fungi, air, cave
121
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
Wstęp
Jaskinia Niedźwiedzia odkryta została w 1966 roku podczas prac w kamieniołomie. Obecnie długość znanych korytarzy wynosi ponad 3 km
[Pulina 1970, 1989]. W Jaskini udostępniony do zwiedzania jest
środkowy poziom, który zaczyna się w pawilonie wejściowym z ekspozycjami przyrodniczymi, a następnie śluza wejściowa prowadzi do
Wielkiej Szczeliny. Przez pomost nad Wielką Szczeliną przechodzi się
przez rozcięty pracami górniczymi Próg Ryżowy z którego przechodzi
się do Sali Lwa. Następnie przechodzi się do Sali Przejściowej z której
przez korytarz przekopany w namuliskach dochodzi się do sali, zwanej
Biwakiem. Z Biwaku przechodzi się przez wykutą sztolnię do Korytarza Stalaktytowego i Sali Pałacowej. Na końcu Sali Pałacowej znajdują
się wejścia do Korytarza Wodnego i Korytarza Mis Martwicowy, który
łączy się z Biwakiem. Z Korytarza Wodnego przechodzi się przez sztolnię do Korytarza Człowieka Pierwotnego, który łączy się z Biwakiem.
Z Korytarza Człowieka Pierwotnego opuszcza się środkowe piętro jaskini przez sztolnię z dwiema śluzami [Pulina 1996].
Jaskinia Niedźwiedzia w przeszłości i obecnie jest środowiskiem
zasiedlanym przez organizmy żywe [Wiszniowska 1967, 1989].
Z osadów wydobyto próby liczące kilkaset tysięcy szczątków, na które składają się kości kręgowców i skorupki ślimaków. Wykryto m.in.
szczątki należące do 29 gatunków ssaków i muszle ślimaków (29 gatunków). Natomiast w faunie współcześnie żyjącej w jaskini występują: skoczogonki, pajęczaki, nietoperze i gryzonie [Bieroński i in.
2007].
Ludzie zwiedzający kopalnie i jaskinie mogą być narażeni na
działanie wielu szkodliwych czynników, ponieważ powietrze poza
stałymi składnikami może zawierać zanieczyszczania biologiczne
[Stach i in. 2004]. Biologiczna frakcja powietrza może zwierać m.in.
wirusy, bakterie, komórki i fragmenty roślin i zwierząt a także fragmenty grzybni grzybów i ich zarodniki [An i in. 2004]. Zanieczyszczenia mikrobiologiczne mogą wydzielać metabolity wtórne takie jak
mykotoksyny, endotoksyny, enterotoksyny i enzymy, które są szkodliwe dla zdrowia ssaków [Gołofit-Szymczak i Skowron 2005]. Źródła
literaturowe donoszą, że większość problemów zdrowotnych związanych z jakością powietrza np. wewnątrz pomieszczeń mieszkalnych
122
Wpływ wysokości nad poziomem morza na wybrane właściwości...
wynika z obecności grzybów. Szacuje się, że stanowią one nawet 70%
wszystkich zanieczyszczeń mikrobiologicznych powietrza. Dowodzą
tego wyniki analizy mikologicznej powietrza przeprowadzone m.in.
w USA i Brazylii [Brickus i in. 1998, Reynolds i in. 2001].
Ogórek [2012] stwierdza, że w powietrzu kopalni Złota w Złotym
Stoku występują grzyby z rodzaju Alternaria, Aspergillus, Botrytis,
Cladosporium, Penicillium, Rhizopus, Sordaria i Trichoderma oraz drożdżaki z rodzaju Rhodotorula. Natomiast według Nováková [2009]
w powietrzu Słowackich jaskiń występują grzyby z rodzaju: Circinella, Mucor, Rhizopus, Acremonium, Alternaria, Arthrinium, Aspergillus,
Beauveria, Botrytis, Chrysosporium, Cladosporium, Clonostachys, Doratomyces, Engyodontium, Fusarium, Geomyces, Isaria, Lecanicillium,
Malbranchea, Ochroconis, Oidiodendron, Paecillium, Paranomuraea,
Phialophora, Phoma, Pithomyces, Pochonia, Scytalidium, Stachybotrys,
Trichoderma, Trichophyton, Ulocladium i Verticillium.
Najczęściej stosowaną techniką do kontroli czystości mikrobiologicznej powietrza jest metoda zderzeniowa z wykorzystaniem
próbnika powietrza i szalek zawierających zestalone podłoże hodowlane [Krygiel 2006].
Materiały i metody
Materiał do badań stanowiły próbki powietrza pobrane 12 września
2011 roku z trzech stanowisk badawczych zlokalizowanych w Jaskini
Niedźwiedziej (Kletno).
Analizę powietrza przeprowadzono metodą zderzeniową (aparat
Air Ideal 3P), z użyciem dwóch podłoży hodowlanych: PDA (Potato
Dextrose Agar, Biocorp) i zakwaszonego PDA (0,5% kwasu cytrynowego). Aparat (Air Ideal 3P) zaprogramowano na pobieranie próbek powietrza o objętości: 100, 150 i 300 dm3 powietrza. W każdym
punkcie pomiar wykonano w trzech powtórzeniach (dla każdej objętości powietrza). W trakcie pomiarów aparat był umieszczony na wysokości 1,5m od podłoża. Inkubację pobranych próbek na płytkach
Petriego (średnica 90mm) prowadzono w temperaturze pokojowej
(~22oC) przez 2–7 dni. Po okresie inkubacji obliczono liczbę jednostek tworzących kolonie (jtk) w 1m3 powietrza.
123
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
Średnio roczna temperatura i wilgotność względna powietrza
wynosiły odpowiednio około 6 oC i prawie 100% [www.jaskinia.pl/
jaskinia/pl/opis.html].
Identyfikacje do danego gatunku grzyba była w oparciu o ogólnie
przyjęte metody stosowane w laboratoriach mikologicznych, z wykorzystaniem dostępnych kluczy do oznaczana grzybów [Eblis 1971,
Raper i Fennell 1965, Raper i Thom 1968].
Wyniki
Liczebność grzybów izolowanych z powietrza w badanych próbkach
pomiarowych zlokalizowanych w Jaskini Niedźwiedziej (Sala Lwa,
Sala Pałacowa, Korytarz Człowieka Pierwotnego) wahała się od 39 do
61 jednostek tworzących kolonie w 1m3 powietrza. Najbardziej zanieczyszczone powietrze pod względem mikologicznym stwierdzono
w Sali Lwa. Natomiast najmniejszą liczebność grzybów odnotowano
w powietrzu Sali Pałacowej – tab. 1.
Szczegółowa analiza jakościowa grzybów izolowanych z powietrza na wytypowanych punktach pomiarowych pozwoliła stwierdzić,
że z podłoża PDA wyizolowano 10 gatunków grzybów a z podłoża
PDA zakwaszonego 8 gatunków. Na podłożu PDA w porównaniu do
PDA zakwaszonego, wyizolowano dodatkowo gatunki grzybów, takie
jak: Penicillium expansum i Sordaria fimicola – ryc. 1.
Najczęściej izolowanym gatunkiem grzyba w badanym środowisku na obu podłożach był Cladosporium herbarum – ryc. 1. Najmniejszą liczbę gatunków grzybów wyizolowano z próbek powietrza
Sali Lwa (na podłożu PDA 4 i PDA zakwaszonym 3 gatunki grzybów),
natomiast najwięcej z Sali Pałacowej (na podłożu PDA 7 i PDA zakwaszonym 6 gatunków) – tab. 1.
dyskusja
Czyste powietrze jest niezbędnym warunkiem do życia człowieka.
W ciągu minuty wdychamy i wydychamy około 10 dm3 powietrza
[Charkowska 2003]. Jest one w odróżnieniu od gleby i wody, środowiskiem nieprzyjaznym dla życia mikroorganizmów, które zachowują w nim swój potencjał infekcyjny [Kaiser i Wolski 2007]. Ponad124
Wpływ wysokości nad poziomem morza na wybrane właściwości...
to Charkowska [2003] wykazała, że zawarte w powietrzu zarodniki
i strzępki grzybów zawierają nie tylko różnego rodzaju toksyny,
ale również antybiotyki i halucynogeny, które są przyczyną wielu
chorób. Wdychanie tych fragmentów może prowadzić do zaburzeń
w działaniu układu immunologicznego, neurologicznego czy też do
różnego rodzaju zatruć.
Wśród wyizolowanych grzybów z próbek powietrza pobranych
z Jaskini Niedźwiedziej stwierdzono gatunki, które mogące wywoływać ciężkie schorzenia oraz alergie. Do pierwszej grupy zalicza się
m.in. grzyby z rodzajów: Aspergillus (aspergiloza płuc, zatok, rogówki, oczodołu, skóry, paznokci, przewodu słuchowego zewnętrznego),
Rhizopus (mukormikoza płuc, zatok, uogólniona), oraz drożdżaki
z rodzaju Candida (kandydozy błon jamy ustnej, gardła, narządów płciowych, rozsiana i układowa kandydoza) [Adamski 2008A, 2008B]. Drugą grupę stanowią patogeny będące alergenami. Do grupy tej zalicza się
grzyby z grupy pierwszej, jak i grzyby należące do rodzajów: Alternaria,
Acremonium, Cladosporium oraz Penicillium [Adamski 2008C].
Na podstawie uzyskanych wyników, stwierdzono, że średnia liczebność grzybów w powietrzu Jaskini Niedźwiedziej wyniosła na
podłożu PDA 57,7 jtk w 1 m3 powietrza a na podłożu PDA zakwaszonym 47. Wang in. [2010] badali zmiany sezonowe w zawartości
grzybów w powietrzu jaskini Mogao Grottoes w Chinach. Stwierdzili
oni, że w tym badanym środowisku średnia liczebność grzybów w powietrzu była na poziomie około 187 jtk w 1m3 powietrza. Natomiast
Ogórek i in. [2011] donoszą, że w powietrzu domów studenckich,
grzyby mogą występować na poziomie od 184 do 889 jtk w 1m3 powietrza na podłożu Sabourauda i od 139 do 978 jtk na 1m3 powietrza
na podłożu Czapek-Dox Agar. Jednymi z przyczyn małej liczebność
izolowanych grzybów z powietrza Jaskini Niedźwiedziej mogą być
niska stała całoroczna temperatura powietrza wynoszącą około 6oC
oraz mała dostępnością materii odżywczej dla nich np. roślin żywicielskich.
W powietrzu badanych miejsc w Jaskini Niedźwiedziej dominowały grzyby z rodzaju Cladosporium (gatunek Cladosporium herbarum). Wang in. [2010] badając powietrze w jaskini Mogao Grottoes stwierdzili także, że najliczniej izolowanym rodzajem grzyba był
Cladosporium. Grzyby z tego rodzaju występują powszechnie w wie125
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
lu rejonach świata [Domach 1980]. Stwierdzono także, że zarodniki Cladosporium spp. stanowią nawet 80% wszystkich zarodników
wyizolowanych z próbek powietrza pobranego z różnych regionów
Europy [D’Amato i Spieksma 1995]. Gatunek C. herbarium u ludzi
powoduje głownie alergie [Adamski 2008C], natomiast u roślin wraz
z grzybami z rodzaju Alternaria i Epicoccum może być przyczyną
czerni zbóż [Kryczyński i Weber 2011].
126
Gatunek grzyba
Acremonium strictum
W. Gams
Aspergillus niger Tiegh.
Cladosporium herbarum
Pers.
Penicillium expansum Link
Acremonium strictum
W.Gams
Candida albicans Berkhout
Cladosporium herbarum
Pers.
Penicillium expansum Link
Rhodotorula glutinis Harrison.
Rhodotorula rubra Harrison
Sordaria fimicola Roberge ex
Desm.
Trichoderma harzianum
Rifai
Powietrze –
jtk / m3
Podłoże zakwaszone
PDA
Powietrze –
jtk / m3
Gatunek
Ogólnie
19
61
31,1
9
7
11,5
30
50,8
20
32,8
20
33,9
15
24,6
-
-
5,6
5
6
11,1
5
12,8
5
9,3
8
20,5
17
31,5
-
-
10
18,5
8
20,5
-
-
5
12,8
4
7,4
-
-
9
16,7
8
20,5
3
54
Gatu- Ogólnek
nie
59
39
Gatunek [%]
Podłoże PDA
Gatunek [%]
Sala Pałacowa
Sala Lwa
Miejsce pomiaru
Tab. 1. Stan mikologiczny powietrza w badanych miejscach
(Sala Lwa, Sala Pałacowa, Korytarz Człowieka Pierwotnego)
Jaskini Niedźwiedziej w Kletnie.
15,3
12,8
Korytarz Człowieka Pierwotnego
Wpływ wysokości nad poziomem morza na wybrane właściwości...
Acremonium strictum
W.Gams
Cladosporium herbarum
Pers.
Penicillium chrysogenum
Westling
Rhodotorula glutinis Harrison.
Rhodotorula rubra Harrison
Trichoderma harzianum
Rifai
7
58
12,1
5
43
11,6
20
34,5
10
23,3
6
10,3
10
23,3
15
25,9
3
7,0
10
17,2
-
-
-
-
15
34,9
Ryc. 1. Procentowy udział gatunków grzybów wyizolowanych z powietrza
wszystkich badanych miejsc (Sala Lwa, Sala Pałacowa, Korytarz Człowieka
Pierwotnego) w Jaskini Niedźwiedziej w Kletnie.
Wnioski
1. Rodzaj zastosowanego podłoża ma wpływ na liczebność i skład
izolowanych grzybów z powietrza.
2. W powietrzu badanych miejsc Jaskini Niedźwiedziej dominował
gatunek Cladosporium herbarum, który może być przyczyną alergii.
3. Liczebność grzybów wyizolowanych z powietrza Jaskini
Niedźwiedziej nie stwarza zagrożenia dla zdrowia ludzi tam przebywających.
127
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
Literatura
1. Adamski Z., Henke K., Zawirska A., Kubisiak-Rzepczyk H. 2008 A. Grzybice narządowe. wyd. Baran E., red. Mikologia – co nowego? Wrocław,
Cornetis, 189–202.
2. Adamski Z., Henke K., Zawirska A, Kubisiak-Rzepczyk H. 2008B. Grzybice
błon śluzowych. wyd. Baran E, red. Mikologia – co nowego? Wrocław,
Cornetis, 174–187.
3. Adamski Z., Henke K., Zawirska A., Kubisiak-Rzepczyk H. 2008C. Rola
grzybów w etiopatogenezie chorób alergicznych. wyd. Baran E, red. Mikologia – co nowego? Wrocław, Cornetis, 30–42.
4. An H. A., Mainelis G., Yao M. 2004. Evaluation of a high-volume portable
bioaerosol sampler in laboratory and field environments. Indoor Air, 14:
385–393.
5. Bieroński J., Socha P., Stefaniak K. 2007. Jaskinie masywu Śnieżnika Kłodzkiego. Materiały 41. Sympozjum Speleologicznego, Kletno, 9–16.
6. Brickus L. S. R., Siqueira L. F. G., Aquino Neto F. R., Cardoso J. N. 1998.
Occurrence of airborne bacteria and fungi in bayside offices in Rio de Janeiro, Brazil. Indoor Built Environment, 7(5–6): 270–275.
7. Charkowska A. 2003. Zanieczyszczenia w instalacjach klimatyzacyjnych
i metody ich usuwania. wyd. IPPU MASTA, 1–60.
8. D’Amato G., Spieksma FThM. 1995. Aerobiologic and clinical aspects of mould allergy in Europe. Allergy, 50: 870–877.
9. Domsch K. H., Games W., Anderson T.H. 1980. Compendium of soil fungi.
Academic Press London, 201–208.
10. Ellis M. B. 1971. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, Surrey.
11. Gołofit-Szymczk M., Skowron J. 2005. Zagrożenia mikrobiologiczne w pomieszczeniach biurowych. Bezpieczeństwo pracy, 3: 29–31.
12. Kaiser K., Wolski A. 2007. Kontrola czystości mikrobiologicznej powietrza.
Technika chłodnicza i klimatyzacyjna, 4: 158–162.
13. Kryczyński S., Weber Z. 2011. Fitopatologia. Choroby roślin uprawnych
(tom 2). Poznań, wyd. PWRiL, 294–298.
14. Krygiel D. 2006. Zanieczyszczenia mikrobiologiczne powietrza hali technologicznej a jakość produkowanych opakowań. Żywność Nauka Technologia Jakość, 46: 52–58.
15. Nováková A. 2009. Microscopic fungi isolated from the Domica Cave system
(Slovak Karst National Park, Slovakia). A review. International Journal
of Speleology, 38(1): 71–82.
16. Ogórek R. 2012. Mycological air pollutions in Gold Mine (Gertruda’s Adit)
in Złoty Stok. Proceedings of the 36th Conference of Agricultural Stu128
Wpływ wysokości nad poziomem morza na wybrane właściwości...
dents and Veterinary Medicine with International Participation. Serbia, Nowy Sad, 36: 100–107.
17. Ogórek R., Pląskowska E., Kalinowska K., Fornalczyk P., Misztal A.,
Budziak J. 2011. The analysis of mycological air pollution in selected rooms
of student hostels. Mikologia Lekarska, 18 (4): 201–210.
18. Pulina M. 1996. Jaskinie Sudetów. Polskie Towarzystwo Nauk o Ziemi, 202.
19. Pulina M. 1970. Wstępne wyniki badań nad środowiskiem geograficznym
Jaskini Niedźwiedziej. Acta Universitatis Wratislaviensis 127, Studia
Geograficzne XIV, 5–37.
20. Pulina M. 1989. Historia odkrycia i badań. wyd. Jahn A., Kozłowski S.,
Wiszniewska T. red. Jaskinia Niedźwiedzia w Kletnie. Badania i udostępnianie. Ossolineum, Wrocław–Warszawa, 11–20.
21. Raper K. B., Fennell D. I. 1965. The genus Aspergillus. Willims and Wilkins Company, Baltimore.
22. Raper K. B., Thom C. 1968. A manual of the Penicillia. Hafner Publishing
Company, New York.
23. Reynolds S. J., Black D. W., Borin S.S., Breuer G., Burmeister L. F.,
Fuortes L. J., Smith T. F., Stein M.A., Subramanian P., Thorne P. S.,
Whitten P. 2001. Indoor environmental quality in six commercial office buildings in the Midwest United States. Applied Occupational and Environmental Hygiene, 16(11): 1065–1077.
24. Stach A., Piotroszewska–Pająk A., Stryjkowska-Sekulska M., Filipiak M.,
Silny W. 2004. Mikroflora powietrza wokół i wewnątrz budynków dydaktycznych wyższej uczelni w Poznaniu. Postępy Dermatologii i Alergologii,
3: 121–127.
25. Wang W., Ma X., Ma Y., Mao L., Wu F., Ma X., An L., Feng H., 2010. Seasonal dynamice of airborne fungi in different caves of the Mogao Grottoes,
Dunhuang, China. International Biodeterioration & Biodegradation,
64: 461–466.
26. Wiszniowska T. 1967. Nowe znalezisko paleontologiczne w Sudetach. Przegląd Zoologiczny, 11: 430–433.
27. Wiszniowska T. 1989. Kopalne szczątki zwierzęce. wyd. Jahn A., Kozłowski S., Wiszniewska T., Jaskinia, red.
129
Magdalena Odrzywolska-Hasiec, Magdalena Troć, Krzysztof Oklejewicz...
Niedźwiedzia w Kletnie. Badania i udostępnianie. Ossolineum,
Wrocław–Warszawa, 255–279.
www.jaskinia.pl/jaskinia/pl/opis.html
Zadanie współfinansowane ze środków Unii Europejskiej w ramach
Europejskiego Funduszu Społecznego w ramach projektu ,,Grant Plus”
Rafał Ogórek
Katedra Ochrony Roślin
Uniwersytet Przyrodniczy we Wrocławiu
Plac Grunwaldzki 24a, 50–363 Wrocław
e-mail: [email protected]
Agnieszka Lejman
Katedra Kształtowania Agroekosystemów i Terenów Zieleni
Uniwersytet Przyrodniczy we Wrocławiu
Plac Grunwaldzki 24a, 50–363 Wrocław
e-mail: [email protected]
Opiekun naukowy: dr hab. Krzysztof Matkowski,
dr hab. Piotr Sobkowicz prof. nadzw.
130
Paulina Topolińska
EPISTEME
18/2013, t. 3
s. 131–138
ISSN 1895-2241
MIKOLOGICZNA OCENA KISZONEK
Z LUCERNY I TRAW SPORZĄDZONYCH
Z DODATKIEM INOKULANTÓW BAKTERYJNYCH
THE MYCOLOGICAL ASSESSMENT OF ALFALFA AND GRASS
SILAGES WITH ADDED BACTERIAL INOCULANTS
Abstrakt. Obecność grzybów pleśniowych w kiszonkach wpływa negatywnie na ich jakość, powodując ograniczenie stabilności tlenowej kiszonek.
Celem badań była analiza mikologiczna kiszonek z traw i lucerny pod względem zawartości grzybów pleśniowych oraz ocena wpływu zastosowanych
dodatków na ograniczenie występowania pleśni w kiszonkach. Badania
przeprowadzono w terminie od 9 czerwca do 20 października 2010 roku.
Doświadczenie polegało na zbadaniu 8 prób kiszonek w 3 powtórzeniach
dla każdej próby, z czego 2 próby bez dodatku mikrobiologicznego oraz
6 prób z dodatkiem inokulantu. W celu wyizolowania grzybów pleśniowych
z badanego materiału, wykonano rozcięczenia podstawowe każdej próby
w poszczególnych dniach po zakiszeniu. Szalki inkubowano w temperaturze
25 ºC, a identyfikacje gatunkową grzybów przeprowadzono w oparciu o obserwacje makro- i mikroskopowe. Z badanych prób kiszonek zidentyfikowano przede wszystkim grzyby należące do rodzajów Mucor, Penicillium, Aspergillus, Fusarium. Analiza kiszonek wykazała hamujący wpływ konserwantu,
poprzez ograniczenie rozwoju grzybów pleśniowych.
Słowa kluczowe: Grzyby pleśniowe, kiszonki z traw i lucerny, dodatki mikrobiologiczne
Summary. The presence of molds in silage has a negative impact on their
quality, resulting in reduction of aerobic stability of silage. Aim of this study
was to analyze the mycological grass silage and alfalfa for content mold and
impact assessment inoculants used to reduce the occurrence of mold in silages. The study was to examine the 8 samples of silage in 3 replications for
each sample, of which 2 samples without the addition of microbiological
6 samples with inoculants.In order to isolate the fungi and yeasts with the
test material, diluting performed for each sample core decreased for each
day after the ensiling. Petri dishes were incubated at 25 °C and the identification of species of fungi was based on observations of macro- and microscopic. The tested samples were identified primarily silage fungi belonging to Mucor, Penicillium, Aspergillus, Fusarium. The analysis silage showed
preservative an inhibitory effect on silage by limiting the growth of molds.
Key words: mold fungi, grass silage, alfalfa silage, bacterial additives
131
Paulina Topolińska
Wstęp
Prawidłowe wykonanie kiszonki stymuluje rozwój bakterii fermentacji mlekowej, ograniczając straty cukrów i innych składników pokarmowych. Zielonki z traw i roślin motylkowatych należą do roślin
trudno zakiszających się [Zastawny 1993]. Zakiszanie tych zielonek bez wstępnego podsuszenia surowca i dodatków ułatwiających
przebieg procesów fermentacyjnych jest trudne. Rodzaj surowca
oraz czynniki środowiskowe określają skład mikroflory epifitycznej
w zakiszanej masie [Purwin i Minakowski 2007]. Kiszonki w aspekcie sensorycznym skażone są przede wszystkim pleśniami z rodzaju
Penicillium, Aspergillus, Fusarium, Mucor, a także Monascus [Grajewski 1995]. Duże znaczenie przy produkcji wysokiej jakości kiszonki
z roślin motylkowych ma sposób jej konserwowania. Środki konserwujące powodują zminimalizowanie strat składników odżywczych,
polepszanie, jakości higienicznej kiszonki, co prowadzi do wzrostu
pobierania paszy przez zwierzęta. Dodatki do zakiszania są konieczne w przypadku zbioru świeżej zielonki w niesprzyjających warunkach. Wpływ dodatków kiszonkarskich, na jakość mikrobiologiczną
kiszonek obejmuje ich specyficzne oddziaływanie na poszczególne
gatunki bakterii i grzybów patogennych [Liu i in. 2009]. Celem badań
była analiza mikologiczna kiszonek z traw i lucerny pod względem
zawartości grzybów pleśniowych oraz ocena wpływu zastosowanych
inokulantów na ograniczenie występowania pleśni w kiszonkach.
Materiał i metody
Ocenie mikologicznej poddano zielonki z lucerny (Medicago L.)
i traw pochodzących z województwa kujawsko– pomorskiego. Skład
zielonek z traw był następujący: Festulolium, Wiechlina łąkowa (Poa
pratensis L.), Tymotka łąkowa (Phleum pratense L.), Życica trwała (Lolium perenne L.), Życica wielokwiatowa (Lolium multiflorum),
Kostrzewa łąkowa (Festuca pratensis Huds.) z wyjątkiem zielonki
oznaczonej symbolem D2 nie zawierającej w swoim składzie Tymotki łąkowej. Badanie wykonano w terminie od 9 czerwca do 20 października 2010 roku. Termin zbioru lucerny odbył się na przełomie
końcowej fazy pączkowania i początku okresu kwitnienia, natomiast
132
Mikologiczna ocena kiszonek z lucerny i traw sporządzonych z dodatkiem inokulantów...
zbiór traw miał miejsce na początku kłoszenia. Metoda zbioru zielonek z lucerny i traw przebiegała w sposób dwufazowy. Zielonkę skoszono przy użyciu kosiarki i podsuszono na pokosach do momentu
uzyskania ok. 28–35% suchej masy. Zielonki zakiszano podsuszone
i rozdrobnione – długość sieczki 2–3 cm. W celu uzyskania dobrego
ubicia zakiszanego materiału, zastosowano specjalną prasę silosującą
do napełnienia rękawów. Zastosowano rękawy o długości 75 metrów
i pojemności 350 ton. Lucernę zakiszano w jednym rękawie foliowym, który podzielono na dwa równe odcinki. W pierwszej połowie
rękawa znajdowała się zielonka bez inokulantu, natomiast w drugiej
części z konserwantem. Trawy zakiszano w dwóch rękawach po 1/3
na każdy rodzaj inokulantu i 1/3 bez środka konserwującego. Zrealizowano badania dla 8 prób kiszonek w trzech powtórzeniach dla
każdej próby, których skład był następujący: 2 próby kontrolne oznaczone symbolami: K1 zawierająca zielonkę z lucerny i K2 zielonka
z traw + 20% lucerny oraz 6 prób doświadczalnych zawierający
w swoim składzie dodatek preparatu mikrobiologicznego: D1 – zielonka z lucerny z dodatkiem Enterococcus faecium, L.plantarum,
L.casei, Pediococcus.spp. o koncentracji 1,5x109 jtk/g, D2 i D6–
zielonka z traw + 20% lucerny z dodatkiem L. plantarum, L. lactis,
Pediococcus acidolacticci o koncentracji 1x1011 jtk/g, D3– zielonka
z traw z dodatkiem Enterococcus faecium, L. plantarum, L.casei, P.acidolacticci, L. buchnerii o koncentracji 1,5x1010 jtk/g, D4– zielonka
z traw + 20% lucerny z dodatkiem Enterococcus faecium, L.plantarum, L.casei, P.spp. o koncentracji 1,5x109 jtk/g, D5– zielonka z traw
z dodatkiem E. faecium, L. plantarum, L. casei, P. acidolacticci o koncentracji 1x1011 jtk/g. Próby badano w 1, 3, 6, 10, 15, 21, 121 dniu
po zakiszeniu oraz po okresie stabilizacji tlenowej. Badanie stabilizacji tlenowej wykonano metodą pomiarów zmian temperatury i pH
w czasie przechowywania kiszonki w warunkach tlenowych w temperaturze pokojowej przez okres 11 dni [Mikołajczak 1984]. Odczyn
pH każdej badanej próby w określonym dniu był mierzony za pomocą pH– metru. W warunkach laboratoryjnych z kiszonek izolowano
grzyby pleśniowe poprzez wypłukanie ich sterylnym płynem fizjologicznym. Po przygotowaniu kolejnych rozcieńczeń wykonano posiew
powierzchniowy stosując podłoża agarowe Sabouraud i Wurz. Próbę
stanowiło 10g kiszonki, dla której wykonano po trzy powtórzenia.
133
Paulina Topolińska
Płytki Petriego z podłożem hodowlanym i inokulum inkubowano
w temperaturze 25 ºC przez 3–5 dni. Następnie izolowano czyste
kultury grzybów i ponownie inkubowano je przez 3–5 dni w temperaturze 25 ºC. Czyste kultury pleśni zidentyfikowano na podstawie
obserwacji makroskopowych i mikroskopowych. Obserwacje makroskopowe dotyczyły cech morfologicznych tj. struktury i zabarwienia
grzybni powietrznej i rewersu kolonii pleśni. Z kolei obserwacje mikroskopowe dotyczyły kształtów strzępek plechy, konidioforów oraz
konidii. W identyfikacji rodzajowej i gatunkowej grzybów posłużono
się kluczem mikologicznym [Fassatiova 1983].
Wyniki
Wyniki badań analizy mikologicznej oraz wartości pH kiszonek bez
dodatku i z dodatkiem preparatu bakteryjnego w tabeli 1. Oznaczenia
mikologiczne kiszonek wskazują na obecność grzybów pleśniowych
z rodzaju: Aspergillus, Fusarium, Mucor, Penicillium, Trichothecium. Kiszonki oznaczone symbolami K1 i K2 bez dodatku preparatu bakteryjnego charakteryzowały się: w pierwszym etapie badań skażeniem
pleśniami na poziomie od 3,3 do 5,5 log10 jtk g-1, po przeprowadzonym teście stabilizacji poziom skażenia pleśniami wynosił od 4,3
do 4,5 log 10 jtk g-1. W kiszonkach kontrolnych odczyn pH po teście
stabilizacji kształtował się na poziomie od 4,65 do 4,56, natomiast
stabilność tlenowa kiszonki wynosiła 3–4 dni. Pozytywny wpływ
dodatku preparatów stymulujących proces kiszenia zaznaczył się
w kiszonkach doświadczalnych, które charakteryzowały się: w pierwszym etapie badań skażeniem pleśniami na poziomie od 2,3 do 3,5
log 10 jtk g-1, po przeprowadzonym teście stabilizacji poziom skażenia pleśniami kształtował się na poziomie od 2,0 do 2,3 log 10 jtk g-1.
W kiszonkach doświadczalnych odczyn pH po teście stabilizacji
kształtował się na poziomie od 4,02 do 4,55, natomiast stabilność
tlenowa kiszonki wynosiła 11 dni. W kiszonce D2 zaobserwowano
po okresie stabilizacji całkowity zanik pleśni. W końcowym etapie
doświadczenia (w 121 dniu) zaobserwowano we wszystkich badanych próbach zanik aktywności grzybów pleśniowych. W pierwszych
dniach wykonywanych badań odnotowano największą aktywność
grzyba pleśniowego o nazwie Rhizopus stolonifer oraz pleśni z ro134
Mikologiczna ocena kiszonek z lucerny i traw sporządzonych z dodatkiem inokulantów...
dzaju Penicillium. Po przeprowadzonym teście stabilizacji tlenowej
zauważono w kiszonkach z wyjątkiem próby D2 występowanie grzybów pleśniowych z rodzaju Penicillium, Fusarium, Aspergillus.
Gatunek grzyba
Dzień doświadczenia
D2 – k z
D1– kitraw + 20% szonka z
lucerny
lucerny
K2 – kiszonka z traw
K1– kiszonka z lucerny
+ 20% lucerny
1
Fusarium oxysporum
3
6
10
15
21 121
Okres po stabilizacji tlenowej
Liczba log10 jtk g-1
pH po teście
stabilizacji
Próby kiszonek
Tab. 1. Grzyby pleśniowe występujące w kiszonkach: n.s.–
nie stwierdzono występowania pleśni, n.b. – nie badano próby.
n.s. n.s. n.s. n.s. n.s. n.s. n.s. 4,5
Mucor sp.
4,3 n.s. n.s. n.s. n.s. n.s n.s. n.s.
Mucor racemosus
4,3 n.s. n.s n.s. n.s. n.s. n.s. n.s.
4,65
Rhizopus stolonifer
5,5 4,5 n.s. n.s. n.s. n.s. n.s. n.s.
Penicillium chryson.s 4,3 n.s. n.s. n.s. n.s. n.s. n.s.
genum
Penicillium sp.
n.s n.s n.s. n.s. n.s. n.s. n.s. 4,5
Fusarium oxysporum
4,5 n.s. n.s. n.s. n.s. n.s. n.s. n.s.
Mucor sp.
4,3 n.s. n.s. n.s. n.s. n.s. n.s. n.s.
Mucor racemosus
n.s. n.s. n.s. n.s. n.s. n.s. n.s.
Rhizopus stolonifer 4,56 5,5 n.s. 3,3 n.s. n.s. n.s. n.s. n.s.
Penicillium chryso4,3 n.s. n.s. n.s. n.s. n.s. n.s. n.s.
genum
Penicillium sp.
n.s. n.s. n.s. n.s. n.s. 3,0 n.s. 4,3
Fusarium oxysporum 4,32 n.b. n.s. n.s. n.s. n.s. n.s. n.s. 2,0
Rhizopus stolonifer
n.b. 3,5 2,5 n.s. n.s. n.s. n.s. 2,0
Penicillium sp.
n.b. n.s. 3,3 n.s. n.s. n.s. n.s. n.s.
Aspergillus flavus 4,33 3,5 n.s. n.s.
Aspergillus niger
n.s. n.s. n.s.
Rhizopus stolonifer
3,5 n.s. n.s.
Penicillium notatum
n.s. n.s. 2,3
n.s.
n.s.
2,3
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
2,0
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
135
D6 – kiszonka z traw +
20% lucerny
D5 – kiszonka
z traw + 20%
lucerny
D4 – kiszonka z traw +
20% lucerny
D3 – kiszonka z
traw
Paulina Topolińska
Aspergillus versicolor 4,02 n.s. n.s. n.s. n.s. n.s. n.s. n.s.
Fusarium oxysporum
n.s. n.s. n.s. n.s. n.s. n.s. n.s.
Rhizopus stolonifer
n.s. n.s. n.s. 2,3 n.s. n.s. n.s.
Penicillium sp.
3,3 n.s. n.s. n.s. n.s. n.s. n.s.
Trichothecium
n.s. 3,3 n.s. n.s. n.s. n.s. n.s.
roseum
Aspergillus versicolor 4,5 n.s. n.s. n.s. n.s. n.s. 2,3 n.s.
Fusarium oxysporum
n.s. n.s. n.s. n.s. n.s. n.s. n.s.
Rhizopus stolonifer
n.s. n.s. n.s. 2,5 n.s. n.s. n.s.
Penicillium sp.
Rhizopus stolonifer
n.s.
n.s.
2,3
n.s.
n.s. n.s. n.s. n.s. n.s. n.s. n.s. 2,0
Aspergillus versicolor 4,37 n.s. n.s. n.s. n.s.
Fusarium oxysporum
n.s. n.s. n.s. n.s.
Rhizopus stolonifer
n.s. n.s. 3,3 n.s.
Penicillium notatum
n.s. n.s. 2,3 n.s.
Trichothecium
3,3 n.s. n.s. n.s.
roseum
Aspergillus niger
2,0
2,0
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
n.s.
2,3
2,0
n.s.
n.s.
n.s. n.s. n.s. n.s.
4,55 n.b. n.s. n.s. n.s. n.s. n.s. n.s. 2,0
n.b. 3,5 3,3 n.s. n.s. n.s. n.s. n.s.
Dyskusja i wnioski
Realizując pierwszy cel badawczy, oceniono stopień skażenia pleśniami
kiszonek bez dodatku oraz z dodatkiem preparatu bakteryjnego. Kiszonki kontrolne zawierały średnio 4,7 jtk. W tych kiszonkach obserwowano występowanie pleśni, co wskazywałoby na błędy popełnione
w procesie ich produkcji. Według Schneweisa [2000] wśród grzybów
pleśniowych dominują Penicillium notatum, P. roqeuforii, Aspergillus flavus i Trichothecium roseum. Analiza mikologiczna kiszonek wykazała
występowanie pleśni z rodzaju Penicillium, Aspergillus oraz Trichothecium roseum. Jednak przeprowadzone badania własne nie potwierdziły obecności Penicillium roqeuforii w próbach kiszonek. W badaniach
przeprowadzonych przez Bauera [2004] do najczęściej występujących
gatunków pleśni należą Fusarium, Aspergillus, Mucor. Uzyskane wyniki
potwierdziły obecność tych gatunków pleśni w kiszonkach. Na pod136
Mikologiczna ocena kiszonek z lucerny i traw sporządzonych z dodatkiem inokulantów...
stawie wyników badań cytowanych w literaturze [Amigot i in. 2006]
i [Maki 1996] oraz badań własnych, wiadomo, że kiszenie zielonek
z traw i lucerny z dodatkiem kultur starterowych bakterii fermentacji mlekowej, zawierających wyselekcjonowane szczepy homo i heterofermentatywnych bakterii z rodzaju Lactobacillus, Enterococcus,
Pediococcus przyczynia się do zwiększenia jakości i stabilności tlenowej kiszonek, hamuje rozwój mikroorganizmów tlenowych: bakterii,
drożdży i pleśni. Zgodnie z drugim założeniem badawczym, określono wpływ dodatku preparatów bakteryjnych na ograniczenie rozwoju zarodników pleśni podczas procesu zakiszania, a zatem obniżenie
stopnia skażenia kiszonek tą mikroflora. Podczas przeprowadzonego
testu stabilizacji tlenowej stwierdzono w kiszonkach doświadczalnych znaczny spadek występowania pleśni. Wyselekcjonowane szczepy bakterii z grupy Lactobacillus, Enterococcus, Pediococcus wchodzące
w skład kultury starterowej preparatu bakteryjnego wykazują zdolności biosyntezy enzymów poprawiających wartość pokarmową kiszonek
oraz zdolność syntezy metabolitów hamujących rozwój pleśni [O’Biren
i in. 2005], [Maki 1996], [Oude Elferink i in.1999].
Literatura
1. Amigot S., Basilico J., Fulgueria. 2006. New parameters to evaluate forage
quality. Postharvest Biology and Technology, 41: 215–224.
2. Bauer J. 2004. Mikrobiologie der Silierung. Hulsenberger Gesprache, 20:
65–72.
3. Fassatiova O. 1983. Grzyby mikroskopowe w mikrobiologii technicznej. Wydawnictwa Naukowo-Techniczne, Warszawa.
4. Grajewski J. 1995. Aktualny problem skażenia surowców i pasz przemysłowych patogenną florą grzybową i mikotoksynami. II Konferencja Naukowo-Techniczna „Jakość Pasz Przemysłowych” CLPP w Lublinie,
34–38, 5–7 Sierpień 1995.
5. Liu P. D., Yu Z., Wang K. 2009. Fermentation quality of alfalfa silages treated with additives. XVth International Silage Conference Proceedings.
Wisconsin, USA, 265–266, 27–29 July 2009.
6. Maki M. 1996. The isolation and characterisation of a heterofermentative
inoculant and its effect on silage quality and aerobic stability. Finnish
Journal of Dairy Science, 53, 173.
7. Mikołajczak J. 1984. Badania nad zakiszaniem zielonek z dodatkiem płynnych konserwantów. Rozprawy. 13, 104, ATR Bydgoszcz.
137
Paulina Topolińska
8. Oude Elferink S. J. W. H., Driehuis F., Kroomean J., Gottschal J. C., Spoestra S.F. 1999. Lactobacillus buchneri can improve the aerobic stability of
silage via a novel fermentation pathway: the aerobe degradation of lactic
acid to acetic and acid to 1,2 propanediol, Conference Proceedings The
XII th International Silage Conference, Uppsala Sweden, 266–267,
5–7 July 1999.
9. Purwin C., Minakowski D. 2007. Jakość kiszonek– kryteria oceny. Hodowca
Bydła, 5: 19–25.
10. Schneweis I. 2000. Futtermittelhygienische Untersuchungen von Silagen:
Nachweis und Vorkommen von Monacolinen, Citrinin und Mykophenolsaure.
Diss. Agr., Technische Universitat Munchen 12: 185–191.
11. Zastawny J. 1993: Wartość pokarmowa różnie konserwowanych pasz
objętościowych z użytków zielonych w świetle badań chemicznych
i zootechnicznych. Rozp. Hab.Wyd. IMUZ, 103.
mgr inż. Paulina Topolińska
Wydział Hodowli i Biologii Zwierząt
Katedra Żywienia Zwierząt i Gospodarki Paszowej
Uniwersytet Technologiczny Przyrodniczy w Bydgoszczy
ul. Mazowiecka 28, 85–084 Bydgoszcz
e-mail: [email protected]
Opiekun naukowy: Prof. dr hab. inż. Jan Mikołajczak
138
Daniel Pruchniewicz
Ludwik Żołnierz
EPISTEME
18/2013, t. 3
s. 139–146
ISSN 1895-2241
Zróżnicowanie wybranych cech
biometrycznych przetacznika
ożankowego (Veronica chamaedrys L.)
na łąkach świeżych Sudetów Środkowych
The diversity of some biometric features
of Germander Speedwell (Veronica
chamaedrys L.) growing on the mesic
meadows of the Middle Sudety Mountains
Abstrakt. Celem badań było określenie wpływu czynników siedliskowych
oraz zróżnicowanych sposobów użytkowania łąk i pastwisk z rzędu Arrhenatheretalia, na wybrane cechy biometryczne Veronica chamaedrys L. Badania
prowadzono na 37 powierzchniach badawczych ulokowanych w obrębie wybranych pasm Sudetów Środkowych. Najsilniej zróżnicowaną cechą okazała się długość pędu. Stwierdzono, że jedynie zawartość materii organicznej
w glebie wywiera istotny statystycznie wpływ na długość całkowitą pędu Veronica chamaedrys.
Słowa kluczowe: Veronica chamaedrys, biometria, łąki, czynniki siedliskowe,
użytkowanie
Summary. The aim of the study was to determine how the environmental
factors and the management of grasslands influence some biometric features of Veronica chamaedrys L. The study was carried out on 37 research
plots in some ranges of the Middle Sudety Mts. The stem length appeared to
be the most variable biometric feature. The results show that only content
of the soil organic matter has significant influence on the stem length of
Veronica chamaedrys.
Key words: Veronica chamaedrys, biometry, grassland, environmental factors,
management
139
Daniel Pruchniewicz, Ludwik Żołnierz
Wstęp
Przetacznik ożankowy (Veronica chamaedrys L.) w tradycyjnych ujęciach systematycznych zaliczany jest do rodziny trędownikowatych Scrophulariaceae [Mirek i in. 2002]. Jest to roślina wieloletnia – hemikryptofit z rozłogami, wytwarza podnoszącą się łodygę
z dwoma naprzeciwległymi rzędami włosków. Występuje w różnych
zbiorowiskach roślinnych. Poza łąkami związany jest ze zbiorowiskami okrajkowymi, zakrzewieniami, miedzami oraz obrzeżami lasów
[Oberdorfer 2001] w górach rośnie po piętro subalpejskie. Veronica
chamaedrys jest gatunkiem o wysokiej stałości występowania w zbiorowiskach łąk świeżych [Hajková i in. 2010].
Celem prowadzonych badań było określenie wpływu czynników
siedliskowych oraz sposobów użytkowania na cechy biometryczne
Veronica chamaedrys w wybranym rejonie Sudetów Środkowych.
Materiał i metody
W wyniku przeprowadzonego rekonesansu w terenie, wybrano łąki
i pastwiska z rzędu Arrhenatheretalia (łąki świeże) charakteryzujące
się silnym zróżnicowaniem czynników siedliskowych oraz sposobów
użytkowania. Wśród tych obiektów w sposób losowy wybrano łąki
i pastwiska, na których badano zmienność Veronica chamaedrys.
W ich obrębie również losowo wyznaczono 37 powierzchni badawczych o wielkości 5x5 m. Na każdej powierzchni badawczej, w oparciu o wstępne pomiary, wytypowano 5 osobników, których całkowita
długość pędu była najbardziej zbliżona do średniej dla lokalnej populacji. Po zebraniu wytypowanych osobników mierzono z dokładnością
do jednego milimetra długość części wegetatywnej pędu (mierzona od
gruntu po podstawę kwiatostanu) i długość kwiatostanu. Suma tych
odcinków określana będzie dalej terminem „długość całkowita pędu”.
Liczbę liści określano na okazach świeżych, zaś masę osobników oznaczono po wysuszeniu w temperaturze 85°C do uzyskania stałej wagi.
Z bezpośredniego sąsiedztwa każdego wziętego do pomiarów osobnika
pobierano za pomocą kwadratowej ramki o powierzchni 25 cm2 próby
nadziemnej biomasy roślinności towarzyszącej oraz zalegającej nekromasy roślinnej. Parametry topograficzne (wystawa, nachylenie stoków,
140
Zróżnicowanie wybranych cech biometrycznych przetacznika ożankowego...
wysokość hipsometryczna) określano za pomocą kompasu, klinometru
i odbiornika GPS. Na podstawie wystawy i nachylenia stoków obliczono
potencjalny roczny ładunek ciepła [McCune 2007]. W końcu października z oznaczonych powierzchni pobrano za pomocą cylindra o średnicy 10 cm i wysokości 15 cm w pięciu powtórzeniach próby gleb, do
badań właściwości fizyko-chemicznych. Analizy wykonano w laboratorium Katedry Botaniki i Ekologii Roślin Uniwersytetu Przyrodniczego
we Wrocławiu: kwasowość czynną (pH w H2O) i wymienną (pH w KCl)
oznaczono metodą potencjometryczną, pojemność wodną (maksymalną pojemność wodną wyrażoną wagowo – MPWw, maksymalną pojemność wodną wyrażoną objętościowo – MPWo, kapilarną pojemność
wodną wyrażoną wagowo – KPWw, kapilarną pojemność wodną wyrażoną objętościowo – KPWo oraz ciężar objętościowy – Ro) oznaczono
za pomocą cylinderków Kopeckiego o pojemności 100 cm3 [Drozd i in.
2002]. Skład granulometryczny oznaczono metodą areometryczną
Bouyoucosa w modyfikacji Casagrande’a i Prószyńskiego (do wydzielenia poszczególnych frakcji wykorzystano klasyfikację uziarnienia gleb
i utworów mineralnych PTG 2009), stratę żarzenia jako przybliżoną
miarę zawartości materii organicznej oznaczano wyżarzając 2 g gleby
w piecu muflowym w temperaturze 600 °C przez 6 godzin [Karczewska
i Kabała 2008]. Zawartości azotu całkowitego oznaczono zmodyfikowaną metodą Kjeldahla. Formy wymienne potasu, magnezu i wapnia
ekstrahowano 1 M octanem amonu (pH 7.0). Magnez oznaczono metodą absorpcji atomowej, na spektrometrze Varian Spectraa 200. Potas
i wapń oznaczano tym samym aparatem pracującym w trybie pomiaru
emisji. Rozpuszczalne formy fosforu oznaczono kolorymetrycznie po
ekstrakcji metodą Olsena z wykorzystaniem 0.5 M roztworu wodorowęglanu sodu o pH 8.5 [Allen 1989]. Analizy statystyczne prowadzono
z wykorzystaniem pakietu STATISTICA [StatSoft, Inc. 2011]. Normalność rozkładów zmiennych badano testem W Shapiro-Wilka. W celu
eliminacji skośności danych oraz poprawy dzięki temu jakości uzyskanego modelu [Chuchro 2011] wykorzystano przekształcenie Boxa-Coxa. Przed przystąpieniem do analizy regresji wielorakiej, w celu uzyskania jednorodności średnich i odchyleń przeprowadzono standaryzację
zmiennych. Wyeliminowano również siedliskowe zmienne kolinearne
mogące wpłynąć na wyniki dalszych obliczeń. W tym celu wykorzystano wyniki analizy składowych głównych PCA (ryc. 1). Eliminowano
141
Daniel Pruchniewicz, Ludwik Żołnierz
zmienne o słabym działaniu, kolinearne ze zmiennymi silnie działającymi. W oparciu o to kryterium usunięto wystawę, pH w KCl, gęstość
objętościową gleby – Ro, kapilarną pojemność wodną wyrażoną objętościowo – KPWo, maksymalną pojemność wodną wyrażoną wagowo –
MPWw oraz maksymalną pojemność wodną wyrażoną objętościowo –
MPWo (ryc. 1). Zmienne związane ze sposobami użytkowania, ze
względu na ich binarny charakter wprowadzono do przestrzeni ordynacyjnej w sposób pasywny.
Wyniki
Na podstawie wyników analizy składowych głównych stwierdzono,
że pierwsza oś PCA opisuje 31.47% całkowitej zmienności, wykazując silny związek ze składem granulometrycznym oraz pojemnością
wodną. Druga oś ordynacyjna tłumaczy 19.06% wariancji wykazując
silny związek z kwasowością czynną oraz formami wymiennymi wapnia, magnezu oraz potasu.
Ryc. 1. Diagram analizy składowych głównych (PCA) sporządzony dla
czynników siedliskowych. Trójkątami zaznaczono zmienne pasywne
związane ze sposobami użytkowania.
142
Zróżnicowanie wybranych cech biometrycznych przetacznika ożankowego...
W celu wybrania cechy biometrycznej najlepiej obrazującej zróżnicowanie badanego gatunku na tle czynników siedliskowych wykorzystano analizę składowych głównych (PCA) wykonaną na podstawie macierzy kowariancji. Uzyskane wartości zostały zeskalowane
do zakresu -1 do +1 (Ryc. 2). Na podstawie siły zmiennej, oraz jej
związku z pierwszą osią kanoniczną do dalszych analiz statystycznych wykorzystano wyłącznie długość całkowitą pędu osobnika, która okazała się najsilniej zróżnicowana (Ryc. 2).
Ryc. 2. Projekcja wyników analizy składowych głównych (PCA)
w przestrzeni dwóch pierwszych osi kanonicznych sporządzona dla cech
biometrycznych Veronica chamaedrys.
W kolejnym kroku analiz badano w jakim stopniu czynniki siedliskowe wpływają na badaną zmienną zależną. W tym celu wykorzystano analizę regresji wielorakiej, z wykorzystaniem metody krokowej
postępującej. Ostateczny wynik otrzymano w 6 kroku analizy (tab. 1).
Tab. 1. Podsumowanie regresji wielorakiej dla zmiennej długość całkowita
pędu Veronica chamaedrys.
β
Błąd standardowy β
Wyraz wolny
Materia organiczna
0.51
0.21
b
Błąd standardowy b
t (30)
p
0.00
0.14
0.00
1.00
0.51
0.21
2.46
0.02
143
Daniel Pruchniewicz, Ludwik Żołnierz
Na podstawie cząstkowych współczynników korelacji stwierdzono istotny statystycznie dodatni wpływ materii organicznej
(R = 0.41) na wielkość badanej cechy. W celu określenia wpływu sposobów użytkowania na długość całkowitą pędów przetacznika ożankowego obliczono wartości średnie całkowitej długości pędu dla wyróżnionych kategorii, a następnie porównano je nieparametrycznym
testem Kruskala-Wallisa (ryc. 3). Przeprowadzone obliczenia wykazały brak statystycznej istotności wpływu sposobów użytkowania na
badaną cechę biometryczną.
Ryc. 3. Wpływ sposobów użytkowania na długość całkowitą pędu
(± 1SE) Veronica chamaedrys * – M – mieszane, N – nieużytki, 2K – kośne
dwukrotne, 1K – kośne jednokrotne, O – wypas owiec, K – wypas koni.
R.N. – różnice nieistotne.
Dyskusja i podsumowanie
Przetacznik ożankowy należy do gatunków pospolicie występujących
na półkuli północnej, od piętra nizin aż po wysokogórskie regiony
alpejskie [Albach 2006]. W Europie notowany jest od zachodnich rejonów Francji i Wielkiej Brytanii, po Ural [Hultén i Fries 1986]. Jest
to gatunek charakteryzujący się szerokim spektrum ekologicznym.
Spotykany jest na glebach ilastych, żyznych, bogatych w humus, od
świeżych po średnio suche, od zasadowych po obojętne [Oberdorfer
2001]. Przetacznik ożankowy należy to gatunków tolerujących pół144
Zróżnicowanie wybranych cech biometrycznych przetacznika ożankowego...
cień [Ellenberg i in. 1992] stąd występuje na łąkach sporadycznie
mulczowanych [Gaisler i in. 2004] lub wyłączonych z użytkowania
[Gaisler i in. 2004, Hejcman i in. 2005]. W badaniach prowadzonych
przez Hejcmana i in. [2005] stwierdzono negatywny wpływ wypasu
na pokrycie terenu przez opisywany gatunek.
Spośród badanych cech biometrycznych najsilniej zróżnicowana
okazała się długość całkowita pędów badanych osobników i dlatego
cecha ta przyjęta została jako wskaźnik kondycji osobników przetacznika ożankowego. Wyniki analiz wskazują jednak, że statystycznie
istotnie i dodatnio wpływa na nią tylko zawartość materii organicznej w glebie. Nie stwierdzono wpływu pozostałych czynników siedliskowych, konkurencji ze strony roślinności towarzyszącej, ani sposobów użytkowania łąk i pastwisk na kondycję badanego gatunku.
W porównaniu z innymi badanymi na tych samych łąkach i pastwiskach gatunkami [Pruchniewicz npbl.] przetacznik ożankowy najmniej specyficznie reaguje na zmienność czynników siedliskowych
i sposobów użytkowania, dlatego uznano, że nie nadaje się do wykorzystania jako gatunek wskaźnikowy w tym zakresie.
Bibliografia
1. Albach D. C. 2006. Evolution of Veronica (Plantaginaceae) on the Balkan Peninsula. Phytologia Balcanica 12 (2): 231–244.
2. Allen S. E. 1989. Chemical Analysis of Ecological Materials. Second Edition,
Blackwell Scientific Publications.
3. Chuchro M. 2011. Analiza danych środowiskowych metodami eksploracji danych. Studia Informatica vol. 32, numer 2A (96): 417–428.
4. Drozd J., Licznar M., Licznar S.E., Weber J. 2002. Gleboznawstwo z elementami mineralogii i petrografii. Wydawnictwo Akademii Rolniczej we
Wrocławiu, wydanie III.
5. Ellenberg H., Weber H. E., Düll R., Wirth V., Werner W., Paulißen D. 1992.
Zeigerwerte von Pflanzen in Mitteleuropa, Scripta Geobotanica 18.
6. Gaisler J., Hejcman M., Pavlů V. 2004. Effect of different mulching and cutting regimes on the vegetation of upland meadow. Plant Soil Environ. 50 (7): 324–331.
7. Hájková P., Hájek M., Blažková D., Kucĕra T., Chytrý M., Řezníčková M.,
Šumberová K., Černý T., Novák J., Simonová D. 2010. Louky a mezofilní
pastviny (Molinio-Arrhenatheretea). [W:] Chytrý M. (red.), Vegetace České
republiky 1. Travinná a keříčková vegetace. Academia, Praha: 165–319.
145
Daniel Pruchniewicz, Ludwik Żołnierz
8. Hejcman M., Auf D., Gaisler J. 2005. Year-round cattle grazing as an alternative management of hay meadows in the Giant Mts (Krkonoše, Karkonosze), the Czech Republic. Ekológia (Bratislava) vol. 24, No. 4: 419–429.
9. Hultén E., Fries M. 1986. Atlas of North European Vascular Plants. North of
the tropic of cancer. Koeltz Scientific Books II.
10. Karczewska A., Kabała C. 2008. Metodyka analiz laboratoryjnych gleb
i roślin. Uniwersytet Przyrodniczy we Wrocławiu, Instytut Nauk o Glebie o Ochrony Środowiska, Zakład Ochrony Środowiska Wydanie 4,
Wrocław.
11. Klasyfikacja Uziarnienia Gleb i Utworów Mineralnych PTG. 2009. Roczniki Gleboznawcze 60, 2: 5–16.
12. McCune B. 2007. Improved estimates of incident radiation and heat load
using non-parametric regression against topographic variables. Journal of
Vegetation Science 18: 751–754.
13. Mirek Z., Piękoś-Mirkowa H., Zając A., Zając M. 2002. Flowering plants
and pteridophytes of Poland. A checklist. W. Szafer Institute of Botany,
Polish Academy of Sciences, Kraków.
14. Oberdorfer E. 2001. Pflanzensoziologische Exkursionsflora: Für Deutschland und angrenzende Gebiete. 8 Auflage.
15. StatSoft, Inc. (2011). STATISTICA (data analysis software system), version 10. www.statsoft.com.
Daniel Pruchniewicz
Katedra Botaniki i Ekologii Roślin
Uniwersytet Przyrodniczy we Wrocławiu
pl. Grunwaldzki 24a, 50–363 Wrocław
e-mail: [email protected]
Promotor: dr hab. Ludwik Żołnierz
Zadanie współfinansowane ze środków Unii Europejskiej w ramach Europejskiego Funduszu Społecznego
146
Katarzyna Suprewicz
Iwona Kozikowska
Magdalena Chrobaczyńska-Dyląg
EPISTEME
18/2013, t. 3
s. 147-154
ISSN 1895-2241
KUMULACJA RTĘCI W ŁOŻYSKU, OWODNI ORAZ
WE KRWI PĘPOWINOWEJ NOWORODKÓW
W POSZCZEGÓLNYCH GRUPACH WIEKOWYCH
KOBIET Z GÓRNEGO ŚLĄSKA
ACCUMULATIOMN OF MERCURY IN PLACENTA,
AMNION AND CORD BLOOD OF NEWBORN IN EACH
AGE GROUP WOMEN FROM UPPER SILESIAN
REGION IN POLAND
Abstrakt. Celem badań było określenie zawartości rtęci w łożysku, błonie płodowej kobiet należących do trzech grup wiekowych oraz we krwi pępowinowej
noworodków. Materiał biologiczny pobrany od 40 kobiet z Kliniki Położnictwa
i Ginekologii w Katowicach. Od kobiet pobrano część brzeżną łożyska, część centralną
łożyska, błonę płodową (owodnię) oraz krew pępowinową noworodków. Kobiety podzielono na trzy grupy wiekowe: I grupa (18–24 lata), II grupa (25–34 lata), III grupa (35–40
lat). Koncentrację rtęci w łożysku, owodni i we krwi pępowinowej określono metodą
zimnych par (CV-AAS). W wyniku przeprowadzonych badań stwierdzono obecność rtęci
we wszystkich poddanych analizie próbkach. Najmniejsze zawartości rtęci zanotowano we krwi pępowinowej noworodków, których matki należały do III grupy wiekowej
(0,002784µg∙g-1 m.m). Największą zawartość rtęci zanotowano w brzeżnej części łożyska
u kobiet należących do II grupy wiekowej (0,013838 µg∙g-1 m.m). Występują statystycznie istotne różnice w średniej zawartości rtęci w brzeżnej części łożyska między II a III
grupą wiekową kobiet (p=0,004612) Zmniejszona zawartość rtęci we krwi pępowinowej może świadczyć o jej niecałkowitym przenikaniu przez barierę łożyskową. Istnieje
prawdopodobieństwo, że kobiety starsze unikają wystawienia organizmu na działanie
czynników szkodliwych.
Słowa kluczowe: rtęć, metale ciężkie, łożysko, krew pępowinowa, owodnia
Abstract. The aim of the study was to determine the level of mercury in different
parts of the placenta, fetal membranes of women belonging to three age groups and
newborn cord blood. The study material was collected from 40 women from the Department of Obstetrics and Gynecology in Katowice. The women’s marginal and central parts of the placenta, fetal membranes (amnion) and coord blood were taken.
Women were divided into three age group: group I (18–24 years), group II (25–34
years), group III (35–40 years).The concentration of mercury was determined by cold
vapor (CV-AAS). In the study presence of mercury was detected. The lowest levels
147
Katarzyna Suprewicz, Iwona Kozikowska, Magdalena Chrobaczyńska-Dyląg
of mercury in cord blood was observed newborns whose mothers belonged to the
age group III (0,002784µg∙g-1 m.m). The highest mercury content was observed in
the marginal part of placenta in women belonging to the age group II (0,013838
µg∙g-1 m.m). There are statistically significant differences in the average mercury content in the marginal parts of the bearing between the II and III women’s age group
(p = 0.004612). Reduced mercury content in cord blood may be indicative of the incomplete penetration of the placental barrier. It is likely that older women avoid lifetime exposure to harmful factors.
Key words: mercury, heavy metals, placenta, cord blood, amnion
Wstęp
Rtęć jest szeroko rozpowszechniona w środowisku. Stosowana w amalgamatowych wypełnieniach dentystycznych, świetlówkach, w rolnictwie, jako
środek grzybobójczy [Grigg, 2004]. Najbardziej niebezpieczną formą rtęci
jest metylortęć, która dostaje się do organizmu człowieka wraz ze spożywaniem owoców morza [Myers i in. 2003]. Uszkadza membrany komórkowe,
osłabia syntezę białek, system nerwowy i z łatwością pokonuje barierę łożyskową [Reus i in. 2003]. Płód jest bardzo narażony na toksyczne działanie
rtęci [Weil i in. 2005] gdyż niszczy dojrzewanie komórek mózgowych [Lutz
i in, 1996]. Ekspozycja na rtęć jest szczególnie ważna w przypadku kobiet
ciężarnych gdyż nie istnieje żadna bariera, która przeciwdziałaby transmisji
rtęci z organizmu matki do organizmu płodu [Grandjean in. 1998]. Rozwój
dzieci, których matki podczas ciąży były narażone na ekspozycję rtęci może
być wolniejszy. Zazwyczaj mają problemy z chodzeniem, mówieniem. Poważniejszymi skutkami są uszkodzenia mózgu z upośledzeniem umysłowym, brak koordynacji ruchów. Innymi ciężkimi niepożądanymi objawami
obserwowanymi jest ślepota, mimowolne skurcze mięśni i drgawki, osłabienie mięśni i niemożność mówienia. Rtęć powoduje porażenie mózgowe,
drgawki, upośledzenie umysłowe, uszkodzenie mózgu [Myers i in. 2003]
oraz problemy sercowo-naczyniowe [Karagas i in. 2012].
Cel pracy
Celem badań było określenie zawartości rtęci w różnych częściach łożyska, błonie płodowej kobiet należących do trzech grup wiekowych oraz
we krwi pępowinowej noworodków.
Materiał i metody
Materiał biologiczny (brzeżna część łożyska, centralna część łożyska,
błona płodowa owodnia), krew pępowinowa) został pobrany zaraz po
porodzie z Kliniki Położnictwa i Ginekologii w Katowicach. Łącznie
148
Kumulacja rtęci w łożysku, owodni oraz we krwi pępowinowej noworodków...
uzyskano i przebadano 140 próbek tkanek (n=140) pochodzących od
40 kobiet. Kobiety zostały zakwalifikowane do trzech grup badawczych
należących do różnych grup wiekowych: I grupa wiekowa (18–24 lata),
II grupa wiekowa (25–34 lata), III grupa wiekowa (35–40 lat). Komisja
Bioetyczna wyraziła zgodę na przeprowadzenie ankiet wśród pacjentek
(No. 48/KBL/OIL / 2010 of 7 May 2010).
Koncentrację rtęci w łożysku, owodni i we krwi pępowinowej określono metodą zimnych par (CV-AAS) z wykorzystaniem analizatora rtęci MA-2.Wyniki pomiarów wyrażono w mikrogramach na gram mokrej
masy (µg∙g-1 m.m). Uzyskane dane opracowano za pomocą pakietu Statistica 9.0.
Wyniki
W wyniku przeprowadzonych badań stwierdzono obecność rtęci we
wszystkich poddanych analizie próbkach (ryc. 1, 2, 3, 4, tab. 1). Najmniejszą zawartość rtęci zanotowano we krwi pępowinowej noworodków,
których matki należały do III grupy wiekowej (0,002784 µg∙g-1 m.m).
Największą zawartość rtęci zaobserwowano w brzeżnej części łożyska
u kobiet należących do II grupy wiekowej (.0,013838 µg∙g-1 m.m).
Ryc. 1. Średnia zawartość Hg w centralnej części łożyska.
Ryc. 2. Średnia zawartość Hg w brzeżnej części łożyska.
149
Katarzyna Suprewicz, Iwona Kozikowska, Magdalena Chrobaczyńska-Dyląg
Ryc. 3. Średnia zawartość Hg w błonie płodowej.
Ryc. 4. Średnia zawartość Hg we krwi pępowinowej.
Ryc.5. Średnia zawartość Hg w A, B, C, D.
W celu określenia istotnych różnic średniej zawartości rtęci w badanych grupach wiekowych oraz w poszczególnych częściach łożyska,
błonie płodowej oraz we krwi pępowinowej wykonano test nieparametryczny. Przyjęto poziom istności p≤0,05. W wyniku przeprowadzonego testu stwierdzono istnienie statystycznie istotnych różnic w średniej
zawartości rtęci pomiędzy II a III grupą wiekową w centralnej części łożys150
Kumulacja rtęci w łożysku, owodni oraz we krwi pępowinowej noworodków...
ka (p=0,004612) (ryc. 1.). Istnienie statystycznie istotnych różnice w średniej zawartości Hg zaobserwowano pomiędzy centralną częścią łożyska
a krwią pępowinową (p=0,0000), brzeżną częścią łożyska a krwią pępowinową (p=0,0000), błoną płodową a krwią pępowinową (p=0,0000) w II
grupie wiekowej kobiet (ryc.5. tab. 1).
0,006000
0,006300
0,006100
0,002600
0,019700
0,016930
0,019450
0,011400
0,49459
0,28198
0,96377
0,40946
24 0,013838a
24 0,013759b
24 0,012211c
24 0,004251a,b,c
0,002070
0,001376
0,001321
0,000497
0,004560
0,005000
0,003400
0,001633
0,051567
0,031167
0,027150
0,010060
0,00002
0,18234
0,15052
0,00697
P=0,0000
8
8
8
8
0,001509
0,001105
0,001700
0,000645
0,000200
0,000000
0,000000
0,001660
0,014430
0,009550
0,014200
0,007200
0,98515
0,72471
0,77691
0,00227
0,007295
0,005618
0,007112
0,002937
Wielokrotne
porównanie
średnich rang
0,002211
0,001759
0,001882
0,001306
P=0,0573
Test KruscalaWallisa
Test ShapiroWilka
0,011748
0,010640
0,012717
0,005773
P<0,05
P= 0,0597
Max
A
B
C
D
Min
N
25–34
A
B
C
D
Standar. Błąd
Badana tkanka
6
6
6
6
Średnia
Wiek kobiet
18–24
A
B
C
D
35–40
Tab.1. Całkowita koncentracja rtęci w poszczególnych częściach łożyska (A,B),
błonie płodowej (C) kobiet oraz we krwi pępowinowej noworodków (D).
Dyskusja
Łożysko ludzkie jest narażone na działalnie czynników znajdujących się
w środowisku. W odniesieniu do metali toksycznych, łożysko zachowuje
się, jako podwójny biomarker oceny zdrowia matki i płodu [Iyengar i Rapp,
2001]. Rtęć jest naturalnie występującym elementem w przyrodzie, lecz
antropologiczna działalność znacznie przyspiesza jej przedostawanie się
do środowiska. Metylortęć gromadzi się w środowisku morskim, gdzie
kumuluje się w tkankach zwierzęcych. Dostarczana jest do organizmu
wraz z pożywieniem. Spożycie ryb jest głównym źródłem narażenia
na metylortęć ludzi na całym świecie [Sunderland 2007]. Warto jednak podkreślić, że spożywanie ryb dostarcza ważnych składników
odżywczych, korzystnych dla wczesnego rozwoju mózgu oraz układu
krążenia [Mozaffarian i Rimm 2006]. Związek pomiędzy spożywaniem
ryb i owoców morza przez kobiety ciężarne a neurotoksycznym narażeniem płodu po raz pierwszy zauważono w roku 1950 wraz ze zdiagnozowaniem choroby Minamata.
151
Katarzyna Suprewicz, Iwona Kozikowska, Magdalena Chrobaczyńska-Dyląg
Nasilenie choroby spowodowane było zanieczyszczeniem zbiorników
wodnych ściekami przemysłowymi, które zawierały w swoim składzie
związki rtęci. Objawy kliniczne choroby uzależnione są od ilości nagromadzonej w organizmie rtęci. Przy zawartości ok. 25 mg metylortęci w
organizmie dochodzi do mrowienia warg i języka, mrowienia kończyn
zaburzenia równowagi (55 mg), zaburzenie mowy (90 mg), zaburzenia
słuchu (170 mg). Dawka śmiertelna przekracza 170 mg. Toksyczny próg
rtęci dla płodu określony przez US EPA (United States Environmental
Protection Agency) wynosi 0,1 µg∙g-1 na dzień [Counter i Buchanon, 2004].
Wyniki badań z Górnego Śląska wskazują, że rozkład rtęci
w różnych częściach łożyska, owodni oraz we krwi pępowinowej związany
jest z wiekiem kobiet. Najwyższy poziom zawartości rtęci w owodni oraz
we krwi pępowinowej odnotowano w I grupie wiekowej (18–24 lata).
Łożysko młodych matek nie jest dobrą barierą gdyż Hg rtęć łatwiej przechodzi przez barierę łożyskową do owodni a dalej przez krew pępowinową do płodu potencjalnie powodując negatywne skutki rozwojowe.
Najmniej rtęci akumuluje się w tkankach pochodzących od starszych kobiet (35-40 lat), co może świadczyć o większej świadomości tych kobiet
o toksycznym działaniu Hg. Koncentracja rtęci jest najwyższa w łożysku
we wszystkich grupach wiekowych kobiet. Świadczy to o niecałkowitym
przenikaniu toksycznego związku przez barierę łożyskową [Corbitt i in.
2011] oraz o pełnieniu przez łożysko funkcji ochronnej.
Badania przeprowadzone przez Hubermont i in. [1978] na wsi
w Belgii wykazały, że poziom rtęci w próbkach krwi pępowinowej od
noworodków był wyższy niż poziom rtęci we krwi matki i łożyska. W badaniach wykonanych na Górnym Śląsku zaobserwowano odmienne
wyniki. Najwyższy poziom rtęci zaobserwowano w badanych częściach
łożyska oraz w owodni kobiet, najniższy zaś poziom zanotowano we krwi
pępowinowej noworodków. Wyniki te potwierdzają badania prowadzone
przez Tsuchiya in. [1984] przeprowadzone w mieście Nagoya w Japoni.
Najwyższy poziomy Hg obserwowano w łożysku, niższy poziom we krwi
pępowinowej. Organiczna rtęć, stosowana np. w nawozach, ma większą
zdolność przenikania przez łożysko [Mansour i in. 1973], co wyjaśnia,
dlaczego ciężarne kobiety z obszarów wiejskich były bardziej narażone
na jego wpływem. Śląsk skąd kobiety pochodziły, to region przemysłowy,
bogaty w zasoby naturalne, gęsto zaludniony. Niezależnie od tego, nasze
badania nie wykazały wpływu miejsca zamieszkania na akumulację rtęci
w łożysku, owodni oraz we krwi pępowinowej kobiet.
Dzieci są najbardziej narażone na działanie toksycznych związków
już od okresu płodowego. Ryzyko uszkodzenia ich tkanek jest dużo
wyższy niż dorosłego człowieka (Goldman i in. 2001). Kobiety w wieku
rozrodczym, kobiety w ciąży oraz karmiące piersią, rozwijające się należą
152
Kumulacja rtęci w łożysku, owodni oraz we krwi pępowinowej noworodków...
do najbardziej zagrożonych, ponieważ mózg jest szczególnie wrażliwe na
działanie metylortęci (Mahaffey i in. 2004).
Różnice w stężeniu rtęci w łożysku, owodni oraz we krwi pępowinowe może być spowodowana czynnikami społecznymi, stylem życia
oraz dietą Ponadto palenie papierosów, spożywanie alkoholu oraz ilość
przebytych ciąż może odgrywać istotną rolę w akumulacji i dystrybucji
toksycznych metali. Ważne jest by dzieci oraz kobiety należące do grupy
ryzyka unikały kontaktu ze źródłem narażenia.
Wnioski
Łożysko błona płodowa oraz krew pępowinowa mogą odgrywać ważną
rolę w biomonitoringu rtęci w środowisku.
Zawartość rtęci nie jest równomierna w badanych tkankach.
Zmniejszona zawartość rtęci we krwi pępowinowej może świadczyć o jej
niecałkowitym przenikaniu przez barierę łożyskową do płodu. Łożysko
ochrania rozwijający się zarodek przed niekorzystnym działaniem
toksycznego ksenobiotyku.
Dystrybucja rtęci w poszczególnych grupach wiekowych nie jest
taka sama. Najmniejszą zawartość Hg zaobserwowano u kobiet należących do III grypy wiekowej. Wraz z wiekiem może się zwiększać
świadomość kobiet na skutki działania związków toksycznych. Istnieje
prawdopodobieństwo, że kobiety starsze unikają wystawienia organizmu na działanie czynników szkodliwych, które mogłyby w niekorzystny
sposób wpływać na rozwój płodu.
Literatura
Corbitt, E. S., D. J. Jacob, C. D. Holmes, D. G. Streets, and E. M. Sunderland.
2011. Global source-receptor relationships for mercury deposition under present-day and 2050 emissions scenarios. Environmental Science & Technology
45: 10477-10484.
Counter S. A., Buchanon L. H. 2004. Mercury exposure in children: a review.
Toxicol Appl Phamacol 198: 209–30.
Goldman L. R., Shannon M. W. 2001. Committee on Environmental Health.
Technical report: mercury in the environment: implications for pediatricians.
Pediatrics. 108: 197–205.
Grandjean P., Weihe P., White R., Debes F. 1998. Cognitive performance of children
prenatally exposed to ‘safe’ levels of methylmercury. Environ Res, 21: 165–72.
Grigg J. 2004. Environmental toxins, their impact on children’s health. Arch Dis
Child. 89: 244–50.
Hubermont G., Buchet J. P., Roels H., Lauwerys R. 1978. Placental transfer of
lead, mercury and cadmium in women in a rural area. Intern Arch Occup
Environ Health (41): 117–124.
153
Katarzyna Suprewicz, Iwona Kozikowska, Magdalena Chrobaczyńska-Dyląg
Iyengar G. V., Rapp A. 2001. Human placenta as a ‘dual’ biomarker for monitoring
fetal and maternal environment with special reference to potentially toxic trace
elements. Part 3: Toxic trace elements in placenta and placenta as a biomarker
for these elements. Sci Total Environ. 280(1-3): 221–238.
Karagas, M. R., A. L. Choi, E. Oken, M. Horvat, R. Schoeny, E. Kamai, W. Cowell,
P. Grandjean, and S. Korrick. 2012. Evidence on the human health effects of
low level methylmercury exposure. Environmental Health Perspectives 120:
799-806.
Lutz E., Lind B., Herin P., Krakau I., Bui T. H.,Vahter M. 1996. Concentrations of
mercury, cadmium, and lead in brain and kidney of second trimester fetuses and
infants. J. Trace Elem Med Biol, 10: 61–7.
Mahaffey, K. R., R. P. Clickner, and C. C. Bodurow. 2004. Blood organic mercury and dietary mercury intake: National Health and Nutrition Examination
Survey, 1999 and 2000. Environmental Health Perspectives 112: 562-570.
Mansour M. M., Dyer N. C., Hoffman L. H., Schulert A. R., Brill A. B. 1973.
Maternal-fetal transfer of organic and inorganic mercury via placenta and milk.
Environ Res (6): 479–484.
Mozaffarian, D., and E.B. Rimm. 2006. Fish intake, contaminants, and human
health: evaluating the risks and the benefits. Journal of the American Medical
Association 296: 1885–1899.
Myers G. J., Davidson P. W., Cox C. 2003. Prenatal methylmercury exposure from
ocean fish consumption in the Seychelles child development study. Lancet, 361:
1686–92.
Reus I. S., Bando I., Andres D., Cascales M. 2003. Relationship between expression
of HSP70 and metallothionein and oxidative stress during mercury chloride induced acute liver injury in rats. J. Biochem Mol Toxicol, 17: 161–8.
Sunderland, E. M. 2007. Mercury exposure from domestic and imported estuarine
and marine fish in the United States seafood market. Environmental Health
Perspectives 115: 235–242.
Tsuchiya H., Mitani K., Kodama K., Nakata T. (1984) Placental transfer of heavy
metals in normal pregnant Japanese women. Arch Environ Health (1): 11-17
Weil M., Bressler J., Parsons P., Bolla K., Glass T., Schwartz B. 2005. Blood mercury levels and neurobehavioral function. JAMA, 293: 1875–82.
mgr Katarzyna Suprewicz, mgr Kozikowska Iwona
mgr Magdalena Chrobaczyńska-Dyląg
Zakład Zoologii Kręgowców i Biologii Człowieka
Instytut Biologii
Podbrzezie 3, 31-054 Kraków
tel. 661-700-582
e-mail: [email protected]
Opiekun naukowy: prof. nadzw. dr hab. Robert Stawarz
154
B. OCHRONA ŚRODOWISKA
Paulina Drożyner, Andrzej Klasa
Krystyna A. Skibniewska, Baryga Andrzej
EPISTEME
18/2013, t. 3
s. 157–163
ISSN 1895-2241
STUDIA NAD UTYLIZACJĄ ODCIEKU
PO PRODUKCJI BIOGAZU
STUDIES ON UTILIZATION
OF EFFLUENCE AFTER BIOGAS
Abstrakt. Celem badań było opracowanie metody zagospodarowania odcieku
po produkcji biogazu z wysłodków buraczanych (WB) oraz glonów (ZG). Doświadczenie przeprowadzono w latach 2010 i 2011 polegało na nawadnianiu
sadzonek wierzby energetycznej Salix viminalis wodą z dodatkiem odcieku
zawierającej określoną dawkę azotu. W trakcie doświadczenia rośliny mierzono, a po zbiorze zważono, wysuszono i oznaczono zawartość azotu. Rośliny
dobrze tolerowały zastosowane dawki odcieku. Stwierdzono większą przyswajalność azotu przez rośliny podlewane odciekiem ZG niż WB. Rośliny nawożone odciekiem ZG zawierały średnio więcej azotu oraz charakteryzowały
się większym przyrostem masy. Wykazano, że nawożenie wierzby odciekiem
ZG jest dobrą metodą jego zagospodarowania, pozwalającą na unieszkodliwienie zawartego w nim azotu bez negatywnych skutków dla środowiska.
Słowa kluczowe: odcieki pofermentacyjne, wierzba energetyczna, Salix viminalis
Summary. The aim of the work was to determine influence of irrigation
with addition of effluents after biogas production from beet pulp (WB) and
algae (ZG) on growth of dedicated willow for energy. In 2010 and 2011 bioenergy willow (Salix viminalis) cuttings grown in cold greenhouse were watered once a week with addition of various portion of effluent. The plants
growth was monitored; after harvesting the plants were weight, dried and
nitrogen content was determined. The plants tolerated very well the effluent doses. Better availability for nitrogen by plants irrigated with ZG addition was found; these plants contained more nitrogen and showed higher
biomass accumulation. It has been found that watering the energetic willow
with the effluent addition is a proper method to utilize the waste without
negative effects to the soil environment.
Key words: post fermentation effluents, nitrogen, bioenergy willow, Salix viminalis
157
Paulina Drożyner, Andrzej Klasa, Krystyna A. Skibniewska, Baryga Andrzej
Wstęp
Intensywny rozwój nowych technologii oraz przemysłu zwiększył
zapotrzebowanie na energię przy jednocześnie rosnącym zainteresowaniu ochroną środowiska naturalnego (Acaroglu, Aksoy 2005).
Skutkiem tej sytuacji jest rozwój technologii produkcji energii ze
źródeł odnawialnych, czego przykładem jest fermentacja metanowa
wytwarzania biogazu z biomasy (Frison i in. 2013). Jednak pojawia
się pytanie, co zrobić z odciekami poprodukcyjnymi. Problemem
w sposobie ich zagospodarowania jest duża zawartość azotu, która
w przykładowym odcieku pofermentacyjnym z wysłodków buraczanych w polskiej cukrowni kształtuje się na poziomie 600 mg N
× dm-3 (dane własne). Z powodu tak wysokiej zawartości odciek ten
nie może służyć do nawożenia upraw rolniczych, ponieważ w wyniku
spływu powierzchniowego ładunek azotu trafiałby do wód gruntowych, a następnie do rzek i jezior (Janssen 2001). Skutkowałoby to
przyspieszoną eutrofizacją zbiorników wodnych oraz powodowało
zagrożenie zdrowia wielu ludzi poprzez zwiększoną zawartość azotanów w wodzie (Saunders i Kalff 2001). Eutrofizacja jest jednym
z głównych powodów pogarszania się stanu wód w jeziorach oraz jedną z ważnych przyczyn ich całkowitego zaniku (Padisak i Reynolds
1998, Qin 2009). Jej skutki bywają widoczne natychmiastowo, głównie w sytuacjach kiedy dochodzi do przekroczenia stanu równowagi
jednego z parametrów fizyko – chemicznych w jeziorze (Istvanovics
i wsp. 2007).
Należy również rozważyć skutki zrzutu ścieków do kanalizacji,
a tym samym dostarczenie go do oczyszczalni ścieków. Jednak nadmiar azotu może powodować gwałtowny przyrost osadu czynnego
nadmiernego, co dalej może prowadzić do problemów związanych
z zagospodarowaniem go (Bohodziewicz i in. 2011).
Problemem zagospodarowania niebezpiecznego dla środowiska
odcieku po produkcji biogazu podjęli naukowcy z Katedry Podstaw
Bezpieczeństwa UWM w Olsztynie. Opierając się na licznych pracach
m.in. Białowca i in. (2012) wykazujących duży potencjał w pobieraniu azotu przez wierzbę energetyczną, podjęto badania nad wykorzystaniem wierzby Salix viminalis do utylizacji odcieków pofermentacyjnych (Skibniewska i in. 2012, Wojtkowiak i in. 2012). Wierzby
158
Studia nad utylizacją odcieku po produkcji biogazu
z gatunku Salix są także wykorzystywane w innych celach mających
chronić środowisko naturalne np. oczyszczanie ścieków (Mant i wsp.
2003), fitoremediacja (Mleczek i in. 2010), unieszkodliwiania osadów ściekowych (Obarska – Pempkowiak i Kołecka 2005) czy oczyszczanie zrzutów wodnych ze stawów hodowlanych (Fillion i in. 2009).
Celem doświadczenia było określenie wpływu dodatku odcieku pofermentacyjnego do wody, którą stosowano do nawadniania wierzby
energetycznej.
Materiał i metody
Materiał: w doświadczeniu wykorzystano odcieki po produkcji biogazu metodą fermentacji metanowej. W 2010 r. odciek pochodził
z fermentatora zasilanego masą glonową – Chlorella sp. (w przewadze ok. 80–90%) i Scenedesmus sp. i został dostarczony z instalacji
doświadczalnej WOŚiR UWM w Olsztynie. Odciek ten zawierał ok.
300 mg N × dm-3. W 2011 r. zastosowano dodatek ciekłej pozostałości po fermentacji wysłodków buraczanych oraz innych odpadów
organicznych powstających w cukrowniach, metodą ciągłą w instalacji doświadczalnej pracującej od 2008 w Oddziale Cukrownictwa,
Instytutu Biotechnologii Przemysłu Rono Spożywczego w Lesznie.
Odciek zawierał ok. 600 mg N × dm-3.
Opis doświadczenia: w hali wegetacyjnej Uniwersytetu Warmińsko – Mazurskiego w Olsztynie. przeprowadzono w latach 2010
i 2011 doświadczenie wazonowe z wykorzystaniem 40 sadzonek
wierzby energetycznej (Salix viminalis), podzielonych na 5 grup po
4 wazony, po 2 sadzonki w każdym wazonie. Po upływie 60 dni od posadzenia, rośliny przez 10 tygodni podlewano raz w tygodniu wodą
z dodatkiem odcieku zawierającego: 0,0 mg N/wazon, 25,0 mg N/wazon, 50,0 mg N/wazon, 75,0 mg N/wazon oraz 100,0 mg N/wazon.
Metodyka: w trakcie doświadczenia mierzono przyrost wysokości roślin oraz ich średnicy na wysokości 3 cm łodygi za pomocą
suwmiarki elektronicznej. Po zakończeniu doświadczenia w pozyskanych roślinach oddzielono liście od łodyg i każdą z frakcji zważono
oddzielnie. Następnie materiał wysuszono w temperaturze ok. 70oC
i zmielono w młynku laboratoryjnym z sitem o średnicy oczek 1 mm.
Zawartość azotu w materiale roślinnym oznaczono metodą Kjelda159
Paulina Drożyner, Andrzej Klasa, Krystyna A. Skibniewska, Baryga Andrzej
ha po mineralizacji w kwasie siarkowym (VI) z dodatkiem nadtlenku
wodoru.
Analiza statystyczna: została wykonana w programie WINSTAT
i obejmowały analizę wariancji.
Wyniki i dyskusja
Analiza statystyczna nie wykazała różnic (p=0,376 przy a=0,05) pomiędzy wysokością i suchą masą roślin (p=0,2491 przy a=0,05) nawadnianych z dodatkiem odcieków różnego pochodzenia, natomiast
wykazano znaczący wpływ na zawartość azotu w roślinach. Rośliny
podlewane odciekiem uzyskanym w procesie fermentacji alg skumulowały znacznie większe (około dwukrotnie) ilości azotu (rys. 1A i B).
W roku 2010 największy przyrost suchej masy oraz pobranie azotu
odnotowano przy zawartości odcieku 75 mg N/wazon, za to w roku
2011 obie te wartości osiągnęły swoje maksimum przy najwyższej
dawce azotu w odcieku przy rosnącej linii trendu.
B
1400,00
1200,00
1000,00
800,00
600,00
400,00
200,00
0,00
0
25
50
75
100
Pobranie N (mg/wazon)
Pobranie N (mg/wazon)
A
600,00
500,00
400,00
300,00
200,00
100,00
0,00
0
Dawka nawozu N (mg/wazon)
50
75
100
D
Sucha masa roœlin (g)
Sucha masa roœlin (g)
C
25
Dawka nawozu N (mg/wazon)
120,00
100,00
80,00
60,00
40,00
20,00
0,00
0
25
50
75
100
Dawka nawozu N (mg/wazon)
100,00
80,00
60,00
40,00
20,00
0,00
0
25
50
75
100
Dawka nawozu N (mg/wazon)
Ryc. 1. Zależność ilości pobranego azotu od dawki azotowej w nawozie
w roku 2010 (A) i 2011 (B) oraz suchej masy roślin od dawki azotowej
w nawozie w roku 2010 (C) i 2011 (D).
160
Studia nad utylizacją odcieku po produkcji biogazu
Przeprowadzone badania cechują się innowacyjnością, dlatego
też nie ma wielu materiałów do porównań. Podobne badania zostały
opisane przez Marlera i in. (2001), jednak dotyczyły one innego gatunku wierzby, krótszy był także czas uprawy roślin. Zmierzona tam
wysokość i sucha masa była zdecydowanie niższa od uzyskanej w niniejszym doświadczeniu, jednak proporcje wyników w zależności od
dawki azotu były zbliżone do tych z 2011 roku. Z kolei Aronsson i in.
(2000) opisali doświadczenie polowe mające na celu określenie wpływu wielkości zawartości azotu w płynnym nawozie na wody gruntowe. Wykazano, że poprzez rozbudowany system korzeniowy wierzba
jest w stanie zaabsorbować na tyle dużą ilość azotu, żeby nie zagrażał
on wodom gruntowym. Daje to szanse na przeniesienie obecnego badania na warunki polowe, bez strat dla stanu wód gruntowych.
Wnioski
1. Wszystkie rośliny dobrze tolerowały nawożenie odciekiem pofermentacyjnym, skutkując większym przyrostem roślin w porównaniu
do grupy kontrolnej.
2. Rośliny podlewane odciekiem uzyskanym w procesie fermentacji alg skumulowały znacznie większe (około dwukrotnie) ilości
azotu.
3. Nawożenie wierzby energetycznej Salix viminalis jest dobrym
sposobem na wykorzystanie odcieku po procesie fermentacji alg lub
wysłodków.
Literatura
1. Aronsson P. G., Bergstrom L. F., Elowson S. N. E. 2000. Long-term influence
of intensively cultured short-rotation Willow Coppice on nitrogen concentration
on groundwater. Journal of Environmental Management 58: 135–145.
2. Acaroglu M., Aksoy A.S. 2005. The cultivation and energy balance of Miscanthus x giganteus production in Turkey. Biomass and Bioenergy 29: 42–48.
3. Białowiec A., Davies L., Albuquerque A., Randerson P. 2012. Nitrogen removal from landfill leachate in constructed wetlands with reed and willow:
Redox potential in the root zone. Journal of Environmental Management
97: 22–27.
161
Paulina Drożyner, Andrzej Klasa, Krystyna A. Skibniewska, Baryga Andrzej
4. Bohodziewicz J., Kuglarz M., Mrowiec B. 2011. Ocena podatności bioodpadów kuchennych i osadów ściekowych do kofermentacji w warunkach statycznych. Proceedings of ECOpole vol. 5 (1).
5. Fillion M., Brisson J., Teodorescu T.I., Sauve S., Labrecque M. 2009. Performance of Salix viminalis and Populus nigra x Populus maximowiczii in
short rotation intensive culture under high irrigation. Biomass and Bioenergy 33: 1271–1277.
6. Frison M., Di Fabio S., Cavinato C., Pavan P., Fatone F. 2013. Best available
carbon sources to enhance the via-nitrite biological nutrients removal from
supernatants of anaerobic co-digestion. Chemical Engineering Journal
215–216: 15–22.
7. Istvanovics V., Clement A., Somlyódy L., Specziar A., G.-Toth L., Padisak
J. 2007. Updating water quality targets for shallow Lake Balaton (Hungary), recovering from eutrophication. Hydrobiologia 581: 305–318.
8. Janssen M. A. 2000. An exploratory integrated model to assess management
of lake eutrophication. Ecological Modeling 140: 111–124.
9. Mant C., Peterkin J., May E., Butler J. 2003. A feasibility study of Salix
viminalis gravel hydroponic system to renovate primary settled wastewater.
Bioresource Technology 90: 19–25.
10. Marler R. J., Stromberg J.C., Patten D.T. 2001. Growth response of Populus fremontii, Salix gooddingii, and Tamarix ramosissima seedlings under
different nitrogen and phosphorus concentrations. Journal of Arid Environments 49: 133–146.
11. Mleczek M., Rutkowski P., Rissmann I., Kaczmarek Z., Golinski P., Szentner K., Strażyńska K., Stachowiak A. 2010. Biomass productivity and
phytoremediation potential of Salix alba and Salix viminalis. Biomass and
Bioenergy 34: 1410–1418.
12. Obarska-Pempkowiak, Kołecka 2005. – http://ros.edu.pl/text/
pp_2005_005.pdf , dostępna dn. 05.02.2013.
13. Padisak J., Reynolds C.S., 1998, Selection of phytoplankton associations
in Lake Balaton, Hungary, in response to eutrophication and restoration
measures, with special reference to the cyanoprokaryotes. Hydrobiologia
384: 41–53.
14. Saunders D.L., Kalff J., 2001, Nitrogen retention in wetlands, lakes and
rivers. Hydrobiologia 443: 205–212.
15. Skibniewska K. A., Klasa A., Kowalczyk M., Baryga A., Wojtkowiak K.,
Bułka W. 2012. Progress in renewable energy production by biomass fermentation generates risk to environmental safety. In: Safety of the System. Technical, organizational and human work safety determinants.
Salamon S. (Ed.). ISBN 978-83-63500-13-9, ISSN 1428-1600. Wyd.
162
Studia nad utylizacją odcieku po produkcji biogazu
Wydział Zarządzania Politechniki Częstochowskiej, Częstochowa. pp.
145–160.
16. Wojtkowiak K., Jędrzejczak M. F., Urban P. A., Zając Ł. D., Klasa A.,
Zieliński M., Dębowski M., Krzemieniewski M., Skibniewska K. A.,
2012. Impact of algae post-gasification effluents on growth and macronutrient contents of energetic willow: studies of promising disposal of undue
leachates. ECO-SUMMIT 2012, 4th International Ecosummit “Ecological sustainability. Restoring the planet’s ecosystem services.” Columbus, Ohio, USA, 30.09.–5.10. P430.
17. Qin B., 2009., Lake eutrophication: Control countermeasures and recycling
exploitation. Ecological Engineering 35: 1569–1573.
mgr inż. Paulina Drożyner
Uniwersytet Warmińsko-Mazurski w Olszynie
Katedra Podstaw Bezpieczeństwa
e-mail: [email protected]
dr hab. inż. Klasa Andrzej
Uniwersytet Warmińsko-Mazurski w Olszynie
Katedra Chemii Rolnej i Ochrony Środowiska
prof. dr hab. Krystyna A. Skibniewska
Uniwersytet Warmińsko-Mazurski w Olszynie
Katedra Podstaw Bezpieczeństwa
dr inż. Andrzej Baryga
Instytut Biotechnologii Przemysłu Rolno-Spożywczego w Warszawie
Oddział Cukrownictwa
Opiekun naukowy: prof. dr hab. Krystyna A. Skibniewska
163
Edyta Kruk
Marek Ryczek
EPISTEME
18/2013, t. 3
s. 165-174
ISSN 1895-2241
OCENA STRAT MATERIAŁU GLEBOWEGO
W SKUTEK EROZJI WODNEJ ZLEWNI POTOKU
PONICZANKA W KARPATACH ZACHODNICH
EVALUATION OF SOIL LOSS AS A RESULT OF WATER
EROSION IN THE PONICZANKA STREAM BASIN
IN THE WESTERN CARPATHIANS
Abstrakt. W pracy przedstawiono wyniki oceny potencjalnego zagrożenia
erozją wodną zlewni potoku Poniczanka w Karpatach Zachodnich, przy użyciu
modelu Uniwersalnego Równania Strat Glebowych (USLE) z zastosowaniem
Systemu Informacji Przestrzennej (GIS). Zlewnia ma powierzchnię 32,10 km2.
Średnia wysokość zlewni osiąga 679,0 m n.p.m. Średni spadek zlewni wynosi
20,29%. Zlewnia w 48,7% zajęta jest przez lasy, w 26,4% przez grunty orne.
Użytki zielone zajmują 17,9% a tereny zabudowane 7,0% powierzchni ogólnej.
Do oceny zagrożenia erozją wodną zastosowano 6-cio stopniową skalę. Obszary jednorodne pod względem zagrożenia erozyjnego wyróżniono na podstawie
nakładania się warstw tematycznych określających poszczególne parametry
modelu. Największą powierzchnię w badanej zlewni zajmują grunty o bardzo
wysokim zagrożeniu erozyjnym (VI klasa). Około 1/2 powierzchni znajduje się
w terenach zagrożonych bardzo małym i małym natężeniem erozji (klasa II i III).
Słowa kluczowe: erozja wodna, model USLE, GIS
Summary. The results of estimation of water erosion potential threat in the
Poniczanka stream basin located in the Western Carpathians were presented
in the work. Erosion intensity was calculated using model USLE and GIS techniques. The basin area amounts 32,10 km2. Mean basin height attains 679,0
m a.s.l. Mean basin slope is %. The basin is mostly occupied by forests – 48,7%,
26,4% occupy arable lands, while 17,9% and 7,0% grasslands and built area respectively. For estimation of erosion threat the 6-degree scale was used. Homogenous areas regarding erosion degrees were distinguished based upon topic
layers determining particular model parameters. The largest area of investigated basin occupy places of highest erosion threat (VI class). About ½ of the area
occupy places of small and very small erosion threat (II and III class).
Key words: water erosion, model USLE, GIS
165
Edyta Kruk, Marek Ryczek
WSTĘP
Rozpoznanie natężenia erozji w zlewniach górskich jest bardzo ważnym
zagadnieniem zarówno z punktu widzenia ochrony środowiska jak i gospodarki danego kraju. Erozja wodna stanowi jeden z najważniejszych
czynników kształtujących powierzchnię zlewni. Powoduje wynoszenie
z obszaru zlewni znacznych ilości materiału organicznego, mineralnego i chemicznego. Intensywność zjawisk erozyjnych wynika zarówno
z sum cech fizjograficznych i hydrologicznych występujących na obszarze danej zlewni [Restrepo i in. 2005, Verstraeten i Poesen 2001] jak
i sposobu jej użytkowania oraz zabudowy przestrzennej [Bromtsówna
1969]. Dodatkowo istotnie na jej nasilenie wpływają takie czynniki jak:
geologia, gleby oraz klimat [Dobija i Dynowska 1975]. Jedynym czynnikiem zależnym od człowieka jest sposób użytkowania. Użytkowanie
rolnicze szczególnie sprzyja erozji wodnej, głównie powierzchniowej.
Celem pracy była ocena strat materiału glebowego w skutek erozji
wodnej zlewni potoku Poniczanka położonej w Karpatach Zachodnich.
Powierzchnia zlewni do profilu wodowskazowego wynosi 32,10 km2.
Średnia wysokość zlewni wynosi 679,0 m n.p.m. Najwyżej położony
punkt ma wysokość 950,0 m n.p.m. Profil wodowskazowy zamykający zlewnię założony w Rabce, ma rzędną 477,00 m n.p.m. Średni spadek zlewni wynosi 20,29%, przeważają spadki 18–27%. Długość cieku
głównego wynosi 9,70 km a jego spadek 4,88%. Sieć hydrograficzna
charakteryzuje się gęstością, liczoną z długości cieków wynoszącą
2,83 km-1. Zlewnia ma układ koncentryczny. W strukturze użytkowania zlewni lasy stanowią 48,7%, grunty orne – 26,4% a użytki zielone
17,9% powierzchni ogólnej. W zlewni przeważają gleby brunatne kwaśne typowe i brunatne wyługowane. Pod względem składu granulometrycznego występuje zróżnicowanie. Największą powierzchnię zajmuje glina średnia pylasta, która występuje w południowej, wschodniej
i miejscami w górnej części. W środkowej i miejscami w północno-zachodniej części zalega glina lekka pylasta, a w północnej glina ciężka
pylasta. Na niewielkich obszarach występuje glina lekka i glina średnia.
MATERIAŁY I METODY
Ocenę start materiału glebowego w badanej zlewni przeprowadzono
przy użyciu modelu USLE, będącego propozycją Wischmeiera i Smi166
Ocena strat materiału glebowego w skutek erozji wodnej zlewni potoku poniczanka...
tha z 1978 roku. Formuła USLE łącząca w sobie wszystkie główne
czynniki, naturalne oraz antropogeniczne, determinujące charakter
i wielkość erozji gleb [Banasik i Górski 1991] ma postać:
A = S · L · R · P ·C · K (Mg·ha-1·rok-1)
(1)
gdzie: A – średnia z wielolecia roczna masa erodowanej gleby z jednostki powierzchni (Mg·ha-1·rok-1), R – wskaźnik erozyjności deszczu (Je), K – wskaźnik podatności gleb na erozję (Mg·ha-1·Je-1), L – wskaźnik długości zbocza (-),
S – wskaźnik spadku zbocza (-), C – wskaźnik pokrywy roślinnej (-), P –
wskaźnik zabiegów przeciwdziałających erozji (-).
Poszczególne parametry modelu wyznaczono z wykorzystaniem technik GIS, w wyniku nałożenia opracowanych następujących
warstw tematycznych: nachylenia terenu, użytkowania zlewni oraz
składu granulometrycznego. Klasyfikację uziarnienia gleb określono
na podstawie Normy BN-78/9180-11.
Warstwy tematyczne zostały opracowane przy wykorzystaniu
programu MapInfo Professional 8.0 SCP bazując na podstawie Cyfrowego Modelu Terenu, mapy glebowo-rolniczej oraz ortofotomapy
w skalach 1:25 000 (ryc. 1).
Wskaźnik erozyjności deszczu (R) wyznaczono na podstawie
indeksu Fouriera w modyfikacji Arnouldsa (1977). Indeks wykazuje
dobrą korelację ze wskaźnikiem R (Licznar 2005). Indeks Fouriera
obliczono jako średnią z wielolecia dla całej zlewni, ze wzoru:
(mm)
(2)
gdzie: m – liczba lat w wieloleciu, pi,j – suma miesięczna opadu w i-tym miesiącu, w j-tym roku (mm), P – suma roczna opadu (mm).
Wskaźnik podatności gleb na erozję (K) obliczono według Renarda i in. (1997):
(Mg·ha-1·Je-1) (3)
gdzie:
167
Edyta Kruk, Marek Ryczek
Ryc. 1. Warstwy tematyczne opracowane przy wykorzystaniu technik GIS
zlewni potoku Poniczanka.
168
Ocena strat materiału glebowego w skutek erozji wodnej zlewni potoku poniczanka...
di – maksymalna średnica ziaren w danej klasie (mm), di-1 – minimalna średnica ziaren w danej klasie (mm), fi – udział masowy (%). Współczynnik Dg
wyznaczono na podstawie oznaczeń składu granulometrycznego, metodą
Casagrande’a w modyfikacji Prószyńskiego, sklasyfikowano według BN78/9180-11.
Wskaźniki długości i spadku zbocza (L,S) połączono w jeden
współczynnik – wskaźnik rzeźby terenu – LS i wyznaczono z następujących wzorów (Mc Cool i in. 1989):
[-]
(4)
Gdzie: L – długość zbocza równa drodze spływu powierzchniowego (m), S –
spadek zbocza (%), m – wykładnik potęgowy zależny od spadku zbocza [Stone i Hilborn 2000]: m = 0,2, gdy s ≤ 1,0%, m = 0,3, gdy 1,0 < s < 3,0%, m =
0,4, gdy 3,0 ≤ s < 5,0%, m = 0,5, gdy s ≥ 5%.
Wskaźnik pokrywy roślinnej (C) przyjęto za Koreleskim (1992):
dla owsa jarego – 0,104, jęczmienia jarego – 0,124, ziemniaków –
0,229, użytków zielonych – 0,015, lasów – 0,002, terenów zabudowanych – 0.
Wskaźnik zabiegów przeciwdziałających erozji (P) przyjęto za
Koreleskim (1992) w następujący sposób: dla upraw prowadzonych
skośnie i prostopadle do warstwic przyjęto wartość 0,75. Kierunki
upraw określono na podstawie ortofotomapy satelitarnej.
WYNIKI I DYSKUSJA
Poszczególne elementy USLE wyznaczono w niżej opisany sposób:
Parametr R – przyjęto jako średnią z wielolecia 1998 – 2007,
z posterunku opadowego w Suchej Beskidzkiej. Wartość wskaźnika
erozyjności deszczu wyniosła 185,08 Je.
Parametr K – jego średnie wartości wyróżnionych grup granulometrycznych wahały się od 0,141 do 0,430 Mg·ha-1·Je–1. Wartość średnia
ważona dla całej zlewni wyniosła 0,318 Mg·ha-1·Je–1. Ze względu na
niewielkie zróżnicowanie tego współczynnika przyjętą tą wartość jako
charakterystyczną dla całego badanego obszaru (tab. 1).
169
Edyta Kruk, Marek Ryczek
Tab. 1. Udział grup granulometrycznych w zlewni
i obliczenie średnich wartości parametru K.
Skład granulometryczny wg
Normy BN-78/9180-11
Powierzchnia (km2)
Udział w
zlewni (%)
Wartość średnia K dla
grupy (Mg·ha-1·Je–1)
glina średnia pylasta – gsp
21,11
65,76
0,372
glina lekka pylasta – glp
7,56
23,55
0,141
glina ciężka pylasta – gcp
2,18
6,79
0,430
glina średnia – gs
0,73
2,28
0,306
glina lekka – gl
0,52
1,62
0,248
Razem
32,10
100,00
0,318
Parametr LS – w zlewni przeważają spadki 18%–27%. Stanowią
one 36,5% powierzchni ogólnej. Znacznie mniej jest spadków najmniejszych < 5% (3,5%) (tab. 2).
Wydzielono 5 obszarów jednorodnych pod względem wartości iloczynu LS. W obszarze I (<5%) wartość LS wyniosła 0,870, w II (5–10%) –
1,952, w III (10–18%) – 6,686, w IV (18–27%) – 15,040 a w V (>27%) –
34,600. Największą powierzchnię (36,48%) zajmuje obszar IV.
Parametr C – w strukturze użytkowania przeważają lasy (48,7%),
grunty orne zajmują 26,4% natomiast użytki zielone 17,9%. Pozostałą część stanowią tereny zabudowane. Na gruntach ornych w roku
wykonania zdjęć satelitarnych owies jary zajmował 8,4%, jęczmień
jary 10,8 % a ziemniaki 7,1% ich powierzchni. Wartości współczynnika C wynoszą od 0 dla terenów zabudowanych do 0,229 dla gruntów
ornych z uprawą ziemniaków (tab. 2).
Tab. 2. Struktura użytkowania zlewni potoku Poniczanka.
Rodzaj użytku
grunty orne
owies jary
jęczmień jary
ziemniaki
użytki zielone
lasy
tereny zabudowane
razem
170
Powierzchnia
[km2]
Udział w
zlewni
Wartość parametru C [-]
2,71
3,47
2,28
5,74
15,65
2,25
32,10
8,4
10,8
7,1
17,9
48,8
7,0
100,00
0,104
0,124
0,229
0,015
0,002
0
–
Ocena strat materiału glebowego w skutek erozji wodnej zlewni potoku poniczanka...
Parametr P – biorąc pod uwagę fakt, iż na terenie badanej zlewni
przeważa układ upraw skośnych i prostopadłych do warstwic dla całej zlewni przyjęto wartość wskaźnika P równą 0,75.
Obliczenie potencjalnej erozji wodnej
Po nałożeniu warstw tematycznych związanych z kolejnymi parametrami uzyskano 30 pól jednorodnych o różnym natężeniu erozji
wodnej. Wielkość potencjalna strat z obszarów jednorodnych wahała
się od 0,000 do 349,751 Mg·ha-1·rok-1. Obliczone jednostkowe natężenia erozji sklasyfikowano według skali zagrożenia erozją zaproponowanej przez Marksa i wsp. (1989). Skala wyróżniona na podstawie
rocznych strat w tonach na ha 6 klas natężenia: I (brak <1), II (bardzo
małe 1–5), III (małe 5–10), IV (średnie 10–15), V (wysokie 15–30)
i VI (bardzo wysokie >30). W badanej zlewni największą powierzchnię zajmują grunty o bardzo wysokim zagrożeniu erozyjnym (VI
klasa). Jest to obszar zajęty przez grunty orne o spadkach powyżej
10%. Około 1/2 powierzchni znajduje się w terenach zagrożonych
bardzo małym i małym natężeniem erozji (klasa II i III), stanowią one
grunty orne o spadkach mniejszych niż 10%, łąki o spadkach 5–27%
oraz lasy o spadkach powyżej 18%. Klasa I (brak erozji) występuje
w tereny zabudowane oraz na łąkach o spadku < 5% a także w terenach zalesionych o spadkach mniejszych niż 18%.
Klasa*
Tab. 3. Obliczenie potencjalnej wielkości erozji wodnej.
I
II
III
IV
V
VI
Total
Udział
%
km2
10,03
27,45
25,95
0,00
1,99
34,58
100,00
3,22
8,81
8,33
0,00
0,64
11,10
32,10
Średnie jednostkowe
natężenie erozji wodnej
(Mg·ha(Mg·k1
·rok-1)
m2·rok-1)
0,354
3,143
9,426
0,00
21,321
126,250
-
35,4
314,3
942,6
0,0
2 132,1
12 625,0
-
Wielkość całkowita
erozji wodnej
(Mg·rok-1)
114,0
2 769,0
7 851,9
0,0
1 364,5
140 137,5
152 236,9
*Klasy zagrożenia erozją wodną wg Marksa i wsp. (1989)
171
Edyta Kruk, Marek Ryczek
Na rycinie 2 przedstawiono graficzny rozkład klas natężenia
erozji wodnej. Łączna potencjalna wielkość rocznej straty gleby na
terenie zlewni wynosi 152 236,9 Mg, co w przeliczeniu na 1 ha daje
średnią wartość 47,43 Mg, a to klasyfikuje badaną zlewnię jako bardzo wysoko zagrożoną (VI klasa).
Ryc. 2. Rozmieszczenie klas potencjalnego zagrożenia erozją wodną
w zlewni potoku Poniczanka.
WNIOSKI
1. Obliczona jednostkowa erozja z 1 ha wyniosła 47,43 Mg, co pozwala na ocenę badanej zlewni jako bardzo wysoko zagrożonej.
2. Roczna wielkość erozji z badanej zlewni wyniosła 152 236,9 Mg.
172
Ocena strat materiału glebowego w skutek erozji wodnej zlewni potoku poniczanka...
3. Ponad 50% powierzchni zajmują obszary o małym i bardzo
małym erozyjnym (klasa II i III).
4. Przedstawiona metoda obliczenia erozji może być wykorzystana do projektowania zabiegów przeciwerozyjnych oraz do wyznaczania obszarów o szczególnym zagrożeniu erozją w aspekcie prawidłowej gospodarki w zlewniach górskich.
BIBLIOGRAFIA
1. Arnoulds H. M. J., 1977. Methodology used to determine the maximum potential average annual soil loss due sheet and rill erosion in Morocco, [w:]
Assesing Soil Degradation. FAO Soil Bulletin 34, Rome: 39–48.
2. Banasik K., Górski D., 1992. Rozkłady prawdopodobieństwa erozyjności
deszczy dla Polski południowo-wschodniej. Zesz. Nauk. AR Kraków, Sesja
Naukowa 35, 271: 125–131.
3. Dobija A., Dynowska J., 1975. Znaczenie parametrów fizjograficznych zlewni do ustalenia wielkości odpływu rzecznego. Folia Geographica, series
Geographica-Physic, vol IX.
4. Koreleski K., 1992. Próby oceny natężenia erozji wodnej. Zesz. Nauk. AR im.
H. Kołłątaja w Krakowie, Sesja Naukowa, z. 35: 25–32.
5. Licznar P., 2005. Ocena możliwości stosowania sztucznych sieci neuronowych
dla określenia średniej rocznej wartości wskaźnika erozyjności deszczy. Acta
Agrophisica, 5(1): 65–74.
6. Marks R., Müller M. J., Leser H., Klink H .J., 1989. Anleitung zur Bewertung des Leistungvermögens des Landschaftshaushaltes (BA LVL). Forschungen zur Deutschen Landeskunde Band 229, Zentralaussuss für
deutsche Landeskunde, Selbstverlag, Trier.
7. Mc Cool D. E., Foster G. R., Mutchler C. K., Meyer L. D., 1989. Revised
slope length factor for the Universal Soil Loss Equation. Trans. ASAE, 32:
1571–1576.
8. Renard K. G., Foster G. R., Weesies G. A., McCool D. K., Yoder D. C., 1997.
Predicting soil erosion by water: a guide to conservation planning with the
revised Universal Soil Loss Equation (RUSLE). USDA, Agricultural Handbook, 703.
9. Respeto J. D., Kjerfve B., Heremelin M., 2005. Factors controlling sediment
yield in a major South American drainage basin: the Magdalena River, Colombia. Journal of Hydrology, 316: 213–232.
10. Stone R. P., Hilborn D., 2000. Universal soil loss equation (USLE). Ontario:
Min. Agricult. Food Rural Affairs
173
Edyta Kruk, Marek Ryczek
11. Verstraeten G., Poesen J. 2001. Factors controlling sediment yield from
small intensively cultivated catchments in a temperate humid climate. Geomorphology, 40: 123–144.
12. Wischmeier W. H., Smith D.D. 1978. Predicting Rainfall erosion losses –
a guide to conservation planning; Supersedes Agriculture Handbook
No.282; Washington, 4–11.
mgr inż. Edyta Kruk, dr hab. inż. Marek Ryczek
Katedra Rekultywacji Gleb i Ochrony Torfowisk Wydział
Inżynierii Środowiska i Geodezji
Uniwersytet Rolniczy
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. inż. Krzysztof Boroń
174
Agnieszka Hawryło, Małgorzata Leja
Leszek Książek, Maciej Wyrębek
EPISTEME
18/2013, t. 3
s. 175-182
ISSN 1895-2241
Prognozowanie zmian hydraulicznych
parametrów siedlisk na wybranym
odcinku rzeki Wisłoki
Prediction of the changes in the hydraulic
aspects of river habitats in the section
of the River Wisłoka
Abstrakt. Celem pracy jest określenie wpływu przepływu Q50% na zróżnicowanie aspektów hydraulicznych siedlisk w korycie głównym. Badania zostały wykonane na odcinku rzeki Wisłoki w jej dolnym biegu (km
48+100÷48+400). Na podstawie pomierzonych przekrojów poprzecznych
rzeki Wisłoki wykonano model numeryczny odcinka, na którym opisano
parametry hydrauliczne warunkujące siedliska dla przepływu pomiarowego
zbliżonego do SNQ. Następnie wykonano symulację warunków przepływu
dla Q50%. W kolejnym kroku określono zróżnicowanie warunków siedliskowych na badanym odcinku dla przepływu pomiarowego. Do analizy wybrano
wielkości zgodnie z metodą Mesohabitat Evaluation Model (MEM): napełnienie, prędkość średnia i naprężenia styczne. Wyniki pomiarów wskazują
na istotną zmianę hydraulicznych parametrów siedlisk na skutek zmniejszenia prędkości i zwiększeniu napełnień. W konsekwencji uległy zmianie
dominujące siedliska na tym odcinku.
Słowa kluczowe: morfologia, model 2D, napełnienie, prędkość, naprężenia styczne
Summary. The aim of this study is to determine the effect of Q50% discharge on hydraulic aspects of the diversity of habitats in the channel. The
study was carried out on the stretch of the River Wisłoka. Based on measured in the field cross-sections model was created and then used to determined the distribution of hydraulic parameters and mesohabitats. The simulation of discharge Q50%, which is close to value of SNQ was performed.
As a result of that flow changes occurred in the configuration of the bottom.
Diversity of habitat conditions on the researched section has been determined for flow measurement. For the analysis values were chosen according
to the Mesohabitat Evaluation Model (MEM) method: depth, mean velocity
and shear stress. The measurement results indicate a significant change in
the hydraulic aspects of habitats. It is seen in reducing mean velocity and
increasing depth after changing the configuration of the river bottom.
Key words: morphology, 2D model, depth, mean velocity, shear stresses
175
Agnieszka Hawryło, Małgorzata Leja, Leszek Książek, Maciej Wyrębek
Wstęp
Zrównoważone wykorzystanie wód powinno brać pod uwagę wrażliwość ekosystemów wodnych [KZGW 2010], dlatego przywracanie
dobrego stanu ekologicznego rzek jest kluczowym elementem polityki wodnej Polski po przyjęciu Ramowej Dyrektywy Wodnej. Ocena stanu ekologicznego zawiera elementy biologiczne, chemiczne
i morfologiczne, do których Ramowa Dyrektywa Wodna (RDW) zalicza między innymi zmienną głębokość oraz strukturę i skład podłoża [Komisja Europejska 2000]. Układ poziomy i pionowy dna cieku
determinują aspekty hydrauliczne siedliska takie jak prędkość wody,
napełnienie, naprężenia styczne czy liczba Frouda, dlatego często
stosuje się zamiennie terminy jednostka morfologiczna i siedlisko
[Parasiewicz 2007]. Siedliska jako jednostki morfologiczne stały się
podstawą do oceny stanu ekologicznego rzeki oraz kierunku zadań
prowadzących do jego poprawy [Mouton 2007]. Wymienione parametry hydrauliczne mają wpływ miedzy innymi na temperaturę
wody oraz jej natlenienie. Poziom tych czynników jest istotny dla zapewnienia odpowiednich warunków do różnych faz rozwoju i funkcji
życiowych organizmów wodnych [Bryliński 1991]. Zatem zachowanie odpowiednich warunków hydraulicznych w korycie rzeki może
determinować wystąpienie poszczególnych gatunków.
Konfiguracja dna cieku jest formowana przez wystąpienie przepływów o odpowiednim natężeniu, które powodują wystąpienie naprężeń stycznych przekraczających naprężenia graniczne, a tym samym transport rumowiska dennego. Podczas dużych wezbrań może
wystąpić erozja boczna i denna, lub depozycja materiału dennego.
W wyniku tych procesów dochodzi do poszerzania koryt oraz powstawania łach śródkorytowych bądź nadbudowywania lub rozmywania istniejących [Bryant i in. 1999]. Periodyczne wezbrania wywołują zmiany morfologiczne dna oraz zmieniają średnicę, zarówno
rumowiska tworzącego obrukowanie, jak i jego podłoża [Książek i in.
2007]. Niniejsza praca ma na celu analizę warunków hydraulicznych
siedlisk po przejściu fali wezbrania Q50% powodującego transport
rumowiska na odcinku rzeki Wisłoki.
Materiał i metody
Badania wpływu przepływu Q50% powodującego transport rumowiska na hydrauliczne aspekty siedlisk zostały wykonane na odcinku
176
Prognozowanie zmian hydraulicznych parametrów siedlisk na wybranym odcinku...
rzeki Wisłoka, który jest prawobrzeżnym dopływem Wisły o długości
ok. 160 km i powierzchni zlewni ponad 4 tys. km2. Jak w przypadku
wielu rzek karpackich tak i na Wisłoce w latach 1950–1990 miało
miejsce obniżenie piaszczysto-żwirowego dna, które średnio wynosiło od 5 do 9 cm.rok-1. Proces ten zmniejszył swą intensywność po
roku 1990 [Galarowski i Klimek 1991; Wyżga 2008].
Badany odcinek rzeki Wisłok zlokalizowany jest w miejscowości
Brzeźnica w km 48+100 do 48+400. Charakteryzuje się on spadkiem
dna równym 0,6 ‰ oraz średnicą miarodajną dm=0,019 m. Wykonano pomiar przepływu i konfiguracji dna w przekrojach poprzecznych
przy użyciu przepływomierza profilującego Acustic Doppler Curent
Profiler (ADCP) oraz pomiar rzędnej zwierciadła wody za pomocą zestawu GPS.
Na podstawie przekrojów poprzecznych wykonano model numeryczny koryta rzeki w programie CCHE2D, który został opracowany
na Uniwersytecie Mississipi [Jia i Wang 2001]. Siatka modelu została
wygenerowana z rozdzielczością 0,6x0,6 m na terasach zalewowych,
oraz 0,6x0,3 m w korycierzeki na badanym odcinku. Przyjęte rozmiary pojedynczych komórek miały zapewnić optymalizację obliczeń
symulacji przy jednoczesnym uzyskaniu dokładniejszych wyników w
miejscach występowania dużych gradientów prędkości. Ponadto taki
rozmiar komórek zapewniał prawidłowe odwzorowanie przepływu
wody i transportu rumowiska. Ilość oczek siatki wynosiła 261x897
co daje 234118 węzłów obliczeniowych. Model został skalibrowany dla przepływu pomiarowego 7,9 m3.s-1 poprzez porównanie pomierzonego i obliczonego poziomu zwierciadła wody, układu nurtu
głównego oraz rozkładów prędkości.
Ocenę warunków siedliskowych przeprowadzono dla dwóch wariantów konfiguracji dna:
• A – model stworzony na podstawie pomiarów terenowych,
• B – model odwzorowujący konfigurację dna po wystąpieniu
transportu rumowiska.
Dla obu wariantów symulację przeprowadzono dla warunków
przepływu ustalonego równego 7,9 m3.s-1, który jest zbliżony do
SNQ. Zmianę morfologii koryta uzyskano dla przepływu równego Q50%=389 m3.s-1, dla którego intensywność transportu na tym
odcinku Wisłoki wynosiła 0,5 kg.s-1 na mb [Bartnik 1997; Michalik
177
Agnieszka Hawryło, Małgorzata Leja, Leszek Książek, Maciej Wyrębek
2000]. Do analizy wybrano trzy parametry hydrauliczne: napełnienie, prędkość średnia oraz naprężenia styczne, które są wykorzystywane w metodzie Mesohabitat Evaluation Model (MEM) do określania typu jednostki hydromorfologicznej [Hauer 2008].
Wyniki i dyskusja
Wykonane obliczenia pozwoliły na ocenę zmian hydraulicznych
aspektów siedliska po przejściu fali wezbraniowej. W tabeli 1 zestawiono procentowy udział powierzchni, na jakiej panują określone
warunki w stosunku do całkowitej obrysu zwilżonego koryta rzeki.
Wyniki obliczeń zestawiono w przedziałach wyznaczonych przez
Hauera [2008] zgodnie z metodyką Mesohabitat Evaluation Model
(MEM). Według tej procedury parametry te determinują wystąpienie różnych typów siedlisk. Analiza wskazuje na zmianę warunków
hydraulicznych w odniesieniu do siedlisk po przejściu przepływu powodującego ruch rumowiska. W wyniku tego doszło do zmniejszenia
się powierzchni, gdzie występowały napełnienia mniejsze od 0,4 m,
na korzyść napełnień w przedziale od 0,5 do 0,6 m. Zmiana konfiguracji dna spowodowała zmniejszenie wartości prędkości oraz naprężeń stycznych na dno przy przepływie 7,9 m3.s-1. Na połowie obrysu
zwilżonego występują naprężenia poniżej 2 N.m-2, gdzie wcześniej
ten zakres naprężeń występował na 18% powierzchni. Takie zmiany
w rozkładzie wartości naprężeń pozwalają wnioskować, że w korycie, gdzie dotychczas dominowały siedliska typu przypływ spokojny
i normalny, koryto zostanie zdominowane przez płytką wodę bądź
zastoiska. W żadnym przypadku nie wystąpiły warunki do powstania
siedlisk wysokiej energii.
W ramach opracowania statystycznego przeprowadzono testy
nieparametryczne porównania dwóch grup: test U Manna-Whitneya
i test Kołmogorowa-Smirnowa dla 2 prób. Testy te służą do weryfikacji istotności różnic rozkładów pomiędzy grupami. Analiza statystyczna (tab. 2) wykazała istotność różnic w wartościach wszystkich
parametrów przed i po przejściu przepływu powodującego transport
rumowiska – p<0,01 dla test Kołmogorowa-Smirnowa dla 2 prób;
p=0 dla test U Manna-Whitneya. Pomimo niewielkiej różnicy w wartościach średnich rozkłady udziału poszczególnych zakresów warto178
Prognozowanie zmian hydraulicznych parametrów siedlisk na wybranym odcinku...
ści różnią się, co świadczy, że transport jest wystarczającym procesem kształtującym hydrauliczne aspekty siedlisk.
Tab. 1. Procent pokrycia powierzchni odcinka koryta rzeki Wisłoki
przez parametry hydrauliczne przed (A) i po (B) wystąpieniu przepływu
Q50% dla przedziałów ustalonych przez Hauera [2008] dla rzeki górskiej.
v-prędkość, h-napeninie, τ-naprężenia styczne.
V [m∙s-1]
A
B
h [m]
A
0–0.3
12.00 17.62 0–0.4 34.03
0.3–0.5 45.12 65.44 0.4–0.5 21.5
0.5–0.75 41.01 15.40 0.5–0.6 20.71
0.75–1.0 1.78 1.54 0.6–0.7 12.59
>1.0
0.09
0
>0.7
11.09
B
21.88
19.61
25.95
15.53
17.03
τ
[N∙m-2]
0–2
2–25
>25
A
B
18.11 54.0
81.89 46.0
0
0
Liczba węzłów
obl. B
Liczba węzłów
obl. A
Odch. Stand. B
Odch. Stand. A
Średnia B
Średnia A
Test U M-W p
Zmienna
Test K-S p
Tab. 2. Wyniki testów nieparametrycznych.
A – przed zmianą konfiguracji dna, B – po zmianie.
Prędkość [m∙s-1] <0.01 0,00 0.46 0,41 0,14 0,14 109553 110362
Napełnienie [m] <0.01 0,00 0,48 0,53 0,18 0,19 109553 110362
Naprężenia
styczne [N∙m-2]
<0.01 0,00 3,58 1,97 1,90 1,16 109553 110362
W czasie niewielkich corocznych wezbrań dochodzi do zmiany
kształtu dna [Malik i in. 2012]. Badania prowadzone na uregulowanym odcinku Nidy wykazały, że w rzekach o podłożu piaszczystym
przy średnich przepływach występuje transport rumowiska wleczonego, co może prowadzić do powstania form dennych o dużych
rozmiarach [Strużyński i Wyrębek 2009]. Inaczej jest w potokach
górskich, gdzie zmiany geometrii koryta powstają po wystąpieniu
zdarzeń ekstremalnych [Krzaklewski 2008]. Bąk i in. [2011] w badaniach erozji, transportu i sedymentacji według teorii mocy strumienia stwierdzili, że transport materiału dennego występuje przy
przepływie niższym od Q50%. Na Wisłoce obecność łach żwirowych
179
Agnieszka Hawryło, Małgorzata Leja, Leszek Książek, Maciej Wyrębek
w korycie świadczy o występowaniu transportu rumowiska dennego,
natomiast w opisywanym biegu rzeka ta jest również jedną z trzech
w Polsce o największym ładunku unosin [Klimek i Łajczak 1991]. Takie
częste zmiany konfiguracji dna będące elementem przemieszczania rumowiska, jego mieszania i sortowania sprzyjają utrzymaniu tarlisk dla
ryb. Jednocześnie zróżnicowaniu ulegają przestrzenne rozkłady napełnień i prędkości przepływu prowadząc do zmian w siedliskach.
Wnioski
Modelowanie potwierdziło, że Q50% jest przepływem przy którym
zaczyna się ruch rumowiska. W wyniku tego procesu uległy zmianie
rozkłady napełnień, prędkości średnich i naprężeń stycznych, które
różnią się istotnie przed i po wystąpieniu symulowanego przepływu,
pomimo niewielkich różnic w wartościach średnich. Wystąpienie
transportu rumowiska jest wystarczające do zmiany warunków hydraulicznych siedliska.
Dynamika przepływu wody sprawia, że warunki siedliskowe
podlegają ciągłym zmianom. Na badanym odcinku, gdzie dominowały siedliska typu przepływ spokojny i normalny w wyniku zmian
konfiguracji dna nastąpiło zwiększenie procentu powierzchni pokrywanego przez zastoiska wraz z płytką wodą. Może to spowodować,
że po przejściu fali wezbraniowej większej od Q50% mogą wystąpić
zmiany w strukturze gatunkowej organizmów żyjących na tym odcinku i warunki zastoiskowe będą sprzyjały funkcjonowaniu innym
gatunkom niż dotychczas.
Bibliografia
1. Bartnik W. 1997. The influence of hydraulics parameter on the bed load transport in mountain rivers and streams, Monografie Komitetu Gospodarki
Wodnej PAN, Warszawa 1997, 47–68 (in polish).
2. Bąk Ł., Michalik A., Tekielak T. 2011. Procesy erozji, transportu i sedymentacji w zlewniach potoków Kasinka i Słomka. Infarstruktura
i Ekologia terenów Wiejskich 9. PAN Oddział w Krakowie.
3. Bryant G., Gilvear D. 1999. Quantifying geomorphic and riparian land cover
changes either side of a large flood event using airborne remote sensing: River Tay, Scotland. Geomorphology 29: 307–321.
180
Prognozowanie zmian hydraulicznych parametrów siedlisk na wybranym odcinku...
4. Bryliński E., 1991. Opis wód śródlądowych. Ryby słodkowodne Polski. wyd.2
pod red. Brylińska M. PWN Warszawa: 94–98.
5. Galarowski T. Klimek K. 1991. Funkcjonowanie koryt rzecznych w warunkach zagospodarowania. Dorzecze Górnej Wisły. red. Dynowska
I. Maciejewski M. Warszawa-Kraków: 230–243.
6. Hauer C. Tritthart M. Habersack H., 2008. Computer-aided mesohabitat
evaluation. I: Background, model concept, calibration and validation based on hydrodynamic numerical modeling. Int. Conf. on Fluvial Hydraulics – River Flow. T. 3. Red. M. Altinakar, M.A. Kokpinar, Y. Darama,
B. Yegen, N. Harmancioglu KUBABA Congress Department and Travel
Services. Ankara: 1967–1974.
7. Klimek K. Łajczak A. 1991. Transport materiału dennego. Dorzecze Górnej
Wisły. red. Dynowska I. Maciejewski M. Warszawa-Kraków: 249–254.
8. Komisja Europejska. 2000. Dyrektywa 2000/60/WE Parlamentu Europejskiego i Rady z dnia 23 października 200r. ustanawiająca ramy wspólnego
działania w dziedzinie polityki wodnej. Dz.U.UE L z dnia 22 grudnia 2000 r.
9. Krajowy Zarząd Gospodarki Wodnej. 2010. Projekt polityki państwa do
roku 2030 (uwzględnieniem etapu 2016). URL:http://kzgw.gov.pl/files/file/Programy/PPWP2030/Projekt_Polityki_wodnej_panstwa_do_
roku_2030_z_uwzglednieniem_etapu_2016.pdf (dostęp 15.01.2013).
10. Krzaklewski P. 2008. Rola zdarzeń ekstremalnych w kształtowaniu meandrowych koryt górskich na przykładzie Czarnej Orawy w okresie 2007–
2008. Landform Analysis, Vol. 8: 45–48.
11. Książek L., Florek J., Świderska A., Radecki-Pawlik A. 2007. Zmiany morfologiczne oraz granulometryczne w rejonie ujściowego odcinka rzeki Raby. Infrastruktura i Ekologia Terenów Wiejskich. Nr 1/2007: 41–51.
12. Malik I., Wistuba M., Stopka R., Trąbka K. 2012. Rzeźbotwórcza rola wezbrań o różnej wielkości zapisana w anatomii drewna drzew, przykład z Hrubégo Jeseníka (Sudety Wschodnie). Studia i Materiały CEPL w Rogowie.
R. 14. Zeszyt 1: 157–165.
13. Michalik A. 2000. Bedload transport in mountain rivers – measurements
and results. 10th International Conference on Transport and Sedimentation of Solid Particles, Zeszyty Naukowe Akademii Rolniczej we Wroclawiu, No 382, Wroclaw, Poland: 41–58.
14. Mouton M., Schneider M., Depestele J., Goethals P., De Pauw N. 2007.
Fish habitat modelling as a tool for river management. Ecological Engineering T. 29, nr 3: 305–315.
15. Parasiewicz P. 2007. The MESOHABSIM model revisited. River Research
and Applications. T. 23, nr August: 893–903.
181
Agnieszka Hawryło, Małgorzata Leja, Leszek Książek, Maciej Wyrębek
16. Srużyński A., Wyrębek M. 2009. Modelowanie wpływu kanału ulgi ze
zbiornika Pińczowskiego na procesy hydromorfologiczne w uregulowanym
odcinku rzeki Nidy. Nauka Przyroda Technologie Tom 3, Zeszyt 3,Wydawnictwo UP Poznań, ISSN 1897-7820. #102.
17. Jia Y., Wang S. S. Y. 2001. CHE2D: Two-dimensional Hydrodynamic and
Sediment Transport Model For Unsteady Open Channel Flows Over Loose Bed, Technical Report No. NCCHE-TR-2001-1. National Center for
Computational Hydroscience and Engineering, The University of Mississippi. USA.
18. Wyżga B. 2008. Wcinanie się rzek polskich Karpat w ciągu XX wieku. Stan
Środowiska rzek południowej Polski i możliwości jego poprawy-wybrane aspekty red. Wyżga B. IOP PAN. Kraków: 7–39.
Promotor: dr hab. inż. Leszek Książek
182
Małgorzata Koncewicz-Baran
Kalina Orłowska, Krzysztof Gondek
EPISTEME
18/2013, t. 3
s. 183–190
ISSN 1895-2241
ZAWARTOŚĆ CHROMU W GLEBIE I ROŚLINACH
PO ZASTOSOWANIU OSADU ŚCIEKOWEGO
PRZEKSZTAŁCONEGO BIOLOGICZNIE I TERMICZNIE
CHROMIUM CONTENT IN SOIL AND PLANTS AFTER
APPLICATION OF SEWAGE SLUDGE BIOLOGICAL AND
THERMAL CONVERTED
Abstrakt. Celem badań przeprowadzonych w oparciu o dwuletnie doświadczenie wazonowe było określenie wpływu przekształconego biologicznie
i termicznie osadu ściekowego na zawartość chromu w biomasie roślin oraz
formy tego pierwiastka w glebie. Największe sumaryczne plony biomasy
w obydwu latach badań uzyskano w obiekcie, w którym zastosowano nieprzekształcony osad ściekowy. Części nadziemne owsa oraz korzenie rzepaku i owsa z obiektu, w którym zastosowano przekształcony termicznie
osad ściekowy zawierały najmniej chromu. Zastosowane materiały nie zróżnicowały zawartości tego pierwiastka w częściach nadziemnych rzepaku.
Nie stwierdzono zwiększenia zawartości najłatwiej dostępnych dla roślin
form chromu po zastosowaniu przekształconych mieszanin osadu ze słomą.
Po drugim roku badań oznaczono mniejsze zawartości tych formy chromu
w glebach wszystkich obiektów w porównaniu do pierwszego roku badań.
Słowa kluczowe: chrom, gleba, roślina, osad ściekowy, biologiczne przekształcenie, termiczne przekształcenie
Summary. The aim of research conducted on the basis of a two-year pot experiment was to determine the effect of application of biological and thermal converted sewage sludge for chromium content in plants biomass and
forms of this element in soil. The highest total yields of biomass in both years
were obtained from the object fertilized with not converted sewage sludge.
Oat aboveground parts and roots spring rape and oat from the object with
thermal converted sewage sludge treatment contained the lowest contents
of chromium. The materials did not effect on the content of chromium in
rape aboveground parts. The use of thermal and biological converted sewage sludge mixtures with straw did not increase in readily available to plants
forms of chromium. After the second year lower contents of this chromium
form were determined in the soil of all objects relative to the first year.
Key words: chromium, soil, plant, sewage sludge, thermal conversion, biological
conversion
183
Małgorzata Koncewicz-Baran, Kalina Orłowska, Krzysztof Gondek
Wstęp
Zwiększającą się ilość wytwarzanych komunalnych osadów ściekowych oraz obowiązujący od 1 stycznia 2013 zakaz ich składowania na
składowiskach innych niż dla odpadów niebezpiecznych wpływają na
pogłębianie problemu zagospodarowania tych odpadów. Znaczna zawartość składników nawozowych oraz materii organicznej w osadach
skłaniają do rozważenia przyrodniczego ich wykorzystania [Jakubus
2006, Vaca i in. 2011], którego jednym z warunków jest poddanie
ich procesom obróbki biologicznej, chemicznej lub termicznej w celu
eliminacji zagrożeń mikrobiologicznych. Ze względu na obciążenie
osadów ściekowych substancjami niepożądanymi, m.in. metalami
ciężkimi, niezbędne jest określenie oddziaływania tych materiałów
na poszczególne elementy środowiska przyrodniczego. Biodostępność metali ciężkich z wprowadzonych do gleby osadów pozostaje
w sferze badań, których różnorodność wynika ze zróżnicowania składu
chemicznego osadów, różnych ich dawek oraz rodzaju gleby [Gondek
2006]. Celem podjętych badań było określenie wpływu przekształconego biologicznie i termicznie osadu ściekowego na zawartość chromu
w biomasie roślin oraz formy tego pierwiastka w glebie.
Materiał i metody
Doświadczenie wazonowe przeprowadzono w latach 2010–2011
w hali wegetacyjnej UR w Krakowie. Wazony PCV mieściły 9,00 kg
materiału glebowego. Doświadczenie obejmowało 5 obiektów prowadzonych w 4 powtórzeniach: 0–gleba bez nawożenia, M–gleba z dodatkiem soli mineralnych, OŚ – gleba z dodatkiem osadu ściekowego,
BOŚ+S – gleba z dodatkiem przekształconej biologicznie mieszaniny
osadu ściekowego i słomy, TOŚ+S – gleba z dodatkiem przekształconej termicznie mieszaniny osadu ściekowego i słomy.
Doświadczenie założono na glebie o składzie granulometrycznym gliny piaszczystej (klasyfikacja wg PTG 2008) o odczynie lekko kwaśnym. Wybrane właściwości materiału glebowego oznaczono
przed rozpoczęciem badań metodami powszechnie stosowanymi
w chemii rolnej [Ostrowska i in. 1991]. Kwasowość hydrolityczna gleby wynosiła 19,4 mmol(+)·kg-1 s.m., zawartość węgla organicznego –
184
Zawartość chromu w glebie i roślinach po zastosowaniu osadu ściekowego...
7,90 g C·kg-1 s.m., a azotu ogólnego – 1,16 g N ·kg-1 s.m. Ogólna zawartość chromu w glebie wynosiła 11,24 mg Cr·kg-1 s.m.
Materiał wyjściowy do badań stanowił osad ściekowy pochodzący z mechaniczno-biologicznej oczyszczalni ścieków w Krakowie-Płaszowie. Osad zmieszano ze słomą pszenną w stosunku wagowym 1:1
w przeliczeniu na ich suchą masę. Biologiczne przekształcanie mieszaniny osadu ściekowego i słomy polegało na jej kompostowaniu
przez 117 dni w warunkach laboratoryjnych w bioreaktorze. Termiczne przekształcenie mieszaniny polegało na jej pirolizie w warunkach
laboratoryjnych w piecu komorowym przy braku dostępu powietrza
wg procedury: 30º C przez 5 min → 130 ºC przez 40 min → 200 ºC
przez 30 min.
W osadzie ściekowym i jego przekształconych mieszaninach
oznaczono podstawowe właściwości chemiczne [Baran i Turski 1996]
(tab. 1.). Z wprowadzonym do gleby osadem ściekowym (OŚ) oraz
mieszaniną osadu i słomy przekształconą biologicznie (BOŚ+S) i termicznie (TOŚ+S). wniesiono 9,09 mg Cr, 12,10 mg Cr oraz 14,60 mg
Cr·wazon-1.
Tab. 1. Wybrane właściwości materiałów organicznych
zastosowanych w badaniach.
Oznaczenie
Sucha masa
Materia organiczna
Jednostka
OŚ
BOŚ+S
TOŚ+S
g · kg-1
225,7
471,2
988,0
g · kg s.m.
504,5
648,1
536,4
6,35
4,19
4,83
3,04
6,12
3,34
46,38
26,22
28,00
32,77
21,97
29,45
2,18
4,14
5,45
390,5
294,1
378,9
-1
pH (H2O)
Przewodność elektrolityczna
mS · cm-1
N
P
g ∙ kg s.m.
-1
K
Crogólny
mg ∙ kg s.m.
-1
Dawka azotu, w pierwszym roku badań w obiektach nawożonych
wynosiła 1,35 g N∙wazon-1, przy czym w obiektach, w których zastosowano osad (OŚ) oraz jego przekształcone mieszaniny (BOŚ+S,
TOŚ+S), 80% dawki N wprowadzono z materiałami organicznymi,
185
Małgorzata Koncewicz-Baran, Kalina Orłowska, Krzysztof Gondek
a 20% w formie wodnego roztworu czystej chemicznie soli NH4NO3.
We wszystkich obiektach (oprócz obiektu bez nawożenia) uzupełniono do jednakowego poziomu wprowadzonego z nawożeniem fosfor (do 1,134 g P∙wazon-1) i potas (do 1,62 g K∙wazon-1) przy użyciu
wodnych roztworów czystych chemicznie soli Ca(H2PO4)2∙H2O oraz
KCl. W obiekcie, w którym zastosowano do nawożenia wyłącznie
sole mineralne azot, fosfor i potas zastosowano w formie: NH4NO3,
Ca(H2PO4)2∙H2O, KCl. W drugim roku badań w obiektach nawożonych zastosowano nawożenie mineralne azotem, fosforem i potasem
w formie wodnych roztworów związków, jakie stosowano w roku
pierwszym. Wprowadzone ilości składników wynosiły: 1,00 g N, 0,40
g P i 1,80 g K·wazon-1.
Rośliną testową w pierwszym roku badań był rzepak jary odmiany „Feliks”, który zebrano w końcu fazy kwitnienia, zaś w drugim
roku owies nagoziarnisty odmiany „Siwek” zebrany w fazie dojrzałości mlecznej ziarna. Plony zebrano z podziałem na części nadziemne
i korzenie, suszono do stałej wagi w temperaturze 70 oC, a następnie
określano plon suchej masy. Rozdrobniony materiał roślinny zmineralizowano na sucho w piecu komorowym (450 oC przez 5 h). Popiół
roztworzono w rozcieńczonym (1:2) HNO3. W uzyskanych roztworach oznaczono zawartość chromu metodą ICP-OES na aparacie Perkin Elmer Optima 7300DV.
W materiale glebowym oznaczono: odczyn potencjometrycznie
w zawiesinie gleby i roztworu KCl o stężeniu 1 mol∙dm-3, zawartość
ogólną chromu po spopieleniu substancji organicznej w piecu komorowym (500 °C przez 8 h) i mineralizacji próbek w mieszaninie (3:2 v/v)
stężonych HNO3 i HClO4, zawartość najłatwiej dostępnych dla roślin form chromu Crekstr (występujących w glebie w formie jonowej,
skompleksowanej, związanej wymiennie oraz z tlenkami Mn) wyekstrahowano roztworem NH2OH-HCl o stężeniu 1 mol·dm-3 i NH4-OAc
o stężeniu 1 mol·dm-3 [Zeien i Brümmer 1989]. W uzyskanych ekstraktach oznaczono zawartość chromu metodą ICP-OES na aparacie
Perkin Elmer Optima 7300DV.
Wyniki poddano ocenie statystycznej z uwzględnieniem analizy
wariancji jedno– lub dwuczynnikowej w zależności od analizowanego
parametru. Istotność różnic pomiędzy średnimi arytmetycznymi oszacowano za pomocą testu Tukey’a przy poziomie istotności α < 0,05.
186
Zawartość chromu w glebie i roślinach po zastosowaniu osadu ściekowego...
Wyniki i dyskusja
W obydwu latach badań w obiektach, w których zastosowano materiały organiczne (OŚ, BOŚ+S, TOŚ+S) uzyskano więcej biomasy
niż po zastosowaniu soli mineralnych (M) (ryc. 1). Przekształcone
mieszaniny osadu i słomy (BOŚ+S, TOŚ+S) wykazywały zbliżone oddziaływanie na ilość wytworzonej biomasy. Korzystniejsze oddziaływanie osadów ściekowych oraz kompostów i wermikompostów przygotowanych na ich bazie na plonowanie różnych roślin w porównaniu
do nawożenia mineralnego wykazali również Gondek i Filipek-Mazur
[2003], Jakubas [2006] oraz Vaca i in. [2011].
Obiekty doświadczenia jak w metodyce. *– średnie oznaczone tymi samymi literami
nie różnią się istotnie według testu t-Tukeya przy α < 0,05, czynnik: nawożenie.
Ryc. 1. Sumaryczne plony biomasy rzepaku jarego i owsa.
Zawartości chromu w roślinach były znacznie mniejsze od dopuszczalnej ilości w paszy wynoszącej 20 mg Cr ∙ kg-1 s.m. [Gorlach
i Gambuś] (tab. 2.). Zastosowane nawożenie nie zróżnicowało zawartości chromu w częściach nadziemnych rzepaku jarego i owsa. Najwięcej tego pierwiastka oznaczono w częściach nadziemnych owsa
z obiektu bez nawożenia (0). W przeprowadzonym przez Jakubus
[2006] doświadczeniu zastosowane w zbliżonej jak w prezentowanych badaniach dawce osady ściekowe nie wpłynęły na zwiększenie
zawartości chromu w nasionach i słomie gorczycy i łubinu białego.
187
Małgorzata Koncewicz-Baran, Kalina Orłowska, Krzysztof Gondek
Gondek i Filipek-Mazur [2003] także nie stwierdzili nadmiernej kumulacji tego pierwiastka w kukurydzy, owsie, rzepaku ozimym ani
słoneczniku po zastosowaniu osadu ściekowego i jego wermikompostów. Niewielką kumulację chromu roślinach uzasadnia się biernym
pobieraniem oraz niewielką mobilnością chromu trójwartościowego,
który jest dominującą formą w glebie (Czekała 1997).
Tab. 2. Zawartość chromu w biomasie rzepaku jarego i owsa.
Rzepak jary
Obiekty
Części nadziemne
Owies
Korzenie
Części nadziemne
Korzenie
mg Cr ∙ kg s.m.
-1
0
2,63 *
7,28 a
3,98 b
13,84 ab
M
2,81 a
16,86 b
2,89 a
17,06 bc
OŚ
2,35 a
10,45 ab
2,28 a
20,03 c
B OŚ+S
2,37 a
12,28 ab
2,15 a
14,14 ab
T OŚ+S
2,40 a
7,13 a
2,14 a
12,69 a
a
Obiekty doświadczenia jak w metodyce. * – średnie oznaczone tymi samymi literami w kolumnach nie różnią się istotnie według testu t-Tukeya przy α < 0,05, czynnik: nawożenie.
Korzenie rzepaku i owsa kumulowały kilkukrotnie więcej chromu w porównaniu do części nadziemnych tych roślin (tab. 2.). Największe ilości tego pierwiastka oznaczono w korzeniach rzepaku
jarego z obiektu, w którym zastosowano sole mineralne (M), zaś w
korzeniach owsa po zastosowaniu osadu ściekowego (OŚ). Spośród
materiałów organicznych najmniejszą ilość chromu w korzeniach roślin oznaczono po zastosowaniu mieszaniny osadu przekształconej
termicznie (TOŚ+S). Czekała [1997] tłumaczy gromadzenie chromu
w korzeniach roślin tworzeniem kompleksów i chelatów tego pierwiastka ze składnikami organicznymi ścian komórkowych, co ogranicza transport do części nadziemnych.
Największą wartość pH po pierwszym badań stwierdzono w glebie z dodatkiem mieszaniny osadu i słomy przekształconych biologicznie (BOŚ+S). Po drugim roku badań w glebach wszystkich obiektów
stwierdzono zmniejszenie wartości pH. Zastosowane osad ściekowy
oraz jego przekształcone mieszaniny nie wpłynęły na zwiększenie
zawartości chromu potencjalnie dostępnego dla roślin. Po drugim
188
Zawartość chromu w glebie i roślinach po zastosowaniu osadu ściekowego...
roku badań w glebie wszystkich obiektów oznaczono mniejsze ilości
tej formy chromu. Udział chromu wyekstrahowanego z gleby roztworem NH2OH-HCl i NH4-OAc w ogólnej zawartości pierwiastka nie
przekraczał 2,0 %. Brak zwiększenia zawartości potencjalnie dostępnych form chromu stwierdził również Gondek [2006] po doglebowej
aplikacji osadu ściekowego i jego kompostów oraz wermikompostów
pomimo znacznych ilości wprowadzonych tego pierwiastka.
Tab. 3. Odczyn i zawartość chromu wyekstrahowanego
z gleby roztworem NH2OH-HCl o stężeniu 1 mol·dm-3 i NH4-OAc
o stężeniu 1 mol·dm-3.
Rok 1.
Obiekty
pH KCl
Rok 2.
Crekstr
mg Cr ∙ kg s.m
-1
pH KCl
Crekstr
mg Cr ∙ kg-1 s.m
0
5,36f*
0,23 d* /1,8**
5,13bcd
0,14 abc / 1,1
M
5,13bcd
0,22 cd / 1,8
5,02 ab
0,11 a / 0,7
OŚ
5,29ef
0,19 bcd / 1,5
5,02 a
0,14 abc / 1,0
B OŚ+S
5,37f
0,18 abcd / 1,6
5,04abc
0,13 ab / 1,0
T OŚ+S
5,23de
0,19 bcd / 2,0
5,14cd
0,14 abc / 1,4
Obiekty doświadczenia jak w metodyce. * – średnie oznaczone tymi samymi literami nie
różnią się istotnie według testu t-Tukeya przy α < 0,05, czynniki: nawożenie i rok, ** –%
udział frakcji chromu wyekstrahowanego w ogólnej zawartości chromu.
Wnioski
1. W obydwu latach badań większe plony biomasy uzyskano po zastosowaniu osadu ściekowego i jego przekształconych mieszanin niż po
zastosowaniu soli mineralnych.
2. Zastosowane nawożenie nie zróżnicowało zawartości chromu
w częściach nadziemnych rzepaku jarego i owsa. Większe zawartości
tego pierwiastka stwierdzono w korzeniach niż w częściach nadziemnych roślin.
3. Nie stwierdzono zwiększenia zawartości najłatwiej dostępnych dla roślin form chromu po zastosowaniu osadu ściekowego oraz
przekształconych biologicznie i termicznie mieszanin osadu i słomy.
189
Małgorzata Koncewicz-Baran, Kalina Orłowska, Krzysztof Gondek
Literatura
1. Baran S., Turski R. 1996. Ćwiczenia specjalistyczne z utylizacji odpadów
i ścieków. Wydawnictwo Akademii Rolniczej w Lublinie.
2. Czekała J. 1997. Chrom w glebie i roślinie – występowanie, sorpcja
i pobieranie w zależności od jego formy i dawki, właściwości środowiska
i nawożenia. Wydawnictwo Akademii Rolniczej w Poznaniu, Rozprawy
Naukowe, 274.
3. Gondek K. 2006. Contents of various forms of cadmium, copper, lead and
chromium in soil after application of untreated and composted tannery sewage sludge. Plant, Soil and Environment 52 (5): 199–210.
4. Gondek K., Filipek-Mazur B., 2003 Biomass yields of shoots and roots of
plants cultivated in soil amended by vermicomposts based on tannery sludge
and content of heavy metals in plant tissues. Plant, Soil and Environment
49 (9): 402–409.
5. Gorlach E., Gambuś F. 2000. Potencjalnie toksyczne pierwiastki śladowe
(nadmiar, szkodliwość, przeciwdziałanie). Zeszyty Problemowe Postępów
Nauk Rolniczych. 472: 275–296.
6. Jakubus M. 2006. Ocena przydatności osadów ściekowych w nawożeniu roślin. Woda-Środowisko-Obszary Wiejskie, 6, 2(18): 87–97.
7. Ostrowska A., Gawliński A., Szczubiałka Z. 1991. Metody analizy i oceny
gleby i roślin. Wydawnictwo Instytutu Ochrony Środowiska, Warszawa.
8. Vaca R, Lugo J., Martínez R, Esteller M.V., Zavaleta H. 2011. Effects of
sewage sludge and sewage sludge compost amendment on soil properties
and Zea mays L. plants (heavy metals, quality and productivity). Revista
Internacional de Contaminación Ambiental. 27(4) 303–311.
9. Zeien H., Brümmer G. 1989. Chemische Extractionen zur Bestimmung von
Schwermetallbindungsformen in Böden. Bonner bodenkundliche Abhandlung. 59: 505–510.
mgr inż. Małgorzata Koncewicz-Baran
mgr inż. Kalina Orłowska
dr hab. inż. Krzysztof Gondek
Katedra Chemii Rolnej i Środowiskowej
Uniwersytet Rolniczy w Krakowie
31–120 Kraków, al. Mickiewicz 21
e-mail: [email protected]
Opiekun naukowy: dr hab. inż. Krzysztof Gondek, prof. UR
190
Marcin Czora
Tomasz Czech
EPISTEME
18/2013, t. 3
s. 191–197
ISSN 1895-2241
FITOTOKSYCZNY WPŁYW PLATYNY
NA PIEPRZYCĘ SIEWNĄ
EXAMINATION OF PLATINUM PHYTOTOXICITY
TO LEPIDIUM SATIVUM
Abstrakt. Ocena oddziaływania toksycznego substancji na organizmy żywe
opiera się głównie na analizie fizyko-chemicznej. Jednak metody fizyko-chemiczne mają swoje ograniczenia, np. nie odzwierciedlają ewentualnych
przemian substancji oraz ich wzajemnych oddziaływań. Fitotoksyczność to
zdolność związku do czasowego lub długotrwałego uszkodzenia roślin. Pod
pojęciem tym rozumiemy opóźnienie kiełkowania roślin, hamowanie wzrostu roślin lub inne negatywne skutki spowodowane związkiem chemicznym
(fitotoksyną). Objawy fitotoksyczności mogą ujawnić się na całej roślinie lub
jej części: korzeniu, pędach, liściach, kwiatach lub owocach. Test fitotoksyczności polega na pomiarze hamowania wzrostu korzeni po pierwszych trzech
dobach kiełkowania. W szalkach Petriego umieszczono po 25 nasion pieprzycy siewnej (Lepidium sativum). Do podlewania nasion użyto roztworów
chlorku platyny (PtCl4) o różnych stężeniach.
Słowa kluczowe: platyna, fitotoksyczność, pieprzyca siewna
Summary. Evaluation of biotoxicity was based mostly on analysis of physic-chemical parameters. However, using of physic-chemical methods for assessment of environmental impact has limitations, e.g. they do not reflect
possible transformations of hazardous substances and their bioavailability
affected by various factors. Phytotoxicity is the capacity of a compound to
cause temporary or long lasting damage to plants. Phytotoxicity is defined as
a delay of seed germination, inhibition of plant growth or any adverse effect
on plants caused by specific substances (phytotoxins). The symptoms may affect the whole plant or any part of the plant. The phytotoxicity test was based
on measurement of inhibition of root growth after first three days of germination period. Number of Petri dishes contained 25 seeds of garden cress
(Lepidium sativum) in which they were germinated on the filtration paper. The
concentration of platinum (PtCl4) was a different in each Petri dish.
Key words: platinum, phytotoxicity, garden cress Lepidium sativum
191
Marcin Czora, Tomasz Czech
WSTĘP
W 2000 roku na polskich drogach jeździło prawie 10 mln zarejestrowanych pojazdów osobowych, w 2011 roku było ich już ponad
18 mln. Przeciętnie przybywa rocznie 700 tysięcy nowych pojazdów.
Równocześnie zwiększyła się liczba innych środków transportu [GUS
2012]. Oprócz niewątpliwych korzyści, transport samochodowy stanowi poważne zagrożenie dla środowiska. Drogi i autostrady przecinają szlaki migracyjne zwierząt. Liczba zwierząt przejechanych bądź
potrąconych przez samochody jest trudna do oszacowania. Innym
czynnikiem jest wytwarzanie spalin samochodowych. Pojazdy spalinowe stanowią jedno z podstawowych źródeł zanieczyszczeń gazowych powietrza, w szczególności tlenków azotu NOx – 43% całkowitej emisji tlenków azotu w 2011 roku [GUS 2012].
Wraz ze zwiększaniem liczby samochodów oraz ilością wydzielanych spalin wprowadzano normy emisji spalin do środowiska. Pierwsze takie normy wprowadzono w latach 70. ubiegłego wieku, w Stanach
Zjednoczonych. Z biegiem lat kolejne państwa wprowadzały własne
normy, które stopniowo modyfikowano, np. normy ECE-15.01 do ECE15.04 [Jaroszek i Wieszała 2011]. Wprowadzenie w Unii Europejskiej
Norm Euro pozwoliło na zmniejszenie emitowanych zanieczyszczeń
w spalinach o 80–90% [Ntziachristos i Samaras 2009]. Zmniejszenie
zanieczyszczeń odbywało się poprzez użyciu reaktorów katalitycznych
montowanych w samochodach, popularnie nazywanych katalizatorami. Ich stosowanie wiążę się jednak z dodatkową emisją rzadkich metali (platyny, rodu i palladu) do środowiska. Szybko zaczęto stwierdzać
śladowe ilości tych metali w glebie w pobliżu tras komunikacyjnych.
Wykrycie platynowców w środowisku dało impuls do intensywnych
badań nad ich bioakumulacją i wpływem na zdrowie ludzi.
Ocena zagrożenia substancjami chemicznymi przez długi czas
opierała się głównie na pomiarze parametrów fizyko-chemicznych.
Jednakże, przy użyciu fizykochemicznych metod ocena oddziaływania związku na środowisko ma swoje ograniczenia, np. nie odzwierciedla możliwych przemian substancji, interakcje z innymi
substancjami, w tym, ze składnikami glebowymi, jak również ich biodostępność [Hlavinek 2008]. Dla rzetelnej oceny wpływu substancji
na środowisko wykonuje się ocenę ich toksyczności dla organizmów
192
Fitotoksyczny wpływ platyny na pieprzycę siewną
żywych. Szczególnie polecane są badania fitotoksyczności z użyciem
roślin wyższych, jako indykatorów toksycznego wpływu substancji
chemicznej. W pracach laboratoryjnych, testy biologiczne stają się
konkurencyjne w stosunku do standardowo stosowanych analiz fizycznych i chemicznych.
MATERIAŁ I METODY
Do oceny fitotoksyczności chlorku platyny (PtCl4) wykorzystano test
Wschodów i Wzrostu Siewek według procedury OECD 208 [2006].
Testowaną rośliną w procedurze jest pieprzyca siewna (Lepidium sativum). Lepidium sativum znana jest popularnie jako rzeżucha, rzeżucha ogrodowa, rzeżucha siewna lub rukiew; jako że Lepidium sativum należy do innego rodzaju niż wspomniane „rzeżuchy”. W tekście
używana jest jej nazwy gatunkowa – pieprzyca siewna.
W szalkach Petriego umieszczono krążki bibułowe zwilżone kolejno następującymi stężeniami platyny: 0,5 mg; 1mg; 5 mg; 10mg;
20 mg Pt/dm3. Po 25 nasion pieprzycy umieszczono na zwilżonych
krążkach bibułowych i inkubowano w cieplarce przez 72 h w temperaturze 25 ± 0,5oC w warunkach braku dostępu światła. Kontrolę
stanowiły nasiona rozwijające się na krążkach zwilżonych wodą destylowaną. W trakcie inkubacji okresowo uzupełniano straty wody
(1cm3 wody destylowanej co 24h). Test fitotoksyczności prowadzono
w trzech powtórzeniach dla każdego ze stężeń.
Pod wpływem związków cytotoksycznych występuje inhibicja
procesów podziałowych komórek merystematycznych korzeni, co prowadzi do zahamowania ich rozwoju, a w rezultacie skrócenia długości
korzenia [ Gong i in. 2001; Maila i Cloete 2002; Walter i in. 2006].
Po inkubacji nasion określono energię kiełkowania, wyrażając ją
jako iloraz ilości nasion skiełkowanych do ilości nasion wysianych,
oraz dokonano pomiarów długości korzeni rośliny testowej. Toksyczność (lub stymulację) określono dwoma parametrami:
– jako procent skiełkowanych nasion:
% S = 100 · (Nw – Nns)/Nw
gdzie Nw i Nns są liczbą nasion wysianych i nasion nieskiełkowanych.
– jako procent inhibicji (lub stymulacji) w odniesieniu do kontroli:
193
Marcin Czora, Tomasz Czech
% I = 100 · (Lk – Lt)/Lk
gdzie Lk i Lt są sumą średnich długości korzeni odpowiednio w kontroli i próbie testowej.
WYNIKI I DYSKUSJA
Po trzech dniach inkubacji dokonano pomiarów długości korzeni siewek. Wykonane pomiary przydzielono do przedziałów długości (każdy przedział miał 0,5 cm), a na ich podstawie opracowano histogramy
(Rys. 1.). Otrzymane wyniki pozwoliły na obliczenie wskaźnika skiełkowania nasion oraz procent inhibicji długości korzenia (Tab. 1.).
Tab. 1. Procent nasion skiełkowanych oraz procent inhibicji wzrostu
korzenia w zależności od stężenia platyny w roztworze.
Stężenie platyny
Kontrola
0,5 mg Pt/dm3
1 mg Pt/dm3
5 mg Pt/dm3
10 mg Pt/dm3
20 mg Pt/dm3
Liczba nasion
skiełkowanych
%S
Średnia długość
korzeni [cm]
0
1
1
1
22
25
100
96
96
96
12
0
3,75
5,23
4,62
3,49
0,33
0,25
%I
39,5
23,2
-6,9
-91,2
-93,3
Chlorek platyny (PtCl4) oddziałuje w rożny sposób na kiełkujące nasiona pieprzycy siewnej (Lepidium sativum). Przy niskich stężeniach mamy do czynienia ze stymulacją wzrostu. Obliczona stymulacja wzrostu jest powiązana z małym wzrostem korzeni w kontroli
(z użyciem wody destylowanej). Inhibicja wzrostu korzeni jest zauważalna przy stężeniach 5 mg Pt/dm3 i wyższych. Przy stężeniach 10 mg Pt/
dm3 oraz 20 mg/dm3 występuje najwyższy wskaźnik inhibicji korzeni.
Wrażliwość pieprzycy siewnej (Lepidium sativum) na czynniki
fitotoksyczne stwarza możliwość zastosowania tego gatunku w testach biologicznych do oceny stanu środowiska. Badania z wykorzystaniem tego gatunku są szeroko stosowane do wstępnej, szybkiej
i taniej oceny fitotoksyczności gleby spowodowanej metalami ciężkimi [Arambasic i in. 1995], związkami ropopochodnymi, czy wielopierścieniowymi węglowodorami aromatycznymi [Oleszczuk 2008].
194
Rys. 1. Średnia liczba korzeni w poszczególnych przedziałach długości
(w cm), w zależności od stężenia platyny w roztworze.
Fitotoksyczny wpływ platyny na pieprzycę siewną
195
Marcin Czora, Tomasz Czech
WNIOSKI
1. W zaprezentowanych badaniach wstępnych udało się ustalić zakres stężeń, przy których występuje inhibicja wzrostu korzeni oraz
kiełkowania nasion, co w przyszłości pozwoli na wykonanie dokładniejszych badań w tym zakresie stężeń. Rozszerzone badania pozwolą na obliczenia stężeń letalnych, efektywnych i progowych.
2. Inhibicja wzrostu korzeni jest zauważalna przy stężeniach
5 mg Pt/dm3 i wyższych.
3. Przy stężeniach 10 mg Pt/dm3 oraz 20 mg/dm3 występują najwyższe wskaźniki inhibicji korzeni.
4. Wrażliwość Lepidium sativum na czynniki fitotoksyczne stwarza możliwość zastosowania tego gatunku w testach biologicznych
i może stanowić wartościowe uzupełnienie metod fizykochemicznych.
LITERATURA
1. Arambašić M. B., Bjelić S., Subakov G., 1995. Acute toxicity of heavy metals
(copper, lead, zinc), phenol and sodium on Allium cepa L., Lepidium sativum
L. and Daphinia magna St.: comparative investigation and the practical applications, Pergamon, 2: 497–503.
2. Gong P., Wilke B.-M., Strozzi E., Fleischmann S., 2001. Evaluation and refinement of a continuous seed germination and early seedling growth test the
use in the ecotoxicological assessment of soil, Chemosphere, 44: 491 – 500
3. GUS 2012 Mały Rocznik Statystyczny Polski, Warszawa.
4. Hlavinek P., 2008. Dangerous pollutants (Xenobiotics) in Urban Water Cycle.
Springer.
5. Jaroszek M., Wieszała R., 2011. Wpływ prędkości pojazdu na wielkość emisji spalin na miejskim odcinku drogowym, Zeszyty naukowe Politechniki
Śląskiej, seria: Transport z. 70, nr kol.1835: 37–44.
6. Maila M. P., Cloete T. E., 2002. Germination of Lepidium sativum as a method to
evaluate polycyclic aromatic hydrocarbons (PAHs) removal from contaminated
soil, International Biodeterioration and biodegradation, 50: 107–113.
7. Ntziachristos L., Samaras Z., 2009, EMEP/EEA emission inventory guidebook, Ateny.
8. Oleszczuk P., 2008. Phytotoxicity of municipal sewage sludge composts related to physico-chemical properties, PAHs and heavy metals. Ecotoxicology
and Environmental Safety 69: 496–505.
196
Fitotoksyczny wpływ platyny na pieprzycę siewną
9. OECD 208. 2006. Terrestrial Plant Test: Seedling Emergence and Seedling
Growth Test, Paris.
10. Walter I., Martínez, Cala V., 2006. Heavy metal speciation and phytotoxic
effect of three sewage sludge’s for agricultural uses. Environmental Pollution, 139: 507–514
mgr Marcin Czora
Katedra Chemii Rolnej i Środowiskowej
Uniwersytet Rolniczy w Krakowie
31–120 Kraków, al. Mickiewicza 21, pok. 348
e-mail: [email protected]
dr Tomasz Czech
Katedra Chemii Rolnej i Środowiskowej
Uniwersytet Rolniczy w Krakowie
31–120 Kraków, al. Mickiewicza 21, pok. 347
e-mail: [email protected]
Opiekun naukowy: Prof. dr hab. inż. Florian Gambuś
197
Mateusz MALINOWSKI
EPISTEME
18/2013, t. 3
s. 199–208
ISSN 1895-2241
ANALIZA DOSTĘPNOŚCI KOMUNIKACYJNEJ
POWIATÓW WOJEWÓDZTWA MAŁOPOLSKIEGO
ANALYSIS OF THE COMMUNICATION ACCESSIBILITY
IN THE COUNTIES OF MAŁOPOLSKA REGION
Abstrakt. W artykule przeprowadzono analizę dostępności do infrastruktury komunikacyjnej wyrażonej wskaźnikami nasycenia infrastruktury
drogowej oraz wskaźnikiem dostępności komunikacyjnej – Wpoparea. Drugi
wskaźnik uwzględnia nie tylko powierzchnię analizowanego obszaru, ale
również liczbę ludności i jakość sieci transportowej. Analizę przeprowadzono dla dróg w powiatach województwa małopolskiego. Badania dotyczą lat
2001 i 2011. Celem badań było określenie zmian, które nastąpiły w gęstości sieci drogowej oraz dostępności do tej sieci. Z przeprowadzonej analizy wynika, że w każdym z powiatów województwa małopolskiego nastąpił
wzrost nasycenia infrastrukturą drogową (największy w powiatach suskim
i tatrzańskim oraz w Krakowie i Tarnowie). Pomimo wzrostu gęstości sieci
drogowej w większości powiatów nie wzrosła dostępność komunikacyjna.
W 14 z 22 analizowanych powiatów wartość wskaźnika WPOPAREA obniżyła się, co między innymi było efektem wzrostu liczby ludności i zmian
w zaklasyfikowaniu niektórych ciągów komunikacyjnych.
Słowa kluczowe: dostępność komunikacyjna, infrastruktura drogowa, wskaźnik nasycenia infrastrukturą
Summary. This article analyzes accessibility to road infrastructure measured
by road infrastructure density rate and communication accessibility index –
Wpoparea. The second index takes into account not only the area, but also the
population and the transport network quality. The analysis was conducted for
the roads in Malopolska counties. Studies relate to years 2001 and 2011. The
aim of the study was to identify changes, which occurred in the density of the
road network and its accessibility. The analysis shows that road infrastructure
density increased in each of the counties (the highest increase in: Suski and
Tatrzański, Krakow city and Tarnow city). This increase did not have a direct
impact on the communication accessibility. In 14 out of 22 analyzed counties
the value of Wpoparea rate decreased, which was the result of population growth
and changes of the roads classification in these counties.
Key words: communication accessibility, road infrastructure, infrastructure
density rate
199
Mateusz Malinowski
Wstęp
Zgodnie z danymi GUS, całkowita długość dróg publicznych w Polsce na dzień 31 XII 2009 roku wynosiła 384,8 tys. km (o 0,4% więcej niż w 2008 r.). Gęstość dróg o nawierzchni twardej wynosiła
85,8 km.100 km-2. Największe nasycenie infrastruktury drogowej,
mierzone długością dróg w przeliczeniu na 100 km2 powierzchni
regionu, charakteryzuje województwa śląskie i małopolskie (ponad
150 km.100km-2), zaś najmniejsze nasycenie cechuje województwa
lubuskie, podlaskie, zachodniopomorskie i warmińsko-mazurskie
(poniżej 60 km.100km-2). Od 2006 roku wzrasta w Polsce długość autostrad i dróg ekspresowych (łącznie 1800 km w 2011 roku). Długość
dróg o najwyższej klasie w przeliczeniu na 1000 km2 wynosi aktualnie 5,7 km (średnia dla krajów członkowskich UE przekracza wartość
13 km).
W latach 2007–2011 nastąpił dynamiczny rozwój sieci drogowej
w Polsce, co było związane z realizacją projektów transportowych
współfinansowanych ze środków UE w ramach okresu finansowania
2004–2006 oraz rozpoczęciem realizacji projektów w ramach perspektywy finansowej 2007–2013. Jednym z instrumentów wspierających rozwój budowy sieci dróg (szczególnie na obszarach wiejskich)
był również „Narodowy Program Przebudowy Dróg Lokalnych 2008–
2011” przyjęty Uchwałą Nr 233/2008 Rady Ministrów z dnia 28 października 2008 r. Program pomagał samorządom w przebudowie lub
budowie dróg lokalnych (gminnych i powiatowych).
Analizy dotyczące dostępności komunikacyjnej realizowane są
zazwyczaj w obszarze badań nad gospodarką przestrzenną w celu
określenia różnic pomiędzy regionami. W porównaniu z krajami europejskimi o podobnej strukturze przestrzennej, Polska charakteryzuje się stosunkowo wysokim nasyceniem siecią dróg publicznych.
Problem stanowi natomiast jakość i stan techniczny tej infrastruktury [Domańska 2006, Janecki i Krawiec 2009, Kalinowski 2005].
Spiekermann i Neubauer [2002] na potrzeby analiz przestrzennych
zdefiniował dostępność komunikacyjną, jako główny produkt systemu transportowego, który determinuje korzystność lokalizacji danego obszaru (regionu, miasta lub trasy) w relacji do innych obszarów.
Wzrost dostępności powoduje wiele pozytywnych interakcji, sprzyja
200
Analiza dostępności komunikacyjnej powiatów województwa małopolskiego
rozwojowi handlu i przemysłu [Koźlak 2008]. Istnieją różne metody
szacowania dostępności transportowej [Komornicki i in. 2008]:
• dostępność wyrażana jako wyposażenie infrastrukturalne,
realizowana za pomocą wskaźników nasycenia infrastrukturalnego danego obszaru (gęstością sieci drogowej),
• dostępność wyrażana bezpośrednią odległością fizyczną,
czasową lub ekonomiczną do celu lub zbioru celów podróży,
• dostępność wyrażana izochronami, wyznaczana przez oszacowanie zbioru celów podróży dostępnych w określonym
czasie i kosztach podróży,
• dostępność mierzona w geografii czasoprzestrzeni, otrzymywana przez porównanie alternatywnych ścieżek podróży
między źródłem, a celem podróży,
• dostępność mierzona jako maksymalizacja użyteczności,
wyznaczana indywidualnie na podstawie zachowań użytkowników systemu transportowego.
Klasyczna miara dostępności podana przez Harrisa, a następnie
rozwinięta przez Hansena [1959], opisuje dostępność Xi w rejonie
i poprzez tzw. „funkcję tarcia” uwzględniającą składniki: atrakcji Dj
i przeszkody f(cij):
(1)
Podstawowa miara dostępności przestrzennej w regionie Xi wyrażana jest przez czas przejazdu (w godzinach lub minutach) pomiędzy
punktem źródłowym i docelowym tij w odniesieniu do powierzchni
tego regionu s. Można ją wyrazić zmodyfikowanym wzorem podanym w opracowaniu Hansena [1959]:
(2)
W Polsce przestrzenne zróżnicowanie dostępności komunikacyjnej opisuje się na podstawie analizy wskaźnika nasycenia infrastrukturą drogową. Wskaźnik ten nie uwzględnia jakości dróg, a także
aspektu dostępu społeczności lokalnej do tej infrastruktury.
201
Mateusz Malinowski
Celem przeprowadzonych badań była analiza zmian przestrzennego zróżnicowania dostępności komunikacyjnej dla powiatów województwa małopolskiego, mierzonej wskaźnikami opracowanymi
przez IGiPZ w Warszawie. Zmiany wartości wskaźników dostępności komunikacyjnej zostały porównane ze wskaźnikami określającymi gęstość sieci drogowej. Badania wykonano dla roku 2001 i 2011,
w celu określenia różnic, jakie nastąpiły w wyniku dofinansowania
infrastruktury drogowej środkami z UE i budżetu państwa w ostatnich latach. Do badań wybrano województwo małopolskie, ze względu na niemal najwyższy poziom nasycenia infrastrukturą drogową
w Polsce i wysoki wskaźnik WPOPAREA obliczony w stosunku do pozostałych województw Polski (1,06) [Komornicki i in. 2008].
Materiał i metoda
Szkielet komunikacyjny województwa małopolskiego tworzą dwa
szlaki stanowiące fragmenty ciągów międzynarodowych drogi E77
relacji Gdańsk – Warszawa – Kraków – Budapeszt oraz drogi E40,
w ciągu której zlokalizowana jest autostrada A4, stanowiąca fragment
transeuropejskiego korytarza Berlin – Kijów. Podstawowy układ drogowy województwa tworzą drogi krajowe, o łącznej długości 1023 km
i drogi wojewódzkie o długości 1413 km, (w tym 551 km przebiega przez obszary miejskie). Układ uzupełniający, stanowiący ważny
element komunikacji wewnętrznej regionu, tworzą drogi powiatowe
o łącznej długości 6611 km oraz drogi gminne o łącznej długości 19
589 km.
Dane do analizy pozyskano z Banku Danych Lokalnych, Głównego Urzędu Statystycznego. Dane dotyczyły długości różnych klas
dróg (razem z drogami gruntowymi) w latach 2001 i 2011.
Dostępność transportową obliczono zgodnie z algorytmem opracowanym przez Komornickiego i in. [2008]. W algorytmie wyróżniono trzy modalne wskaźniki dostępności do sieci drogowej (można je
analizować w różnych typów infrastruktury komunikacyjnej):
1. WPOP – wyposażenie powiatu i w infrastrukturę drogową S w stosunku do liczby mieszkańców (POP) ważone ilością i jakością dróg
w odniesieniu do wyposażenia większej jednostki niż analizowana
(województwo j)
202
Analiza dostępności komunikacyjnej powiatów województwa małopolskiego
(3)
gdzie:
Sc – długość dróg w powiecie i województwie (wszystkich klas: A –
autostrad,
E – ekspresowych, Kr – krajowych, P – powiatowych, G – gminnych)
[km],
(gdzie:
L – długość poszczególnych klas dróg [km], wx – wskaźnik przeliczeniowy
maksymalnych prędkości dla poszczególnych klas dróg: A – 2,33; E – 2, Kr
i P – 1,5, G – 1).
2. WAREA – wyposażenie powiatu i w infrastrukturę drogową S w stosunku do powierzchni analizowanego obszaru (AREA) ważone ilością
i jakością dróg w odniesieniu do wyposażenia większej jednostki niż
analizowana (województwo j)
(4)
3. WPOPAREA – (wskaźnik średnioważony)
(5)
Wskaźnik nasycenia infrastrukturą drogową w każdym z powiatów obliczono ze wzoru:
.
Sc
100km-2]
[km
d (i ) =
AREA(i )
×100
(6)
203
Mateusz Malinowski
Wyniki
W latach 2001–2011 na terenie województwa małopolskiego nie nastąpiły znaczące zmiany w powierzchni poszczególnych powiatów,
wzrosła natomiast o 110 tys. osób liczba ludności i o ponad 3200
km długość dróg. W tabeli 1 przedstawiono nasycenie infrastrukturą drogową, wskaźniki dostępności komunikacyjnej WPOP oraz WAREA,
a także zmiany wartości tych wskaźników, które nastąpiły w okresie
2001–2011 w powiatach woj. małopolskiego.
Wskaźnik nasycenia infrastrukturą drogową przyjmuje najwyższe wartości zarówno w 2001, jak i w 2011 roku w miastach grodzkich (ponad 400 km.100km-2). Ponadto wysokie wartości wskaźnika
zaobserwowano w powiatach sąsiadujących z Krakowem oraz chrzanowskim, oświęcimskim, wadowickim i nowosądeckim. W każdym
z powiatów, w analizowanym okresie nastąpił wzrost gęstości sieci
drogowej (w największym stopniu w powiatach: suskim, tatrzańskim, brzeskim i dąbrowskim oraz grodzkich: krakowskim i tarnowskim). Wzrost gęstości sieci drogowej wynikał bezpośrednio z faktu budowy wielu kilometrów nowych dróg. Rozkład przestrzenny
wartości wskaźnika WAREA w województwie małopolskim, zarówno
w 2001 jak i 2011 roku przedstawia się podobnie jak nasycenie infrastrukturą drogową. Największe wartości wskaźnika charakteryzują
miasta grodzkie oraz powiaty sąsiadujące z Krakowem, najmniejsze
zaś powiaty centralne i południowe (limanowski, brzeski, myślenicki,
tatrzański). Zmiany wartości wskaźnika liczone jako różnica pomiędzy 2011 i 2001 rokiem, w 14 powiatach są ujemne. Fakt ten spowodowany jest między innymi zmianami dokonanymi w klasyfikacji
dróg (część szlaków komunikacyjnych o wyższej randzie dróg zostało zamienionych na drogi niższej klasy), a także budową dużej ilości
dróg gminnych (w stosunku do dróg powiatowych). W powiatach,
w których różnica pomiędzy wskaźnikami WAREA jest ujemna, różnica
pomiędzy wskaźnikami WPOP z 2011 i 2001 roku także jest ujemna.
W przypadku wskaźnika WPOP obniżenie się wartości wskaźników,
wynikało ze wzrostu liczby mieszkańców. Wskaźnik WPOP charakteryzuje dostępność komunikacyjną w odniesieniu do liczby ludności
zamieszkującej poszczególne powiaty. Najniższe wartości przyjmuje
on w powiatach o największej gęstości zaludnienia (miastach grodz204
B – 2011 rok
Źródło: Opracowanie własne.
Rys. 1. Przestrzenny rozkład dostępności komunikacyjnej w województwie małopolskim
A – 2001 rok
Analiza dostępności komunikacyjnej powiatów województwa małopolskiego
205
206
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
L.p.
bocheński
brzeski
chrzanowski
dąbrowski
gorlicki
krakowski
limanowski
M. Kraków
M. Nowy Sącz
M. Tarnów
miechowski
myślenicki
nowosądecki
nowotarski
olkuski
oświęcimski
proszowicki
suski
tarnowski
tatrzański
wadowicki
wielicki
Małopolska
Powiat
6267
3285
-1263
1116
3019
23885
8810
1195
-128
-6492
-1448
9073
16356
10194
-7029
3131
282
3003
16685
2402
4551
13634
110528
Zmiana
liczby
ludności
Wskaźnik nasycenia infrastrukturą
2001
2011
Zmiana
km.100km-2
km.100km-2
km.100km-2
137,59
143,99
6,40
140,08
174,86
34,77
227,47
232,02
4,55
160,09
209,49
49,40
165,47
167,25
1,78
212,22
220,50
8,28
117,73
140,79
23,06
406,61
463,91
57,31
482,11
491,03
8,93
483,61
546,39
62,78
163,09
188,89
25,80
115,11
126,67
11,56
205,88
210,87
4,99
157,02
164,31
7,28
156,12
162,93
6,81
209,37
210,15
0,78
236,47
254,53
18,06
136,14
265,12
128,98
182,58
193,68
11,10
80,78
141,46
60,68
233,12
258,98
25,86
228,57
230,63
2,06
179,26
200,07
20,8
2001
1,08
1,12
0,79
1,74
1,77
1,30
1,12
0,22
0,38
0,35
2,61
0,85
1,93
1,50
1,05
0,66
2,76
1,36
1,58
0,68
1,20
1,14
1,00
WPOP
2011 Zmiana
1,00
-0,08
1,23
0,11
0,76
-0,04
2,04
0,30
1,65
-0,12
1,15
-0,15
1,14
0,02
0,23
0,01
0,37
-0,01
0,38
0,04
2,83
0,22
0,79
-0,06
1,70
-0,23
1,37
-0,13
1,04
-0,01
0,62
-0,03
2,69
-0,07
2,29
0,93
1,50
-0,08
1,04
0,36
1,17
-0,03
0,92
-0,22
1,00
0,00
2001
0,78
0,79
1,29
0,90
0,91
1,18
0,65
2,34
2,64
2,70
0,93
0,67
1,12
0,85
0,91
1,18
1,36
0,75
1,00
0,44
1,31
1,27
1,00
WAREA
2011
Zmiana
0,73
-0,05
0,87
0,08
1,18
-0,11
1,04
0,14
0,84
-0,06
1,11
-0,07
0,69
0,04
2,42
0,08
2,44
-0,20
2,73
0,03
0,96
0,02
0,65
-0,02
1,04
-0,08
0,79
-0,06
0,88
-0,03
1,08
-0,11
1,29
-0,07
1,27
0,52
0,95
-0,05
0,68
0,23
1,30
-0,01
1,17
-0,10
1,00
0,00
Tab. 1. Charakterystyka wskaźników opisujących dostępność komunikacyjną
w powiatach województwa małopolskiego . Źródło: Opracowanie własne, na podstawie danych z GUS
Mateusz Malinowski
Analiza dostępności komunikacyjnej powiatów województwa małopolskiego
kich oraz powiatach: chrzanowskim, oświęcimskim i myślenickim).
Najwyższe wartości wskaźnik WPOP przyjmuje w powiatach miechowskim i proszowickim (w obu analizowanych okresach) oraz w suskim
i dąbrowskim (w 2011 roku).
Na rysunku 1 zilustrowano rozkład przestrzenny średnioważonego wskaźnika dostępności komunikacyjnej WPOPAREA w latach 2001
i 2011. Najwyższe wartości wskaźnik przyjmuje w powiatach miechowskim i proszowickim (oraz suskim w 2011 roku), a także we wschodniej części województwa. Największy wzrost wskaźnika odnotowano
w powiecie suskim, tatrzańskim oraz dąbrowskim. Największy spadek
dostępności komunikacyjnej nastąpił w powiatach: wielickim i nowosądeckim. Podobnie jak w przypadku wskaźników WPOP oraz WAREA
w 14 powiatach Małopolski wartości wskaźnika WPOPAREA obniżyła się.
Dyskusja i wnioski
Z przeprowadzonych badań wynika, iż województwo małopolskie
jest silnie zróżnicowane pod względem gęstości i dostępności do sieci
drogowej. W latach 2001–2011 we wszystkich powiatach województwa małopolskiego nastąpił wzrost nasycenia infrastrukturą drogową
(największy w powiatach suskim, tatrzańskim oraz miastach: Kraków
i Tarnów). Pomimo wzrostu gęstości sieci drogowej w większości powiatów nie wzrosła dostępność komunikacyjna. Jedynie w powiatach,
w których zmiana wskaźnika nasycenia infrastrukturą drogową przekroczyła 20 km . 100km-2 dostępność komunikacyjna zwiększyła się
(w powiatach tych nie nastąpił również znaczący wzrost liczby ludności). Do najważniejszych wniosków z przeprowadzonej analizy należą:
• największa dostępność komunikacyjna cechuje powiaty miechowski i proszowicki, najmniejsza zaś powiaty myślenicki, tatrzański i miasto Kraków.
• powiaty o dużym nasyceniu infrastrukturą drogową nie posiadają najwyższych wskaźników dostępności komunikacyjnej (miasta grodzkie),
• główną przyczyną obniżenia się dostępności komunikacyjnej w większości powiatów, był przyrost liczby ludności
(w stosunku do długości nowych dróg) oraz przekwalifikowanie klas dróg głównie z powiatowych na gminne.
207
Mateusz Malinowski
Literatura
1. Domańska A. 2006. Wpływ infrastruktury transportu drogowego na rozwój
regionalny. PWN, Warszawa.
2. Hansen W. 1959. How accessibility shapes land use. Journal of the American Institute of Planners, Nr 25.
3. Janecki R., Krawiec S. 2009. Problemy dostępności przestrzennej we współczesnej polityce transportowej. Transport Miejski i Regionalny.
4. Koźlak A. 2008. Ekonomika transportu. Teoria i praktyka gospodarcza. Wydawnictwo Uniwersytetu Gdańskiego, Gdańsk.
5. Kalinowski T. 2005. Atrakcyjność inwestycyjna województw i podregionów
Polski 2005. Instytut Badań nad Gospodarką Rynkową, Gdańsk.
6. Komornicki T., Śleszyński P., Pomianowski W., Rosik P., Siłka P., Stępniak
M., 2008. Opracowanie metodologii liczenia wskaźnika międzygałęziowej
dostępności transportowej terytorium Polski oraz jego oszacowanie. PAN
IGIPZ. Warszawa.
7. Spiekermann K., Neubauer J. 2002. European Accessibility and Peripherality. Concepts, Models and Indicators. Nordregio, Stockholm.
mgr inż. Mateusz Malinowski
Uniwersytet Rolniczy w Krakowie
Instytut Inżynierii Rolniczej i Informatyki
ul. Balicka 116b, 30–149 Kraków
e-mail: [email protected]
Promotor: prof. dr hab. inż. Stanisław Gruszczyński
208
Monika Mierzwa, Krzysztof Gondek
Kalina Orłowska
Małgorzata Koncewicz-Baran
EPISTEME
18/2013, t. 3
s. 209–216
ISSN 1895-2241
OCENA ZAWARTOŚCI NIKLU I MANGANU
W MISZANINIE OSADU ŚCIEKOWEGO
Z RÓŻNYMI MATERIAŁAMI ORGANICZNYMI
PO PRZEKSZTAŁCENIU TERMICZNYM
I BIOLOGICZNYM
ASSESSMENT OF NICKEL AND MANGANESE
CONTENT IN SEWAGE SLUDGE MIXED WITH
DIFFERENT ORGANIC MATERIALS CONVERTED
THERMALLY AND BIOLOGICALLY
Abstrakt. Wartość nawozowa osadów ściekowych jest uwarunkowana
sposobem przekształcenia oraz rodzajem dodawanych materiałów w celu
poprawy ich właściwości fizycznych. Stosowane metody przeróbki osadów
ściekowych nie zapewniają jednak usunięcia zawartych w nich pierwiastków śladowych i z tego względu istnieje konieczność monitorowania jakości
uzyskanych materiałów. Celem pracy była ocena zawartości niklu i manganu
w osadzie ściekowym oraz mieszaninach osadu z różnymi materiałami organicznymi, przekształconych biologicznie i termicznie. Na podstawie uzyskanych wyników stwierdzono, że w wyniku przekształcenia biologicznego
i termicznego mieszanin nastąpiło zmniejszenie zawartości materii organicznej. Dodatek komponentów strukturotwórczych do osadu ściekowego
spowodował efekt rozcieńczenia zawartości oznaczanych pierwiastków
śladowych. Oznaczona zawartość niklu i manganu w badanych materiałach
przekształconych termicznie i biologicznie nie wyklucza ich wykorzystania
do celów rolniczych i rekultywacyjnych.
Słowa kluczowe: Osad ściekowy, przekształcenie biologiczne, przekształcenie
termiczne
Summary. The fertilizing value of sewage sludge depends not only on its
chemical composition, but also on structure-forming components which are
added to converted mass in order to improve its physical properties. The
methods applied for sewage sludge do not guarantee removal of the con209
Monika Mierzwa, Krzysztof Gondek, Kalina Orłowska, Małgorzata Koncewicz-Baran
tained trace elements, and for this reason there exists a need for monitoring
of the quality of the resultant materials. The aim of the study was to determine the content of organic matter as well as nickel and manganese in biologically and thermally transformed sludge. The obtained results showed,
that processes of biological and thermal transformation of mixtures led to
a reduction in organic matter content. The addition of structure-forming
components to sewage sludge caused a dilution effect of the examined trace
elements.
Key words: sewage sludge, biological transformation, thermal transformation
210
Ocena zawartości niklu i manganu w miszaninie osadu ściekowego...
WSTĘP
Osad ściekowy jest nieodłącznym produktem oczyszczania ścieków komunalnych i przemysłowych. W myśl ustawy z dnia 23 stycznia 2013
r. o odpadach [Ustawa o odpadach 2001] wytwórca odpadów zobowiązany jest do ich przetworzenia. Uzyskany materiał po odpowiednim
przekształceniu może być wykorzystany zarówno do celów rekultywacyjnych jak i rolniczych. Najczęściej stosowanym procesem uzdatniania osadów ściekowych jest kompostowanie, które bardzo często przebiega z udziałem komponentów strukturotwórczych, takich jak np:
słoma, kora czy trociny [Siuta, 1999]. Komponenty te, często będące
również odpadami, wpływają nie tylko na poprawę stosunku C:N, ale
także nadają osadowi strukturę ułatwiającą jego późniejsze zastosowanie. Innym sposobem przekształcenia osadów ściekowych jest ich
rozkład termiczny. Choć metoda ta jest dość popularna w systemach
gospodarki odpadami państw UE, to w Polsce udział odpadów przekształconych termicznie w ogólnej masie zebranych odpadów komunalnych pozostaje na poziomie 1% [GUS 2011].
Charakterystyczną cechą osadów ściekowych jest duża zmienność ich składu chemicznego [Dimambro i in. 2007]. Pomimo znacznych zawartości substancji organicznej i makroskładników, osady
ściekowe mogą jednocześnie zawierać toksyczne pierwiastki śladowe, co może wykluczać zasadność ich przyrodniczego, w tym rolniczego wykorzystania. Spośród licznie występujących pierwiastków
śladowych w osadach ściekowych, szczególną uwagę zwraca się na
te, których oddziaływanie na organizmy żywe jest największe [RosikDulewska i Mikszta 2004].
Przeprowadzone badania miały na celu określenie wpływu procesu przekształcenia termicznego i biologicznego osadu ściekowego
z dodatkiem komponentów strukturotwórczych na ogólną zawartość
niklu i manganu.
MATERIAŁ I METODY
Materiałem wyjściowym do badań były mieszaniny sporządzone na bazie
stabilizowanego tlenowo osadu ściekowego pochodzącego z oczyszczalni
ścieków „Płaszów” w Krakowie. Doświadczenie obejmowało następują211
Monika Mierzwa, Krzysztof Gondek, Kalina Orłowska, Małgorzata Koncewicz-Baran
ce warianty, które były prowadzone w dwóch powtórzeniach: obiekt I –
osad ściekowy bez dodatku (kontrola); obiekt II – osad ściekowy + słoma
pszenna; obiekt III – osad ściekowy + trociny drzew iglastych; obiekt IV –
osad ściekowy + zmielona kora drzew iglastych. Wybrane właściwości
materiałów użytych do badań podano w tabeli 1.
Tab. 1. Charakterystyka wybranych właściwości chemicznych
materiałów wyjściowych.
Oznaczenie
Sucha masa [g·kg-1s.m.]
Osad
ściekowy
536±0,02
Słoma
990±0,01
Trociny
Kora
989±0,02
989±0,95
Popiół [%]
49,0±7,53
40,9±5,79
43,8±4,24
44,6±10,70
Nog [g·kg-1s.m.]
10,3±10,19
4,41±0,04
1,68±0,49
4,38±0,04
Ni [mg·kg-1s.m.]
57,7±0,61
1,85±0,10
1,40±0,07
4,48±0,25
Mn [mg·kg s.m.]
193±3,46
29,2±0,36
142±1,92
267±5,95
-1
± odchylenie standardowe
Wymienione powyżej komponenty strukturotwórcze zostały
zmieszane z osadem ściekowym w stosunku 1:1 w przeliczeniu na
suchą masę. Proces biologicznej transformacji prowadzono w izolowanych pojemnikach o pojemności 30 dm3 przez 121 dni. W tym
czasie biomasę regularnie napowietrzano oraz kontrolowano jej
temperaturę i wilgotność, którą utrzymywano na poziomie 50–55%.
Mieszaniny do przekształcenia termicznego wstępnie rozdrobniono,
a następnie poddano działaniu temperatury w piecu komorowym
przy ograniczonym dostępie powietrza w następujących warunkach
temperaturowych: 30 ºC przez 10 minut → 130 ºC przez 30 minut →
200 ºC przez 30 minut.
Zawartość niklu i manganu w osadzie ściekowym, mieszaninach
przed przekształceniem oraz po przekształceniu oznaczono po spopieleniu substancji organicznej w piecu komorowym (temperatura
450 ºC przez 12 godzin) i mineralizacji pozostałości w mieszaninie
stężonych kwasów HNO3 i HClO4 (3:2). Zawartość niklu i manganu
oznaczono metodą atomowej spektrometrii absorpcyjnej. Przedstawione wyniki badań stanowią średnią arytmetyczną z 3 powtórzeń.
Dla uzyskanych wyników obliczono odchylenie standardowe (SD)
oraz współczynnik zmienności (V%).
212
Ocena zawartości niklu i manganu w miszaninie osadu ściekowego...
WYNIKI I DYSKUSJA
Zasadniczym ograniczeniem przyrodniczego wykorzystania osadów
ściekowych jest nadmierna koncentracja w nich substancji toksycznych, zwłaszcza metali ciężkich. Całkowita zawartość tych pierwiastków w osadach ściekowych stanowi jedno z kryteriów określających
ich rolniczą przydatność. W ostatnich latach przeprowadzono liczne
badania dotyczące oceny zawartości oraz mobilności metali ciężkich
w osadach ściekowych [Filipek-Mazur i Gondek 2000, Gondek i Filipek-Mazur 2004, Madrid i in. 2007, Ciesielczuk i Kusza 2009]. Wyniki badań wskazują, że zawartość i mobilność metali ciężkich w tego
typu materiałach jest uwarunkowana głównie pochodzeniem osadu
ściekowego, chemizmem pierwiastka, a w przypadku kompostowania osadów z różnymi dodatkami również ubytkiem substancji organicznej i rodzajem dodatku.
Analizując wyniki badań stwierdzono, że największą zawartość
niklu i manganu oznaczono w nieprzetworzonym osadzie ściekowym
(odpowiednio 57,7 i 193,2 mg·kg-1 s.m.) (tab. 2). Zbliżone zawartości
omawianych pierwiastków w osadach ściekowych uzyskali inni autorzy [Gondek 2006, Dusza i Zabłocki 2009, Ciesielczuk i Kusza 2009].
W mieszaninach wyjściowych osadu ściekowego ze słomą, trocinami lub korą, ogólna zawartość niklu mieściła się w przedziale
od 28,32 mg·kg-1 s.m. do 32,75 mg·kg-1 s.m. Dodatek komponentów
strukturotwórczych spowodował na ogół 2 – krotne rozcieńczenie
zawartości tego pierwiastka w poszczególnych mieszaninach (tab. 2).
W mieszaninach nieprzekształconych oznaczone zawartości niklu
były blisko o 50% mniejsze od zawartości tego metalu stwierdzonych
w mieszaninach przekształconych termicznie. W wyniku transformacji termicznej mieszanin, ogólna zawartość niklu zwiększyła się:
w mieszaninie osadu ściekowego i słomy o 56%, osadu ściekowego
i trocin o 45%, natomiast w mieszaninie osadu ściekowego i kory
o 30%. Tak wyraźnego zwiększenia zawartości ogólnych form niklu
nie stwierdzono w mieszaninach przekształconych biologicznie, w których wyniosły one odpowiednio: 2%, 9% i 9%. Pomimo zwiększenia
się zawartości ogólnej niklu w przekształcanych mieszaninach należy
podkreślić, że zawartość tego pierwiastka kształtowała się poniżej zawartości oznaczonej w nieprzetworzonym osadzie ściekowym.
213
Monika Mierzwa, Krzysztof Gondek, Kalina Orłowska, Małgorzata Koncewicz-Baran
Tab. 2. Zawartość niklu i manganu w materiałach organicznych przed
i po procesie przekształcenia termicznego i biologicznego.
Materiał
Ni [mg·kg -1 s.m.] Mn [mg·kg -1 s.m.]
Osad ściekowy + 28,3 ± 1,00
Materiał organicz- trociny
ny wyjściowy
Osad ściekowy + 29,0 ± 0,02
kora
Osad ściekowy + 32,8 ± 0,80
słoma
Osad + trociny
41,1 ± 2,37
Materiał po procesie termicznego Osad + kora
37,1 ± 1,17
przekształcenia
Osad + słoma
51,1 ± 1,30
Osad ściekowy
30,9 ± 2,14
+ trociny
Materiał
po procesie
Osad ściekowy
31,7 ± 0,89
+ kora
przekształcenia
biologicznego
Osad ściekowy
33,5 ± 4,50
+ słoma
V%
19,4
140 ± 4,67
181 ± 1,47
125 ± 2,99
190 ± 10,07
214 ± 7,72
162 ± 4,72
150 ± 4,80
188 ± 2,03
132 ± 25,57
17,3
± odchylenie standardowe
Ogólna zawartość manganu w mieszaninach nieprzekształconych mieściła się w przedziale od 125 mg·kg -1 s.m. do 181 mg·kg -1
s.m. (tab. 2). Z kolei, zawartości tego metalu oznaczone w mieszaninach przekształconych termicznie były średnio o 28% większe od zawartości Mn, jaką oznaczono w mieszaninach nieprzekształconych.
W wyniku transformacji termicznej mieszanin ogólna zawartość
manganu zwiększyła się odpowiednio: w mieszaninie osadu ściekowego i trocin o 36%, osadu ściekowego i kory o 18%, a w mieszaninie
osadu ściekowego i słomy o 30%. Tak wyraźnego zwiększenia zawartości ogólnych form manganu nie stwierdzono w mieszaninach przekształconych biologicznie. Zwiększenie zawartości tego pierwiastka
w tych mieszaninach wyniosły odpowiednio: 7%, 4% i 6%. Mieszaninę najzasobniejszą w mangan, zarówno przed jak i po przekształceniu, stanowił osad ściekowy z dodatkiem kory. Najmniej manganu
stwierdzono w mieszaninie osadu ściekowego i słomy (tab. 2). Na
podstawie uzyskanych wyników badań zaobserwowano zwiększenie
214
Ocena zawartości niklu i manganu w miszaninie osadu ściekowego...
zawartości form ogólnych manganu w porównaniu do zawartości
tego pierwiastka w materiale wyjściowym. Podobne wyniki badań
uzyskali Drozd i Licznar (2004) oraz Gondek i Kopeć (2012).
WNIOSKI
1. Dodatek kory, słomy lub trocin do osadu ściekowego spowodował
efekt rozcieńczenia zawartości oznaczanych pierwiastków śladowych.
2. Proces przekształcenia termicznego we wszystkich analizowanych mieszaninach przyczynił się do zwiększenia zawartości Ni oraz
Mn. Tak wyraźnego zwiększenia zawartości badanych pierwiastków
nie stwierdzono w mieszaninach przekształconych biologicznie.
3. Zawartość niklu i manganu w badanych materiałach przekształconych termicznie i biologicznie nie wyklucza ich wykorzystania do celów rolniczych i rekultywacyjnych.
LITERATURA
1. Capizzi-Banas S., Deloge M., Remy M., Schwartzbrod J., 2004. Liming as
an advanced treatment for sludge sanitisation: helminth eggs eliminationAscaris eggs as model. Water Research, 38: 3251–3258.
2. CiesielczukT., Kusza G., 2009. Zawartość metali ciężkich w kompostach z odpadów jako czynnik ograniczający ich wykorzystanie do celów nawozowych.
Ochrona Środowiska i Zasobów Naturalnych, 41.
3. Czekała J., Dach J., Wolna-Maruwka A., 2006. Wykorzystanie bioreaktora
do badań modelowych kompostowania osadu ściekowego. Woda Środowisko Obszary Wiejskie, t. 6, 2: 29–40.
4. Dimambro, M. E., Lillywhite, R. D. and Rahn, C. R. 2007. The physical,
chemical and microbial characteristics of biodegradable municipal waste derived composts. Compost Science & Utilization, 15: 243–252.
5. Dusza E., Zabłocki Z. 2009. Zawartość metali ciężkich w kompostach
z osadów ściekowych z Miejskiej Oczyszczalni Ścieków W Reczu. Zeszyty
Problemowe Postępów Nauk Rolniczych, 537: 75–81.
6. Drozd J., Licznar M., 2004. Zmiany makro- i mikroskładników w czasie kompostowania odpadów komunalnych w różnych warunkach uwilgotnienia
i przy różnym dodatku mocznika. [w:] Komposty z odpadów komunalnych
produkcja, wykorzystanie i wpływ na środowisko. Wyd. Polskie Towarzystwo Substancji Humusowych, 151–170.
215
Monika Mierzwa, Krzysztof Gondek, Kalina Orłowska, Małgorzata Koncewicz-Baran
7. Gondek K. Kopeć M. 2012. Zawartość wybranych makro i mikroelementów
w przekompostowanych komunalnych odpadach biodegradowalnych. Acta
Agrophysica, 19: 527–538.
8. Madrid F., Lopez R., Cabrera F. 2007. Metal accumulation in soil after application of municipal solid waste compost under intensive farming conditions.
Agriculture, Ecosystems and Environment, 119: 249–256.
9. Rocznik Statystyczny Rzeczpospolitej Polskiej. 2011. Główny Urząd Statystyczny, 22.
10. Rosik-Dulewska Cz., Mikszta M. 2004. Formy wybranych metali ciężkich
wkompostach z odpadów komunalnych jako wskaźnik oddziaływania na
środowisko. [w:] Komposty z odpadów komunalnych produkcja, wykorzystanie i wpływ na środowisko. Drozd J. (red.), Wyd. Polskie Towarzystwo Substancji Humusowych, 171–185.
11. Siuta J. 1999. Zasoby surowców do kompostowania. Materiały I Konferencji Naukowo–Technicznej, „Kompostowanie i użytkowanie kompostu”,
Puławy–Warszawa, 16-18.06.1999, 21–36.
12. Wolna-Maruwka A., 2009. Estimation of the microbiological status of sewage sludges subject to composting process in controlled conditions, Polish
Journal of Enviromental Studies, 18: 279–288.
dr hab. inż. Krzysztof Gondek
e-mail: [email protected]
mgr inż. Monika Mierzwa
e-mail: [email protected]
mgr inż. Kalina Orłowska
e-mail: [email protected]
mgr inż. Małgorzata Koncewicz-Baran
e-mail: [email protected]
Katedra Chemii Rolnej i Środowiskowej
Uniwersytet Rolniczy w Krakowie
al. Mickiewicza 21, 31–120 Kraków
tel. +48 12 662 43 46
opiekun naukowy: Dr hab. inż. Krzysztof Gondek, prof. UR
216
Kalina Orłowska
Monika Mierzwa
EPISTEME
18/2013, t. 3
s. 217–223
ISSN 1895-2241
WPŁYW NATURALNEGO WYCIEKU ROPY
NA AKTYWNOŚĆ BIOLOGICZNĄ GLEBY
INFLUENCE OF A NATURAL OIL SPILL TO THE
BIOLOGICAL ACTIVITY OF THE SOIL
Abstrakt. Teren województwa Podkarpackiego leży w podkarpackim basenie
naftowo-gazonośnym. Na tym obszarze można spotkać wiele, różnie użytkowanych, miejsc naturalnego wycieku ropy. Często miejsca te są niezabezpieczone i mogą stanowić zagrożenie dla środowiska. Celem badań była analiza
wpływu naturalnego wycieku ropy na aktywność biologiczną gleby poprzez
pomiar zapotrzebowania na tlen z wykorzystaniem systemu pomiarowego
OxiTop Control oraz aktywność dehydrogenaz. Naturalne wycieki ropy mają
wpływ na alkalizację środowiska glebowego w najbliższym otoczeniu oraz
zwiększenie przewodności elektrolitycznej gleby. W dużym stopniu wpływają one na środowisko mikrobiologiczne gleby, gdyż aktywność dehydrogenaz
materiału glebowego pobranego bezpośrednio z miejsca wycieku jest około
2,5 razy większa a aktywność respiracyjna około 16 razy większa, niż materiału glebowego pochodzącego z nieznacznie dalszych odległości.
Słowa kluczowe: ropa, gleba, biologiczna aktywność gleby, aktywność dehydrogenazy
Summary. The area of the Podkarpacie province is located in the Podkarpacie’s oil basin. In this area there are places of a natural oil spills used in many
different way. This kind of areas are not protect very well and very often they
can constitute the environmental risk. Aim of research was analysis of the
influence of a natural oil spills on the biological activity of the soil. Determination of the biochemical oxygen demand was measured using OxiTop Control measurement system. Activity of dehydrogenases was also measured.
Natural oil spills affect the soil environment causing alkalinization and increasing electrolytic conductance of the soil. They also affect microbiological
environment of the soil. Activity of dehydrogenases was 2,5 times higher
and respiratory activity was 16 times higher in samples gathered directly
from the place of oil spill than in samples gathered from further distances.
Key words: oil, soil, biological activity of the soil, activity of the dehydrogenase
217
Kalina Orłowska, Monika Mierzwa
Wstęp
Na terenie polskich Karpat fliszowych znajduje się karpacki obszar
ropo-gazonośny. Fakt występowania naturalnych wypływów ropy na
Podkarpaciu był znany już w średniowieczu. Pierwsza eksploatacja na
skalę przemysłową rozpoczęto w Bóbrce w 1854r. [Lipińska 2010].
Teren podkarpackiego basenu naftowo-gazonośnego zlokalizowany
jest w przedgórskim obniżeniu, które zostało podzielone rzekami
na część północną i północno-wschodnią [Lipińska 2010]. Na terenie Podkarpacia nadal występuje wiele miejsc naturalnego wycieku
ropy, gdzie zlokalizowane są aktywne kopanki. Są to tereny najczęściej zlokalizowane poza terenami górniczymi, należące do prywatnych właścicieli, samorządów gminnych i gospodarstw leśnych. Miejsca wycieku w większości nie są zabezpieczone lub jest to zrobione
w bardzo prowizoryczny sposób. Często znajdują się one na terenach
uzdrowisk, przy obecności wód mineralnych [Lipińska 2010].
Zanieczyszczenie środowiska glebowego ropopochodnymi, które
są płynami o dużej lepkości, powoduje blokowanie przestrzeni międzyglebowej, przez którą jest transportowana woda i powietrze. W konsekwencji prowadzi to do niekorzystnych zmian fizycznych i chemicznych
gleby, co skutkuje także pogorszeniem jej zdolności produkcyjnych
[Sęk i in. 2011]. Grunty te tracą zdolność do wymiany wapnia, magnezu, potasu i wodoru poprzez zmniejszenie zdolności sorpcyjnych gleby.
W wyniku skażenia środowiska ropopochodnymi dochodzi do zaburzenia stosunku zawartości węgla organicznego do zawartości azotu
oraz fosforu, co w konsekwencji prowadzi do zakłócenia życia biologicznego w glebie [Wyszkowski i Ziółkowska 2009, Sęk i in. 2011].
Ponieważ naturalne wypływy ropy, które zostają niezabezpieczone mogą stanowić poważny problem dla najbliższego otoczenia, celem badań była ocena oddziaływania tego typu wycieku na aktywność
biologiczną gleby w oparciu o pomiar zapotrzebowania na tlen oraz
aktywności dehydrogenaz, które stanowią pośrednie metody badań
wskaźnika aktywności biologicznej gleby [Mocek-Płóciniak 2010].
Materiał i metody
Materiał glebowy pobrany do wykonania analizy pochodził z jednej
z gmin województwa podkarpackiego. Pobrano go w październi218
Wpływ naturalnego wycieku ropy na aktywność biologiczną gleby
ku 2012 r. z terenu wykorzystywanego jako pastwisko dla koni. Na
wybranym terenie było około 10 miejsc naturalnego wypływu ropy
naftowej, które nie były zabezpieczone. Do badań wybrano wypływ
najbardziej reprezentatywny pod względem wielkości. Pokrywa ropy
wynosiła około 2 m długości i 1 m szerokości oraz około 2 cm grubości.
Z odległości 0, 1, 2, 5 i 15 m od miejsca naturalnego wypływu
ropy pobrano miejscowo 5 próbek materiału glebowego z wierzchniej
warstwy gleby (0–10 cm głębokości). Materiał pobrany bezpośrednio
przy wypływie ropy był przykryty warstwą zastygłej ropy, zaś próbki
materiału glebowego z dalszych odległości były pokryte zwartą roślinnością trawiastą. W powietrznie suchym, przesianym przez sito
o średnicy oczek 2 mm, materiale oznaczono skład granulometryczny, metodą areometryczną Bouyoucosa-Casagrande w modyfikacji Prószyńskiego, pH w zawiesinie wody i roztworu KCl o stężeniu
1 mol·dm-3, przewodność elektrolityczną konduktometrycznie w zawiesinie wody oraz węgiel organiczny metodą Tiurina [Ostrowska
i in. 1991]. W materiale świeżym wykonano analizę zapotrzebowania na tlen z wykorzystaniem systemu pomiarowego OxiTop Control. Analiza opierała sią na pomiarze zmiany ciśnienia, w szczelnie
zamkniętym naczyniu, która jest proporcjonalna do ilości zużytego
tlenu wykorzystanego przez mikroorganizmy w procesie utleniania
aktywnych form węgla. Czas pomiaru wynosił 7 dni i odbywał się
w stałej temperaturze 20oC. Wraz ze zużyciem tlenu powstawał CO2,
który był absorbowany przez roztwór NaOH o stężeniu 1 mol·dm-3.
Świeża masa próbki wynosiła 100 g. Cała procedura była wykonana według metody AT4 [WTW, Aktywność oddechowa AT4, 2006].
W glebie o naturalnej zawartości wody oznaczono również aktywność dehydrogenaz [Thalmann 1968]. Naważono 0,5 g materiału
glebowego, zadano go 1 ml TTC i 1 ml glukozy. Całość inkubowano przez 24 godziny w szafie termicznej w temperaturze 37oC. Po
upływie tego czasu dodano 6 ml acetonu i umieszczono powtórnie
w szafie termicznej na 2 godziny. Po upływie tego czasu materiał został przeniesiony jakościowo do kolbek i wykonano pomiar na aparacie Beckman DU-640, przy długości fal 546 nm. Analizę wykonano
w dwóch powtórzeniach.
219
Kalina Orłowska, Monika Mierzwa
Wyniki i Dyskusja
Większość badanych gleb charakteryzowała się składem granulometrycznym gliny zwykłej (tab. 1) [Systematyka Gleb Polski 2011].
Jedynie materiał glebowy pochodzący z najbliższej odległości od wycieku został sklasyfikowany jako glina piaszczysta. Zmiana składu
granulometrycznego na tak małym obszarze może świadczyć o wpływie substancji ropopochodnych na środowisko glebowe. Substancje
ropopochodne wiążą się z najdrobniejszą frakcją, która decyduje
o stopniu ich kumulacji w gruncie, prowadząc do znacznego spadku
frakcji ilastej. Wpływa to niekorzystnie na właściwości sorpcyjne gleby [Izdebska-Mucha i Korzeniowska-Rejmer 2006].
pył
ił
pH
H2O
1
0
50
46
2
1
40
48
3
2
34
56
4
5
35
55
5
15
32
57
±SD-odchylenie standardowe
4
12
10
10
11
6,52±0,05
7,09±0,20
6,96±0,03
6,80±0,02
6,06±0,02
KCl
5,72±0,03
6,14±0,01
6,11±0,03
5,42±0,76
4,89±0,01
Przewodność
elektrolityczna
[mS·cm-1 ]
Udział frakcji [%]
piasek
Odległość od miejsca
wypływu [m]
Nr próbki
Tab. 1. Udział frakcji glebowych, pH oraz przewodność
elektrolityczna materiału glebowego z zależności
od miejsca naturalnego wypływu ropy.
0,153±0,033
0,115±0,027
0,103±0,002
0,104±0,008
0,062±0,011
Odczyn materiału glebowego wahał się od obojętnego do lekko
kwaśnego. Analizując przestrzenny rozkład pH stwierdzono, wzrost
wartości tego parametru na odcinku od 0 do 1 m do poziomu 7,09
w zawiesinie wody i 6,14 w zawiesinie KCl a następnie zmniejszenie wartości pH wraz ze zwiększeniem odległości od miejsca wypływu ropy. Ustalono także, że badany wypływ ropy miał wpływ na
przewodność elektrolityczną, gdyż wraz ze wzrostem odległości od
miejsca wycieku następowało zmniejszenie jej wartości z poziomu
0,153 mS·cm-1 do 0,062 mS·cm-1 (tab. 1).
220
Wpływ naturalnego wycieku ropy na aktywność biologiczną gleby
Największą aktywnością dehydrogenaz, wynoszącą prawie 10
μg TPF·g-1·24h-1, charakteryzował się materiał glebowy pobrany
z miejsca bezpośrednio przylegającego do naturalnego wypływu ropy
(tab. 2) i przewyższała ona aktywność obserwowaną w materiałach
pobranych z miejsc bardziej oddalonych od miejsc wycieku. Z wyjątkiem miejsca położonego w odległości 1 m, stwierdzono tendencję
do zmniejszania się aktywności dehydrogenaz w kolejnych punktach
wraz ze wzrostem odległości od wycieku ropy.
Nr próbki
Tab. 2. Aktywność dehydrogenaz, biologiczna aktywności gleby oraz
zawartość węgla organicznego w materiale glebowym w zależności
od miejsca naturalnego wypływu ropy.
Odległość
od miejsca
wypływu
[m]
C org
[g C-1·kg s.m]
Aktywność
dehydrogenaz
[μg TPF·g-1·24h-1]
Biologiczna
aktywność gleby
[mg O2·kg s. m.-1·24h ]
1
0
66,00±3,54
9,99
877,55
2
1
25,75±0,82
3,63
64,42
3
2
23,94±0,74
5,14
48,37
4
5
24,01±0,72
4,47
67,98
5
15
22,22±0,15
3,13
40,65
Dehydrogenazy to enzymy przyśpieszające szybkość reakcji w procesach biochemicznego utleniania składników organicznych i wskazują na obecność fizjologicznie aktywnych mikroorganizmów. Obecność dehydrogenazy jest powiązana z zawartością węgla organicznego
[Mocek-Płóciniak 2010]. Potwierdzają to otrzymane wyniki analizy.
Zależność tą dokładnie widać w przypadku materiału glebowego
z najbliższej odległości od miejsca wycieku. Przedostawanie się do
środowiska glebowego związków ropopochodnych może w znacznym
stopniu wpływać na zwiększenie ilości węgla organicznego w glebie,
co zostało potwierdzone w badaniach przytaczanych przez Wyszkowskiego i Ziółkowską [2009]. Prawie 2,5 krotnie większą zawartość
węgla organicznego w materiale glebowym pochodzącym z miejsca
wycieku w stosunku do ilości oznaczonych w pozostałych punktach
może tłumaczyć, fakt dużej ilości ropy w próbce, gdyż jest ona złożoną
mieszaniną węglowodorów należących do grupy węglowodorów alifa221
Kalina Orłowska, Monika Mierzwa
tycznych, aromatycznych i związków polarnych [Kwapisz 2006]. Według Mocek-Płóciniak [2010] gleby piaszczyste wykazują niewielką
aktywność enzymatyczną, ilaste przeciętną, najwyższą zaś charakteryzują się gleby próchniczne. W przypadku przeprowadzonych badań
stwierdzono, że największą aktywność biologiczną wykazywały się
gleby, w których duży udział ma frakcja piasku (tab. 1). W przypadku
biologicznej aktywności gleby największym wskaźnikiem respiracji,
podobnie jak w wypadku aktywności dehydrogenaz, charakteryzował się materiał pochodzący z miejsca bezpośrednio położonego przy
wycieku ropy. Oznaczona w glebie z tego punktu ilość tlenu wynosiła
877,55 mg O2·kg s.m.-1·24h-1 i znacznie odbiegała od zapotrzebowania na tlen zanotowanego w glebie bardziej oddalonej od wycieku.
Najmniejszą wartość stwierdzono w najdalej oddalonym punkcie. Na
aktywność enzymatyczną gleby duży wpływ miał jej odczyn. W glebach o kwaśnym odczynie mikroorganizmy glebowe charakteryzuje
mniejsza aktywność enzymatyczna [Mocek-Płóciniak 2010, Natywa
i in. 2010]. Duża aktywność biologiczna gleby w najbliższym otoczeniu od miejsca wycieku może świadczyć o generowaniu energii dla
procesów życiowych drobnoustrojów oraz o zachodzących procesach
biodegradacji z ich udziałem [Kwapisz 2006].
Wnioski
1. Naturalny wypływ ropy naftowej zmienia skład mechaniczny gleby
zmniejszając w nim udział frakcji ilastej.
2. Wraz z odległością od wycieku zmniejsza się przewodnictwo
elektrolityczne gleby.
3. Zanieczyszczenie gleby ropą i substancjami ropopochodnymi
prowadzi do zwiększenia zawartości węgla organicznego w glebie.
4. Przedostająca się do gleby ropa zwiększa jej wskaźniki aktywności biologicznej, co najprawdopodobniej jest efektem zachodzących procesów biodegradacji związków organicznych przez drobnoustroje.
222
Wpływ naturalnego wycieku ropy na aktywność biologiczną gleby
Bibliografia
1. Izdebska-Mucha D. Korzeniowska-Rejmer E. 2006. Ocena wpływu zanieczyszczeń ropopochodnych na uziarnienie i plastyczność gruntów spoistych.
Inżynieria i Ochrona Środowiska. 9 nr 1: 89–103.
2. Kwapisz E. 2006. Szlaki tlenowej biodegradacji węglowodorów ropy naftowej.
Biotechnologia 2(73): 166–188.
3. Lipińska E. J. 2010. Miejsca naturalnego wypływu ropy naftowej i emisji gazu
ziemnego na Podkarpaciu. Polska Akademia Nauk. Infrastruktura i ekologia terenów wiejskich: 113–24.
4. Mocek-Płóciniak A. 2010. Wykorzystanie aktywności enzymatycznej do oceny wpływu antropogenicznych zmian wywołanych przez metale ciężkie w
środowisku glebowym. Nauka Przyroda Technologia. 4, 6.
5. Natywa M. Sawicka A. Wolna-Maruwka A. 2010. Aktywność mikrobiologiczna i enzymatyczna gleby pod uprawą kukurydzy z zależności od zóżnicowanego nawożenia azotem, Woda-Środowisko-Obszary Wiejskie, t 10,
z 2: 111–120.
6. Ostrowska A. Gawliński S. Szczubiałka Z. 1991. Metody analizy i oceny
właściwości gleby i roślin. Wydawnictwo IOŚ, Warszawa, ss. 325.
7. Sęk J. Dziubański M. Błaszczyk M. Padyk A., 2011. Badanie procesu przesiąkania roztworów olejowych roślinnych i substancji ropopochodnych przez
ośrodek porowaty. Inżynieria Ekologiczna, nr 26: 48–58.
8. Systematyka gleb Polski. 2011. Roczniki Gleboznawcze 62, 3: 5–142.
9. Thalmann A. 1968. Zur Methodik der Bestimmung der Dehydrogenase – Activität im Boden mittels Triphenyltetrazoliumchlorid (TTC). Landwirtschaftliche Forschung 21, 1, 249–258.
10. WTW/OxiTop 2006. Opis aplikacji. Aktywność oddechowa AT4.
11. Wyszkowski M. Ziółkowska A. 2009. Zawartość węgla organicznego i niektórych makropierwiastków w glebie zanieczyszczonej benzyną
i olejem napędowym, Ochrona Środowiska i Zasobów Naturalnych, nr
40: 112–122.
mgr inż. Kalina Orłowska, mgr inż. Monika Mierzwa
prof. dr hab. inż. Michał Kopeć
Katedra Chemii Rolnej i Środowiskowej
Uniwersytet rolniczy w Krakowie
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. inż. Michał Kopeć
223
Angela Potasznik, Marcin Sidoruk
Ilona Świtajska, Żaneta Banaszek
EPISTEME
18/2013, t. 3
s. 225–232
ISSN 1895-2241
WPŁYW ROLNICZEGO ZAGOSPODAROWANIA ZLEWNI
NA ZAWARTOŚĆ AZOTU W JEZIORZE SYMSAR
INFLUENCE OF AGRICULTURAL DEVELOPMENT
ON THE CONTENT OF NITROGEN IN LAKE SYMSAR
Abstrakt. Jezioro Symsar o głębokości 9,6 m usytuowane jest na Pojezierzu
Olsztyńskim w gminie Lidzbark Warmiński. W zlewni bezpośredniej o powierzchni 2,1 km2 dominują lasy, zwłaszcza w północno – wschodniej części
jeziora. Jezioro jest zbiornikiem przepływowym, które zasila głównie rzeka
Symsarna oraz mniejsze cieki takie jak rów melioracyjny Tolknicka Struga oraz
ciek leśny. Celem badań jest ocena wpływu rolnictwa dominującego w zlewni
na stężenia azotu w jeziorze Symsar. Najwyższe stężenie N-NO3 występowało
w wodach cieku leśnego (0,33 mg·dm-3). Wody Tolknickiej Strugi charakteryzowały się najwyższą koncentracją N-NH4 (0,08 mg·dm-3) ze względu na dopływ mechanicznie oczyszczonych ścieków z osiedla mieszkaniowego Klutajny. W cieku tym obserwuje się największą zawartość mineralnej formy azotu
w stosunku do azotu ogólnego (27,1%). W wodach rzeki Symsarna obserwuje
się redukcję formy organicznej i wzrost formy mineralnej do ok. 6,1%.
Słowa kluczowe: azot, biogeny, jezioro, rolnictwo
Summary. Lake Symsar has a depth of 9.6 m, and is located on Olsztyn
Lake District in community Lidzbark Warmiński. On 2.1 km2 area of direct
catchment are dominated by forests, especially in the north– eastern part
of the lake. The lake is a flow basin which feeding mainly of river Symsarna
and smaller courses. It powered by drainage ditch Tolknicka Struga and
forest stream. Aim of this study is a valuation of agriculture dominance in
the catchment area on the concentration of nitrogen in the lake Symsar.
The highest concentration of N-NO3 was in the waters of the forest stream
(0,33 mg·dm-3). Water of Tolknicka Struga was characterized by the highest concentration of N-NH4 (0,08 mg·dm-3) which are dropped mechanically
discharged waste water from a housing estate Klutajny. In this waster was
observed the highest content of mineral form of nitrogen in the total nitrogen (27.1%). In the waters of the river Symsarna was observed reduction of
organic form nitrogen and increased of mineral form to about 6.1%.
Key words: nitrogen, nutrients, lake, agriculture
225
Angela Potasznik, Marcin Sidoruk, Ilona Świtajska, Żaneta Banaszek
WSTĘP
Decydujący wpływ na jakość wód powierzchniowych i podziemnych
ma sposób zagospodarowania zlewni. Rozwój rolnictwa wiąże się
z obszarowym oraz punktowym zanieczyszczeniem wód powierzchniowych. Masowe zużycie nawozów chemicznych i składowanie
odpadów rolniczych spowodowały akumulacje azotu w środowisku
wodnym [Zho i in. 2010a]. Badania wykazały, że produkcja rolna
jest jednym z podstawowych działań człowieka wpływających na dopływ azotu do zbiorników wodnych. Globalnie ok. 1,5·108 ton azotu
jest uwalniane przez rok działalności rolniczej [Vitousek i in. 1997,
Zho i in. 2010b]. Azot jest składnikiem, który jest niezbędny dla
funkcjonowania roślin, jednak w przypadku jego nadmiaru w glebie
w wyniku spływu powierzchniowego może się przedostawać do wód
powierzchniowych potęgując proces eutrofizacji. Eutrofizacja jest
to zjawisko przeżyźniania, co prowadzi do stopniowego zarastania
zbiornika, a w konsekwencji całkowitego jego zaniku [Kajak 1998].
Celem badań była analiza wpływu rolniczego zagospodarowania
zlewni na zawartość azotu w Jeziorze Symsar.
MATERIAŁ I METODY
Badania dotyczące wpływu rolniczego zagospodarowania zlewni na
zawartość azotu w jeziorze Symsar prowadzone były od marca 2011
do lutego 2012 r. Jezioro Symsar jest typowym zbiornikiem przepływowym o powierzchni 135,5 ha, głębokości maksymalnej wynoszącej
9,6 m i objętości 6649,5 tys. m3. Jezioro jest ostatnim zbiornikiem
ciągu rzeki Symsarny przed jej dopływem do Łyny. Oprócz rzeki Symsarna, jezioro zasilają również mniejsze cieki między innymi Tolknicka Struga, do której dopływają mechanicznie oczyszczone ścieki
z osiedla mieszkaniowego Klutajny. Zlewnia bezpośrednia jeziora
Symsar składa się głównie z lasów (45%) położonych w północno-wschodniej części akwenu. Pozostałą część obszaru zasilania stanowią grunty orne (40%), użytki zielone (5%) oraz liczne domki letniskowe, które wraz z zabudowaniami zajmują ok. 10% powierzchni
zlewni. Jezioro według badań Sidoruka i Potasznik [2011] posiada III
klasę jakości wód i III kategorie podatności na degradacje. W ramach
226
Wpływ rolniczego zagospodarowania zlewni na zawartość azotu w jeziorze symsar
badań pobierane były co miesiąc próbki wody (łącznie 12 prób) do
pojemników polietylowych o pojemności 5 dm3.
Rys. 1. Lokalizacja punktów poboru prób.
Po utrwaleniu i przetransportowaniu do laboratorium Katedry
Melioracji i Kształtowania, w pobranych próbach przeprowadzono
analizy chemiczne według metod podanych przez Hermanowicza
i in. [1999]:
• Azot azotanowy (III), kolorymetrycznie z kwasem sulfanilowym;
• Azot azotanowy (V), kolorymetrycznie z kwasem fenylodwusulfanilowym;
• Azot amonowy, metodą Nesslera;
• Azot Kiejdahla, metodą Kiejdahla.
WYNIKI I DYSKUSJA
Głównym źródłem azotu w jeziorach są spływy powierzchniowe, dopływ biogenów rzekami, depozycja atmosferyczna oraz resuspensja
osadów.
Analiza koncentracji poszczególnych form azotu w badanej wodzie (tab.1) wykazała, że największymi stężeniami N-NO2 charakteryzowały się wody rzeki Symsarny (0,0192±0,04 mg·dm-3) przy
227
Angela Potasznik, Marcin Sidoruk, Ilona Świtajska, Żaneta Banaszek
współczynniku zmienności wynoszącym 202,9%, natomiast najniższymi stężeniami azotu azotanowego (III) charakteryzowały się
wody jeziora Symsar (0,0067±0,01 mg·dm-3). Azot azotanowy (V)
może być związkiem pochodzenia rolniczego lub ściekowego, a na
jego zawartość w wodzie znaczący wpływ wywiera intensyfikacja
rolnictwa w obrębie zlewni. Największe średnie koncentracje azotu
azotanowego (V) występowały w wodach cieku leśnego (0,33±0,79
mg·dm3), a wartość współczynnika zmienności wynosiła 236,8%.
Natomiast najniższe stężenia występowały w wodzie dopływającej
rzeką Symsarną (0,16±0,14 mg·dm3). Azot amonowy jest związkiem,
którego głównym źródłem w wodzie są ścieki surowe i wstępnie
oczyszczone. Według Ignatowicz i Struk-Sokołowskiej [2004] azot
amonowy charakteryzuje się wyższymi stężeniami w okresie pozawegetacyjnym, gdy nie jest intensywnie pobierany przez rośliny, co powoduje zahamowanie procesu nitryfikacji. Badania Yang i in. [2010]
ukazują, że największe koncentracje występują w okresach deficytu
opadów atmosferycznych. Największe stężenie azotu amonowego
i azotu ogólnego obserwowano w wodach Tolknickiej Strugi i wynosiły kolejno 0,48±0,65 mg·dm-3 i 2,60±0,33 mg·dm-3, na co wpływ mógł
mieć dopływ ścieków po mechanicznym oczyszczaniu. Najniższymi
stężeniami tych związków odznaczały się wody dopływu rzeki Symsarny (0,08±0,07 mg·dm-3 i 1,73±0,23 mg·dm-3), przy współczynniku
zmienności na poziomie 82,7 i 14,2%. Po przepłynięciu przez jezioro
obserwowano wzrost stężenia o 15,8%.
Tab.1. Stężenia związków azotu azotanowego (III), (V).
azotu amonowego oraz azotu ogólnego w poszczególnych dopływach
i odpływie oraz w samym jeziorze [mg·dm-3].
N-NO2
Próba
Dopływ Symsarna
Tolnicka Struga
Ciek leśny
Odpływ Symsarna
Jezioro
228
Min
0,0052
0,0077
0,0032
0,0036
0,0016
Max
Średnia
0,0605 0,0192
0,0207 0,0131
0,0261 0,00907
0,0220 0,0090
0,0154 0,0067
Odchylenie Współczynstandarnik zmiendowe
ności [%]
0,04
0,01
0,02
0,01
0,01
202,9
68,9
166,5
143,3
146,1
Wpływ rolniczego zagospodarowania zlewni na zawartość azotu w jeziorze symsar
Próba
Min
Max
Średnia
Odchylenie Współczynstandarnik zmiendowe
ności [%]
N-NO3
Dopływ Symsarna
Tolnicka Struga
Ciek leśny
Odpływ Symsarna
Jezioro
0,08
0,12
0,09
0,06
0,05
0,28
0,31
1,21
0,43
0,52
0,16
0,23
0,33
0,19
0,20
0,14
0,14
0,79
0,26
0,33
89,4
60,2
236,8
132,9
162,3
0,08
0,48
0,26
0,19
0,17
0,07
0,65
0,13
0,39
0,23
82,7
135,9
49,9
200,5
135,0
1,73
2,60
1,93
1,75
1,79
0,25
0,33
0,99
0,26
0,19
14,2
12,6
51,2
14,7
10,5
N-NH4
Dopływ Symsarna
Tolnicka Struga
Ciek leśny
Odpływ Symsarna
Jezioro
0,03
0,20
0,16
0,05
0,06
0,13
1,12
0,35
0,60
0,39
Nogólny
Dopływ Symsarna
Tolnicka Struga
Ciek leśny
Odpływ Symsarna
Jezioro
1,36
2,27
1,03
1,46
1,56
2,05
3,12
3,79
2,22
2,09
Na podstawie analizy wyników badań wód dopływających do jeziora Symsar jak i samego zbiorniku stwierdzono, że azot występował głównie w formie organicznej stanowiąc 72,8–85,1% azotu całkowitego (ryc.1). Największy udział formy organicznej stwierdzono
w wodach dopływu Symsarny (85,1%), a najmniejszy Tolknickiej
Strugi (72,8%).
Analizując zawartość azotu mineralnego można stwierdzić, że największy udział miała zawartość N-NO3 (31,0–61,3%) oraz azotu amonowego, którego udział kształtował się na poziomie 32,1–67,2%. Po
przepłynięciu wód rzeki przez jezioro Symsar w odpływie ze zbiornika
stwierdzono zwiększenie się udziału azotu mineralnego z 15 do 21%.
Jeziora stanowią swoiste układy ekologiczne, których funkcjonowanie zależy od przepływu wody oraz przemieszczania materii ze
zlewni, co prowadzi do jej akumulacji w zbiorniku wodnym [Bajkiewicz – Grabowska i Mikulski 1996]. Średni przepływ rzeki Sym229
Angela Potasznik, Marcin Sidoruk, Ilona Świtajska, Żaneta Banaszek
Ryc. 1. Procentowy udział ładunków azotu mineralnego i organicznego
w poszczególnych dopływach, odpływie i w jeziorze Symsar.
sarny, który wynosił 1,07 m3·s-1 powodował wprowadzenie do zbiornika znaczących ilości biogenów. Badania Durowskiego i in. [2006]
ukazują, że największe stężenia związków azotu obserwowane są w
wodach niewielkich cieków, które bezpośrednio uchodziły do jeziora
Miedwie. Podobną zależność można było zaobserwować w przypadku
jeziora Symsar. Największe zagrożenie stanowią cieki, które przepływają przez tereny zagospodarowane rolniczo (rzeka Symsarna) lub
drobne cieki przepływające przez wsie pozbawione infrastruktury
sanitarnej (Klutajny). Średnie stężenie azotu ogólnego w wodzie Jeziora Symsar wynosiło 1,84 mg·dm3. W przeliczeniu na całą objętość
jeziora zawartość Nog wynosiło 46 997 kg. Oprócz dopływu biogenów
wodami rzecznymi zagrożenie dla wód powierzchniowych mogą stanowić spływy obszarowe oraz opady atmosferyczne.
WNIOSKI
1. Największe stężenie N-NO3 stwierdzono w wodach cieku leśnego
i kształtowało się ono na poziomie 0,33±0,79 mg·dm3, natomiast
najniższymi stężeniami azotu azotanowego (V) charakteryzowały się
wody rzeki Symsarny (0,0192±0,04 mg·dm-3).
2. Wody dopływu rzeki Symsarna odznaczały się najniższą zawartością N-NH4 i azotu ogólnego kształtującą się na poziomie
0,08±0,07 mg·dm-3 i 1,73±0,23 mg·dm-3, natomiast ze względu na dopływ mechanicznie oczyszczonych ścieków w wodach Tolnickiej Stru230
Wpływ rolniczego zagospodarowania zlewni na zawartość azotu w jeziorze symsar
gi stwierdzono najwyższe koncentrację i średnio wynosiły 0,48±0,65
mg·dm-3 i 2,60±0,33 mg·dm-3.
3. W wodach rzeki Symsarny dopływającej do jeziora azot występował głównie w formie organicznej stanowiąc 85% azotu ogólnego.
Po przepłynięciu przez jezioro obserwowano redukcję formy organicznej (do 79%) i wzrost udziału formy mineralnej (o ok. 6,1%).
4. Największą zawartość mineralnej formy azotu w stosunku
do sumy azotu ogólnego obserwowano w wodach Tolnickiej Strugi (27,1%), a najmniejszą w dopływie rzeki Symsarny (14,8%). Na
zwiększony udział formy mineralnej azotu w dopływie Tolknickiej
Strugi wpływ mógł wywierać dopływ mechanicznie oczyszczonych
ścieków z miejscowości Klutajny.
LITERATURA
1. Bajkiewicz – Grabowska, Mikulski Z., 1996. Hydrologia ogólna. Wydawnictwo Naukowe PWN: 330.
2. Durowski T., Burczyk P., Królak B. 2006. Ocena odpływu składników nawozowych ze zlewni rolniczych jeziora Miedwie w okresie restrukturyzacji
rolnictwa. Woda-Środowisko – Obszary wiejskie, t.6, z. 2 (18): 51–63.
3. Hermanowicz W., Dojlido J., Dożańska W., Koziorowski B., Zerze J. 1999.
Fizyczno-chemiczne badanie wody i ścieków. Arkady, Warszawa: 88–89,
4. Ignatowicz K., Struk-Sokołowska J., 2004. Sezonowe wahania zanieczyszczeń agrotechnicznych w rzece Narwi ze szczególnym uwzględnieniem herbicydów fenoksyoctowych. Rocznik Ochrony Środowiska, 6: 189–205.
5. Kajak Z., 1998. Hydrobiologia – limnologia. Ekosystemy wód śródlądowych,
Wydawnictwo Naukowe PWN, Warszawa: 107–113.
6. Sidoruk M., Potasznik A., 2011. Stan trofii jeziora Symsar i możliwości jego
poprawy. Inżynieria Ekologiczna Nr. 26: 221–229.
7. Vitousek P. M., Aber J. D., Howarth R. W., Likens G. E., Matson A., Schindler D. W., Schlesinger W. H., Tilman D. G. 1997. Human alteration of the
global nitrogen cycle: sources and consequences. Ecol. Appl. 7: 737–750.
8. Yang R., Hayashi K., Zhu B., Feiyue L., Yan X. 2010. Atmospheric NH3 and
NO2 concentration and nitrogen deposition in an agricultural catchment of
Eastern China. Science of the Total Environmental 408: 4624–4632.
9. Zho Y. H., Deng X. Z., Zhan J. Y., Xi B. D., Lu Q. 2010a. Progress on preventing and controlling strategies of the lake eutrophication in China. Environmental Sciences&Technology, 33 (3): 92–98.
231
Angela Potasznik, Marcin Sidoruk, Ilona Świtajska, Żaneta Banaszek
10. Zho Y. H., Deng X. Z., Lu Q., Huang W. 2010b. Regional Rural Development, Nitrogen Input and Output in Farming – Grazing System and its
Environmental Impacts – A Case Study of the Wuliangsuhai Catchment.
Procedia Environmental Sciences 2: 542–556.
mgr. inż. Angela Potasznik
dr inż. Marcin Sidoruk
mgr. inż. Ilona Świtajska
mgr. inż. arch. kraj. Żaneta Banaszek
Uniwersytet Warmińsko – Mazurski w Olsztynie
Wydział Kształtowania Środowiska i Rolnictwa
Katedra Melioracji i Kształtowania Środowiska
e-mail: [email protected]
Opiekun naukowy: dr hab. inż. Sławomir Szymczyk
232
Milena Rusin
Janina Gospodarek
EPISTEME
18/2013, t. 3
s. 233–240
ISSN 1895-2241
WYSTĘPOWANIE ISOPODA, CHILOPODA
I DIPLOPODA W WARUNKACH GLEBY SKAŻONEJ
SUBSTANCJAMI ROPOPOCHODNYMI ORAZ
PODDANEJ PROCESOWI BIOREMEDIACJI
OCCURRENCE OF ISOPODA, CHILOPODA AND
DIPLOPODA IN SOIL CONTAMINATED WITH
PETROLEUM SUBSTANCES AND TREATED WITH
A PROCESS OF BIOREMEDIATION
Abstrakt. Celem badań było określenie oddziaływania benzyny, oleju silnikowego oraz oleju napędowego na występowanie wybranych grup bezkręgowców naziemnych. Ponadto zbadano wpływ procesu bioremediacji na
liczebność odławianych osobników. Doświadczenie zostało założone na obszarze nieużytków rolnych w Mydlnikach, niedaleko Krakowa. Odłowy fauny prowadzono na glebie kontrolnej oraz sztucznie zanieczyszczonej substancjami ropopochodnymi. Doświadczenie prowadzono w dwóch seriach:
z zastosowaniem bioremediacji i bez bioremediacji. Na podstawie badań
stwierdzono, że w największym stopniu ilość odławianych osobników ograniczał olej silnikowy. Pozostałe substancje także przyczyniły się do spadku
liczebności Isopoda (równonogie) i Diplopoda (dwuparce). Zastosowana bioremediacja w większości przypadków nie wpływała istotnie na aktywność
badanych bezkręgowców. Spowodowała jednak pojawienie się Chilopoda (pareczniki) na glebie skażonej olejem silnikowym, natomiast na glebie kontrolnej przyczyniła się do spadku ilości odławianych Isopoda.
Słowa kluczowe: substancje ropopochodne, bioremediacja, fauna naziemna
Summary. The aim of this study was to determine the effect of petrol, engine
oil and diesel oil on the occurrence of selected groups of epigeal entomofauna.
In addition, the effect of bioremediation process on the number of trapped
individuals was investigated. The experiment was set up in the wastelands in
Mydlniki, near Krakow. Fauna was trapped on control soil and on soil artificially contaminated with petroleum substances. Experiment was conducted
in two series: with and without applied bioremediation. The research showed
233
Milena Rusin, Janina Gospodarek
that the engine oil had the most negative impact on the number of trapped
individuals. Other substances also contributed to the decline in numbers of
Isopoda and Diplopoda. In most cases applied bioremediation did not influence
activity of examined invertebrates. This process caused that the Chilopoda appeared on the soil contaminated with engine oil, however on the control soil
lead to the decrease of trapped Isopoda number.
Key words: petroleum substances, bioremediation, epigeal entomofauna
Wstęp
Zanieczyszczenie środowiska substancjami ropopochodnymi w ciągu
ostatnich kilku lat stało się jednym z największych problemów ekologicznych. Związane jest to z silnym rozwojem cywilizacji i urbanizacją, a co za tym idzie, z dużo większym zużyciem ropy naftowej oraz
produktów z niej otrzymywanych [Bieszkiewicz i in. 1997]. Jest to
zagadnienie bardzo ważne ze względu na silną toksyczność związków
ropopochodnych, ich tempo rozprzestrzeniania, a także trwałość
w środowisku. Związki te, w większości przypadków, charakteryzują
się toksycznym działaniem na organizmy żywe, hamując ich wzrost
i rozwój [Steliga 2000]. Nadal niewiele jest informacji na temat wpływu tych substancji na bezkręgowce, zwłaszcza lądowe. Większość
dostępnych wyników wskazuje na negatywny wpływ tych związków
na występowanie określonych grup organizmów glebowych, w tym
także pożytecznych [Gospodarek 2008]. Udowodniono negatywne oddziaływanie ropopochodnych między innymi na: biegaczowate, kusakowate, skoczogony i atmobionty [Jaworska, Gospodarek
2004 b, Jaworska, Gospodarek 2007]. Wśród przedstawicieli fauny
naziemnej równonogie (Isopoda), pareczniki (Chilopoda) i dwuparce
(Diplopoda) uważane są za dobre wskaźniki informujące o jakości gleb
[Lee i in. 2002]. Organizmy te, jako destruenci, odgrywają kluczową funkcję w obiegu materii, a gatunki drapieżne regulują liczebność
zwierząt w środowisku [Sander 1990].
Celem przeprowadzonych badań było określenie oddziaływania
związków ropopochodnych: benzyny, oleju silnikowego oraz oleju
napędowego na występowanie na powierzchni gleby wybranych grup
bezkręgowców naziemnych – Isopoda, Chilopoda i Diplopoda. Zbadano również wpływ procesu bioremediacji z udziałem żywych organizmów na liczebność odławianych osobników.
234
Występowanie isopoda, chilopoda i diplopoda w warunkach gleby skażonej...
Materiał i metody
Doświadczenie zostało założone w czterech powtórzeniach na obszarze nieużytków rolnych w Stacji Doświadczalnej Uniwersytetu Rolniczego w Mydlnikach, położonej w pobliżu Krakowa. Jesienią 2009
roku glebę rodzimą umieszczono w kontenerach o pojemności 1m3,
z zachowaniem naturalnego układu warstw. Kontenery następnie
wkopano do gleby, tak, aby ich górna powierzchnia znajdowała się na
takim samym poziomie, jak otaczająca gleba. Glebę w kontenerach
pozostawiono przez okres 8 miesięcy bez ingerencji, aby powróciła do
naturalnej sprawności biologicznej. Następnie w czerwcu 2010 roku
glebę w kontenerach zanieczyszczono sztucznie (poprzez wylanie) następującymi substancjami ropopochodnymi: benzyną, olejem napędowym i zużytym olejem silnikowym w ilości odpowiadającej 6 000 mg
paliwa · kg-1 s. m. gleby. Po upływie jednego tygodnia glebę w połowie
kontenerów poddano bioremediacji poprzez dodatek biopreparatu,
który w swym składzie zawierał wyselekcjonowane mikroorganizmy
prokariotyczne. Odłowy fauny naziemnej prowadzono od czerwca do
sierpnia 2011 roku. Wykorzystano w tym celu pułapki Barber’a, które
były opróżniane raz w tygodniu. Pułapki zawierające substancję konserwującą (roztwór glikolu etylowego) były umieszczone pojedynczo
w centralnej części każdego z kontenerów. Uzyskane wyniki poddano
analizie z udziałem programu STATISTICA 10.0. Istotność różnic pomiędzy średnimi zbadano przeprowadzając analizę wariancji dwuczynnikowej, a średnie zróżnicowano testem NIR Fishera przy p < 0,05.
Wyniki
W trakcie trwania całego okresu badawczego, na obszarze całego doświadczenia, odłowiono łącznie 442 osobniki należące do rzędów:
Isopoda, Chilopoda i Diplopoda, z czego 163 na glebie kontrolnej, 78
na glebie zanieczyszczonej benzyną, 80 – olejem silnikowym i 121 –
olejem napędowym. W warunkach gleby, która nie została poddana procesowi bioremediacji odłowiono 238 osobników wszystkich
rzędów, z kolei na glebie remediowanej 204. Zarówno w warunkach
gleby kontrolnej jak i skażonej odławiano najwięcej Isopoda (Rys.1).
Najliczniej występowały one w sierpniu na glebie kontrolnej, któ235
Milena Rusin, Janina Gospodarek
ra nie została poddana procesowi bioremediacji, z kolei najrzadziej
w czerwcu w warunkach bioremediowanej gleby zanieczyszczonej
benzyną. W większości przypadków zaobserwowano wyższą liczebność Isopoda na glebie, na której nie został zastosowany biopreparat,
z wyjątkiem obiektu zanieczyszczonego olejem silnikowym.
Diplopoda najczęściej występowały na glebie kontrolnej w czerwcu. Natomiast w niektórych okresach i obiektach nie notowano ich
obecności. Ponadto zaobserwowano większą ich liczebność na glebie
zanieczyszczonej substancjami ropopochodnymi po zastosowaniu
bioremediacji. Osobniki z rzędu Chilopoda odławiano sporadycznie
(jedynie w warunkach gleby zanieczyszczonej olejem silnikowym
w okresie od czerwca do sierpnia, bądź benzyną w sierpniu), stąd nie
zaprezentowano przebiegu dynamiki ich występowania.
Rys. 1. Liczebność Isopoda i Diplopoda w warunkach gleby skażonej
ropopochodnymi oraz poddanej bioremediacji. K – kontrola, OS – gleba
skażona olejem silnikowym, ON – gleba skażona olejem napędowym,
B – gleba skażona benzyną, OR – bez bioremediacji, R – z bioremediacją.
Wszystkie zastosowane rok wcześniej polutanty spowodowały
spadek liczebności odławianych Isopoda, przy czym najbardziej ne236
Występowanie isopoda, chilopoda i diplopoda w warunkach gleby skażonej...
gatywnie na ich liczebność oddziaływał olej silnikowy (Rys.2). Zastosowany proces bioremediacji we wszystkich przypadkach z wyjątkiem gleby z dodatkiem oleju silnikowego oddziaływał niekorzystnie
na ilość odławianych Isopoda, jednak różnice istotne statystycznie
zaobserwowano jedynie w warunkach gleby kontrolnej. W obiekcie
skażonym olejem silnikowym zastosowany biopreparat sprzyjał występowaniu Isopoda, jednak różnice także nie były istotne statystycznie. Występowanie Chilopoda na glebie niepoddanej bioremediacji,
stwierdzono jedynie w obiekcie zanieczyszczonym benzyną. Zastosowanie biopreparatu spowodowało pojawienie się tych bezkręgowców
na glebie skażonej olejem silnikowym.
Rys. 2. Występowanie Isopoda, Chilopoda i Diplopoda w ciągu całego
okresu badawczego w warunkach gleby skażonej ropopochodnymi oraz
poddanej bioremediacji. Oznaczenia jak na rysunku 1. Średnie oznaczone
różnymi literami różnią się od siebie istotnie przy p<0,05. Pionowe słupki
oznaczają przedziały ufności na poziomie 0,95.
237
Milena Rusin, Janina Gospodarek
W pozostałych obiektach nie spowodowało zmian w ilości odławianych Chilopoda. Wszystkie zastosowane substancje ropopochodne spowodowały zmniejszenie liczebności odłowionych Diplopoda
i w każdym przypadku różnice w porównaniu do kontroli były istotne statystycznie. Zastosowany biopreparat we wszystkich obiektach
z wyjątkiem gleby kontrolnej wpływał korzystnie na ich występowanie, lecz różnice także nie były istotne statystycznie.
Dyskusja
Wykorzystanie pułapek Barber’a jest w literaturze wskazywane jako
bardzo dobry wskaźnik aktywności bezkręgowców naziemnych [Santos i in. 2007, Hartley i in. 2008]. Na podstawie przeprowadzonych
badań stwierdzono, że wszystkie zastosowane substancje ropopochodne przyczyniły się do zmniejszenia liczebności odławianych
bezkręgowców. Najbardziej niekorzystnie oddziaływał olej silnikowy,
z kolei najmniej benzyna, która w niektórych przypadkach wpływała
stymulująco na liczebność badanych bezkręgowców. Podobne zależności obserwowano w badaniach Jaworskiej i Gospodarek [2004 a].
Mniejsza szkodliwość benzyny wynika prawdopodobnie z faktu, że
zawiera ona w swym składzie znaczną ilość związków lotnych, które
są w stanie szybko odparować z gleby. Ponadto badania udowodniły
negatywne oddziaływanie związków ropopochodnych na przedstawicieli Isopoda i Diplopoda. Przeczy to badaniom przeprowadzonym
przez wyżej wspomniane autorki [Jaworska, Gospodarek 2007],
które nie stwierdziły negatywnego oddziaływania tych związków na
badane organizmy. Różnice te prawdopodobnie wynikają z ponad
3 – krotnie niższej dawki zanieczyszczeń zastosowanej w badaniach
przez autorki. Wyniki uzyskane w odniesieniu do Isopoda znajdują
odzwierciedlenie w badaniach prowadzonych u wybrzeży Antarktydy, w których autorzy stwierdzili zdecydowanie mniej tych organizmów w osadach morskich, zanieczyszczonych olejem napędowym
[Stark i in. 2003]. Inne badania wskazują ponadto, że znaczna ilość
metali ciężkich występujących w substancjach ropopochodnych może
kumulować się w organizmach Isopoda [Bernini i in. 2004].
Proces bioremediacji wykazywał odmienne działanie w przypadku poszczególnych grup badanych organizmów. Znaczenie mogą
238
Występowanie isopoda, chilopoda i diplopoda w warunkach gleby skażonej...
mieć tu intermediaty, które powstają w czasie bioremediacji. Mogą
być one różne, zależnie od rodzaju substancji zanieczyszczającej.
Badania własne potwierdzają przydatność, zarówno Isopoda jak
i Diplopoda, jako potencjalnych bioindykatorów gleb skażonych ropopochodnymi. Do podobnych wniosków doszli także inni naukowcy.
Cortet i in. [1999] udowodnili, że Isopoda są dobrymi biowskaźnikami, informującymi o jakości gleby z kolei Biaz i in. [2011] wykorzystali je do określenia stanu gruntu skażonego wielopierścieniowymi
węglowodorami aromatycznymi.
Wnioski
1. Zanieczyszczenie gleby olejem silnikowym i olejem napędowym
po upływie roku od momentu ich wylania spowodowało spadek aktywności Isopoda i Diplopoda. Nie stwierdzono natomiast istotnego
wpływu badanych ropopochodnych na występownie Chilopoda.
2. Zastosowany biopreparat na ogół nie wpływał istotnie na liczebność większości badanych bezkręgowców. Użycie go w obiekcie
z glebą zanieczyszczoną olejem silnikowym spowodowało wzrost aktywności Chilopoda, z kolei zastosowanie go na glebę kontrolną doprowadziło do spadku ilości odławianych Isopoda.
Bibliografia
1. Bernini F., Bianchi N., Leonzio C., Migliorini M., Pigino G. 2004. The effects of heavy metal contamination on the soil arthropod community of a
shooting rang. Environmental Pollution, 129(2), 331–340.
2. Biaz A., Calvert V., Caupert C., Cébron A., Cortet J, Criquet S., Pernin
C., Leyval C. 2011. Biological functioning of PAH-polluted and thermal desorption-treated soils assessed by fauna and microbial bioindicators. Research in Microbiology, 162(9), 896–907.
3. Bieszkiewicz E., Boszczyk-Maleszak H., Mycielski R., Wyszkowska B. 1997.
Biodegradacja frakcji olejowej ścieków petrochemicznych przez bakterie
izolowane z zaolejonej gleby. Biotechnologia, 1(36), 70.
4. Cortet J., Gomot-De Vauflery A., Poinsot-Balaguer N., Gomot L., Texier
Ch. i Cluzeau D. 1999. The use of invertebrate soil fauna in monitoring pollutant effects. Eur. J. Soil Biol., 35(3), 115–134.
239
Milena Rusin, Janina Gospodarek
5. Hartley W., Uffindell L., Plumb A., Rawlinson H. A., Putwain P., Dickinson NM. 2008. Assessing biological indicators for remediated anthropogenic urban soils. Sci. Total. Environ.,405(1–3), 358–369.
6. Gospodarek J. 2008. Effect of oil derivative spill on epigeal mezofauna. Ecological Chemistry and Engineering, 2(2), 309–314.
7. Jaworska M., Gospodarek J. 2004 a. Effect of soil pollution with oil derivatives on beneficial epigeal entomofauna. Ecological Chemistry and Engineering, 11(2–3), 182–186.
8. Jaworska M., Gospodarek J. 2004 b. Soil organisms and their activity as an
indicator of the natural environment state under conditions of soil contaminated with oil derivatives. Zeszyty Problemowe Postępów Nauk Rolniczych, z. 501, 189–194.
9. Jaworska M., Gospodarek J. 2007. Effect of oil derivatives in soil on selected
invertebrates. Ecological Chemistry and Engineering, 14(11), 1181–
1187.
10. Lee L., Stassen J., McDonald A., Culshaw C., Venosa A. D., Lee K. 2002.
Snails as Biomonitors of Oil-Spill and Bioremediation Strategies. Bioremediation Journal, 6(4), 373–386.
11. Sandner H. 1990. Owady. Państwowe Wydawnictwo Naukowe 1990,
wyd. 3, 452.
12. Santos S. A. P., Cabanas J. E., Pereira JA. 2007. Abundance and diversity
of soil arthropods in olive grove ecosystem (Portugal): effect of pitfall trap
type. Eur. J. Soil Biol., 43, 77–83.
13. Stark J. S., Snape I., Riddle M. J. 2003. The effects of petroleum hydrocarbon and heavy metal contamination of marine sediments on recruitment
of Antarctic soft-sediment assemblages: a field experimental investigation.
Journal of Experimental Marine Biology and Ecology, 283(1–2), 21–50.
14. Steliga T. 2000. Sposoby oczyszczania ścieków i wód złożowych
w kopalniach ropy naftowej i gazu ziemnego. Inżynieria Ekologiczna 2,
14–22.
mgr inż. Milena Rusin
dr hab. inż. Janina Gosodarek
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
240
Krzysztof Stasiak
Karolina Piekarska
EPISTEME
18/2013, t. 3
s. 241–248
ISSN 1895-2241
PTAKI WODNE STARORZECZA WISŁY ORAZ
OCZYSZCZALNI ŚCIEKÓW DESZCZOWYCH
W PUŁAWACH (WSCHODNIA POLSKA) W 2012 R.
WATERFOWL OF THE VISTULA OXBOW AND
THE RAIN SEWAGE TREATMENT PLANT IN PUŁAWY
(EASTERN POLAND) IN 2012
Abstrakt. Starorzecze Wisły w Puławach stanowi ważną część Parku Czartoryskich. Leżąca w sąsiedztwie oczyszczalnia ścieków deszczowych jest
istotnym elementem sieci kanalizacyjnej miasta. Oba te zbiorniki, oprócz
pełnienia głównych funkcji, stanowią ważne miejsce przebywania i rozrodu ptaków wodnych w ciągu całego roku. Celem pracy było opisanie i porównanie awifauny wodnej występującej na obu zbiornikach w 2012 r. Na
starorzeczu stwierdzono 12 gatunków ptaków, w tym 5 lęgowych, na terenie oczyszczalni 9 gatunków, w tym jeden lęgowy. Wykazano istotne statystycznie różnice między liczbą stwierdzanych na obu zbiornikach gatunków
ptaków i między średnią liczbą stwierdzanych jednorazowo osobników. Starorzecze było miejscem udanego lęgu gągoła Bucephala clangula, gatunku
rzadkiego, którego populację na Lubelszczyźnie szacuje się na 10–15 par
lęgowych. Najczęściej notowanym gatunkiem była krzyżówka Anas platyrhynchos, najliczniej występującą jesienią.
Słowa kluczowe: ptaki wodne, starorzecze, oczyszczalnia ścieków, Puławy
Summary. The Vistula oxbow in Puławy is an important part of Czartoryskis Park. The rain sewage treatment plant beside is an important component of the city sewage network. Apart from main functions, both reservoirs were the place for waterfowl to rest and breed. The aim of this study
was to describe and to compare waterfowl found on both reservoirs in 2012.
On the Vistula oxbow 12 species were found, 5 of them was breeding, on the
rain sewage treatment plant 9 species were found, one of them was breeding. Significant differences were found in the number of species surveyed
on each water body and in the average number of birds found on both reservoirs in each control. The oxbow was the breeding place of Goldeneye Bucephala clangula, which is a rare species in Lublin region, with a population
of 10–15 breeding pairs. The most frequent species was Mallard Anas platyrhynchos, the highest concentration of this species was noted in autumn.
Key words: waterfowl, oxbow, sewage treatment plant, Puławy
241
Krzysztof Stasiak, Karolina Piekarska
Introduction
The Vistula oxbow in Puławy is an important part of Czartoryskis
Park. The rain sewage treatment plant beside is a component of the
city sewage network. Apart from main functions, both reservoirs
were the place for waterfowl to rest and breed, providing two different habitats for water avifauna. In 2012 the survey was conducted to show if objects could be an important place for waterfowl to
rest and breed. Due to the historical aspect, the presence of birds on
the oxbow could be attractive for tourists. In case of the rain sewage
treatment plant, its positive influence on avifauna could be an argument for building this kind of constructions.
The aim of present study was to survey and to compare waterfowl found on both reservoirs during the whole year, in the context
of their presence in Lublin region.
Material and methods
The Vistula oxbow in Puławy (51˚24’33” N, 21˚57’53” E) had the area
of 4,8 hectares, width of 30 to 50 m and length of 1,2 km. The south-west bank was covered with willow thickets with a belt of high
poplars. Adjacent to the north-east side of the oxbow was the lower
part of Czartoryskis Park with old trees. The south part of the oxbow
adjoins to the fenced area of the Beekeeping Institute. Both ends of
the reservoir were covered with reeds and water lilies. Some fallen
trees were left in the water forming refugees for animals.
The rain sewage treatment plant in Puławy (51˚24’09” N,
21˚58’05” E) was placed adjacent to the south end of the Vistula oxbow. Treated wastewater runs to the oxbow and then to the Vistula
river. The object was built in 1995 [Wydział Ochrony Środowiska
Urząd Miasta Puławy 2007]. The whole complex took 4,5 hectares
and consisted of four reservoirs divided by dikes: two primary settling tanks, the biological treatment and the clean water tank with an
area of 1,1 hectare. The biological treatment was covered with reeds
and typha. The clean water tank was surrounded by the belt of reeds.
There were no plants in primary tanks. All plants were cut off in early
March. On the west side of both reservoirs was the farmland.
242
Ptaki wodne starorzecza wisły oraz oczyszczalni ścieków deszczowych w puławach...
Both surveyed objects were during the whole year, penetrated by
people like tourists in the park, anglers and people walking their dogs.
The survey was conducted from December 2011 to December
2012. 31 controls were made. The transect of 1,5 km was set next
to the oxbow and over the treatment plant. Birds were observed
through binoculars (7x50). Depending on the number and distribution of birds, one control took 1–2,5 hours. All observations were
noted, if it was possible, birds sex and age were defined. If a nest or
nestlings were seen, the species was indicated as the breeding one.
The non-waterfowl birds using reservoirs were also noted.
Results
Twelve waterfowl species were surveyed on the Vistula oxbow, and
nine on the rain sewage treatment plant (Tab. 1). On the first reservoir five species were found breeding: Mallard Anas platyrhynchos,
Mute swan Cygnus olor, Goldeneye Bucephala clangula, Moorhen Gallinula chloropus and Coot Fulica atra. The only breeding species found
on the sewage treatment plant was the Mallard. The highest number
of individuals observed on the oxbow in one control was 162, and
on the treatment plant 28, respectively. The average number of individuals found on the oxbow was significantly higher than on the
treatment plant (p≤0,0001, t test). The average number of species
observed in one control differed significantly between both water bodies (p≤0,0064, t test).
Tab. 1. The number of waterfowl on the Vistula oxbow and the rain sewage
treatment plant in Puławy in 2012.
Rain sewage
statistics
treatment plant
12 (average 2,6) 9 (average 1,4) p≤0,0064, test t
Vistula oxbow
Number of species
Average number of
birds
Average number of
Mallard
Highest number of
individuals
79,8
7
p≤0,0001, test t
74
5,16
p≤0,0001, test t
162
28
243
Krzysztof Stasiak, Karolina Piekarska
5
Rain sewage
treatment plant
1
7
13
160
28
Vistula oxbow
Breeding species
Number of empty
controls
Highest number of
Mallard individuals
statistics
Breeding species:
Mute swan – one pair was found nesting in the reed bed on the
western part of the oxbow. Six nestlings hatched, two of which were
killed in first two months.
Mallard – eight females with 5 to 10 young were surveyed on
the oxbow and two on the treatment plant. Numerous non-breeding individuals and pairs were found on both reservoirs. The highest
number of 160 individuals was found in late November.
Moorhen – one brood with eight nestlings was found. Birds
were observed on water lilies at the western end of the oxbow.
Coot – one brood with two nestlings was found at the western
end of the oxbow.
Goldeneye – seven pairs were surveyed on the oxbow and one
on the treatment plant. On the oxbow one brood was found with
three nestlings.
On both reservoirs non-breeding species were surveyed. The
most numerous was the Black-headed gull Larus ridibundus, found
on the oxbow in 10 controls with the highest number of 25 individuals and in 7 controls with 10 individuals on the treatment plant, respectively. On the oxbow were also noted Garganey Anas querquedula
(2 males and a female), Common gull Larus canus, Sandpiper Actitis
hypoleucos, Great Reed Warbler Acrocephalus arundinaceus (two singing males), Pochard Aythya ferina, Merganser Mergus merganser. On
the treatment plant were observed non-breeding Goldeneye (one
pair), Coot, Garganey, Lapwing Vanellus vanellus, Great Reed Warbler
and Sandpiper.
From the beginning of February to the middle of March and during the whole December, both reservoirs were frozen. No waterfowl
were observed then.
244
Ptaki wodne starorzecza wisły oraz oczyszczalni ścieków deszczowych w puławach...
Discussion and conclusions
Though both surveyed reservoirs lie in immediate vicinity, they differ in function and character. This fact implies differences in water avifauna. Waterfowl prefer more diverse habitat [Stachyra i in.
2002], which was confirmed on the test area in Puławy. On the less
varied object, which was the treatment plant, the number of birds
was significantly lower than on the semi-natural oxbow. This status
remained unchanged during the whole study period.
The rarest species breeding on the test area was the Goldeneye.
In Lublin region it was extremely scarce breeder with a population of
10–15 breeding pairs [Buczek 2005a]. The species was found on Vistula river from Puławy to Wieprz estuary, on some lakes in Sobiborskie Forest and occasionally on lakes in northern part of the region.
The situation of Goldeneye on the test area seemed to be stable, since
it was noted breeding in previous years [Buczek 2005a, Safader 2009,
own data].
Mute swans in southern part of Lublin region rarely brood on
small reservoirs in cities or parks [Kitowski 2004] and only 4% of
187 surveyed breeding sites of the species was placed on oxbows
[Buczek i Buczek 2005]. On the oxbow in Puławy the species was
successfully breeding each year in the last period [Safader 2009,
own data]. The number of six nestlings in the brood observed during our survey was similar to other data from Lublin region (average
of 4,35–5,77) [Kitowski 2004] and was slightly higher than average
from other parts of the country (4,1–4,5) [Czapulak i Wieloch 1991].
The main thread to swans on the test area were cases of aggression of
anglers to birds, which provided to death of two young. This kind of
people behavior is one of the most important threads to the species
in Poland [Indykiewicz 2008].
The Moorhen was mentioned as scarce or fairly numerous breeder in Lublin region. It’s earlier nesting on the oxbow in Puławy was
confirmed in literature as a sign of synurbization [Buczek 2005b].
The species was frequently found on ponds in towns or villages [Potakiewicz G. in Buczek 2005b], even in Lublin [Biaduń 2004]. The
last two species were numerous breeders in Lublin region [Buczek
2005c,d]. The expansion of Coot to the urban area was observed re245
Krzysztof Stasiak, Karolina Piekarska
cently [Tomiałojć i Stawarczyk 2003], the reason for selecting small
ponds in build-up areas may be the predation avoidance strategy
[Brzeziński i in. 2013]. The Mallard was breeding on all types of reservoirs and was mentioned as the most numerous duck in the region
[Buczek 2005c]. The average number of Mallards noted on the oxbow
was significantly higher than on the rain sewage treatment plant in
Puławy (p≤0,0001, t test).
The diversity of two surveyed reservoirs results in the difference
in number of waterfowl. The food availability and the habitat quality are mentioned as the important factors of waterfowl breeding
success [Elmberg i in. 1994, Kajzer i in. 2010]. Nest site selection
depends on many factors like vegetation, ground cover and others
[Clark i Shutler 1999]. In present study the main factor seemed to be
the diversity of the habitat. Straight shoreline with lack of refugees in
the treatment plant provided to lower number of birds, while volatility of the oxbow coastline creates suitable conditions for water birds.
The small area of the both reservoirs result in lack of importance for
migrating birds. Only bigger objects, like Zalew Zemborzycki in Lublin were used this way [Aftyka i in. 2006].
Due to the showed importance of the Vistula oxbow in Puławy
for waterfowl, it is recommended to protect the present state of the
reservoir. Any care treatment should provide to maintaining the current status. In opposite, the rain sewage treatment plant in Puławy
was not the important place for waterfowl, because of the small diversity of the habitat. Any changes of the water body should provide
to increase of the diversity of the environment.
References
1. Aftyka S., Cios S., Nieoczym M., Polak M. 2006. Avifauna of Zemborzycki
reservoir in Lublin. Teka Kom. Ochr. Kszt. Środ. Przyr., 3: 7–12.
2. Biaduń W. 2004. Ptaki Lublina. Wyd. AM. Lublin
3. Brzeziński M., Jedlikowski J., Żmihorski M. 2013. The effect of the nesting
site on the nesting success of the Coot Fulica atra. Ornis Fennica, 90:00-00.
4. Buczek A., Buczek T. 2005. Łabędź niemy. [in:] Wójciak J., Biaduń W.,
Buczek T., Piotrowska M. 2005. Atlas ptaków lęgowych Lubelszczyzny.
Lubelskie Towarzystwo Ornitologiczne. Lublin.
246
Ptaki wodne starorzecza wisły oraz oczyszczalni ścieków deszczowych w puławach...
5. Buczek T. 2005a. Gągoł. [in:] Wójciak J., Biaduń W., Buczek T., Piotrowska
M. 2005. Atlas ptaków lęgowych Lubelszczyzny. Lubelskie Towarzystwo
Ornitologiczne. Lublin.
6. Buczek T. 2005b. Kokoszka. [in:] Wójciak J., Biaduń W., Buczek T., Piotrowska M. 2005. Atlas ptaków lęgowych Lubelszczyzny. Lubelskie Towarzystwo Ornitologiczne. Lublin.
7. Buczek T. 2005c. Krzyżówka. [in:] Wójciak J., Biaduń W., Buczek T., Piotrowska M. 2005. Atlas ptaków lęgowych Lubelszczyzny. Lubelskie Towarzystwo Ornitologiczne. Lublin.
8. Buczek T. 2005d. Łyska. [in:] Wójciak J., Biaduń W., Buczek T., Piotrowska
M. 2005. Atlas ptaków lęgowych Lubelszczyzny. Lubelskie Towarzystwo
Ornitologiczne. Lublin.
9. Clark R. G., Shutler D. 1999. Avian habitat selection. Pattern from process in
nest-site use by ducks? Ecology, 80(1): 272–281.
10. Czapulak A., Wieloch M. 1991. The breeding ecology of mute swan Cygnus
olor in Poland – preliminary report. [in] Sears J., Bacon P.J. (Eds). Proc.
Third International Swan Symposium, Oxford 1989. Wildfowl (Spec.
suppl.), 1:161–166.
11. Elmberg J., Nummi P., Poeysae H., Sjoeberg K. 1994. Relationships between species number, lake size and resource diversity in assemblages of
breeding waterfowl. Journal of Biogeography, 21: 75–84.
12. Indykiewicz P. 2008. Ptaki doliny Noteci i Kanału Bydgoskiego – problem czy
szansa w rozwoju regionu? [in:] Szumińska D. (Editor) 2008. Zasoby przyrodnicze i kulturowe drogi wodnej Wisła-Odra. Tom II: 51–59.
13. Kajzer J., Paciora K., Bobrek R., Kośmicki A. 2010. Przelotne i zimujące
ptaki wodno-błotne zbiornika Czorsztyńskiego i Sromowieckiego w latach
2006–2007. Pieniny – Przyroda i Człowiek, 11: 81–89.
14. Kitowski I. 2004. Distribution and ecology of mute swans in Zamość region
(southeast Poland) in 1991–1997. Berkut, 13: 67–72.
15. Safader P. 2009. Ptaki Puław. Urząd Miasta Puławy. Puławy.
16. Stachyra P., Urban M., Tchórzewski M., Kitowski I. 2002. Awifauna stawu
Boćków na Zamojszczyźnie. Chrońmy Przyrodę Ojczystą 58(3): 78–87.
17. Tomiałojć L., Stawarczyk T. 2003. Awifauna Polski. Rozmieszczenie, liczebność i zmiany. PTPP „Pro-Natura”, Wrocław–Kraków.
18. Wydział Ochrony Środowiska Urząd Miasta Puławy. 2007. Diagnoza stanu środowiska miasta Puławy. Stan na koniec 2007 r. Wydział Ochrony
Środowiska Urząd Miasta Puławy. Puławy.
247
Krzysztof Stasiak, Karolina Piekarska
mgr inż. Krzysztof Stasiak
Katedra Zoologii, Ekologii Zwierząt i Łowiectwa
Uniwersytet Przyrodniczy w Lublinie
ul. Akademicka 13, 20–950 Lublin
mgr inż. Karolina Piekarska
ul. Sierakowskiego 6a, 24–100 Puławy
e-mail: [email protected], e-mail: [email protected]
Opiekun naukowy: dr hab. prof. nadzw. Jacek Łętowski
248
Ilona Świtajska, Sławomir Szymczyk
Angela Potasznik, Żaneta Banaszek
EPISTEME
18/2013, t. 3
s. 249-258
ISSN 1895-2241
WPŁYW UPRAWY WIERZBY NA CELE
ENERGETYCZNE NA JAKOŚĆ WÓD GRUNTOWYCH
INFLUENCE OF THE CULTIVATION OF THE WILLOW ON
ENERGY PURPOSES TO THE QUALITY OF GROUNDWATERS
Abstrakt. Celem przeprowadzonych badań było określenie wpływu wieloletniej uprawy wierzby krzewiastej (Salix viminalis L.) w celach energetycznych na zmiany właściwości fizyko-chemiczne wód gruntowych pod
plantacją z uwzględnieniem sezonu wegetacyjnego i poza wegetacyjnego.
Bezpośrednio w terenie zmierzono stany gruntowych i sondą wieloparametryczną oznaczono ich: odczyn, temperaturę, zasolenie, sumę substancji
rozpuszczonych (TDS) i przewodnictwo. Na właściwości fizykochemiczne
(pH, temperatura, przewodnictwo, TDS, zasolenie) największy wpływ wywiera sposób zagospodarowania terenu, jego ukształtowanie oraz warunki
meteorologiczne. Modyfikują one intensywność gruntowego przemieszczania wód. Wykazano również, że w zbliżonych warunkach położenia wód
gruntowych uprawa wierzby na cele energetyczne, w porównaniu do użytkowania ornego gleb sprzyja obniżeniu zanieczyszczenia wód gruntowych
substancjami rozpuszczonymi (TDS) oraz obniża ich zasolenie.
Słowa kluczowe: wierzba krzewiasta, wody gruntowe, sezon wegetacyjny i po-za wegetacyjny, jakość wód gruntowych
Summary. Determining the income of the long-term cultivation of the shrub
willow was an aim of conducted examinations (Salix viminalis L.) in energy
purposes for changes of the physical and chemical property in groundwaters
beneath the plantation including the vegetative season and pose vegetative
season. Directly in the field states were measured a level of waters and many
parameters probe was being measured: reaction pH, temperature, salinity,
total dissolved solids (TDS) and electric conductivity. For physicochemical
properties (reaction pH, temperature, salinity, TDS and electric conductivity)
are exerting the large impact the manner of the land developement, moulding
him and meteorological conditions modifying intensity of ground transferring waters. They stated, that in conditions moved close of putting groundwaters the cultivation of the willow to energy purposes, in comparing to the
arable use the soil is in favour for lowering polluting groundwaters with dissolved substances (TDS) and salting them is lowering.
Key words: willow (Salix viminalis), groundwater, vegetative and growth-external season, quality of groundwaters
249
Ilona Świtajska, Sławomir Szymczyk, Angela Potasznik, Żaneta Banaszek
Wstęp
W ostatnich latach obserwuje się wzrost zainteresowania uprawą
wierzby na cele energetyczne. Wynika to głównie z potrzeby ochrony środowiska poprzez wykorzystanie energii ze źródeł odnawialnych, zwiększenia możliwości produkcyjnych rolnictwa [Faber 2001;
Stolarski 2004], a także ze względów ekonomicznych – pozyskanie
tańszej energii niż z dotychczasowych używanych surowców energetycznych [Kaniuczak i in. 2005]. Uprawa wierzby na glebach czasowo
wyłączonych z produkcji rolniczej daje możliwość wykorzystywania
gruntów organicznych oraz mineralnych, które są nie wykorzystywane [Marks i in. 2000; Szczukowski i in. 2000]. Ponadto wskazuje się
na możliwości wykorzystania gleb nadmiernie uwilgotnionych oraz
o niskiej wartości rolniczej [Kaniuczak i in. 2001]. W celu uzyskania
wysokiej produkcyjności uprawa wierzby na cele energetyczne w ujęciu skali przemysłowej wymaga określenia warunków siedliskowych,
w tym warunków wodnych w glebach przeznaczonych pod plantacje. Dlatego też, istotne jest wskazanie nie tylko gatunków, których
genotypy charakteryzować się będą dużą tolerancją na warunki środowiska oraz odpornością na szkodniki i patogeny [Błażej i Czerniakowski 2005], ale również wpływu jej uprawy na przekształcenia
w środowisku glebowym i jakość wód gruntowych.
Celem pracy jest ocena wpływu uprawy wierzby energetycznej
na jakość wód gruntowych za pomocą określenia ich właściwości fizykochemicznych (pH, temperatura, przewodnictwo, TDS, zasolenie).
Materiał i metody
Badania nad wpływem uprawy wierzby krzewiastej (Salix viminalis
L.) na właściwości fizyczno-chemiczne wód gruntowych realizowano
w okresie od stycznia 2011 roku do grudnia 2012 roku na terenie Stacji
Dydaktyczno-Badawczej UWM w Olsztynie z siedzibą w Łężanach –
obiekt Samławki, położonej w województwie warmińsko-mazurskim,
w odległości ok. 80 km od Olsztyna. Ze względu na zmienne ukształtowanie terenów pojeziernych, na obszarze plantacji wierzby punkty
badawcze (trzy piezometry) umieszczono na: wzniesieniu (1 szt.), stoku (1 szt.) oraz w obniżeniu terenu (1 szt.). W celach porównawczych,
w pobliżu uprawy wierzby umieszczono również trzy piezometry: je250
Wpływ uprawy wierzby na cele energetyczne na jakość wód gruntowych
den na gruncie ornym sąsiadującym z plantacją oraz dwa w pobliskim
lesie (po jednym na wierzchowinie i w obniżeniu terenu).
Badania wykonywano systematycznie, raz w miesiącu. Każdorazowo gwizdkiem hydrologicznym określano głębokość położenia wód
gruntowych (stany wód), a następnie, po pobraniu pompką zanurzeniową GIGANT, bezpośrednio w terenie, sondą YSI 556 oznaczono
ich: pH, temperaturę, zasolenie, suma substancji rozpuszczonych
(TDS) oraz przewodnictwo. Wyniki badań omówiono z uwzględnieniem dwóch charakterystycznych przedziałów czasowych, czyli okresy wegetacyjny (IV–IX) i poza wegetacyjny (X–III).
Wyniki i Dyskusja
Położenie zwierciadła wód gruntowych w okresie wegetacyjnym i poza
wegetacyjnym w poszczególnych punktach pomiarowych kształtował
się na wyrównanym poziomie. Głębokość położenia wód gruntowych,
zarówno na plantacji wierzby, jak i na obiektach porównawczych była
silnie uzależniona od ukształtowania terenu, nasilenia procesu wegetacji (intensywność parowania) oraz aktualnie panujących warunków
atmosferycznych (rys. 1). Na plantacji wierzby w sezonie wegetacyjnym poziom wód wahał się średnio od 130 cm poniżej powierzchni
terenu (p.p.t.) w obniżeniu terenu do 372 cm p.p.t. na wierzchowinie.
W sezonie poza wegetacyjnym, czyli w warunkach przewagi opadów
nad parowaniem, stwierdzono nieco wyższy poziom wód gruntowych
w stosunku do okresu wegetacyjnego. Wynosił on średnio 124 cm
p.p.t. w obniżeniu terenu i 334 cm p.p.t. na wierzchowinie. Odwrotną
tendencję obserwowano na stoku, gdzie w okresie od października do
marca, w stosunku do okresu kwiecień-wrzesień nastąpił spadek poziomu wód, średnio o 10 cm. Jednocześnie na stoku, w porównaniu do
wzniesienia i obniżenia terenu, wystąpiły największe wahania poziomu wód gruntowych: od 31 cm w styczniu 2011 roku do 250 cm w listopadzie i grudniu 2011 roku. Mogło to być spowodowane dużą przewagą parowania nad opadami w sezonie wegetacyjnym 2011 roku oraz
odpływem gruntowym wód zgodnie ze spadkiem do obniżenia terenu.
Powstały w tym okresie znaczny ubytek wód gruntowych, zauważalny szczególnie na stoku, został pokryty dopiero w okresie wiosennym
następnego roku. Wówczas zaobserwowano znaczące podnoszenie się
stanów głównie na stoku.
251
Ilona Świtajska, Sławomir Szymczyk, Angela Potasznik, Żaneta Banaszek
Spośród obiektów porównawczych w sezonie wegetacyjnym największe wahania wód gruntowych stwierdzono na gruntach ornych
(od 48 cm p.p.t. w lipcu 2012 roku, do 211 cm p.p.t. w sierpniu 2011
roku). Związane było to z intensywnym parowaniem i mniejszymi
opadami w sezonie wegetacyjnym 2011, w porównaniu do 2012
roku. Jednak ze względu na charakter użytkowania terenu, czyli krótszy okres wegetacji niż w lesie, czy też na plantacji wierzby,
najniżej zwierciadło wód gruntowych utrzymywało się pod gruntem
– średnio 116 cm p.p.t. w okresie wegetacyjnym oraz 105 cm p.p.t.
w okresie poza wegetacyjnym.
Oznaczenia: 1 – Wierzchowina; 2 – Stok; 3 – Obniżenie; 4 – Grunt orny
w sąsiedztwie wierzby; 5 – Las – wierzchowina; 6 – Las – obniżenie.
Rys. 1. Zmienność stanów wód gruntowych na plantacji wierzby i obiektach
porównawczych w okresie wegetacyjnym i poza wegetacyjnym
w latach 2011–2012.
Bezwzględnie najniższy poziom wód gruntowych stwierdzono
w lesie na wzniesieniu (średnio 574 p.p.t. – sezon wegetacyjny
i 568 cm p.p.t. – sezon poza wegetacyjny). Było to związane zarówno
z ukształtowaniem terenu (odpływ gruntowy), jak i intensywnym zużyciem wód opadowych w sezonie wegetacyjnym.
Największe wahania wartości pH stwierdzono w okresie wegetacyjnym (rys. 2) w wodach gruntowych pod uprawą wierzby krzewiastej na wierzchowinie (od pH 4,92 w kwietniu 2012 roku do 8,1
w czerwcu 2011 roku).
252
Wpływ uprawy wierzby na cele energetyczne na jakość wód gruntowych
Oznaczenia: 1 – Wierzchowina; 2 – Stok; 3 – Obniżenie; 4 – Grunt orny
w sąsiedztwie wierzby; 5 – Las – wierzchowina; 6 – Las – obniżenie.
Rys. 2. Zmienność pH w wodach gruntowych na plantacji wierzby
i obiektach porównawczych w okresie wegetacyjnym i poza wegetacyjnym
w latach 2011–2012.
Wody gruntowe na plantacji wierzby krzewiastej miały pH średnio od 6,79 (wierzchowina) do 7,17 (obniżenie terenu). Najmniejsze
średnie pH w okresie wegetacyjnym stwierdzono w obniżeniu terenu
w lesie (średnio 6,35).
Temperatura płytkich wód gruntowych może podlegać pewnym
wahaniom nawet w cyklu dobowym. Jej zmienność zależy przede
wszystkim od odległości od powierzchni terenu oraz właściwości fizycznych gruntu. Największe wahania temperatury wody gruntowej
wystąpiły na plantacji wierzby na wierzchowinie w okresie wegetacyjnym oraz na stoku i w obniżeniu w okresie poza wegetacyjnym (rys. 3).
Było to silnie związane z aktualnie panującymi warunkami meteorologicznymi, ale również wynikało to z głębokości położenia wód gruntowych oraz stopnia zacienienia gleby w sezonie wegetacyjnym.
W analizowanym okresie wegetacyjnym na obszarze uprawy wierzby wartości przewodnictwa elektrolitycznego wahały się średnio w zakresie od 522 (obniżenie) do 708 µS·cm-1 (wierzchowina). Dla obiektów
porównawczych był to zakres od 84 (obniżenie terenu w lesie) do 498
µS·cm-1 (grunt orny) (rys. 4). Taka zależność była spowodowana sposobem zagospodarowania terenu i głębokością zalegania wód gruntowych.
Wysokie wartości przewodnictwa w wodach gruntowych pod plantacją
wierzby na wierzchowinie były związane z utrzymującym się niskim
zwierciadłem wody gruntowej, co powodowało małą bioakumulację za253
Ilona Świtajska, Sławomir Szymczyk, Angela Potasznik, Żaneta Banaszek
wartych w nich składników. Przypuszczenie to potwierdza wykazanie
znacznie mniejszej przewodności elektrolitycznej w wodzie gruntowej
w obniżeniu terenu, zarówno pod plantacją wierzby, jak i w lesie (czyli na
obszarach, gdzie dostępność wody dla roślin była większa).
Oznaczenia: 1 – Wierzchowina; 2 – Stok; 3 – Obniżenie; 4 – Grunt orny
w sąsiedztwie wierzby; 5 – Las – wierzchowina; 6 – Las – obniżenie.
Rys. 3. Zmienność temperatury w wodach gruntowych na plantacji wierzby
i obiektach porównawczych w okresie wegetacyjnym i poza wegetacyjnym
w latach 2011–2012.
Oznaczenia: 1 – Wierzchowina; 2 – Stok; 3 – Obniżenie; 4 – Grunt orny
w sąsiedztwie wierzby; 5 – Las – wierzchowina; 6 – Las – obniżenie.
Rys. 4. Zmienność przewodnictwa elektrolitycznego wód gruntowych na
plantacji wierzby i obiektach porównawczych w okresie wegetacyjnym
i poza wegetacyjnym w latach 2011–2012.
254
Wpływ uprawy wierzby na cele energetyczne na jakość wód gruntowych
Zawartość w badanych wodach gruntowych substancji rozpuszczonych (TDS – rys. 5) oraz soli mineralnych (zasolenie – rys. 6)
podlegały zbliżonym tendencjom. Ich stężenia były powiązane z dostępnością wody dla roślin. Im była ona większa (wyższe stany wód
gruntowych), tym mniejsze były ich stężenia. Stąd najmniejsze wartości TDS i zasolenia stwierdzano w wodach gruntowych w obniżeniu
terenu (zarówno pod plantacją wierzby jak i pod lasem). Mogło to być
również związane z faktem, że w obniżeniach terenowych na plantacji wierzby i w lesie, ze względu na bujniejszą roślinność i dopływ
z terenu wyżej położonego, utwory glebowe mogą mieć więcej frakcji, a w efekcie większą sorpcję glebową. Bardzo małe, odbiegające od
pozostałych, wartości TDS i zasolenia wystąpiły w wodzie gruntowej
w obniżeniu terenu w lesie (średnio 0,053 w okresie wegetacyjnym
i 0,094 g∙dm-3 w okresie poza wegetacyjnym). Stwierdzono również,
że w zbliżonych warunkach dostępności wody, mierzonych położeniem wód gruntowych, nieco większe obciążenie wód gruntowych
substancjami rozpuszczonymi (TDS i zasolenie) charakteryzowały
się wody pod gruntami ornymi. Było to bardziej zauważalne w sezonie poza wegetacyjnym, a mogło wynikać zarówno z większej zasobności gleb w składniki pokarmowe (nawożenie mineralne) oraz
z uprawy płużnej rozluźniającej wierzchnią warstwę gleby, co ułatwiało wymywanie składników w głąb profilu glebowego.
Oznaczenia: 1 – Wierzchowina; 2 – Stok; 3 – Obniżenie; 4 – Grunt orny
w sąsiedztwie wierzby; 5 – Las – wierzchowina; 6 – Las – obniżenie.
Rys. 5. Zmienność stężenia substancji rozpuszczonych (TDS) w wodach
gruntowych na plantacji wierzby i obiektach porównawczych w okresie
wegetacyjnym i poza wegetacyjnym w latach 2011–2012.
255
Ilona Świtajska, Sławomir Szymczyk, Angela Potasznik, Żaneta Banaszek
Oznaczenia: 1 – Wierzchowina; 2 – Stok; 3 – Obniżenie; 4 – Grunt orny
w sąsiedztwie wierzby; 5 – Las – wierzchowina; 6 – Las – obniżenie.
Rys. 6. Zmienność zasolenia w wodach gruntowych na plantacji wierzby
i obiektach porównawczych w okresie wegetacyjnym i poza wegetacyjnym
w latach 2011–2012.
Wnioski
1. Na obszarze uprawy głębokość położenia oraz dynamika poziomu
wód gruntowych jest ściśle uzależniona od konfiguracji, sposobu zagospodarowania terenu oraz od warunków meteorologicznych (opady i temperatura powietrza) wpływających na zasoby płytkich wód
gruntowych i intensywność ewapotranspiracji.
2. Na jakość wód gruntowych największy wpływ wywarł sposób
zagospodarowania terenu, jego ukształtowanie oraz warunki meteorologiczne. Modyfikują one intensywność gruntowego przemieszczania wód, a wraz z nimi substancji rozpuszczonych oraz dostępność
wody dla roślin decydującej o możliwości bioakumulacji składników
pokarmowych.
3. W porównywalnych warunkach głębokości położenia wód
gruntowych uprawa wierzby na cele energetyczne, w porównaniu do
użytkowania ornego gleb sprzyja obniżeniu zanieczyszczenia wód
gruntowych substancjami rozpuszczonymi (TDS) (maksymalnie od
0,420 na gruntach ornych do 0,375 w obniżeniu terenu na plantacji
wierzby) oraz obniża ich zasolenie (maksymalnie od 0,34 na gruntach ornych do 0,29 w obniżeniu terenu na plantacji wierzby), co poprawia jakość wód gruntowych.
256
Wpływ uprawy wierzby na cele energetyczne na jakość wód gruntowych
literatura
1. Błażej J., Czerniakowski Z. W. 2005. Choroby i szkodniki w uprawie wierzby
energetycznej. [W:] Wybrane Aspekty Zagospodarowania Odpadów Organicznych A Produkcja Biomasy Wierzby Energetycznej. Uniwersytet Rzeszowski, Politechnika Rzeszowska: 210–214.
2. Faber A. 2001. Emisja gazów cieplarnianych oraz retencjonowanie węgla
przez rolnictwo. Fragm. Agron. 4 (72): 102–117.
3. Kaniuczak J., Błażej J., Gąsior J., Gierlicki P. 2001. Zawartość makroelementów w różnych klonach wikliny uprawianej na glebie piaszczystej. Acta
Agroph. 48: 63–68.
4. Kaniuczak J., Błażej J., Jasiński T., Niemiec W., Puchalski Cz. 2005. Wartość energetyczna jednorocznych pędów wierzby energetycznej uprawianej
na agromeliorowanej glebie piaszczystej. W: Wybrane Aspekty Zagospodarowania Odpadów Organicznych A Produkcja Biomasy Wierzby Energetycznej. Uniwersytet Rzeszowski, Politechnika Rzeszowska: 191–200.
5. Marks M., Nowicki J., Szwejkowski Z. 2000. Odłogi i ugory w Polsce. Cz.II.
Sposoby zagospodarowania. Fragm. Agron. I (65): 21–34.
6. Stolarski M. 2004. Mat. Konf. Polowe plantacje wierzby krzewiastej z przeznaczeniem na cele energetyczne. Możliwości energetycznego wykorzystania biomasy w warunkach województwa Podkarpackiego. WODR Boguchwała 18–19 marzec: 63–69.
7. Szczukowski S., Tworkowski J., Marks M. 2000. Biomasa krzewiastych
wierzb (Salix sp.) w kształtowaniu i ochronie środowiska. Post. Nauk. Rol.
4: 19–23.
257
Ilona Świtajska, Sławomir Szymczyk, Angela Potasznik, Żaneta Banaszek
dr hab. inż. Sławomir Szymczyk
e-mail: [email protected]
mgr inż. Ilona Świtajska
e-mail: [email protected]
mgr inż. Angela Potasznik
e-mail: [email protected]
mgr inż. arch. kraj. Żaneta Banaszek
e-mail: [email protected]
Katedra Melioracji i Kształtowania Środowiska
pl. Łódzki 2, 10–719 Olsztyn
Uniwersytet Warmińsko-Mazurski w Olsztynie
«Opisane badania były finansowane z budżetu Zadania Badawczego nr 4
pt. «Opracowanie zintegrowanych technologii wytwarzania paliw i energii
z biomasy, odpadów rolniczych i innych» w ramach strategicznego programu
badań naukowych i prac rozwojowych pt.: «Zaawansowane technologie pozyskiwania energii» realizowanego ze środków NCBiR i ENERGA S.A.
Opiekun naukowy: dr hab. inż. Sławomir Szymczyk
258
C. VARIA
Jarosław Bielan, Katarzyna Łyduch
Piotr Cymanow
EPISTEME
18/2013, t. 3
s. 261-270
ISSN 1895-2241
Działania podjęte na etapie reagowania
jako przykład zarządzania kryzysowego
podczas gradacji kornika drukarza
(Ips typographus L.)
The actions taken at the stage of response
as an example of crisis management during
bark beetle outbreak
Abstrakt. W latach 2005–2010 w drzewostanach świerkowych Beskidu Śląskiego i Żywieckiego miała miejsce gradacja kornika drukarza, która spowodowała zamieranie lasów na tym obszarze na niespotykaną do tej pory skalę.
W pracy zaprezentowano proces decyzyjny i realizację działań z zakresu zarządzania kryzysowego w Nadleśnictwie Wisła. Celem podjętych działań była
ochrona jeszcze istniejących drzewostanów, likwidacja skutków gradacji i minimalizacja powstałych szkód. Ponadto, dokonano oceny wszystkich czynności
wchodzących w skład trzeciego etapu zarządzania kryzysowego – reagowania,
związanego bezpośrednio z gradacją kornika drukarza. Działania podejmowane
na poziomie reagowania charakteryzowały się wysoką skutecznością. Świadczy
to o dużym zaangażowaniu kadry zarządzającej w walkę z kryzysem oraz rzetelne i sumienne wykonywanie powierzonych zadań przez właściwe jednostki.
Słowa kluczowe: klęska ekologiczna, Nadleśnictwo Wisła, drzewostany świerkowe
Summary. In the years 2005–2010 in spruce stands in Beskid Śląski and
Żywiecki there were bark beetle outbreak, that caused the decay of forest in
this area at unprecedented scale. The study presents decision making process
and implementation of the action from range of crisis management in Wisła
Forest District. The aim of actions was to protect the existing forest, removing the effects of outbreak and reducing the damage caused. Furthermore, it
was pursued the assessment of all operations included in third phase of crisis
management – response, directly related to bark beetle outbreak. Actions taken at the level of response turned out to be highly effective. This proves strong
commitment of the management team to fight against the crisis and honest
and scrupulous implementation of tasks by the competent units.
Key words: ecological disaster, Wisła Forest District, spruce stands
261
Jarosław Bielan, Katarzyna Łyduch, Piotr Cymanow
WSTĘP
Kryzys, sytuacja kryzysowa to zjawiska, które w obecnych czasach niemalże codziennie dosięgają człowieka i organizacje. Przykładem sytuacji kryzysowych są wszelkiego rodzaju klęski ekologiczne dotykające zarówno człowieka jak i środowisko naturalne
(np. huragany, powodzie, susze), za których wystąpienie odpowiedzialni są przede wszystkim ludzie i prowadzona przez nich działalność.
W związku z tym, że kryzys nie jest zjawiskiem nowym (towarzyszył on już starożytnym cywilizacjom), człowiek nauczył się zapobiegać tym negatywnym zjawiskom, a w przypadku ich wystąpienia
stara się je kontrolować i łagodzić ich niekorzystne skutki. Działania
takie definiowane są jako zarządzanie kryzysowe. Jak podaje Grocki
[2012], zarządzanie kryzysowe jest procesem planowania i podejmowania działań, których celem jest zminimalizowanie lub wykluczenie
ryzyka powstawania sytuacji kryzysowej lub kryzysu, przejęcie kontroli nad nim i powrót do stanu sprzed kryzysu.
Proces ten składa się z czterech etapów, zależnych i powiązanych
ze sobą. Zalicza się do niego [Grocki 2012, Michalczuk-Wlizło 2012]:
zapobieganie, przygotowanie, reagowanie oraz odtwarzanie. Etapy zapobiegania i przygotowania dotyczą działań podejmowanych
przed wystąpieniem potencjalnego kryzysu, etap reagowania obejmuje czynności wykonywane w trakcie i po wystąpieniu zdarzenia,
natomiast odtwarzanie to zespół działań, zmierzających do przywrócenia stanu poprzedzającego klęskę.
Celem niniejszej pracy jest przedstawienie zarządzania kryzysowego na etapie reagowania, na przykładzie klęski ekologicznej –
gradacji kornika drukarza (Ips typographus L.), która miała miejsce
w drzewostanach świerkowych Nadleśnictwa Wisła, oraz szczegółowa ocena wszystkich elementów zarządzania kryzysowego wchodzących w zakres analizowanego etapu.
MATERIAŁ I METODY
W pracy wykorzystano metodę analizy źródeł oraz statystykę opisową. Źródłem informacji była literatura przedmiotu, dokumentacja
własna Nadleśnictwa Wisła oraz przeprowadzone wywiady z pracownikami Nadleśnictwa.
262
Działania podjęte na etapie reagowania jako przykład zarządzania kryzysowego...
Analiza obejmowała okres lat 2005–2010, kiedy to na terenie
Nadleśnictwa Wisła (południowa część Beskidu Śląskiego) miała miejsce największa w historii tego regionu gradacja kornika drukarza (masowy i gwałtowny wzrost liczebności populacji jednego gatunku [Szafraniec 2012]). W badaniach, dla celów porównawczych, w badaniach,
uwzględniono również okres poprzedzający klęskę (lata 2000–2004).
Ocena zarządzania kryzysowego podczas gradacji kornika drukarza została wykonana na podstawie trzynastu czynności przedstawionych przez Fałeckiego [2011] i Michalczuk-Wlizło [2012], które
są charakterystyczne dla etapu reagowania.
Każdej czynności przyporządkowano odpowiednią wartość liczbową – ocenę, mieszczącą się w przedziale liczb całkowitych od 1 do
5. Poszczególne oceny oznaczały:
1 – brak jakichkolwiek działań wykonanych w danym zakresie,
lub działania wykonane jedynie w stopniu minimalnym (zazwyczaj
z negatywnym skutkiem), lub wszystkie podjęte działania zostały
wykonane nieprawidłowo,
2 – część działań została wykonana jedynie w stopniu minimalnym, ale ich skutki okazały się pozytywne dla dalszego przebiegu
procesu zarządzania, inne elementy nie zostały wykonane lub zrealizowane w sposób błędny,
3 – wszystkie działania podejmowano w oparciu o przyjęte procedury i wykonano je poprawnie, lecz w podstawowym zakresie, lub
wystąpiły zarówno działania wykonane poprawnie jak i niepoprawnie, z przewagą tych wykonanych właściwie,
4 – podejmowane działania wykonywane były na ogół dobrze
i rzetelnie, zdarzały się błędy, jednak ich konsekwencje były mało
istotne dla prawidłowego przebiegu dalszych prac, a trafnie podjęte
działania miały duży wpływ na skuteczność walki z gradacją kornika
drukarza,
5 – wszystkie podejmowane działania zostały zrealizowane w sposób sprawny i skuteczny, przez co miały ogromny wpływ na prawidłowy przebieg walki z gradacją kornika drukarza.
Ocenę każdej z czynności uzasadniono merytorycznie, w oparciu
o zgromadzone materiały. Ponadto, posłużono się średnią arytmetyczną wyników wszystkich czynności wchodzących w zakres reagowania,
aby ustalić końcową ocenę zarządzania kryzysowego na tym etapie.
263
Jarosław Bielan, Katarzyna Łyduch, Piotr Cymanow
WYNIKI I DYSKUSJA
Przebieg gradacji. Szkodliwość gradacji można określić na podstawie powierzchni lub miąższości uszkodzonych i zniszczonych drzewostanów oraz wpływu tych uszkodzeń na obniżenie jakości pozyskiwanego drewna [Szafraniec 2012].
W latach 2000–2001 udział cięć sanitarnych (związanych z usuwaniem drzew chorych, obumierających i obumarłych, w celu utrzymania właściwego stanu sanitarnego lasu) w pozyskaniu grubizny
ogółem nie przekraczał 50%. W ciągu kolejnych trzech lat proporcje te
uległy zmianie na rzecz posuszu, osiągając poziom około 80% (ryc. 1).
W listopadzie 2004 r. huragan „Bora” przyczynił się do wielkopowierzchniowej klęski wiatrowałów i wiatrołomów, m.in. w Nadleśnictwie Wisła. Drewno uszkodzone w wyniku klęski nie zostało na czas
usunięte poza obręb lasu, co przyczyniło się do wzrostu liczebności
populacji szkodników kambiofagicznych (żyjących pod korą i żywiących się miazgą), wśród których dominujące znaczenie odegrał
kornik drukarz [Strategia…2007].
Pierwsze oznaki gradacji wystąpiły w 2005 r. W kolejnym roku
nastąpił intensywny wzrost wielkości wydzielającego się posuszu
(ryc. 1), m.in. za sprawą wysokich temperatur i długotrwałego okresu
suszy, które sprzyjały rozwojowi tego szkodnika [Strategia… 2007].
Kulminacja kryzysu (gradacji) wystąpiła w 2007 r., kiedy to pozyskano w ramach cięć sanitarnych niemal 300 tys. m3 drewna świerkowego. W latach 2008–2010 nastąpiło powolne i stopniowe wyhamowanie gradacji kornika drukarza, o czym świadczy m.in. spadek
wielkości pozyskanego drewna w ramach cięć sanitarnych (ryc. 1).
Proces zarządzania kryzysowego. Zgodnie z rozumieniem
przedstawionej we wstępie definicji zarządzania kryzysowego, głównym celem Nadleśnictwa Wisła była neutralizacja, ognisk gradacyjnych
kornika drukarza, w jak najkrótszym czasie. Było to możliwe m.in.
dzięki minimalizacji i usuwaniu skutków powstałych szkód, a także
przywracaniu równowagi ekologicznej na zarządzanym terenie.
W wyniku wielkopowierzchniowych szkód w drzewostanach,
spowodowanych wystąpieniem huraganu „Bora”, już na początku
2005 r. Nadleśniczy wydał decyzję o całkowitym wstrzymaniu cięć
planowych na rzecz cięć sanitarnych. Została ona utrzymana aż do
2008 r. [Wywiad… 2012a].
264
Działania podjęte na etapie reagowania jako przykład zarządzania kryzysowego...
Ryc. 1. Pozyskanie drewna świerkowego w wyniku cięć sanitarnych
na tle całkowitego pozyskania grubizny w Nadleśnictwie Wisła w latach
2000-2010.
Źródło: opracowanie własne na podstawie Nadleśnictwo Wisła 2011.
W latach 2005–2006 merytoryczną podstawą podejmowanych
decyzji oraz prowadzonych działań była funkcjonująca wówczas Instrukcja Ochrony Lasu (IOL) [2004]. Dostarczała ona niezbędnych
dla pracowników terenowych Nadleśnictwa informacji o biologii
i ekologii kornika drukarza, dzięki którym byli oni w stanie dostosować prowadzone aktualnie czynności ochronne (korowanie drewna,
wyznaczanie drzew trocinowych, wystawianie pułapek klasycznych
i feromonowych) do etapu rozwojowego tego szkodnika. Jednak
w związku ogólnym charakterem tego dokumentu, a także z dużym
zróżnicowaniem koniecznych do wykonania prac w tym czasie, pod
koniec 2006 r. powołano zespół antykryzysowy, którego celem było
opracowanie metod oraz strategii walki z gradacją. Dodatkowo powołano zespół ekspercki (specjaliści z dziedziny entomologii i ochrony
lasu), którego zadaniem było m.in.: doradztwo pracownikom Nadleśnictwa oraz kontrola podjętych działań [Hanyga 2007]. Od 2007 r.,
przez cztery kolejne lata w Nadleśnictwie Wisła były przygotowywane strategie ograniczania liczebności szkodników wtórnych świerka.
Pomysłodawcą tego typu opracowań była Regionalna Dyrekcja Lasów Państwowych (RDLP) w Katowicach, zaś wykonawcą pracownicy Nadleśnictwa Wisła [Wywiad…2012b]. Dokumenty te umożliwiły
prawidłowe zaplanowanie sił oraz środków, a także właściwą koordynację wysiłków, które zmierzały do zahamowania procesu zamie265
Jarosław Bielan, Katarzyna Łyduch, Piotr Cymanow
rania świerczyn [Szabla 2011]. Strategie te zawierały szczegółowe
prognozy koniecznych do wykonania zadań w najbliższym roku w wariantach optymistycznym i pesymistycznym, w oparciu o dane z lat
poprzedzających [Strategia...2007].
Cięcia wykonane w latach 2007–2009 stanowiły 96,6% pozyskania planowanego na realizację w okresie lat 2007–2016 [Plan…2007].
W związku z tym, z dniem 1 stycznia 2010 r. wszedł w życie Aneks
do istniejącego Planu Urządzania Lasu, który pozwolił odpowiednio
zmodyfikować rozmiar i zakres prowadzonych cięć tak, aby prawidłowo prowadzić gospodarkę leśną w kolejnych latach [Aneks…2010].
Ocena przedstawionego procesu zarządzania kryzysowego na
etapie reagowania w Nadleśnictwie Wisła wypadła pomyślnie, a wynik 4,23 świadczy o skuteczności podjętych działań przez kadrę
Nadleśnictwa Wisła w trakcie prowadzonej walki z gradacją kornika
drukarza. Najprawdopodobniej dzięki zaangażowaniu pracowników
wszystkich szczebli – począwszy od robotników zatrudnionych przez
zakłady usług leśnych (ZUL), poprzez leśniczych, pracowników biura
Nadleśnictwa, pracowników Zespołu Ochrony Lasu (ZOL) w Opolu,
pracowników RDLP w Katowicach, aż po zespół ekspercki (tab. 1) –
gradacja została „złamana” po trzech latach jej trwania. Od 2008 r.
zaczęła ona stopniowo tracić na sile (ryc. 1).
Lp.
Tab. 1. Ocena czynności wchodzących w zakres etapu reagowania.
Czynność
powołanie sztabu
1
zarządzania
kryzysowego
rozpoczęcie
procesu bie2
żącej i ciągłej
informacji
266
Ocena
12345
Uzasadnienie
sztab zarządzania kryzysowego tworzyli
Nadleśniczowie Nadleśnictw zagrożonych
wraz ze swoimi zastępcami oraz Dyrektor
Regionalny Lasów Państwowych w Katowicach; pod koniec 2006 r. powołano
zespół antykryzysowy, do którego dołączyli
pracownicy ZOL w Opolu oraz tzw. osłona
naukowa
proces bieżącej informacji rozpoczął się po
wystąpieniu szkód wiatrowych w leśnictwie
Barania, istotne informacje przekazywane
były praktycznie cały czas, tworzono także
comiesięczne raporty o postępach
Lp.
Działania podjęte na etapie reagowania jako przykład zarządzania kryzysowego...
Czynność
kierowanie i
koordynacja
3
prowadzonych
działań
organizacja
4 punktu informacyjnego
uruchomienie
systemu alar5
mowania
i ostrzegania
pobudzenie reakcji
6
społeczności
lokalnej
uruchomienie
procedur niezbędnych do
prawidłowego
funkcjonowa7
nia podczas
sytuacji kryzysowej i walki
z powstałym
zagrożeniem
natychmiastowe uruchomienie osób
odpowiedzial8
nych w danej
jednostce za
zarządzanie
kryzysowe
Ocena
12345
Uzasadnienie
kierowanie i koordynacja działaniami na
szczeblu RDLP w Katowicach była bardzo
skuteczna, na szczeblu Nadleśnictwa Wisła
kierowanie i koordynacja podjętych działań
była relatywnie rzetelna i skuteczna
brak fizycznego punktu informacyjnego,
jednak meldunki z leśnictw spływały do
siedziby Nadleśnictwa, a stamtąd były przekazywane dalej zgodnie ze swoim przeznaczeniem
początkowo brak systemu ostrzegania,
jednak wraz ze wzrostem nasilenia gradacji
kornika drukarza zaczął taki system się
tworzyć (internet, lokalna prasa)
zachęcenie społeczności lokalnej do odpłatnej pracy na rzecz usuwania skutków klęski,
informowanie społeczeństwa o konieczności wykonywania podobnych zabiegów
w lasach prywatnych, samowyrób drewna
opałowego, informacje w lokalnej prasie
początkowo postępowanie oparte o IOL,
od 2007 r. zaczęto tworzyć Strategie, które
precyzowały sposób postępowania
w zaistniałej sytuacji, ścisłe przestrzeganie
przyjętych reżimów
w momencie pojawienia się pierwszych
oznak gradacji Nadleśniczy wydał dyspozycje leśniczym prowadzenia wzmożonych
kontroli stanu sanitarnego lasów;
w przypadku pojawienia się niepokojących
oznak żerowania kornika drukarza należało
usunąć takie drzewa
267
Lp.
Jarosław Bielan, Katarzyna Łyduch, Piotr Cymanow
Czynność
Ocena
12345
neutralizacja
9 ognisk zagrożenia
zorganizowa10 nie wzajemnej
pomocy
wsparcie
działań przez
jednostki
zewnętrzne
11
(prywatne
i publiczne,
krajowe i zagraniczne)
zorganizowanie sztabu
doradczego,
12 składającego
się ze specjalistów w danej
dziedzinie
mobilizacja
dodatkowych
13 sił i środków
(w razie konieczności)
liczne klęski na początku gradacji (znaczna
powierzchnia drzewostanów uszkodzonych
przez huragan znajdowała się w terenie
trudnodostępnym, w związku z tym część
drewna nie wywieziono na czas – 2005 r.;
nienadążanie z robotami w 2006 r.) spowodowały wzmożony rozwój kornika drukarza, w późniejszym okresie neutralizacja
ognisk była bardziej skuteczna
organizowano dodatkowych pracowników
Służby Leśnej z rejonu całej RDLP
w Katowicach, a także stażystów, relatywnie szybko i sprawnie przekierowywano
pracowników ZUL pomiędzy zagrożonymi
gradacją leśnictwami
zatrudniano dodatkowych robotników ZUL
z terenów miasta Wisła i gminy Istebna,
wsparcie z Ministerstwa Środowiska (finansowanie badań)
w ramach zespołu antykryzysowego powołano zespół ekspercki jako osłonę naukową
prowadzonych prac
organizowanie dodatkowych robotników
ZUL z rejonów sąsiednich, organizowanie
specjalistycznego sprzętu do zrywki (m.in.
kolejki linowe)
4,23
Ocena łączna
Uzasadnienie
Źródło: opracowanie własne na podstawie Fałęcki 2011 i Michalczuk-Wlizło 2012.
268
Działania podjęte na etapie reagowania jako przykład zarządzania kryzysowego...
WNIOSKI
1. Trwająca sześć lat gradacja kornika drukarza wymagała całkowitej reorganizacji procesu zarządzania (w tym czasie usunięto blisko
1,1 mln m3 posuszu świerkowego, co wielokrotnie przekraczało planowane pozyskanie w tym okresie), podjęcia działań związanych
z powołaniem sztabu antykryzysowego czy zatrudnienia dodatkowych pracowników.
2. Właściwie prowadzone działania na etapie reagowania pod
wspólnym kierownictwem RDLP w Katowicach i Nadleśnictwa Wisła
przyczyniły się do ograniczenia rozmiarów klęski (opanowane zostało niekontrolowane wydzielanie się posuszu), przez co znacznie
zredukowano negatywne skutki gradacji (całkowite wyeliminowanie
szkód poklęskowych było niemożliwe) i prawdopodobnie skrócono
czas jej trwania.
BIBLIOGRAFIA
1. Aneks do planu urządzania lasu na lata 2007–2016 dla Nadleśnictwa Wisła, stan na 1 stycznia 2010 r., 2010. Kraków.
2. Fałecki J. 2011. Teoretyczne aspekty zarządzania kryzysowego. [w:] J. Stawnicka, B. Wiśniewski, R. Socha (red.), Zarządzanie kryzysowe. Teoria,
praktyka, konteksty, badania (s. 50–61). Wydawnictwo WSPol. Szczytno.
3. Grocki R. 2012. Zarządzanie kryzysowe. Dobre praktyki. Difin. Warszawa.
4. Hanyga K. 2007. Siła złego. Sprawy Nauki, www.sprawynauki.edu.pl,
24.07.2007 r. www.sprawynauki.edu.pl/index.php?option=com_content&task=view&id=427&Itemid=35, dn. 15.01.2013 r.
5. Instrukcja Ochrony Lasu. 2004. E. Kwiecień (red.),CILP, Warszawa.
6. Michalczuk-Wlizło M. 2012. Zasady i etapy zarządzania kryzysowego. [w:]
M. Żmigrodzki (red.), Zarządzanie kryzysowe w państwie. Towarzystwo
Naukowe Powszechne. Warszawa.
7. Nadleśnictwo Wisła, 2011. Raport dotyczący cięć sanitarnych prowadzonych w Nadleśnictwie Wisła w latach 1986–2011, Wisła.
8. Plan Urządzania Lasu dla Nadleśnictwa Wisła na okres od 01.01.2007 r.
do 31.12.2016 r., 2007. Kraków.
9. Strategia ograniczania liczebności szkodników wtórnych świerka w Nadleśnictwie Wisła w 2007 roku, 2007. Wisła.
9. Szabla K. 2011. Ekonomiczne konsekwencje klęsk żywiołowych w lasach na
przykładzie Regionalnej Dyrekcji Lasów Państwowych W Katowicach. [w:]
269
Jarosław Bielan, Katarzyna Łyduch, Piotr Cymanow
D. Lotz (red.), Międzynarodowa Konferencja – Współczesne problemy
ekonomiki leśnictwa, Puszczykowo, 7–9.06.2011, Instytut Badawczy
Leśnictwa, Sękocin Stary.
10. Szafraniec M. 2012. Gradacja szkodników. www.bryk.pl/teksty/liceum/biolgia/ekologia/19140-gradacja_szkodnik%C3%B3w.html, dn. 01.12.2012 r.
11. Wywiad z Zastępcą Nadleśniczego Nadleśnictwa Wisła, 2012a. Wisła,
21.11.2012 r.
12. Wywiad ze specjalistą ds. Ochrony Lasu i Przeciwpożarowej
w Nadleśnictwie Wisła, 2012b. Wisła, 13.12.2012 r.
mgr inż. Jarosław Bielan
Katedra Ochrony Lasu, Entomologii i Klimatologii Leśnej
Wydział Leśny
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
mgr inż. Katarzyna Łyduch
Zakład Ekonomiki i Organizacji Rolnictwa
Wydział Rolniczo-Ekonomiczny
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
dr inż. Piotr Cymanow
Zakład Ekonomiki i Organizacji Rolnictwa
Wydział Rolniczo-Ekonomiczny
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
270
Mateusz Cuske, Leszek Gersztyn
Bernard Gałka, Ewa Pora
EPISTEME
18/2013, t. 3
s. 271–279
ISSN 1895-2241
WPŁYW ODCZYNU NA MOBILNOŚC CYNKU
W GLEBACH ZANIECZYSZCZONYCH
THE INFLUENCE OF REACTION ON SOLUBILITY
OF Zn IN CONTAMINATED SOILS
Abstrakt. Gleby zanieczyszczone metalami ciężkimi stanowią istotne zagrożenie dla środowiska. W zależności od pH gleby, metale ciężkie mogą
być sorbowane przez fazę stałą gleby bądź desorbowane do roztworu glebowego, a stamtąd wymywane do wód gruntowych, bądź pobierane przez
rośliny. Celem niniejszych badań było określenie wpływu odczynu na mobilność cynku w glebach zanieczyszczonych przez przemysł miedziowy. W doświadczeniu pobrano dwie próbki glebowe z poziomów powierzchniowych
(0–30 cm) z otoczenia Huty Miedzi „Legnica”. Materiał glebowy różnił się
całkowitą zawartością cynku. Próbki gleby były traktowane różnymi dodatkami HCl i NaOH w obecności ekstrahenta CaCl2 stanowiącego tło. Stężenie
cynku i pH badano w powstałej zawiesinie. Na podstawie wyników badań
wykreślono krzywe buforowe. Zmiany wartości pH wpłynęły na mobilność
cynku w zanieczyszczonych glebach. Dodatek HCl spowodował zwiększenie
rozpuszczalności cynku, natomiast dodatek NaOH zmniejszał mobilność
tego pierwiastka. Przeprowadzone analizy wykazały, że mobilność cynku
jest zróżnicowana w zależności od odczynu.
Słowa kluczowe: gleby zanieczyszczone, cynk, pH
Summary. Soils contaminated with heavy metals pose significant threat
to the environment. Depending on soil pH, heavy metals can be adsorbed
on the solid phase of the soil, desorbed to the soil solution and thereafter
leached to the ground water or taken by plants The aim of the study was to
determine the influence of changes in pH on the solubility of zinc in soils
contaminated by copper industry. Soil samples were collected from the surface soil horizon (0–30 cm) at three sites situated in the vicinity of “Legnica”
Copper Smelter. Soil material differs in content of total Zn. Soil samples
were treated with various amounts of HCl and NaOH, in the presence of
CaCl2 exctractant as background. Zinc concentrations and pH values were
determined in the solutions obtained from the experiment. Buffering capacity curves were prepared on the basis of those results. The changes in pH
value affected the solubility of zinc in contaminated soils. Addition of HCl
resulted in raising of zinc solubility, while NaOH addiction caused reduction
at zinc solubility. Buffering capacity of soils depended on their properties.
Key words: contaminated soils, zinc, pH
271
Mateusz Cuske, Leszek Gersztyn, Bernard Gałka, Ewa Pora
Wstęp
Degradacja środowiska występująca w wyniku zanieczyszczenia
środowiska metalami ciężkimi budzi coraz szersze zainteresowanie
opinii publicznej. Jest to również rozumiane i zauważalne w sferze
problemu lokalnego zanieczyszczenia komponentów przyrody, ponieważ metale ciężkie wywołują bezpośrednie i pośrednie negatywne
efekty dla zdrowia człowieka, produkcji rolniczej, a także dla samych
ekosystemów [Alloway 1995].
Należy również zaznaczyć, że gleba jest rezerwuarem metali
ciężkich, a ich mobilność w środowisku oraz toksyczność, jest silnie
skorelowana z czynnikami wywołującymi zmiany środowiska glebowego. Do najważniejszych czynników decydujących o ruchliwości
metali ciężkich w glebach należą: pierwotna forma geochemiczna
pierwiastka, odczyn gleby, pojemność sorpcyjna, warunki tlenowe,
a także obecność jonów konkurencyjnych [Kabata-Pendias i Pendias
1999; Mercik 2002].
Pomimo że obszary wzbogacenia w metale ciężkie są sukcesywnie rekultywowane i zagospodarowywane, to nadal istnieje potencjalne ryzyko wynikające z obecności tych zanieczyszczeń w środowisku. Strategie rekultywacji terenów poprzemysłowych w naszym
kraju opierają się głównie na unieruchomieniu metali ciężkich w fazie stałej gleby, a następnie ich zagospodarowaniu w wybranym kierunku (rolniczym, leśnym bądź specjalnym). Stosowanie tego typu
zabiegów jest podyktowane czynnikami ekonomicznym, ale nie wyklucza ono problemu obecności zanieczyszczenia w środowisku. Zagospodarowanie tych obszarów niewątpliwie wiąże się z wprowadzeniem zmian w środowisku glebowym (np.: zmiana odczynu w wyniku
stosowania nawozów fizjologicznie kwaśnych lub wprowadzenia zalesień; zmiana potencjału redox w wyniku intensywnego nawadniania). Skutkiem tego jest mobilizacja metali ciężkich i ich migracja do
wód gruntowych lub pobieranie przez organizmy roślinne i zwierzęce
[Alloway 1995; Karczewska 2002; McBride 1994].
Do grupy najbardziej ruchliwych metali ciężkich jest zaliczany
cynk [Baran i Jasiewicz 2009]. Dlatego celem niniejszej pracy było
określenie wpływu zmiany pH na mobilność cynku w glebach zanieczyszczonych.
272
Wpływ odczynu na mobilnośc cynku w glebach zanieczyszczonych
Materiały i metody
Badaniom poddano dwie próbki glebowe pobrane w miejscach zlokalizowanych w bezpośrednim sąsiedztwie Huty Miedzi Legnica (gleby
leśne obszaru o ograniczonym użytkowaniu, znajdujące się w odległości 50 m i 650 m od granicy huty). Próbki materiału glebowego pobrano w 5 powtórzeniach. Wysuszony i przetarty materiał glebowy
przesiano przez sito o średnicy oczek 1 mm. Tak przygotowane próbki poddano ekstrakcji roztworem 0,01 M chlorku wapnia (CaCl2),
w trzech powtórzeniach. Odczyn zawiesiny modyfikowano przez dodatek roztworu kwasu solnego (HCl) bądź zasady sodowej (NaOH).
Zawiesinę z dodatkiem 0,1 cm3, 0,2 cm3, 0,5 cm3, 1 cm3, 2 cm3 i 5
cm3 1 M HCl lub 1 M NaOH) i odpowiednią ilością wody, uzupełnioną do 50 cm3, poddano wytrząsaniu na mieszadle rotacyjnym. Czas
ekstrakcji wynosił 1 godz. Następnie roztwór sączono przez twarde
sączki. W otrzymanym ekstrakcie oznaczono stężenie cynku metodą
atomowej spektroskopii absorpcyjnej AAS. Uzyskane wyniki zostały
poddane weryfikacji statystycznej z użyciem testu Duncana. Stężenie
to jest miarą mobilności cynku przy określonej wartości pH.
Dodatkowo oznaczono skład granulometryczny gleb metodą
areometryczno-sitową w modyfikacji Prószyńskiego, odczyn w zawiesinie H2O i 1M KCl metodą potencjometryczną. Określono także
pojemność sorpcyjną i zawartość węgla organicznego standardowymi metodami wykorzystywanymi w gleboznawstwie [Ostrowska i in.
1999] oraz całkowite zawartości metali ciężkich oznaczonych po ekstrakcji wodą królewską.
Wyniki i dyskusja
Analizowane gleby wykazują uziarnienie pyłu gliniastego. Odczyn
obu gleb jest kwaśny, a wartości pH oznaczane w KCl wynoszą odpowiednio dla gleby nr 1: 5,3 a dla gleby nr 2: 4,5. Pojemność sorpcyjna obu utworów oscyluje w granicach 63,6–65,6 mmol(+)∙kg-1,
natomiast całkowita zawartość cynku jest zróżnicowana i wynosi:
86,9 mg Zn∙kg-1 w glebie nr 1 oraz 245 mg Zn∙kg-1 w glebie nr 2.
Analizowane utwory, charakteryzują się całkowitą zawartością
cynku typową dla gleb zanieczyszczonych, występujących w obrębie
Legnicko-Głogowskiego Okręgu Miedziowego (LGOM). Właściwości
273
Mateusz Cuske, Leszek Gersztyn, Bernard Gałka, Ewa Pora
fizykochemiczne przedstawione w tab. 1 są typowe dla gleb leśnych,
obszarów ograniczonego użytkowania Huty Miedzi „Legnica” [Kabała i Singh 2001].
Tab.1. Podstawowe właściwości fizykochemiczne analizowanych gleb.
Zawartość frakcji<0,002mm%
Całkowita zawartość cynku,
oznaczona po
mineralizacji w
wodzie królewskiej
mg∙kg-1gleby
1
pyg
5,3
5,9
63,6
1,19
7
245,32
2
pyg
4,5
5,3
65,6
1,9
10
86,9
Grupa granulometryczna
Corg.
%
Gleba
Pojemność
sorpcyjna
mmol(+)∙kg-1
pH
KCl
H2O
Na ryc. 1 przedstawiono wpływ dodatku kwasu lub zasady na
zmiany wartości pH zawiesiny glebowej oraz stężenie mobilnych
form Zn w glebie nr 1, silniej wzbogaconej w Zn. Stwierdzono, że
dodatek kwasu solnego do zawiesiny powoduje znaczne zwiększenie
mobilnych form cynku. Natomiast dodatek zasady sodowej powoduje nieznaczne zmniejszenie zawartości form cynku ekstrahowanych
roztworem 0,01 M CaCl2.
HCl
NaOH
Ryc. 1. Wpływ dodatku kwasu lub zasady na zmiany wartości pH
zawiesiny oraz stężenie mobilnych form Zn, gleba 1.
Z przeprowadzonych analiz wynika, że gleba nr 1, w warunkach
jej naturalnego pH zawiera 2,2 mg∙kg-1 cynku ekstrahowanego 0,01
M CaCl2. Zaobserwowano istotny wpływ obniżenia wartości pH na
274
Wpływ odczynu na mobilnośc cynku w glebach zanieczyszczonych
stężenie mobilnych form cynku w glebie, które zwiększyły się do 17,7
mg∙kg-1, przy wartości pH w przedziale 1–2. Wraz ze wzrostem wartości pH zaobserwowano zmniejszenie zawartości form cynku ekstrahowanych 0,01 M CaCl2, który następował do wartości pH około
7,5. Wzrost wartości pH powyżej 7,5 nie powodował istotnych zmian
stężenia mobilnych form cynku, które, przy pH 7,5 oscylowało w granicach 0,1 mg∙kg-1.
Ryc. 2 przedstawia wpływ dodatku kwasu lub zasady na zmiany wartości pH zawiesiny glebowej oraz stężenie mobilnych form
Zn w glebie nr 2. Z przeprowadzonych analiz wynika, że również
w tym przypadku dodatek kwasu solnego do zawiesiny powodował
zwiększenie zawartości mobilnych form cynku w analizowanej glebie. Natomiast dodatek zasady sodowej praktycznie nie miał wpływu
na udział form cynku ekstrahowanych 0,01 M CaCl2. Należy jednak
zaznaczyć, że zawartość mobilnych form cynku w glebie nr 2, osiąga
znacznie niższą wartość niż 0,1 mg∙kg-1 gleby. Skutkiem tego jest
brak możliwości określenia realnego wpływu zmiany zakwaszenia
(powyżej 7,0) na zawartość mobilnych form cynku w tej glebie.
Pod wpływem zwiększającego się zakwaszenia stężenie form
cynku ekstrahowanych z gleby nr 2 roztworem 0,01 M CaCl2 wzrasta,
osiągając wartość 9,5 mg∙kg-1, przy wartości pH równej 0,5. Natomiast zmniejszenie zawartości mobilnych form cynku następuje od
wartości pH około 4,5.
HCl
NaOH
Ryc. 2. Wpływ dodatku kwasu lub zasady na zmiany wartości pH
zawiesiny oraz stężenie mobilnych form Zn, gleba 2.
275
Mateusz Cuske, Leszek Gersztyn, Bernard Gałka, Ewa Pora
Analizując ryc. 2 należy stwierdzić, że radykalne zwiększenie
zawartości mobilnych form cynku następuje dopiero poniżej pH 4,5
(w przypadku gleby nr 1 była to wartość 5,0). Przyczyną tego może
być nieco niższa wyjściowa wartość pH gleby nr 2.
Ryc. 3. Wpływ pH na mobilność cynku w glebach 1 i 2.
Uzyskane wyniki potwierdzają dane literaturowe, zgodnie z którymi rozpuszczalność cynku w glebie zwiększa się wraz ze spadkiem
wartości pH [Kabata Pendias i Pendias 1999; Karczewska 2002; Stephan Ch. I in. 2007]. Odczyn to główny czynnik warunkujący rozpuszczalność metali ciężkich w glebie. Zwiększenie rozpuszczalności
metali ciężkich w warunkach kwaśnego odczynu jest związana początkowo z procesami desorpcji kationów z kompleksu sorpcyjnego,
a następnie – ze stopniowym rozpuszczaniem tlenków Fe, Al, i Mn,
a nawet wtórnych i pierwotnych minerałów ilastych. Dodatkowo niska wartość pH może prowadzić do rozpuszczania niektórych składników organicznych gleby, które wiążą zanieczyszczenia. Konsekwencją tego jest uwalnianie metali ciężkich do roztworu glebowego
[Beesley i in. 2010; Kabata-Pendias i Pendias 1995; Kicińska 2011;
Mercik 2002, Yobouet Y. i in. 2010].
276
Wpływ odczynu na mobilnośc cynku w glebach zanieczyszczonych
Wnioski
1. Zmiana odczynu gleby istotnie wpływa na ruchliwość cynku w glebie.
2. Zakwaszenie gleb zanieczyszczonych cynkiem powoduje
zwiększenie udziału jego form mobilnych.
3. Wzrost wartości pH do 7,5 skutecznie ogranicza mobilność
cynku w glebach.
4. Zawartość mobilnych form cynku zależy od całkowitej zawartości tego metalu w glebie.
Bibliografia
1. Alloway B. 1995. Heavy metals in soils. Blackie Academic and Professional.
Glasgow.
2. Baran A., Jasiewicz Cz. 2009. Toksyczna zawartość cynku i kadmu
w glebie dla różnych gatunków roślin. Ochrona Środowiska i Zasobów Naturalnych, 40: 157–164.
3. Beesley L., Moreno-Jiménez E., Clemente R., Lepp N., Dickinson N. 2010.
Mobility of arsenic, cadmium and zinc in a multi-element contaminated soil
profile assessed by in-situ soil pore water sampling, column leaching and
sequential extraction. Environmental Pollution, 158: 155–160.
4. Kabała C., Singh BR. 2001 Fractionation and mobility of copper, lead, and
zinc in soil profiles in the vicinity of a copper smelter. Journal of Environmental Quality, 30(2): 485–492.
5. Kabata-Pendias A., Pendias H. 1999. Biogeochemia pierwiastków śladowych.
Wydawnictwo Naukowe PWN. Warszawa.
6. Karczewska A. 2002. Metale ciężkie w glebach zanieczyszczonych emisjami hut
miedzi – formy i rozpuszczalność. Rozprawa habilitacyjna. Zeszyty Naukowe AR we Wrocławiu. Rozprawy CLXXXIV, 432. Wrocław.
7. Kicińska A. 2011. Formy występowania oraz mobilność cynku, ołowiu i kadmu w glebach zanieczyszczonych przez przemysł wydobywczo-metalurgiczny. Ochrona Środowiska i Zasobów Naturalnych, 49: 152–162.
8. McBride M. 1994. Environmental chemistry of soils. Oxford University
Press. New York.
9. Mercik S. 2002. Chemia rolna. Podstawy teoretyczne i praktyczne. Wydawnictwo SGGW. Warszawa.
10. Stepchan Ch., Courchesne F., Hendershot W., McGrath S., Chaudri A., Sappin-Didier V., Sauve S. 2008. Environmental Pollution 155 (2): 208–216.
277
Mateusz Cuske, Leszek Gersztyn, Bernard Gałka, Ewa Pora
11. Yobouet Y. A., Adouby K., Trokourey A., Yao B. 2010. Cadmium, Copper,
Lead and Zinc speciation in contaminated soils. International Journal of
Engineering Science and Technology, 2 (5): 802–812.
mgr inż. Mateusz Cuske
Promotor: prof. dr hab. inż. Anna Karczewska
e-mail: [email protected]
Leszek Gersztyn
Promotor: prof. dr hab. inż. Anna Karczewska
Bernard Gałka, Ewa Pora
Promotor: prof. dr hab. inż. Jarosław Kaszubkiewicz
Instytut Nauk o Glebie o Ochrony Środowiska
Uniwersytet Przyrodniczy we Wrocławiu
278
Blanka Ćwieluch
Dorota Merta
EPISTEME
18/2013, t. 3
s. 279–286
ISSN 1895-2241
ZIMOWA DIETA LISA (VULPES VULPES L.)
W NADLEŚNICTWIE RUSZÓW, BORY DOLNOŚLĄSKIE
WINTER DIET OF THE RED FOX (VULPES VULPES L.)
IN THE RUSZÓW FOREST DISTRICT, BORY
DOLNOŚLĄSKIE FOREST
Abstrakt. Badania zimowej diety lisa prowadzono w zwartym kompleksie leśnym Polski południowo-zachodniej, na terenie Nadleśnictwa Ruszów, gdzie
dominującym siedliskowym lasu są bory i bory mieszane. Zimą 2009/2010
zebrano 109 próbek kału lisa. Materiał moczono w alkoholu i w detergencie
nieenzymatycznym, a następnie płukano go bieżącą wodą i dzielono na frakcje. Wyodrębniono 7 kategorii pokarmu (jeleniowate, dziki, gryzonie, ptaki,
gady, owady i rośliny). Skład diety przedstawiono jako frekwencję występowania danej kategorii (%F), oraz procent biomasy (%B). Do obliczenia biomasy
skonsumowanej użyto współczynników strawności. Najwyższą frekwencję
wykazano dla jeleniowatych (42,2%), dla roślin (34,9%) oraz gryzoni (29,4%).
Najwyższy udział w biomasie pokarmu konsumowanego przez lisy zimą miały
dziki (34,9%), gryzonie (34,5%) i jeleniowate (20,0%).
Słowa kluczowe: odchody, kategorie pokarmu, frekwencja, % biomasy, padlina, dziki, gryzonie, jeleniowate, zwarty kompleks leśny
Summary. The studies on the winter diet of red foxes were carried out in
dense forest in southwestern Poland, in the Ruszów Forest District where
coniferous and coniferous mixed forest habitats predominate. During winter 2009/2010, a total of 109 samples of faeces were collected. The material was soaked in alcohol and in non-enzymatic detergent, washed under
running water, and then divided into fractions. Seven categories of food
were distinguished (cervids, wild boars, rodents, birds, reptiles, insects, and
plants). The composition of the diet was presented as the frequency of occurrence of a given category (%F), and the percentage of biomass (%B), calculated from digestibility coefficients. The highest frequencies were found
for cervids (42.2%), plants (34.9%) and rodents (29.4%). The highest proportions in the biomass of winter food were those of wild boars (34.9%),
rodents (34.5%), and cervids (20.0%).
Key words: faeces, food categories, frequency, % biomass, carrion, wild boars,
rodents, cervids, dense forest complex
279
Blanka Ćwieluch, Dorota Merta
WSTĘP
W Polsce lis występuje pospolicie na terenie całego kraju i posiada status zwierzęcia łownego. W latach 80-tych XX wieku bytowało w naszym kraju ok. 50 tys. lisów, a pozyskanie wynosiło 23–34 tys. sztuk.
W kolejnych latach, na skutek wykładania szczepionek przeciwko
wściekliźnie liczebność lisa zwiększyła się drastycznie (Smreczak,
2007). Trend taki trwał do roku 2006, kiedy stan populacji oszacowano na ok. 204 tys. osobników (Kamieniarz i Panek 2008). Dodatkowym czynnikiem powodującym zwiększenie liczebności lisa był
spadek zainteresowania myśliwych pozyskaniem tego gatunku, będący skutkiem kampanii przeciwko futrom naturalnym. Gwałtowny
wzrost liczebności lisa skutkował zwiększoną jego presją na populacje potencjalnych ofiar. Drapieżnictwo lisów jest główna przyczyną
regresu oraz utrzymywania się niskich stanów populacji zająca, kuropatwy i bażanta, oraz obniżenia sukcesu lęgowego gniazdujących na
ziemi ptaków (Panek 2007; Wasilewski 1986). Wykazano negatywny
wpływ lisów na kuraki leśne, zwłaszcza na lęgi, pisklęta oraz wysiadujące samice (Baines i in. 2004).
Teren Nadleśnictwa Ruszów jest obszarem niezwykle cennym
przyrodniczo położonym w całości w obszarze Natura 2000 „Bory
Dolnośląskie”. Znajdują się tam ostatnie ostoje krytycznie zagrożonego gatunku, jakim jest głuszec (Tetrao urogallus), a w roku 2009
rozpoczęto tam program restytucji tego kuraka. Lis występuje w Nadleśnictwie Ruszów pospolicie, a jego zwyczaje pokarmowe na tym
terenie nie są znane. Niniejsza praca stanowi pierwszy etap badań
diety tego drapieżnika, a jej celem jest określenie ilościowego i jakościowego składu zimowego pokarmu lisa w oparciu o analizę kału.
MATERIAŁY I METODY
Nadleśnictwo Ruszów stanowi zachodnią część Borów Dolnośląskich,
największego w Europie kompleksu lasów nizinnych. W strukturze
typów siedliskowych lasu największa rolę odgrywają bory i bory mieszane, stanowiące łącznie 94% powierzchni leśnej. Najważniejszym
gatunkiem lasotwórczym jest sosna pospolita (Pinus sylvestris). Obszar Nadleśnictwa Ruszów charakteryzuje się dużą różnorodnością
280
Zimowa dieta lisa (vulpes vulpes l.) W nadleśnictwie ruszów, bory dolnośląskie
fauny, licznie występuje tu jeleń szlachetny (Cervus elaphus), sarna
(Capreolus capreolus) i dzik (Sus scrofa) a z drapieżników oprócz lisa
wilk (Canis lupus), borsuk (Meles meles), kuna leśna (Martes martes),
jenot (Nyctereutus procyonides), norka amerykańska (Mustela vison)
oraz szop pracz (Procyon lotor) (Bena, 2001).
Ocenę zimowej diety lisa na terenie Nadleśnictwa Ruszów wykonano metodą analizy kału. Zimą 2009/2010 zebrano 109 prób odchodów tego gatunku, które analizowano standartowymi metodami
(Lockie, 1959; Goszczyński, 1974). Próby moczono w alkoholu, detergencie nieenzymatycznym, a następnie płukano na sicie o średnicy oczek 0,7 mm. Każdą próbę dzielono na frakcje (włosy, kości,
skóra, pióra, części owadów, nieoznaczona tkanka zwierzęca, owoce, nasiona, liście, szpilki, materiał roślinny), a następnie przez 24
godziny suszono w temperaturze 60oC i ważono. Identyfikację ssaków wykonano w oparciu o klucze (Dziurdzik 1973, Teerink 1991,
Pucek 1991), a owoce i nasiona zbóż na podstawie atlasu Bednarz
i Koczwańskiej (1976). Wyróżniono następujące kategorie pokarmu:
jeleniowate, dziki, gryzonie, ptaki, gady, owady i rośliny. Skład diety lisa podany został jako frekwencja występowania poszczególnych
kategorii pokarmu (%F), oraz jako % spożytej biomasy (%B). W obliczeniach % skonsumowanej biomasy zastosowano tzw. współczynnik strawialności obliczony doświadczalnie dla podstawowych typów
ofiar (Lockie, 1961, Goszczyński, 1974; Fairley i in., 1987; Jędrzejewska i Jędrzejewski 1992).
WYNIKI
Częstość występowania danej kategorii pokarmu w odchodach lisa
była najwyższa dla jeleniowatych (42,2%) oraz materiału roślinnego
(34,9%) (Ryc. 1). Wśród materiału roślinnego najczęściej pojawiały się
owoce należące do rodzajów: jabłoń (Malus sp.), grusza (Pirus sp.), oraz
borówka brusznica (Vaccinium vitis-idaea). W 9 próbach oznaczono
nasiona zbóż takich jak owies (Avena sp.), kukurydza (Zea mays) oraz
pszenica (Triticum sp.). W 13 próbach występowały trawy (Graminae),
natomiast liście i szpilki drzew oznaczono w 7 przypadkach. Wysoka
frekwencję wynosząca odpowiednio 29,3% i 16,5% wykazano dla gryzoni i dzików. Wśród gryzoni dominował nornik (Microtus sp.) obecny
281
Blanka Ćwieluch, Dorota Merta
w 54,5% odchodów zawierających szczątki gryzoni, a następnie nornica (Cletherionomys sp.) oraz karczownik (Arvicola sp). – po 15,1 %.
Natomiast darniówka (Pitymys sp.) i mysz leśna (Apodemus sp.)
pojawiały się najrzadziej, odpowiednio w 9,1% i 6,1% próbek. Frekwencja gadów oraz ptaków łącznie nie przekroczyła 7%. Procentowy
udział poszczególnych kategorii w biomasie pokarmu skonsumowanego przez lisy przedstawia Ryc. 2. Dominują dziki (34,9%), gryzonie
(34,5%) oraz jeleniowate (20,0%). Pozostałe 10,6% biomasy stanowił
materiał roślinny (8,5%), ptaki, owady oraz gady. W trakcie analizy
odchodów w kilku próbach pojawiły się fragmenty sznurka, gumy
oraz plastikowe opakowania, których z oczywistych względów nie
uwzględniono w obliczeniach.
Ryc. 1. Frekwencja (%F) występowania poszczególnych kategorii pokarmu
w odchodach lisa (n=109) zebranych zimą 2009/2010 na terenie
Nadleśnictwa Ruszów, Bory Dolnośląskie.
Ryc. 2. Procentowy udział poszczególnych kategorii pokarmu (%B)
w sumie biomasy skonsumowanej. Obliczono na podstawie analizy
odchodów lisa (n=109) zabranych zimą 2009/2010 na terenie
Nadleśnictwa Ruszów, Bory Dolnośląskie.
282
Zimowa dieta lisa (vulpes vulpes l.) W nadleśnictwie ruszów, bory dolnośląskie
WNIOSKI
Lisy zaliczane są do drapieżników oportunistycznych, a położenie
geograficzne oraz aktualna dostępność pokarmu w znacznej mierze
decyduje o tym, co dominuje w jego diecie. W warunkach środkowej
Europy głównymi składnikami diety lisów są przede wszystkim gryzonie, a także zającokształtne i ptaki, natomiast udział pokarmu roślinnego jest dużo mniejszy. Lisy wykorzystują także padlinę dużych
ssaków, a nawet ryby i gady (Goszczyński, 1995).
Istotny udział padliny dzików (34,9% biomasy), oraz jeleniowatych (20,0%) w diecie lisów związany jest najprawdopodobniej z występowaniem na terenie Nadleśnictwa Ruszów wilków. Na terenie
Puszczy Białowieskiej padlina dzików i jeleniowatych pozostawiona
przez wilki może stanowić aż 40% spożytej przez lisy biomasy (Jędrzejewski i Jędrzejewska, 1992). Dodatkowe źródło padliny mogą
również stanowić nieodnalezione przez myśliwych postrzałki.
Baltrunaite (2006) zbadał dietę lisa na podstawie analizy odchodów w kompleksie (55,9 tys. ha) borów w Litewskim Parku Narodowym Dzukija. Najwyższą frekwencję (40,9%) oraz biomasę (37,1%)
posiadały tam gryzonie. Również w Puszczy Białowieskiej gryzonie
były najważniejszym składnikiem diety lisa – frekwencja tej kategorii
pokarmu wynosiła 77,8% a udział w biomasie aż 54,8% (Jędrzejewski i Jędrzejewska, 2001). Znaczenie gryzoni w diecie lisów wzrasta
na terenach o niskiej lesistości. W Dolinie Biebrzy udział tej kategorii
pokarmu w diecie lisów wynosił ok. 89% (Gębczyńska i Raczyński,
2001). Natomiast na terenach rolniczych w Wielkopolsce gryzonie
stanowiły 65% biomasy (Goszczyński, 1995). Wyniki ukazane w niniejszej pracy dobrze korespondują z rezultatami podobnych badań
przeprowadzonych na terenie dużych kompleksów leśnych, różnią się
natomiast od prowadzonych na terenach o niskiej lesistości. W siedliskach borowych zagęszczenie populacji gryzoni jest zwykle niskie
(Górecki, 1984) i tym tłumaczyć można stosunkowo niewielki udział
tej kategorii (34,5%) w diecie lisa na terenie Nadleśnictwa Ruszów.
Ponadto, podczas długiej i ostrej zimy 2009/2010, w trakcie, której
zbierano materiał gruba i długo utrzymująca się pokrywa śnieżna
najprawdopodobniej znacznie utrudniła lisom chwytanie gryzoni.
Wyniki niniejszej pracy potwierdzają polifagiczność i oportunizm pokarmowy lisa, który z chwilą deficytu innych kategorii po283
Blanka Ćwieluch, Dorota Merta
karmowych urozmaica dietę pokarmem roślinnym (Goszczyński
1995). Chociaż frakcja roślinna pojawiała się często (%F= 34,86), to
jednak jej udział w biomasie skonsumowane był niewielki (8,54%).
Materiał roślinny (nasiona pszenicy, owsa i kukurydzy) pochodził
z nęcisk stosowanych przy polowaniach na zwierzynę, bądź też z okolic gospodarstw domowych. Obecność w zimowej diecie lisa owoców
jest prawdopodobnie związane z obecnością gospodarstw i samego
człowieka w pobliżu miejsc bytowania lisów. Drapieżniki te coraz
częściej pojawiają się w sąsiedztwie siedzib ludzkich, wysypisk śmieci
czy też zadrzewień w miejscowych parkach (Gębczyńska i Raczyński,
2001). Ponadto lis korzystał z zakonserwowanych niskimi temperaturami i śniegiem owoców borówki brusznicy. Być może część materiału
roślinnego (np. trawy) konsumowana była przez lisy przypadkowo podczas pobierania innych kategorii pokarmu, bądź też leczniczo, w celu
usunięcia pasożytów przewodu pokarmowego (Goszczyński, 1995).
Pewnym zaskoczeniem jest brak w składzie pokarmu lisa zająca,
choć liczne badania potwierdzają, iż jest to pokarm chętnie zjadany przez lisy, zwłaszcza na terenach o niskiej liczebności, lub małej
dostępności gryzoni. Zając stanowił 11,8% skonsumowanej przez
lisy biomasy w Puszczy Białowieskiej (Jędrzejewski i Jędrzejewska,
2001) oraz aż 20,5% Puszczy Niepołomickiej (Miciak, 2010). Zagęszczenie zająca na terenie Nadleśnictwa Ruszów wynosi ok. 0,44 osobnika/100 ha powierzchni ogólnej i jest bardzo niskie w porównaniu
np. z danymi pochodzącymi terenów rolniczych zachodniej Polski
(10–65 zajęcy/1000 ha) (Kamieniarz i Panek, 2008) i dlatego brak
frakcji zająca w zimowej diecie lisa na badanym terenie tłumaczyć należny bardzo niską dostępnością tej kategorii pokarmu.
Analiza odchodów jest metodą nieinwazyjną, często stosowaną
w badaniach nad dietą drapieżników. Ponadto można ją stosować
przez cały rok, także w czasie trwania okresu ochronnego badanych
gatunków zwierząt. Natomiast wadą metody są przede wszystkim
trudności w prawidłowym rozpoznaniu jedzonych ofiar. Poza tym kategorie pokarmu łatwo strawne, niezawierające opornych na trawienie fragmentów mogą być w ogóle niewykrywalne, przez co pomijane
w ogólnej charakterystyce diety danego zwierzęcia. Natomiast kategorie pokarmu zawierające stosunkowo dużą ilość części niestrawnych będą odnajdywane częściej i w związku z tym ich udział w diecie
284
Zimowa dieta lisa (vulpes vulpes l.) W nadleśnictwie ruszów, bory dolnośląskie
może być zawyżony. Dlatego celem dokładniejszego poznania diety
lisa na badanym terenie należałoby zbadać zwyczaje pokarmowe tego
zwierzęcia poprzez analizę zawartości żołądków (Goszczyński 1995).
BIBLIOGRAFIA
1. Baines D., R. Moss and D. Dugan. 2004. Capercaillie breeding success in relation to forest habitat and predator abundance. Jour. Appl. Ecol. 41: 59–71.
2. Baltrunaite. L. 2006. Diet and winter habitat use of the red fox, pine marten and
raccon dog in Dzukija National Park, Lithuania., Acta Zool.Lituanica nr. 1.
3. Bednarz, Z. i J. Koczwańska. 1976 Atlas roślin runa leśnego. PWRiL, Warszawa 1976.
4. Bena, W. 2001. Nadleśnictwo Ruszów. Rys historyczny. Wydawnictwo F.H.
Agat. Zgorzelec 2001.
5. Dziurdzik B. 1973. Klucz do oznaczania włosów ssaków Polski. Acta Zool.
Cracov. 18(4): 73–92.
6. Fairley, J. S., D. P. Ward and C. M. Smal. 1987. Correction factors and mink
feces. Ir. Nat. Jour. 22: 334–336.
7. Goszczyński J. 1974. Studies on the food of foxes. Acta Theriol. 19: 1–18.
8. Goszczyński J. 1995. Lis. Monografia przyrodniczo-łowiecka. Wyd. Oikos
Warszawa.
9. Górecki, A. 1984. Energy and the matter flow through rodents. Pages 113–
121 in: W. Grodziński, J. Weiner, P.F. Maycoch (eds). Forest ecosystems
in industrial region. Springer-Verlag.
10. Gębczyńska, Z. i J. Raczyński. 2001. Drapieżniki Doliny Biebrzy – lis.
Łowiec Polski 12.
11. Jędrzejewski, W. i B. Jędrzejewska. 1992. Foraging and diet of the red fox
in relation to variable food resources in Białowieża National Park, Poland.
Ecography 15: 212–213.
12. Jędrzejewska, B. i W. Jędrzejewski. 2001. Ekologia zwierząt drapieżnych
Puszczy Białowieskiej. Wydawnictwo Naukowe PWN, Warszawa.
13. Kamieniarz, R. i M. Panek. 2008. Zwierzęta łowne w Polsce na przełomie
XX i XXI wieku. Stacja Badawcza OHZ PZŁ w Czempiniu. Czempiń 2008
14. Lockie, J. D. 1959. The estimation of the food of fox. J. Wildl. Manage.23:
224–227.
15. Lockie, J. D. 1961. The food of pine marten Martes martes in West Ross
Shire, Scotland. Proc. Zool. Soc. London 136: 187–195.
16. Miciak, M. 2010. Jesienno-zimowa dieta lisa na terenie Puszczy Niepołomickiej. Praca magisterska. Uniwersytet Pedagogiczny. Kraków 2010.
285
Blanka Ćwieluch, Dorota Merta
17. Panek M. 2007. Drapieżnictwo lisów na zającach. Monografia – Nauka łowiectwu. Część II. Zającowi na ratunek. Wyd. Mazowsze: 96–105.
18. Pucek, Z. 1991. Keys to vertebrates of Poland. PWN Warszawa.
19. Smreczak M. 2007. Efekt doustnego uodparniania lisów przeciwko wściekliźnie. Strony 39–47 w: Monografia–Nauka łowiectwu. Część I. Kryzys
zwierzyny drobnej i sposoby przeciwdziałania. Wyd. Mazowsze.
20. Teerink, B. J. 1991. Hair of West-European mammals: atlas and identification key. Cambridge University Press 1991.
21. Wasilewski, M. 1986. Population dynamics of pheasants near Rogów, central Poland. Ekologia Polska 34: 669–680.
mgr Blanka Ćwieluch, dr Dorota Merta
Zakład Ekologii, Badań Łowieckich i Ekoturystyki
Instytut Biologii, Uniwersytet Pedagogiczny w Krakowie
ul. Podbrzezie 3, 31–054 Kraków
e-mail: [email protected]
Promotor: prof. dr hab. Bogusław Bobek
286
Bartłomiej Glina, Adam Bogacz
Oskar Bojko, Magdalena Kordyjarek
EPISTEME
18/2013, t. 3
s. 287-296
ISSN 1895-2241
Zróżnicowanie gleb z obszaru torfowiska
stokowego okolic Karłowa
(Park Narodowy Gór Stołowych)
diversity of soils in the peatland located
on slope near Karłów
(Stołowe Mountain National Park)
Abstrakt. Badania terenowe przeprowadzono w maju 2011 roku na obszarze torfowiska stokowego w centralnej części Parku Narodowego Góry
Stołowych. Długoletnie użytkowanie leśne połączone z procesem odwadniania, wywołało znaczne wahania poziomu wód gruntowych oraz zainicjowało proces murszenia gleb. Procesom tym towarzyszy okresowe namulanie gleb organicznych, materiałem niesionym przez potok płynący wzdłuż
torfowiska. Rośliny torfotwórcze pierwotnie tu występujące powoli zostały
wyparte przez ekspansywną roślinność trawiastą, krzewy i drzewa. To ważny problem z punktu widzenia ochrony różnorodności biologicznej siedlisk
podmokłych. Materiał glebowy do badań laboratoryjnych pobrano z 4 profili glebowych (20 próbek), reprezentowały one płytkie gleby organiczne i minerlano-organiczne. W pobranym materiale oznaczono właściwości fizyczne, fizykochemiczne i chemiczne. Celem pracy było określenie aktualnego
stanu gleb organicznych oraz mineralno-organicznych z torfowiska stokowego, centralnej części Parku Narodowego Gór Stołowych.
Słowa kluczowe: gleby organiczne, gleby mineralno-organiczne, drenowanie,
degradacja, namulanie
Summary. Researches was conducted in May 2011 on shallow organic soils
and mineral-organic soils located in the central part of Stołowe Mountain
National Park (SW Poland) near village Karłów. These site according to
slightly drainage and long-term use of spruce forest are exposed to periodic
fluctuation of ground water table. Occurred soils are also enriched in mineral material by periodic flooding of the stream running along the peatland.
Peat forming plants, originally occurring there, are displaced by the expansive grassy plants, shrubs and trees. This is an important problem from the
viewpoint of biodiversity conservation of wetland habitats. Peat soil mate287
Bartłomiej Glina, Adam Bogacz, Oskar Bojko, Magdalena Kordyjarek
rial for laboratory analysis were sampled from 4 soil profiles (20 samples)
selected on study area. In sampled material several physical, physicochemical and chemical properties were determined. The aim of work was to give
general characterization of examined soils in the peatland located on slope.
Key words: organic soils, mineral-organic soils, peatlands, drainage, degradation, silting
288
Zróżnicowanie gleb z obszaru torfowiska stokowego okolic Karłowa...
Wstęp
Torfowiska są cennym elementem środowiska przyrodniczego [Tarnocai 2006]. Prawidłowo funkcjonujące pełnią rolę rezerwuaru wody
[Mouser i in. 2005] oraz węgla organicznego [Ojanen i in. 2013].
Zmiana warunków hydrologicznych, wywołana drenowaniem terenów użytkowanych jako grunty orne oraz użytki zielone, a także
długoletnie użytkowanie leśne przyczynia się do zatrzymania procesu torfotwórczego [Sokołowska i in. 2005]. Dochodzi wówczas do
zmian środowiska glebowego, a także do drastycznych zmian w składzie florystycznym, z szybką utratą charakterystycznych gatunków
roślinności torfotwórczej [Malson i in. 2008]. Następuje zanikanie
gleb organicznych powodowane przez proces murszenia połączony z mineralizacją materii organicznej [Grzelak i in. 2008]. Wzrost
natlenienia środowiska powoduje intensywne przemiany fizyczne
i chemiczne tego rodzaju gleb [Trepel i in. 2000]. Zmiany morfologii
profilu oraz właściwości gleb mogą być wywoływane także przez naturalne procesy stokowe m in. spełzywanie, osuwanie się materiału
[Kabała i in. 2008, Starkel 2008].
Celem pracy było określenie aktualnego stanu gleb organicznych
oraz mineralno-organicznych z torfowiska stokowego, centralnej
części Parku Narodowego Gór Stołowych.
Materiał i metody
W trakcie badań terenowych w czerwcu 2011 roku, wytypowano 4 powierzchnie badawcze na obszarze torfowiska stokowego w centralnej
części Parku Narodowego Gór Stołowych (50°28’19–20’’N, 16°19’40–
41’’ E) (ryc. 1). Obszar badanego torfowiska znajduje się na wysokości od 798 do 806 m.n.p.m, na stoku o nachyleniu 3°. Średnia roczna
temperatura dla obszaru Gór Stołowych wynosi 4,8 °C. W najcieplejszym miesiącu (lipiec) wynosi 16,9oC, a w najzimniejszym (styczeń)
–7,3 oC. Opady atmosferyczne kształtują się w przedziale 790–1100
mm i zależą bardzo istotnie od wyniesienia terenu [Otop i Miszuk
2012]. Omawiane torfowisko powstało na podłożu piaskowcowo-mułowcowym, w miejscu gdzie początek bierze najdłuższy ciek wodny PNGS, potok Czerwona Woda. Badane torfowisko pokrywa sieć
289
Bartłomiej Glina, Adam Bogacz, Oskar Bojko, Magdalena Kordyjarek
rowów drenujących, które wykonane zostały na przełomie XIX i XX
wieku w celu osuszenia torfowiska pod użytkowanie leśne. Aktualnie
odpływ wody został ograniczony poprzez wykonanie drewnianych
zastawek w rowach drenujących. Analizując skład gatunkowy roślinności wyraźnie zauważa się dominację gatunków trawiastych (Trzęślica modra, Mietlica biaława, Śmiałek pogięty) oraz drzew (Jarząb
pospolity, Świerk pospolity, Olsza czarna). Rośliny torfotwórcze
(Turzyce, Płonnik, Sphagnum sp.) stanowią tylko niewielki udział
w składzie gatunkowym roślinności tu występującej.
Ryc. 1. Obiekt badań.
Materiał analityczny do badań (22 próbki) został pobrany za pomocą świdra typu Instorf (Profile 1, 2 i 3) oraz z odkrywki glebowej
(profil 4). W trakcie prac dokonano klasyfikacji gleb według Systematyki Gleb Polski [PTG 2011] oraz międzynarodowej klasyfikacji
[WRB 2007]. Stopień rozkładu torfu określony w terenie porównano z rezultatami uzyskanymi w laboratorium przy użyciu metody
SPEC oraz pół strzykawki [Lynn i in. 1974]. Ponadto określono właściwości fizyczne pobranego materiału glebowego, fizykochemiczne i chemiczne: popielność przez spalanie próbek przez 4h w temp.
550°C, gęstość właściwą przy zastosowaniu formuły Zawadzkiego:
ρ= 0,11·A+1,451 [Okruszko 1971], gdzie: ρ – gęstość właściwa,
A – zawartość popiołu, 1,45 – gęstość właściwa humusu, gęstość
objętościową na podstawie popielności wg formuły Okruszki:
ρo= 0,004·A+0,0913 [Okruszko 1971], gdzie ρo – gęstość objętościowa, A – zawartość popiołu, 0, 0913 – gęstość objętościowa
290
Zróżnicowanie gleb z obszaru torfowiska stokowego okolic Karłowa...
humusu, stopień wtórnego przeobrażenia torfu – na podstawie
wskaźnika chłonności wodnej W1, pH w 1 mol·dm3·-1 KCl potencjometrycznie, hydrofobowość potencjalną gleb – przy użyciu testu alkoholowego, C ogółem przy użyciu aparatu CS-MAT 5500,
kwasowość wymienną metodą Sokołowa oraz zawartość kationów
o charakterze zasadowym Ca2+, Mg2+, K+, Na+ w wyciągach octanu
amonu.
Wyniki i dyskusja
Badane gleby według Systematyki Gleb Polski [2011] zaklasyfikowano
jako gleby torfowe saprowe płytkie (profile nr 1 i 2), glebę torfiastoglejową (profil nr 2) oraz glebę murszowatą (profil nr 4). Posługując
się międzynarodową kalsyfikacją FAO-WRB [2007], gleby zostały przydzielone do 3 grup referencyjnych: Histosols, Gleysols oraz Regosols
(Tab. 1). Pomimo braku wcześniejszych literaturowych doniesień na
temat omawianych gleb, aktualne obserwacje pozwalają stwierdzić,
że profile nr 2 i 4 w przeszłości były typowymi glebami organicznymi.
Uległy one silnym przeobrażeniom na skutek intensywnego procesu
namulania (profil nr 2) oraz odwadniania torfowiska (profil nr 4). Na
badanej powierzchni występują odsłonięte korzenie drzew, co świadczy o erodowaniu powierzchniowych warstw gleb na stokowych.
Bazując na zawartości przetartego włókna (B) <16,6% oraz wartości indeksu pirofosforanowego (IP), poziomy organiczne klasyfikowano głównie jako sapric (IP)<4. Jedynie poziom powierzchniowy
w profilu nr. 1 zaklasyfikowano jako hemic, gdyż zawierał 37,5 %
przetartego włókna (tab.1). Badane profile glebowe wykazały duże
zróżnicowanie wartości gęstości właściwej oraz objętościowej. Związane to jest z zamuleniem pojedynczych poziomów organicznych
oraz zmniejszoną zawartością materii organicznej w profilach gleb
mineralno-organicznych. Poziomy torfowe zaliczano najczęściej do
średnio popielnych, ilość popiołu wahała się w przedziale od 20 do
35%. Wartości popielności w profilach nr 2 i 4 z uwagi na większy
udział części mineralnych kształtowały się powyżej 70% (tab. 1).
Poszczególne poziomy glebowe, zarówno organiczne jak i mineralne posiadają kwaśny odczyn. Wartości pH zawierają się w szerokim przedziale 3,4–5,8 (tab. 2). Najniższe wartości stwierdzono w poziomach
291
Bartłomiej Glina, Adam Bogacz, Oskar Bojko, Magdalena Kordyjarek
powierzchniowych, co warunkowane jest ombrotroficznym zasilaniem
tych warstw. W każdym z badanych profili obserwuje się wzrost wartości
pH wraz z głębokością. Otrzymane wartości pH (>5) w poziomach organicznych są charakterystyczne dla gleb torfowisk niskich [Sjӧrs 1950].
Numer
Profilu
Tab. 1. Właściwości fizyczne gleb.
Poziom
genetyczny
Miąższość
[cm]
SPEC
IP
ρw
ρo
Popielność
[g∙cm-3]
A
B
[%]
gleba torfowa sprowa płytka; Rheic Sapric Histosol Eutric
1
2
Oe
O/C
Oa1
Oa2
Oa3
C
0–7
10YR 7/3 4 1,58 0,14 11,3
7–14 10YR 5/3 2 2,30 0,40 77,6
14–31 10YR 3/3 0 1,77 0,21 29,2
31–37 10YR 3/3 0 1,75 0,20 27,2
37–42 10YR 4/3 1 1,91 0,26 41,5
>42
- 2,51 0,48 96,6
gleba torfiasto-glejowa; Histic Gleysol Eutric
62,5 37,5
40,0 5,0
42,5 5,0
37,5 2,5
-
10YR 5/3 2 1,96 0,28 46,5 43,5
Oi
0–3
- 2,42 0,44 88,2
A
3–10
10–25
- 2,31 0,40 78,1
G1
- 2,37 0,42 83,2
25–44
G2
- 2,33 0,41 79,7
G3
44–60
- 2,38 0,43 84,1
60–75
G4
gleba torfowa sprowa płytka; Rheic Sapric Histosol Eutric
3
Oa1
Oa2
Oa3
Oa4
Oa5
4
Olf
M1
A1
A2
C/R
0–3
10YR 4/4 0 1,61 0,15 14,5
3–20 10YR 4/3 1 1,80 0,22 32,1
20–30 10YR 3/3 0 1,81 0,22 32,9
30–41 10YR 3/3 0 1,96 0,28 46,5
41–49 10YR 4/3 1 2,03 0,30 52,4
gleba murszowata; Leptic Regosol Humic Eutric
0–7
7–14
14–23
23–31
31–40
-
-
1,73
2,26
2,29
2.35
2,40
0,19
0,39
0,40
0,42
0,44
25,2
73,9
76,2
81,5
86,4
5,0
-
45,0 12,5
27,5 5,0
47,5 2,5
55,0 2,5
50,0 2,5
-
-
Objaśnienia: SPEC – barwa glebowych ekstraktów pirofosforanowych,
PI – indeks pirofosforanowy, ρw – gęstość właściwa, ρo – gęstość objętościowa, A – włókno przed przetarciem, B – włókno po przetarciu.
292
Zróżnicowanie gleb z obszaru torfowiska stokowego okolic Karłowa...
1
2
3
4
Oa1
O/C
Oa2
Oa3
Oa4
C
Oi
A
G1
G2
G3
G4
Oa1
Oa2
Oa3
Oa4
Oa5
Olf
M1
A1
A2
C/R
0–7
7–14
14–31
31–37
37-42
>42
0–3
3–10
10–25
25–44
44–60
60–75
0–3
3–20
20–30
30–41
41–49
0–7
7–14
14–23
23–31
31–40
3,7
5,1
5,5
5,7
5,6
5,8
4,2
3,9
4,2
4,2
4,4
4,4
4,8
5,2
5,1
5,2
5,2
3,4
4,0
4,2
4,4
4,6
20,2
12,2
32,1
31,7
26,1
1,41
25,5
5,07
9,76
6,41
7,93
5,47
34,2
28,5
27,4
24,0
15,8
33,5
10,1
8,70
6,40
4,85
Ca2+
Mg2+
Na+
K+
Kw
cmol(+) kg-1
9,60
24,8
72,0
56,0
72,8
9,60
27,2
12,0
20,8
24,0
22,4
27,2
46,4
76,0
60,0
76,0
68,8
33,6
26,4
31,2
36,0
32,0
2,16
1,35
2,14
2,25
2,03
1,21
3,18
1,46
1,41
1,60
1,34
1,57
3,09
3,30
4,11
3,71
3,42
3,46
1,82
1,57
1,67
1,65
1,33
0,32
0,19
0,17
0,15
0,55
3,63
1,45
3,37
0,61
0,63
0,69
0,96
1,08
0,61
0,71
0,84
2,16
0,86
0,82
0,86
0,82
0,56
0,69
4,06
3,47
1,98
0,55
0,63
3,37
5,45
5,45
6,44
7,93
11,8
2,68
1,98
2,48
14,3
8,33
5,45
6,44
8,43
8,52
7,46
0,34
0,32
0,42
0,44
0,40
9,80
3,00
1,80
3,20
1,80
1,00
1,00
0,60
0,80
0,80
0,60
9,00
3,40
2,20
0,80
0,80
V [%]
Miąższość
[cm]
C [%]
Poziom
genetyczny
pH KCl
Numer
Profilu
Tab. 2. Właściwości chemiczne gleb.
56,3
96,4
99,2
99,0
99,2
96,7
77,9
85,9
94,5
90,8
94,5
97,4
98,4
99,3
98,8
99,0
99,3
84,1
91,0
94,8
98,3
98,2
Objaśnienia: C – zawartość węgla organicznego, Kw – kwasowość wymienna, V – stopień wysycenia kompleksu sorpcyjnego kationami o charakterze
zasadowym.
Zawartość węgla w poziomach organicznych kształtowała się w przedziale od 34,2 % w poziomie torfu silnie rozłożonego do 12,2% w poziomie torfu zamulonego. W pozostałych dwóch profilach zawartość
węgla organicznego jest znacznie niższa i nie przekracza 10%, swoje
maksimum osiągając w poziomie murszastym w profilu nr 4 (tab. 2).
Zasilanie torfowiska zmineralizowanymi wodami węglanowymi [Sienkiewicz i Wójcik 2012] warunkuje dominację kationów Ca+2 oraz Mg+2
w kompleksie sorpcyjnym (tab. 2). Udział poszczególnych kationów
293
Bartłomiej Glina, Adam Bogacz, Oskar Bojko, Magdalena Kordyjarek
o charakterze zasadowym możemy uporządkować w następujący szereg: Ca+2>Mg+2>K+>Na+. Niekiedy Na+ zmienia się w szeregu miejscami
z K+. Podobne zależności w glebach torfowisk Gór Stołowych przedstawił Bogacz i in. [2012]. Bardzo wysoki stopień wysycenia kompleksu
sorpcyjnego (V%) głównie powyżej 90% spowodowany jest bardzo niskimi wartościami kwasowości wymiennej, kształtującymi się w granicach od 0,40 do 9,80 cmol(+) kg-1. Wzrost zawartości kationów zasadowych w poziomach podpowierzchniowych, spowodowanych opadaniem
poziomu wody gruntowej oraz wymywaniem składników pokarmowych
przez infiltrujące wody opadowe. Jest to zjawisko charakterystyczne dla
gleb objętych procesem decesji [Gąsiorek i Nicia 2010].
Analiza indeksu chłonności wodnej według Gawlika [2000] oraz
potencjalna zwilżalność gleb [Doerr i in. 2000], zostały przeprowadzone tylko dla poziomów organicznych. Analiza indeksu chłonności wodnej W1 wykazała słaby (II klasa) lub średni (III klasa) stopień
wtórnego przeobrażenia. Powierzchniowe poziomy genetyczne odznaczają się średnim stopniem wtórnego przeobrażenia, wartość W1
w przedziale 0,66–0,80. Poziomy podpowierzchniowe w niewielkim
stopniu uległy wtórnym przeobrażeniom o czym świadczą niskie
wartości wskaźnika W1 (0,51–0,66).
Świadczy to o inicjalnym stadium procesu decesji w tych glebach,
który aktualnie obejmuje tylko powierzchniowe poziomy. Poszczególne poziomy genetyczne na podstawie analizy potencjalnej zwilżalności zaklasyfikowano jako bardzo hydrofilne (6 poziomów), hydrofilne
(4 poziomy) oraz 3 powierzchniowe poziomy jako umiarkowanie hydrofobowe. Wyniki tej analizy doskonale korelują z analizą stopnia
wtórnego przeobrażenia. Valat i in. [1991] w swej pracy także wykazali, że poziomy silnie przeobrażone są najbardziej odporne na próby
ponownego nawodnienia.
Wnioski
1. Zmiany morfologiczne profilu glebowego wywołane procesami namulania i odwadniania gleb organicznych, maja istotny wpływ na ich
klasyfikację.
2. Właściwości sorpcyjne oraz odczyn badanych gleb są determinowane rodzajem dominującego sposobu zasilania w wodę.
294
Zróżnicowanie gleb z obszaru torfowiska stokowego okolic Karłowa...
3. Powierzchniowe warstwy badanych gleb organicznych są najbardziej narażone na procesy wtórnego przeobrażenia.
4. Potencjalna zwilżalność gleb organicznych zależy głównie od
stopnia ich wtórnego przeobrażenia.
Bibliografia
1. Bogacz A., Dzięcioł D., Glina B., Gersztyn L. 2012. Gleby organiczne na
renaturyzowanym torfowisku „Niknąca Łąka” w Parku Narodowym Gór
Stołowych. Rocz. Glebozn, 63, 2: 3–8.
2. Gąsiorek M., Nicia P. 2010. Zawartość wybranych makroelementów w glebach młak o zróżnicowanym trofizmie. Woda-Środowisko-Obszary-Wiejskie, 10, 1: 33–39.
3. Grzelak M., Janyszek M., Kaczmarek Z., Bocian T. 2008. Kształtowanie się
różnorodności zbiorowisk szuwarowych z klasy Phragmitetea pod wpływem
warunków siedliskowych. Woda-Środ.-Obsz.-Wiejskich, 8, 1: 99–108.
4. Kabała C., Bogacz A., Waroszewski J., Ochyra S. 2008. Wpływ pokryw stokowych na morfologię i właściwości bielic subalpejskiego piętra Karkonoszy.
Rocz. Glebozn, 59, 1: 90–99.
5. Lynn W. C., McKenzie W. E., Grossman R. B. 1974. Field laboratory tests
for characterization of Histosols. [In]: Histosols: Their Characteristic, Classification and Use. (Ed.): Stelly M., SSSA Spec. Pub. 6 Medison, 1: 11–20.
6. Malson K., Backeus I., Rydin H. 2008. Long-term effects of drainage and
initial effects of hydrological restoration on rich fen vegetation. Applied
Vegetation Science, 11: 99–106.
7. Mouser P. J., Hession W. C., Donna M., Rizzo D. M., Nicholas J., Gotelli N.
J. 2005. Hydrology and Geostatistics of a Vermont, USA Kettlehole Peatland. Journal of Hydrology, 301: 250–266.
8. Ojanen P., Minkkinen K., Penttila T. 2013. The current greenhouse gas impact of forestry-drained boreal peatlands. Forest Ecology and Management, 289: 201–208.
9. Okruszko H., 1971. Określenie ciężaru właściwego gleb hydrogenicznych
na podstawie zawartości w nich części mineralnych. Wiad. IMUZ, 10, 1:
47–54.
10. Otop I., Miszuk B. 2012. Zróżnicowanie temperatury powietrza w warunkach rzeźby Parku Nardowego Gór Stołowych [w:] Geoekologiczne warunki środowiska przyrodniczego Parku Narodowego Gór Stołowych.
WIND. Wrocław, s 183–190.
11. Polskie Towarzystwo Gleboznawcze. 2011. Systematyka Gleb Polski Wyd.
5. Roczniki Gleboznawcze, 62, 3: ss. 193.
295
Bartłomiej Glina, Adam Bogacz, Oskar Bojko, Magdalena Kordyjarek
12. Sienkiewicz J., Wójcik G. 2012. Plan ochrony Parku Narodowego Gór Stołowych – operat ochrony ekosystemów torfowiskowych. Warszawa, ss. 24.
13. Sjörs M. 1950. The relation beetwen vegetation and electrolytes in north
Swedish mire waters. Oikos, 2: 241–258.
14. Sokołowska Z., Szajdak L., Matyka-Sarzyńska M. 2005. Impact of the
degree of secondary transformation on acid–base properties of organic compounds in mucks. Geoderma, 127: 80–90.
15. Starkel L. 2008. Procesy stokowe i fluwialne przekształcające rzeźbę – czy
model z lat 70 jest nadal aktualny? Landform Analysis, 9: 16-20.
16. Tarnocai Ch. 2006. The effect of climate change on carbon in Canadian peatlands. Global and Planetary Change, 53: 222–232.
17. Trepel M., Davidsson T., Jorgensen S.E. 2000. Quantitative simulation of
biochemical processes in peatlands as tool to define sustainable use? Suo,
51: 83–93.
18. W. R. B. 2007. World Reference Base for soil resources: a framework for international classification, correlation and communication. World soil resources reports 103. FAO, ISRIC, IUSS, Rome, ss. 128.
19. Valat B., Jouany C., Riviere L.M. 1991. Characterization of the wetting
properties of air-dried peats and composts. Soil Sci, 152: 100–107.
promotor: dr hab. Adam Bogacz, prof nadzw.
Badania współfinansowane przez Unię Europejską ze środków
Europejskiego Funduszu Społecznego w ramach projektu systemowego pn. ,,Grant Plus” (Program Operacyjny Kapitał Ludzki, Priorytet VIII
Regionalne Kadry Gospodarki, Działanie 8.2 Transfer Wiedzy, Poddziałania
8.2.2 Regionalne Strategie Innowacji).
296
Alexandra Horváth
Blanka Kovács
Géza Nagy
EPISTEME
18/2013, t. 3
s. 297–304
ISSN 1895-2241
stosowanie mięty i cynamonu
PRZECIW chorobie PSZENICY FUSARIUM
APPLICATION OF MINT AND CINNAMON AGAINST
FUSARIUM DISEASE OF WINTER WHEAT
Abstrakt. W naszym badaniu zbadano efektywność stosowania gatunków
mięty (mięta, mięta pieprzowa „Mitcham“ i mięta pieprzowa „Mexian“)
oraz cynamonu do zainfekowanych przez Fusarium kłosów pszenicy ozimej
w warunkach in vitro i in vivo. Wpływ leków roślinnych i wodnego ekstraktu
z mięty i efekt olejków eterycznych z mięty i cynamonu na wzrost grzybicy
badano w laboratorium. Eteryczne olejki cynamonu i mięty ogrodowej skutecznie hamowały wzrost grzybni. W próbie polowej zaszczepiono sztucznie pszenicy ozimej potraktowano skutecznych olejów in vitro w warunkach
małej wydruku. Chorobę najskuteczniej zahamował zastosowany leczniczo
olejek cynamonowy. Według otrzymanych wyników, olejek z cynamonu
może być odpowiednim kandydatem do badań nad alternatywnymi sposobami kontroli nad chorobą.
Słowa kluczowe: pszenica ozima, kontrola chorób, olejek
Summary. In our study the application of mint species (spearmint, peppermint ‘Mitcham’ and peppermint ‘Mexian’) and cinnamon was investigated
against Fusarium head blight of winter wheat in vitro and in vivo. The effect
of crude drugs and the aqueous extract of mint, and the effect of essential
oils of mint and cinnamon on mycelial growth were evaluated in lab. On
artificial media the crude drug showed higher inhibition than aqueous plant
extracts. Cinnamon and spearmint oils effectively inhibited mycelia growth.
In field trial artificially inoculated winter wheat was treated with the in vitro
effective oils under small-plot conditions. The disease incidence was most
inhibited by cinnamon oil, applied curative. According to our results the essential oil of cinnamon can be an appropriate candidate for the research of
alternative disease control.
Key words: winter wheat, disease control, essential oil
297
Alexandra Horváth, Blanka Kovács, Géza Nagy
Introduction
Winter wheat is one of the most important field-grown plants that
is cultivated over more than 1 million hectares of Hungary [Hungarian Central Statistical Office, 2010]. Fusarium head blight caused
by Fusarium species is one of the most destructive diseases of wheat.
Most common pathogens are Fusarium graminearum and F. culmorum
[Halász and Tóth, 2010]. In addition to direct damage the production
of mycotoxins means high risk to human and animal health [Princzinger 2009]. The effective disease control requires the integrated
application of the different methods [Békési 2012]. In recent years
the strict pesticide regulations and changing consumer trends raise
the demand for the research of pesticide-free control methods. The
effect of several essential oils were investigated against Fusarium
species [Pattnaik et al., 1996; Perez-Sanchez et al., 2007; Fekete et
al., 2009], however results have been mainly obtained from in vitro
testing. Therefore it is needed to better understand how to protect
the yield without applying chemicals, and to inform the farmers about in vivo results.
The main objectives of this study were to investigate in vitro the
effect of air-dried crude drug, aqueous extract of mint and of essential oils of mint and cinnamon on mycelial growth of the pathogen
and to evaluate the efficacy of essential oil treatments against head
blight of wheat under small-plot field conditions.
Materials and Methods
In vitro tests were carried out in the Laboratory of the Department
of Plant Pathology of Faculty of Horticultural Science of the Corvinus University of Budapest. Plant extracts, air-dried crude drugs and
essential oils were tested against the pathogen of Fusarium disease
of wheat.
For in vitro assay Fusarium sp. isolated from diseased wheat grains was used. Aqueous plant extracts and essential oils were derived
from three mint varieties: Mentha spicata var. crispata L. (spearmint),
and Mentha × piperita f. rubescens ‘Mitcham’ L. and Mentha × piperita
f. pallescens L. ‘Mexian’ (peppermint). Plant extracts were prepared
298
Application of mint and cinnamon against fusarium disease of winter wheat
by transferring 5 g of air-dried crude drug into 50 mL of boiling distilled water, and after shaking the mixture for 24 hours at 25°C the
mixture was centrifuged at 4000 RMP for 10 minutes. The supernatant was filtered through filter paper. Crude drugs of mint alone were
involved in the in vitro evaluation as well. Essential oils were extracted by steam distillation using Clevenger-type apparatus according to
the Ph. Hg. VII. Hungarian standard. Beside mint oils the efficacy of
the commercially available essential oil of cinnamon (Cinnamomum
verum) (AROMAX Ltd., Hungary) was assessed against the pathogen
as well. Measurement of the total-phenol content (TPC) and the total
antioxidant capacity (TAC) of the plant extracts and determination
of essential oil composition were carried out at the Department of
Medicinal and Aromatic Plants of the University.
The antifungal activity of plant materials was compared on the
basis of the inhibition of the growth of mycelia by agar dilution technique. Different amounts of crude drug, plant extract and essential
oils were incorporated into hand warm malt extract agar medium.
Final concentrations were 0g/15ml, 0.1g/15ml, 0.3g/15ml and 1g/15
ml for crude drug, 0%, 3% and 10% for aqueous extract and 0%,
0.003% (cinnamon only), 0.01%, 0.03%, 0.1% and 0.3% for essential
oils. Small agar discs – originated from the culture of the pathogen –
were placed into the center of agar plates. Petri discs were incubated
at 24°C in dark. Growth of mycelium was measured regularly.
Field trial was carried out under small-plot conditions in winter
wheat in 2012 at Sóskút located at the downy part of the Buda hill
in Hungary. The Fusarium susceptible wheat cultivar ‘MV Toborzó’
was treated with the in vitro effective cinnamon and spearmint essential oils. Artificial inoculation was carried out by spraying heads
with the mixed conidium suspension of Fusarium graminearum and
F. culmorum (1.1–1.6×105 conidia/cm3) at early milk growth stage. To
support infection inoculated plants were sprayed with distilled water
just after inoculation. Oils were sprayed to the heads in 0.1% concentrations either 2 days prior to artificial inoculation (protective application) or 2 days after inoculation (curative application). To increase
the dispersion of oils in water Silwet Star (Momentive Performance
Materials, CH) spread sticker was applied in 0.01% concentration.
For comparison plants were treated with tebuconazole (Folicur Solo)
299
Alexandra Horváth, Blanka Kovács, Géza Nagy
in 0.04% concentration as well (fig.1). Evaluation of trial was carried
out after harvest. Effectiveness of oils was assessed by the frequency
of internal seed infection. After surface sterilization seeds were placed
onto wet filter paper, malt extract agar or Czapek-Dox agar in 120 mm
Petri dishes. Seeds were incubated at 24°C in dispersed light.
* Uc – untreated control
Fig. 1. Experimental design of field trial in winter wheat
(plot size ca. 180 m-2).
Statistical analysis was performed by SPSS software ver. 20.0.
Data were first tested for normality, and then subjected to analysis
of variance (ANOVA). Significant differences between mean values
were determined using Duncan’s, Tuckey’s and occasionally Games-Howell (if data did not meet the homogeneity of variances) post-hoc
tests (P=0.05). Effect of cinnamon oil was analyzed by one sample
t-test as well.
Results
Great differences could be observed among crude drugs, plant
extracts and essential oils in in vitro antifungal activity at the different concentrations. Crude drugs resulted better inhibition of mycelial growth, than aqueous extracts on malt extract medium. According
to univariate ANOVA all mint drugs significantly (p<0.05) inhibited
pathogen growth. The most effective was peppermint ‘Mitcham’ in
1g/15ml concentration. The antifungal effect of plant extracts was
300
Application of mint and cinnamon against fusarium disease of winter wheat
not so remarkable. In comparison with the control medium significant difference (p<0.05) in the inhibition could be observed only in
case of medium containing the extract of peppermint ‘Mitcham’ in
10%. In agar dilution tests essential oils showed different effect on
mycelial growth of Fusarium sp.. According to univariate ANOVA the
effect of the applied concentrations differed significantly (P<0.05) as
well. The greatest differences could be observed on the 8th day. Among
essential oils the oil of cinnamon was the most efficient in antifungal activity. The pathogen did not start to grow on media containing
the oil in 0.01%, 0.03%, 0.1% and 0.3% concentrations. However
the growth of mycelium on media that contained cinnamon oil in
0.003% concentration was similar to that of on media not containing
essential oils. From mint oils, the essential oil of spearmint resulted
the most effective inhibition of the pathogen. Antifungal activity of
essential oils of peppermint ‘Mexian’ and peppermint ‘Mitcham’ was
remarkable only in the applied higher (0.1% and 0.3%) concentrations. Significant differences (P<0.05) between essential oils in inhibition could be observed only in the lower applied concentrations
(0.01%, 0.03%). Since the essential oil of cinnamon gave total inhibition in the investigated concentrations it was omitted in the multiple comparison of the effect of concentration and oil type. According
to repeated measures ANOVA, essential oils alone and concentrations
alone had significant effect (P<0.05) on mycelial growth. However considering the multiple effect of the mentioned two factors significance
weakened (P=0.077). For the comparison of cinnamon essential oils
with mint oils one sample t-test was applied. Considering the effect
of the concentrations of cinnamon oil significant difference (P<0.05)
in the inhibition from other essential oils could be observed only in
the lower applied concentrations (0.01%, 0.03%). In higher concentrations all essential oil inhibited effectively mycelial growth (fig. 2.).
Evaluation of the effectiveness of essential oil applications in
field was carried out on the basis of the frequency of internal Fusarium seed-infection. The assessment on artificial media (malt extract
agar, Czapek-Dox agar) was more accurate than that of on wet filter
paper. Beside Fusarium spp. Alternaria sp. was observed in high frequency on the grains as well. Assessment methods did not differ for
the latter fungus.
301
Alexandra Horváth, Blanka Kovács, Géza Nagy
2. day
4. day
8. day
5000
4500
4000
3500
3000
Colony size (mm-2)
2500
2000
1500
1000
500
0
Concentrations
* C - control, Ci - cinnamon, S - spearmint, PMi - peppermint ‘Mitcham’, PMe - peppermint ‘Mexian’.
Fig. 2. Effect of essential oils on colony size of Fusarium sp.
* Ci_p – cinnamon oil applied protective, Ci_c – cinnamon oil applied curative, S_p – spearmint oil applied protective, S_c – spearmint oil applied curative, Uc – untreated control,
Teb – tebuconazole application, Inc – inoculated control Homogenous groups (univariate
ANOVA, p≤0.05; Duncan’s test) are indicated by same letters
Fig. 3. Effect of essential oil application on average internal seed infection
of Fusarium spp. assessed on malt extract agar and Czapek-Dox agar media
on the 10th day.
Under medium infection level disease incidence was most inhibited by cinnamon oil, applied curative, two days after artificial inoculation. Frequency of internal Fusarium seed-infection decreased to
less than one third in comparison with artificially inoculated control
302
Application of mint and cinnamon against fusarium disease of winter wheat
plants. According to univariate ANOVA, disease incidence on plants
treated with cinnamon oil curative significantly (P<0.05) differed
from that of artificially inoculated, treated with tebuconazole and
untreated plants, however difference in the effectiveness of essential
oil applications was not significant (P>0.05) (fig. 3.). Treatments did
not influence significantly (P>0.05) the frequency of occurrence of
Alternaria sp. on kernels.
Discussion and conclusions
On artificial media mint crude drugs showed higher inhibition than
aqueous plant extracts. Difference in inhibition could be based on
the different contents of phenolic compounds and on the different
antioxidant capacity. Among essential oils, in agreement with Velluti
et al. [2004], cinnamon oil showed significant antifungal activity to the
growth of Fusarium sp. Spearmint oil showed remarkable inhibition as
well. The essential oils of peppermint ‘Mexien’ and peppermint ‘Mitcham’ were effective only in higher concentrations (0.1% and 0.3%). The
applied cinnamon oil had high eugenol and cinnamaldehyde content,
which according to Velluti et al. [2004] are responsible for inhibition.
Antifungal effect of mint oils is attributed by Héthelyi et al. [2002] to carvon and limonene content. Spearmint oil in this study contained significantly higher concentration of both components than other mint oils.
In field under medium disease degree the application with cinnamon oil proved to be the most efficient against Fusarium head blight
in accordance with the results obtained in laboratory. Curative application was more efficient than protective treatment. This statement
is not supported by Marin et al. [2004], who found that in vitro effectiveness of essential oils against Fusarium graminearum on corn seeds
was better if they had been applied 24h prior to artificial inoculation.
Curative activity of cinnamon oil could be based on the high content
of those components responsible for strong inhibition of mycelial
growth. Application with mint oils proved to be effective as well.
According to our results the essential oil of cinnamon can be an
appropriate candidate for the research of alternative disease control.
However further studies are needed to clarify mode of action.
This research was supported by the European Union and Hungary in the scope of TÁMOP (Social Renewal Operational Program)
4.2.4.A/1-11-1-2012-0001 “National Excellence Program” project.
303
Alexandra Horváth, Blanka Kovács, Géza Nagy
References
1. Békési, P. 2012. Az integrált védelem lehetőségei az őszi búza betegségek elleni védelemben. Agrofórum. Extra, 45: 70–75.
2. Fekete M. Nagy G. and Palkovics L. 2009. Az illóolajok hatása a Botrytis cinerea, a Fusarium oxysporum f. sp. cyclaminis és a Sclerotinia sclerotiorum
kórokozókra. Növényvédelem, 45 (7): 343–349.
3. Halász Á. and Tóth Á. 2010. A búza Fusarium-fertőzöttségéről. Agrárium.
Növényvédelem, 20: 18–19.
4. Héthelyi B. É. Stoeva T. and Bernáth J. 2002. Bolgár és magyar Mentha
spicata L. Huds. illóolajok kémiai karakterének vizsgálata GC, GC/MS
módszerrel. Olaj, Szappan, Kozmetika, 51 (1): 26–32.
5. Marín S. Velluti A. Ramos A. J. Sanchis, V.: 2004. Effect of essential oils
on zearalenone and dezoxynalenol production by Fusarium graminearum in
non-sterilized maize grain. Food Microbiology, 21: 313–318.
6. Pattnaik S. Subramanyam V. R. and Kole C. 1996. Antibacterial and antifungal activity of ten essential oils in vitro. Microbios, 86 (349): 237–246.
7. Perez-Sanchez R. Infante F. Galvez C. and Ubera J. L. 2007. Fungitoxic
activity against phytopathogenic fungi and the chemical composition of
Thymus zygis essential oils. Food Science and Technology International, 13
(5): 341–347.
8. Princzinger G. 2009. Búza, fuzáriumok, toxinok. Mezőhír, 13 (8): 14., 16., 18.
9. Velluti A. Marín S. Gonzalez P. Ramos A. J. Sanchis V. 2004. Initial screening for inhibitory activity of essential oils on growth of Fusarium verticillioides, F. proliferatum and F. geraminearum on maize-based agar media.
Food Microbiology, 21: 649–656.
Alexandra Horváth
Corvinus University of Budapest
Department of Plant Pathology
e-mail: [email protected]
Blanka Kovács
Corvinus University of Budapest
Department of Plant Pathology
e-mail: [email protected]
Géza Nagy, PhD.
Corvinus University of Budapest
Department of Plant Pathology
e-mail: [email protected]
Thesis supervisor: Géza Nagy associate professor
304
Katarzyna Łyduch
Piotr Cymanow
EPISTEME
18/2013, t. 3
s. 305–312
ISSN 1895-2241
PRIORYTETY ZARZĄDZANIA FINANSAMI
OSOBISTYMI GOSPODARSTW DOMOWYCH
W DOBIE KRYZYSU
PRIORITIES IN HOUSEHOLD FINANCE
MANAGEMENT IN TIMES OF CRISIS
Abstrakt. Celem pracy jest przedstawienie kluczowych elementów wpływających na planowanie i realizację budżetów gospodarstw domowych w okresie
spowolnienia gospodarczego. Finanse osobiste stanowią sferę działalności
wpływającą w sposób szczególny na jakość życia podmiotów rozumianych
jako rodzina. Dzięki precyzyjnemu określeniu priorytetów finansowych badanych podmiotów z uwzględnieniem szeregu czynników nie tylko natury
ekonomicznej, ale także socjologicznej i kulturowej, możliwe staje się kontrolowanie przychodów i wydatków, a także prowadzenie spójnej polityki inwestycyjnej, co w długim okresie czasu gwarantuje stabilność finansową i otwiera perspektywy systematycznego rozwoju takiej jednostki. Przeprowadzone
badania dowodzą, iż mimo wysokiej świadomości dotyczącej konieczności
planowania przychodów i wydatków oraz ich bieżącej kontroli, działania te
podejmuje jedynie niespełna 60% gospodarstw domowych.
Słowa kluczowe: budżet, kryzys gospodarczy
Summary. The aim of this study is to present the most important elements
that affected planning and implementation of household budgets during
the economic downturn. Personal finances are that sphere of activity which
affected the family quality of life. Thanks to precise determination of financial priorities of selected households, taking into account many factors, not
only economic one but also sociological and cultural, it is possible to control
incomes and expenditures as well as a coherent investment policy. It ensures
financial stability and opens new prospects for the systematic development
of households in long-term. This study shows that there is high consciousness of planning incomes and expenditures and also the ongoing monitoring of these activities, but less than 60% of households really do that.
Key words: budget, economic crisis
305
Katarzyna Łyduch, Piotr Cymanow
WSTĘP
Obszar finansów osobistych stanowi tą sferę aktywności każdego
dorosłego człowieka, która w decydujący sposób wpływa na jakość
jego życia. Podstawą do określenia priorytetów własnej polityki finansowej jest zapamiętanie i zrozumienie sześciu zasad zarządzania
budżetem własnym [Lipiński 2008]. Ograniczają się one do prostych
słów kluczy: Zrozum, Zaplanuj, Zorganizuj, Kontroluj, Oszczędzaj
oraz Inwestuj. Precyzyjne określenie celów finansowych, postępowanie zgodnie z przyjętym planem, kontrola wydatków, a także inwestowanie umożliwiają zaspokojenie potrzeb gospodarstwa domowego oraz zabezpieczenie jego bytu w przyszłości.
Głównym celem każdego gospodarstwa domowego jest kumulowanie środków pieniężnych, które w przyszłości posłużą zaspokojeniu zarówno wspólnych, jak i indywidualnych potrzeb konsumpcyjnych poszczególnych członków gospodarstwa [Zalega 2007]. Taka
motywacja jest podstawą wyborów ekonomiczno-organizacyjnych,
dokonywanych przez członków gospodarstwa domowego zarówno
w jego obrębie, jak i poza nim [Kędzior 1998].
Według Hodoly [1971] gospodarstwo domowe to jednostka działająca w celach konsumpcyjnych. Pod pojęciem tym kryje się szeroko
pojęta organizacja spożycia (planowanie celów i związanych z tym
wydatków, podejmowanie decyzji ekonomiczno-organizacyjnych,
zaopatrzenie, realizacja prac domowych, itd.), oraz sama konsumpcja (działania o charakterze gospodarczym, znacząco odmiennym od
analogicznych procesów zachodzących w sferze publicznej). Finanse
publiczne wykorzystywane są bowiem na realizację konkretnych potrzeb publicznych [Majchrzycka-Guzowska 1997].
Planowanie finansów i późniejsze zarządzanie majątkiem jest
procesem składającym się z wielu decyzji oraz konkretnych przedsięwzięć. W przypadku majątku gospodarstwa domowego, planowanie
decyduje o wpływaniu na wielkość oraz strukturę składników majątkowych w taki sposób, aby jak najefektywniej realizować cele tego
gospodarstwa [Bywalec 2009].
Warto zauważyć, iż tradycyjnie pojmowana teoria gospodarstwa
domowego postrzega rodzinę jako podmiot maksymalizujący funkcję użyteczności, natomiast nowa ekonomia rodziny traktuje ją jako
wieloosobową jednostkę produkcyjną, maksymalizującą produkcję,
306
Priorytety zarządzania finansami osobistymi gospodarstw domowych...
gdzie nakładami są dobra rynkowe, wykształcenie, kwalifikacje oraz
wiedza wszystkich jej członków [Flejterski 2007].
Gospodarstwa domowe podejmują cztery główne rodzaje decyzji
finansowych [Bodie i Merton 2003]:
1. decyzje związane z konsumpcją i oszczędnościami – wskazujące na to, jaką część środków przeznaczyć na bieżące wydatki, a jaką część przychodów odłożyć na oszczędności,
2. decyzje inwestycyjne – określające jak najkorzystniej zainwestować zaoszczędzone pieniądze,
3. decyzje finansowe – mówiące kiedy i w jaki sposób gospodarstwa domowe powinny wykorzystać pieniądze innych ludzi,
aby efektywniej wprowadzić w życie własne plany konsumpcyjne oraz inwestycyjne,
4. decyzje związane z zarządzaniem ryzykiem – pomagające
określić w jakich warunkach i w jaki sposób gospodarstwa
domowe powinny redukować poziom niepewności finansowej, a kiedy podejmować takie ryzyko.
Wzrost znaczenia teorii finansów osobistych, z jakim mamy do
czynienia w ostatnich latach, dowodzi istotnej roli masowych zjawisk
gospodarczych w sferze zachowań gospodarstw domowych i ich silnej współzależności z poszczególnymi obszarami systemu rynkowego. Korelacje te silnie ujawniają się w sytuacjach związanych z przesileniem koniunktury, zwłaszcza w kontekście zjawisk spowolnienia
gospodarczego i kryzysu.
Celem niniejszej pracy jest przedstawienie zmian zachodzących
w procesach decyzyjnych gospodarstw stosowanych w sferze finansów w kontekście globalnego spadku koniunktury gospodarczej.
MATERIAŁY I METODY
W artykule wykorzystano literaturę przedmiotu odnoszącą się do
teorii i praktyki finansów osobistych oraz dziedzin pokrewnych, materiały Narodowego Banku Polskiego oraz – w części empirycznej –
wyniki badań ankietowych przeprowadzonych na próbie 120 gospodarstw domowych powiatu kozienickiego (woj. mazowieckie).
Dane zostały pozyskane w pierwszej połowie 2012 r. Połowa respondentów pochodziła z terenów miejskich, zaś drugą połowę stanowiły gospodarstwa osób zamieszkujących wieś.
307
Katarzyna Łyduch, Piotr Cymanow
Wśród respondentów nieznacznie przeważały kobiety (53%). W badanej grupie dominowały osoby w przedziale wiekowym 41–50 lat,
51–60 lat (po około 25%) oraz 31–40 lat (około 23%). Zdecydowanie mniej liczne były grupy respondentów w przedziałach wiekowych
21–30 lat oraz powyżej 60 lat (po około 12%). Ankietowani poniżej 21
roku życia stanowili najmniej liczną grupę (3% ogółu respondentów).
Pod względem edukacji dominowały osoby z wykształceniem
średnim (51% badanych). Co czwarty respondent legitymował się
dyplomem ukończenia studiów, pozostałe osoby posiadały wykształcenie podstawowe i zasadnicze zawodowe. Mieszkańcy obszarów
wiejskich znajdowali się znacznie rzadziej w grupie osób z wykształceniem wyższym, natomiast w tej grupie dominowali respondenci
z wykształceniem zasadniczym zawodowym.
Różnice zauważalne są również w odniesieniu do liczebności rodzin – o ile w grupie miejskiej dominują gospodarstwa dwuosobowe
(38%) i 3–4 osobowe (33%), to na wsi wspomniane kategorie liczą
odpowiednio 17% i 35%, natomiast rodziny posiadające 5 i więcej
członków stanowią 37% (w mieście 10%).
WYNIKI I DYSKUSJA
Kryzys finansowy, który rozpoczął się w 2007 r. jest najpoważniejszą
od 1929 r. zapaścią globalnej gospodarki w czasach pokoju. Załamanie się rynków kapitałowych, częściowy paraliż światowego systemu
finansowego oraz najgłębsza od wielu dziesięcioleci recesja o wymiarze globalnym i groźba bankructwa państw, to sytuacja wyjątkowo
trudna. Mimo, że skala bankructw i zapaści gospodarki światowej nie
ma jak dotąd tego wymiaru, co w latach 1929–1932, to istnieją poważne przesłanki do tego aby sądzić, iż mamy do czynienia z kryzysem głębokim i długotrwałym [Polska…2009]. Nie ulega wątpliwości,
że sytuacja globalna musi wpływać na rynki lokalne – w tym na rynek
finansowy, pracy czy dóbr konsumpcyjnych. Interakcje takie obserwujemy również w odniesieniu do polskiej gospodarki, która notuje zdecydowanie niższą dynamikę wzrostu, przy zwiększającej się
stopie bezrobocia i spadku konsumpcji. Sytuacja ta przekłada się na
zachowania podmiotów indywidualnych – nie tylko firm, ale przede
wszystkim gospodarstw domowych.
308
Priorytety zarządzania finansami osobistymi gospodarstw domowych...
Analizując poziom deklarowanych dochodów, warto zauważyć,
iż średnia wielkość środków, jakimi rozporządzają respondenci w obu
analizowanych grupach, różni się nieznacznie, natomiast istotne rozbieżności można zaobserwować w odniesieniu do ich źródeł pochodzenia. Wśród respondentów dominują rodziny o średnim miesięcznym dochodzie znajdującym się w przedziale 1500–2000 PLN (33%
ogółu), oraz 2000–2500 PLN (28%), dalsze miejsca zajmują gospodarstwa z przedziału 2500–3000 PLN (18%), 1500 PLN (13%) oraz
powyżej 3000 PLN (8%). Warto pamiętać, iż gospodarstwa domowe
często generują dochody z wielu źródeł. 73% mieszkańców wsi deklaruje, iż czerpie dochody z pracy na własny rachunek (głównie z prowadzenia gospodarstwa rolnego) – z czego dla ¾ stanowi to jedyne
źródło utrzymania, natomiast dochody 37% gospodarstw pochodzą
z pracy najemnej. W mieście proporcje te są odwrotne – działalność
gospodarczą prowadzi niespełna 18% badanych, natomiast główne
źródło dochodów to praca najemna – 75% ogółu. Renty, emerytury
i zasiłki stanowią źródło dochodu dla około 17% budżetów domowych, natomiast inne obszary działalności (np. najem) stanowią dochód jedynie co dziesiątego gospodarstwa – dwie ostatnie kategorie
praktycznie nie są różnicowane miejscem zamieszkania.
Znajomość pojęcia planowania budżetu deklaruje 97% respondentów, jednak warto zaznaczyć, iż sama znajomość nie jest tożsama
z rzeczywistym prowadzeniem kalkulacji we własnym gospodarstwie
domowym.
Do systematycznego planowania przychodów i wydatków przyznaje się 63% gospodarstw na wsi. W mieście udział ten jest nieco
niższy – 55% badanych deklaruje analizę własnego budżetu. Z kolei
jeżeli chodzi o funkcję kontrolną, to 62% gospodarstw wiejskich stara się dbać o utrzymanie wydatków w ramach posiadanych środków
(w mieście wielkość ta wynosi 64%), przy czym zdecydowanie częściej działania te są domeną kobiet – co może wynikać z częstszego
dokonywania przez nie zakupów.
Siła nabywcza polskich gospodarstw domowych jest słaba. Blisko
40% dochodów pochłaniają wydatki na żywność, znaczącą kategorią
są też wydatki mieszkaniowe (mieszkańcy wsi z reguły posiadają tytuł własności do nieruchomości, częściej też żyją w rodzinach wielopokoleniowych, co redukuje koszty). Pozostałe kategorie posiadają
309
Katarzyna Łyduch, Piotr Cymanow
mniejsze znaczenie, co z jednej strony dowodzi postawionej wcześniej tezy, z drugiej zaś uniemożliwia tworzenie rezerw w postaci
znaczących oszczędności czy inwestycji (tab. 1).
Tab. 1. Udział kategorii wydatków budżetów domowych (%).
Kategoria
Żywność
Mieszkanie i zdrowie
Kultura i wypoczynek
Transport i łączność
Nauka i edukacja
Odzież / obuwie
Inne
Wieś
40
21
9
12
3
8
7
Miasto
36
25
11
11
2
9
6
Źródło: opracowanie własne na podstawie badań ankietowych.
Co trzecie badane gospodarstwo na obszarach wiejskich deklaruje brak jakichkolwiek oszczędności, blisko połowa posiada jedynie
równowartość miesięcznego dochodu. W przypadku miasta wielkości
te są wyższe, choć jedynie 30% ogółu badanych gospodarstw deklaruje miesięczne oszczędności na poziomie co najmniej trzykrotności
dochodu (ryc. 1).
Ryc. 1. Deklarowana wysokość oszczędności względem uzyskiwanego
dochodu (%).
Źródło: opracowanie własne na podstawie badań ankietowych.
310
Priorytety zarządzania finansami osobistymi gospodarstw domowych...
Sposoby lokowania nadwyżek finansowych dowodzą konserwatywnej postawy respondentów w kwestii wyboru metody oszczędzania. Blisko połowa ankietowanych – niezależnie od miejsca zamieszkania – trzyma swoje oszczędności na nisko oprocentowanych
kontach typu ROR. Wśród mieszkańców miast znaczącym uznaniem
cieszą się lokaty (27% badanych) oraz gromadzenie środków w funduszach inwestycyjnych czy innych bardziej wyrafinowanych instrumentach rynku finansowego (35%). Z kolei mieszkańcy wsi preferują
trzymanie gotówki w domu (33%), zdecydowanie rzadziej zakładają
lokaty czy inwestują w inny sposób (ryc. 2).
Ryc. 2. Preferowane formy lokowania oszczędności (%).
Źródło: opracowanie własne na podstawie badań ankietowych.
WNIOSKI
Przeprowadzone badania wskazują, iż w dobie kryzysu gospodarczego analizowane podmioty mają świadomość konieczności planowania i kontroli budżetów domowych, przy czym aktywne zarządzanie
w tej dziedzinie podejmuje jedynie około 60% respondentów.
Słaba siła nabywcza polskich gospodarstw domowych determinuje kształt wydatków w których dominują koszty bytowe. Utrudnia
to wygenerowanie znaczących nadwyżek finansowych umożliwiających pokrycie nieprzewidzianych wydatków czy zwiększenie pozostałych pozycji budżetowych (np. wypoczynek, edukacja).
311
Katarzyna Łyduch, Piotr Cymanow
Stosowane w zarządzaniu nadwyżką finansową instrumenty
dowodzą pasywnej postawy badanych, wynikającej z niskiego poziomu wiedzy ekonomicznej, z drugiej natomiast strony są pochodną
niskiego stanu zamożności i obaw związanych z aktywnym inwestowaniem swoich oszczędności.
BIBLIOGRAFIA
1. Bodie Z., Merton R.C., 2003, Finanse, Polskie Wydawnictwo Ekonomiczne, Warszawa.
2. Bywalec Cz., 2009, Ekonomika i finanse gospodarstw domowych, Wydawnictwo Naukowe PWN, Warszawa.
3. Flejterski S., 2007, Metodologia Finansów, Wydawnictwo Naukowe PWN,
Warszawa.
4. Hodoly A., 1971, Gospodarstwo domowe i jego rola społeczno-ekonomiczna,
Książka i Wiedza, Warszawa.
5. Kędzior Z., 1998, Gospodarstwo domowe jako obiekt badań, [w:] Konsument – Przedsiębiorstwo – Przestrzeń, CBiE AE im. K. Adamieckiego,
Katowice.
6. Lipiński M., 2008, Finanse osobiste. Świadome zarządzanie własnym portfelem, Wydawnictwo Onepress, Warszawa.
7. Majchrzycka-Guzowska A., 1997, Finanse w Gospodarce Rynkowej, wydawnictwo Szkolne i Pedagogiczne, Warszawa.
8. Polska wobec Światowego kryzysu gospodarczego, 2009, Raport NBP,
Warszawa, www.nbp.pl/aktualnosci/wiadomosci_2009/polska_wobec_swiatowego_kryzysu_gospodarczego_2009.pdf, dn. 05.01.2013
9. Zalega T., 1/2007, Gospodarstwo domowe jako podmiot konsumpcji, Studia
i Materiały, Wydział Zarządzania UW, Warszawa.
mgr inż. Katarzyna Łyduch, dr inż. Piotr Cymanow
Zakład Ekonomiki i Organizacji Rolnictwa
Wydział Rolniczo-Ekonomiczny
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected], [email protected]
312
Márton Takács
EPISTEME
18/2013, t. 3
s. 313–320
ISSN 1895-2241
PREZENTACJA EUROPEJSKIego kasztanu jadalnego
oraz węgierskiego kasztanu jadalnego
PRESENTATION OF THE EUROPEAN SWEET CHESTNUT
CULT AND THE GREATEST HUNGARIAN SWEET
CHESTNUT TREES
Abstrakt. Przegląd kultu europejskiego i węgierskiego kasztanów jadalnych występuje w kilku legendah i świętach ludowych wiążących się
z tym, jak też z innymi gatunkami jak lipa, wierzba czy dąb. Według naszych
dendrometrycznych pomiarów, największy jadalny kasztan rosnie obecnie
niedaleko miejscowości Nagykutas (SW-Węgry). Fragmentaryczne szczątki
obszernych kasztanowych gajów pobliżu Zengővárkony lub Velem również zawierają pewną ilość olbrzymów. Największy kasztanowiec powiatu
Vas (W-Węgry) rośnie w pobliżu wsi Torony, wśród wysokich krzewów.
Największe w Komitacie Somogy (SW-Węgry) żyją w okolicach Iharosberény.
Oprócz nich, w artykule przedstawiono dane pomiarowe z Zalaegerszeg,
Dióskál, Bak, Csepreg i Csipkerek.
Słowa kluczowe: kasztan, Dendrometrii, kultowe, ochrona, krajobraz, ekologia
Abstrakt. An overview of the European and the Hungarian sweet chestnut
cult is given as several legends and folk feasts are connected to this species, similarly to other ones such as linden, willow or oak. Based on our
dendrometrical measurements, the greatest sweet chestnut tree lives near
Nagykutas village (SW-Hungary), among wine cellars. Patchy remnants
of one-time extended chestnut groves near Zengővárkony or Velem have
also preserved some giants as well as wine yards around Surd. The greatest chestnut tree of Vas County (W-Hungary) thrives near Torony village,
among tall shrubs. The greatest ones in Somogy County (SW-Hungary) live
around Iharosberény. Besides them, measurement data are presented from
Zalaegerszeg, Dióskál, Bak, Csepreg and Csipkerek.
Key words: chestnut, dendrometry, cult, protection, landscape ecology
313
Márton Takács
Introduction
The trees have always been surrounded by great respect. From time
to time, different nations connected legends, stories, notable persons
(e. g. in Hungary: Suzerain Rákóczi, King Béla the 4th, King Imre, King
Matthias Corvinus) to some of them. These trees, besides preserving
legends, deserve recognition due to their size, shape and age as well.
An important mission of nature conservation is to protect the more
than one hundred year old trees everywhere in the world. Their collective feature is their individuality and uniqueness. These giants affect their
landscape, they are in the remembrances. Some deserve protection because of their high age and size, others keeping stories and folk legends.
Materials and methods
References of different disciplines were processed in favour of examining the European chestnut cult. The database of Pósfai (2005)
helped us to start our examination on the Hungarian greatest sweet
chestnut trees and we have also found an unregistered tree.
During the data gathering we listed the legends of the trees, the
noted people and local stories which belong to them, their past and
present state, the problems of their conditions and treatments.
We examined trunk perimeter, trunk diameter and crown diameter of the trees, and valued their height. The diameter of the trunk
was measured at breast height (1,3 m above the ground). Trunk diameter was registered by counting an average of measurements on several sides. After measureing the trunk diameter (two times, d1, d2)
and crown radius (four times, r1, r2, r3, r4), we used a simple formula
to count the crown diameter:
Crown diameter
We estimated the height on the spot and based on photographs.
Besides these, we elaborated a scale for the health state (1-not
alive, 2-bad, 3-acceptable, 4-good, 5-excellent), and the accessibility
of the trees (1-difficult, 2-weak, 3-moderate, 4-good, 5-excellent).
314
Presentation of the european sweet chestnut cult and the greatest
Results and discussion
The chestnut is mentioned only once in the Bible, when Jacob tried
to affect the breeding of sheeps and goats by using also chestnut
branches. In the early Christianity, this species symbolized moral
and clarity (Gáspár 2006).
In Athens it had a lot of names, such as acorn of sardia, lopimon,
moton, acorn of Zeus, castanon etc. (Illés 1884). The last one refers to
its Latin name (Castanea sativa). The Greek word Castanon is inherited from the name of the Thessalian city Castana. According to another theory, its scientific name refers to the Latin castrare (castrate),
because the cupule remains empty after the seeds fall out of it. The
scientific name sativa means cultivated.
The well-known phrase „To take the chestnut out of the fire with the
cat’s/dog’s paw” is known from the La Fontaine tale of Monkey and
the cat. In this tale, the monkey inspires the cat to take some chestnuts out of the fire. The cat takes three chestnuts, but the monkey
eats them fast. The housekeeper comes and sends both of them to
the right-about, so the cat remains hungry (Nagy 1966).
Prehistoric people had already known this fruit in Hungary, as
its remnants were founded in the Anna Cave, Bükk Mts. (Páll 1954).
According to Konkolyné (2007), the sweet chestnut has been known
since the Neolithic age in Hungary.
During its harvest in Greece, lots of donkey stood around the
tree to put the sacks onto their back. They thought that if a family
had 20–24 chestnut trees and a group of goat, then they had everything (Illés 1884). The Romans thought that the optimal place for
living is the habitat of chestnut.
Contemporary books and patent letters prove that in the 13th
century the chestnut has already lived in Hungary. The word Castaneae was found in a letter of King Imre, dated from 1203, as well as
in a document on the privileges of a hospitium given by King Béla the
4th in 1242. These were surely not wild chestnuts as that species was
introduced by the Turks in the end of the 15th century.
In the 14th century, the chestnuts of Cevenne were really important in the feeding of French people. They didn’t know the bread till
the 17th century, but 90% of arable lands were covered by chestnut
315
Márton Takács
plantations. The sweet chestnut was also an important food in the
warmer valleys of the Italian and the Swiss Alps. Here the chestnut
was dried, grinded, and used for baking bread (they called it „the bread of poor people”). It was even used as fodder for livestock if producing high amount of seed (e.g. Switzerland). The chestnut was called
„bread-tree” on Corsica, where an ordinance that everybody has to
plant four sweet chestnut trees per year dates back to the 16th century (Konkolyné 2007). On the Feast of St. Martin, people usually eat
chestnut with wine in Italy (Gáspár 2006).
Legends state that the chestnut became known in Hungary during the reign of King Matthias Corvinus in the 15th century, when
Queen Beatrix brought it from Italy. Their favourite food was the
chestnut-filled capon (Konkolyné 2007).
It is tasty with wine, but some thought that eating a lot leads
to being nitty (Konkolyné 2007). Its seed was used as mothproof
in wardrobes, and its wood for musical instruments (Marosi 2010),
mine timber (Földes 1885), or beam in wine cellars. It was not used
for heating. Some poors used its leaves to fill pillows (Paládi 2001)
or as herb (Szőcs 2008).
As a symbol, chestnut can be found on several settlements’ coat
of arms. We state that Spain and Italy have the most coat of arms
with chestnut symbol, but Portugal, France, Switzerland and Hungary also conserve some.
The tree in Szentgyörgyvár (SW-Hungary) was the greatest sweet
chestnut in Hungary, but it dried out some years ago. Once it was
sanctified and treated, a cross is still on the trunk. At the last measure its perimeter was 868 cm.
Based on our dendrometric measurements, the greatest Hungarian sweet chestnut tree lives near Nagykutas village (SW-Hungary),
among wine cellars. Its perimeter at breast height is 840 cm, thanks
for its low branching. It has been protected since 1974, stands in a
clean, treated environment, we did not see any negligence. It is more
than 500 years old.
The greatest tree of the famous chestnut grove in Zengővárkony
(S-Hungary) is several hundred years old. This small grove stands
among agricultural and industrial areas. Chestnut cultivation has got
a long tradition here; therefore, it is really bad to see the state of the316
Presentation of the european sweet chestnut cult and the greatest
se trees. The greatest tree is in a bad condition; its central branch was
broken at 4 meter height. Its crown dried, we found several damages
on the trunk. Its perimeter is 780 cm.
One of the greatest sweet chestnuts of Hungary (later referred
as Surd I.) can be found in Surd (SW-Hungary). Its perimeter is 777
cm, and is 700 year old. Its health state is the worst among the chestnut trees alive. Once it was damaged by a thunderbolt, its trunk is
full of hollows inside, and only one of its three main braches is alive.
There is a fungus infection at the lower part of the trunk. It has been
protected for a long time. We found also the settlement’s smaller
chestnut tree among wine cellars, with a perimeter of 672 cm (later referred as Surd II.). In contrast with its mate, this tree is easily
accessible, and is in a better health state with more seeds. Its lower
branches touch the ground.
The greatest chestnut tree of Vas County (W-Hungary) thrives
near Torony village, among tall shrubs, making its documentation
and examination difficult. It almost dried up and is poor in fruit, we
found fungi on it. It has not a lot of publication and former notified
data.
Luckily we found chestnuts in good health state as well, for
example in Boncodfölde (SW-Hungary), standing alone in a well treated area. The tree is 600 years old (Rakonczay 1997). On the lower
part of the trunk we found a treatment of a former bark injury. Despite its excellent health state, it is poor in fruit.
In the Landscape Protection Area of Kőszeg Mts. the chestnuts of
Velem (W-Hungary) are also protected. There is an old, large chestnut
plantation in the northern part of Velem village (it is called Gesztenyés, meaning Covered by Chestnut). Although near the ground there is
a fungous infection on the greatest examined tree (Velem I.), its
crown and branches are healthy, except for one of them, which is broken. We also found great trees in the chestnut woods of the southern
part of the village. In proof of that, the greatest sweet chestnut has
a 656 cm big perimeter (Velem II.). It branches on 1,8 meter, and the
crown is healthy. These trees are more resistant against the diseases
due to their massive substance, there are no infected ones.
One of the most beautiful sweet chestnuts of Hungary is hiding
in Szenterzsébethegy, the western part of Zalaegerszeg city (SW317
Márton Takács
Hungary). Its whole trunk is screwed, thus, it gives a really imposing
appearance. In the surrounding area there is no chestnut culture. An
information table shows its protection state, but there is no trace of
treating on the tree. In 1978 a thunderbolt broke down several branches. Its age is more than 400 years.
We found the greatest sweet chestnuts of Somogy County in Iharosberény (SW-Hungary). In this little village there is a long tradition
of chestnut cultivation. One of its remains is a nearly 250 years old
tree in the north side of the settlement. Its trunk perimeter is 715
cm. There is a big wound on the trunk, and three out of four main
branches were cut off (at one and a half, four and five meters). Some
giant chestnuts stand in a private garden in the southern part of the
village, the greatest one has got a trunk perimeter of 660 cm. Sometimes this tree was a piece of the well-known registrated breed of
Iharosberény, its registration number is still on the trunk. The tree is
in a good health.
About the others: the chestnut of Dióskál (SW-Hungary) stands
on a private area, near grape plantations. In contrast to a smaller
local tree, the greatest sweet chestnut tree of Bak (SW-Hungary) is
not under legal protection. The tree in Csepreg (W-Hungary) stands
in a distant place among black locusts and pines, its trunk is rugged.
The greatest tree of Csipkerek (W-Hungary) is in an excellent health
thanks to its lower age, its trunk is screwed (such as in Zalaegerszeg).
Our results are summarized in Table 1.
Height (m)
Diameter of crown (m)
Diameter of trunk (m)
Settlement
Perimeter of trunk (cm)
Tab. 1. Main parameters of greatest chestnut trees in Hungary
(most important ones with bold).
Reaching
State of
health
State
of protection
Szentgyörgyvár 868 4,5 – 5 14 10 3 (medium) 1 (not alive) unprotected
Nagykutas
840 4 25 16 3 (medium)
4 (good) unprotected
Zengővárkony 780 3
21 15
4 (good)
2 (bad)
unprotected
318
Diameter of crown (m)
Height (m)
Surd (I.)
Torony
Boncodfölde
Velem (I.)
Zalaegerszeg/
Szt.erzsébethegy
Iharosberény (I.)
Dióskál
Bak
Surd (II.)
Csepreg
Iharosberény (II.)
Velem (II.)
Csipkerek
Diameter of trunk (m)
Settlement
Perimeter of trunk (cm)
Presentation of the european sweet chestnut cult and the greatest
777
775
738
738
3
3,5
3,5
3
10
21
23
23
12 3 (medium)
2 (bad)
unprotected
13
4 (good)
2 (bad)
unprotected
20 5 (excellent) 4 (good) unprotected
14 3 (medium) 3 (enough) unprotected
730
3
Reaching
18 13 3 (medium)
State of
health
2 (bad)
715 3
12 8 3 (medium)
2 (bad)
710 3 – 3,5 16 12 1 (difficult)
2 (bad)
701 3
18 16
2 (weak)
2 (bad)
672 2,5 – 3 25 17
4 (good)
4 (good)
665 3
17 14 1 (difficult)
2 (bad)
660 2,5 15 14 3 (medium)
4 (good)
656 2,5 22 16 1 (difficult) 5 (excellent)
653 2,5 – 3 25 16
2 (weak) 5 (excellent)
State
of protection
unprotected
unprotected
unprotected
unprotected
unprotected
unprotected
unprotected
unprotected
unprotected
Conclusion
Legends and folk customs are preserved only by old trees in many
places. They are the last witnesses of our historical sweet chestnut
cult. By their disappearance, a part of our natural and spiritual heritage gets lost. Although there are some promising actions (protection at local level, Tree of the Year competition etc.), the attention is
lower and lower, their habitats are treated less and less, they fall in
a far-gone state.
In case of the protected specimen we propose to follow the protection orders and plans, creation of direction and information panels and markings on tourist maps. The owners have to make the
necessary treatments on the non-protected ones, and place under
protection.
319
Márton Takács
References
1. Földes J. (1885): A szelíd gesztenye, Castanea vesca-ról. In: Erdészeti Lapok.
24. évf. 1. sz. 1–11 p.
2. Gáspár R. (2006): Éltető és gyógyító táplálékok. Heted7világ Kiadó, Budapest. 56–58 p.
3. Illés N. (1884): A szelíd gesztenyéről. In: Erdészeti Lapok. 23. évf. 9. sz.
769–780. p.
4. Konkolyné Gyúró É. (2007): A szelídgesztenye táji, kultúrtörténeti és kertészeti
vonatkozásai. In: Erdészeti Lapok. 142. évf. 12. sz. 392–394 p.
5. Marosi K. (2010): Élet-mód – A szelídgesztenye. In: Élet és Tudomány.
65. évf. 44. sz. 1385 p.
6. Nagy G. (1966). Gesztenye (szócikk). In: Magyar szólások és közmondások.
Talentum Kiadó, Budapest. 239 p.
7. Paládi-Kovács A. (főszerk.) (2001): Magyar Néprajz II. Gazdálkodás. Akadémiai Kiadó, Budapest. 19–20., 503–504 p.
8. Páll M. (1954): Karoljuk fel a szelídgesztenyét. In: Az erdő. 89. évf. 8. sz.
292–295 p.
9. Pósfai Gy. (2005): Magyarország legnagyobb fái. Alexandra Kiadó, Budapest. pp. 13–20.
10. Rakonczay Z. (1997): Göcsejtől Mohácsig. Mezőgazda Kiadó, Budapest. p. 119.
11.Szőcs E. (2008): Gyógyító növények. Kossuth Kiadó, Budapest. 34 p.
Márton Takács (Phd student)
dr. Ákos Malatinszky (associate professor)
Szent István University
Faculty of Agricultural and Environmental Sciences
Department of Nature Conservation and Landscape Ecology
H-2103 Gödöllő, Páter K. u. 1
e-mail: [email protected], [email protected]
Scientific supervisor: Dr. Ákos Malatinszky, associate professor
320
Łukasz Mendyk
Maciej Markiewicz
EPISTEME
18/2013, t. 3
s. 321-327
ISSN 1895-2241
Wpływ stopnia odwodnienia
na właściwości gleb wytworzonych
z osadów jeziornych
The influence of the degree
of dehydration on the properties
of soils derived from lake sediments
Abstrakt. Celem pracy była ocena wpływu obniżenia poziomu wód gruntowych na morfologię i właściwości gleb powstałych z osadów jeziornych.
Obszar badań znajduje się w północnej Polsce, na Pojezierzu Brodnickim
i obejmuje bezpośrednią zlewnię zanikających Jezior Sumowskich. Odwodnienie tego terenu spowodowane było koniecznością zwiększenia obszarów
użytków zielonych. Analiza objęła 4 profile glebowe występujące w obrębie
dna dawnego jeziora. Badane gleby odznaczały się wysoką zawartością materii organicznej i węglanu wapnia. Właściwości gleb i ich morfologia różniły
się w zależności od stopnia odwodnienia. Największe różnice obserwowano
w poziomach powierzchniowych i dotyczyły przede wszystkim ilości materii
organicznej (w tym także wartości stosunku C:N) i odczynu.
Słowa kluczowe: zanikające jeziora, odwodnienie gleb, osady jeziorne, gytia
Summary. The aim of this study was to estimate impact of the catchment
groundwater level fall on morphology and properties of soils derived from
lake sediments. The study area is located in the North Poland, within the
Brodnica Lake District and it includes the direct catchment area of dwindling Sumowskie Lakes. Drainage of the former lake area was caused by the
need to increase the areas of grassland. The analysis covered 4 soil profiles
emerging within former lake. Examined soils have high content of organic
matter and calcium carbonates. The properties and morphology of profiles
indicates differences in degree of dehydration between them. The greatest
differences are observed in the surface horizons and in particular the quantity of organic matter (including the value of the ratio C: N) and pH.
Key words: dwindling lakes, soils dehydration, lake sediments, gyttja
321
Łukasz Mendyk, Maciej Markiewicz
Wstęp
Zanikanie jezior na świecie zachodzi w zasadzie od momentu ich powstania [Churski 1998, Marszelewski 2005]. W Polsce od ostatniego zlodowacenia zanikowi uległa połowa jezior [Kalinowska 1961,
Marszelewski 2005]. Na obszarach tych dochodzi do powstania gleb
zupełnie nowych, wytworzonych z odsłoniętych osadów jeziornych.
Występowanie i rozwój charakterystycznych gleb na obszarze dna
zanikających Jezior Sumowskich potwierdzają badania m.in. Goneta
i in. [2010].
Celem pracy była ocena wpływu obniżenia poziomu wód gruntowych w zlewni na morfologię i wybrane właściwości gleb wytworzonych z dennych osadów jeziornych.
Materiał i metody
Obszar badań zlokalizowany był w północnej Polsce, na terenie Pojezierza Brodnickiego (Ryc. 1). Obejmował on zlewnię bezpośrednią
zanikających Jezior Sumowskich oraz zlewnię cząstkową niewielkiego cieku wypływającego z nich w kierunku północnym.
Ryc. 1. Lokalizacja obszaru badań.
322
Wpływ stopnia odwodnienia na właściwości gleb wytworzonych z osadów jeziornych
Poziom wód dawnego jeziora Sumowskiego obniżył się wskutek
procesów naturalnych i antropogenicznych tworząc dwa oddzielne akweny [Marszelewski 2005]. Powierzchnia większego, północnego jeziora wynosi obecnie około 15,1 ha, natomiast mniejszego,
południowego około 10,3 ha (obliczenia w ArcGIS 9.3). Pod względem gospodarki rybackiej zostały one zaklasyfikowane jako jeziora
typu karpiowego, co podkreśla znaczny stopień zeutrofizowania obu
zbiorników [Burak i in. 2005].
Badania polegały na wykonaniu 4 odkrywek glebowych. Trzy
z nich zlokalizowano w południowo-zachodniej części Jezior Sumowskich i objęły one dawne dno Jeziora Sumówek oraz podnóże południowego zbocza przyległego plateau kemowego. Czwarta odkrywka
została wykonana w północnej części systemu Jezior Sumowskich,
na wschód od kemu we wsi Tomki (Ryc. 1).
Ze wszystkich poziomów genetycznych pobrano próbki o naruszonej strukturze do analiz laboratoryjnych, a z 12 poziomów pobrano także
próbki do oznaczenia wybranych właściwości fizycznych. W pobranym
materiale glebowym zostały wykonane standardowe analizy zgodnie
z procedurami obowiązującymi we współczesnym gleboznawstwie [SgP
2011]. Zawartość węgla organicznego oznaczono – metodami Tiurina
i Altena, azotu ogółem – metodą Kjeldahla, węglanów – metodą Scheiblera, pH – potencjometrycznie. Według najnowszej systematyki gleb
symbole Lc (poziomy osadów limnicznych – ziemie koprogeniczne) poziomów genetycznych użyte w tabelach z wynikami odnoszą się do gytii zawierających powyżej 20% materii organicznej. Natomiast symbole
C obejmują zarówno gytie oraz piaski i mułki jeziorne.
Wyniki i dyskusja
Badane gleby różniły się między sobą stopniem odwodnienia, który
został określony na podstawie morfologii poszczególnych profili (poziom występowania wód gruntowych, charakterystyczne struktury
powstałe w wyniku przesuszenia). Gleby słabiej odwodnione, o płytszym zaleganiu poziomu wód gruntowych (profile 1 i 2) cechowały
się bardziej miąższymi poziomami murszowymi (30–60 cm) w porównaniu z glebami bardziej odwodnionymi (profile 3 i 4; 10–15 cm),
w których dodatkowo obecne były kliny powstające w wyniku przesuszenia i spękania pionowego gytii. Skutkiem wyższego poziomu
323
Łukasz Mendyk, Maciej Markiewicz
wód gruntowych jest spowolnienie tempa mineralizacji wpływające
na wyższą zawartość zhumifikowanej materii organicznej i większą
miąższość poziomów powierzchniowych gleb słabiej odwodnionych
(Tab. 1 i 2). Na miąższość tych poziomów wpłynęły także inne procesy takie jak, dostawa materiału mineralnego ze stoku (profilu 1),
worywanie materiału z poziomu murszowego w przykrywające go
deluwia (profil 3) lub osypywaniem się tego materiału w powstające
kliny (profil 4).
M1
M2
C
M
C
M
Lc1
Lc2
C1
C2
M
M
Lc1
Lc2
C
Profil 1 – gleba organiczna limnowo-murszowa
0–40
88
10
2 0,68 2,35 93,8 63,8
40–60 n.o. n.o. n.o. n.o. 1,69 n.o.
n.o.
60–120 n.o. n.o. n.o. n.o. 2,22 n.o.
n.o.
Profil 2 – gleba organiczna limnowo-murszowa
0–30
n.o. n.o. n.o. 0,48 1,97 184 88,8
30–100 34
57
9 0,59 2,47 125 74,3
Profil 3 – kopalna gleba organiczna limnowa
60–75 n.o. n.o. n.o. 0,55 2,00 93,3 51,2
75–80 n.o. n.o. n.o. 0,40 1,81 170 68,5
80–90 n.o. n.o. n.o. 0,29 1,78 213 61,3
90–102 19
59
22 0,69 2,48 96,2 66,7
102–125 27
58
15 0,73 2,47 99,3
72
Profil 4 – gleba organiczna limnowa
0–10
n.o. n.o. n.o. 0,34 2,00 218 74,7
KLIN
n.o. n.o. n.o. n.o. 1,99 n.o.
n.o.
10–40 n.o. n.o. n.o. 0,38 2,13 220 83,0
40–120 n.o. n.o. n.o. 0,30 2,17 299 89,8
120–170 n.o. n.o. n.o. n.o. n.o. n.o.
n.o.
Wh [%]
P [%]
[%
obj.]
Wilgotność
aktualna 28 i
29.09.2011
[%
wag.]
ρ [g·cm-3]
ρo [g·cm-3]
0,05 –
0,002
<
0,002
% zawartość
frakcji o średnicy
w mm
2,0 –
0,05
Głębokość
pobrania [cm]
Poziom
Tab. 1. Wybrane właściwości fizyczne gleb.
71,1 3,9
n.o. 9,9
n.o. 4,3
75,6 8,4
76,1 1,6
72,5
77,9
83,7
72,2
70,4
11
9,5
12
2,8
2,8
83,0
82,9
82,2
86,2
n.o.
12
9,2
8,5
7,4
2,1
ρo – gęstość objętościowa, ρ – gęstość właściwa, P – porowatość, Wh – woda higroskopijna n.o. – nie oznaczono, M – poziomy murszowe, Lc – gytie organiczne,
C – gytie mineralne.
324
Wpływ stopnia odwodnienia na właściwości gleb wytworzonych z osadów jeziornych
M1
M2
C
M
C
M
Lc1
Lc2
C1
C2
M
M
Lc1
Lc2
C
C:N
Głębokość
pobrania [cm]
N [%]
Poziom
genetyczny
Corg
[%]
Tab. 2. Wybrane właściwości chemiczne i fizykochemiczne gleb.
pH
H2O
KCl
Profil 1 – gleba organiczna limnowo-murszowa
0–40
9,66 0,562 17
6,3
6,1
40–60
42,3 2,68 16
6,0
5,7
60–120
14,4 1,02 14
8,0
7,8
Profil 2 – gleba organiczna limnowo-murszowa
0–30
25,5 1,71 15
6,4
6,2
30–100
5,34 0,399 13
7,9
7,6
Profil 3 – kopalna gleba organiczna limnowa
60–75
24,3 1,57 15
7,6
7,2
75–80
34,7 2,15 16
7,5
7,0
80–90
36,5 2,39 15
7,4
6,9
90–102
5,17 0,358 14
8,6
7,4
102–125
5,30 0,372 14
7,8
7,4
Profil 4 – gleba organiczna limnowa
0–10
24,1 2,17 11
7,0
6,8
KLIN
24,7 2,13 12
6,7
6,5
10–40
18,4 1,41 13
7,8
7,6
40–120
16,3 1,11 15
7,4
7,3
120–170
4,48 0,294 15
7,6
7,1
CaCO3
[%]
n.o.
n.o.
49
n.o.
23
0,4
0,3
0,8
24
39
0,5
n.o.
27
0,7
6,1
Corg – węgiel organiczny, N – azot ogółem, CaCO3 – węglan wapnia M – poziomy
murszowe, Lc – gytie organiczne, C – gytie mineralne.
Charakterystyczną cechą badanych gleb jest zagęszczenie partii stropowych gytii leżących bezpośrednio pod murszem. Wyraźnie
zaakcentowane jest to w przypadku profilu 4. Cecha ta widoczna
w terenie nie ma potwierdzenia w wynikach oznaczenia gęstości objętościowej (Tab. 1). W pozostałych profilach nie wydzielono warstw
sprasowanych jako osobnych poziomów morfologicznych. Warstwy
te, często małej miąższości, zostały włączone do poziomów zalegających niżej, w związku z czym cecha ta uległa zatarciu.
Najwęższą wartość stosunku C:N – 11 i 12 wykazano w poziomach powierzchniowych gleby limnowej (profil 4) w północnej części
dawnego dna Jezior Sumowskich. Świadczy to o wspomnianych wyżej
325
Łukasz Mendyk, Maciej Markiewicz
warunkach sprzyjających procesom humifikacji i mineralizacji materii
organicznej oraz o dużej biologicznej aktywności tych gleb [Lal 1997].
W pozostałych poziomach murszowych wartości te wynosiły od 15 do
17. Wysokie wartości stosunku C:N w profilu 3 mimo odwodnienia tej
gleby spowodowane są pogrzebaniem jej pod glebą deluwialną.
Zróżnicowanie właściwości chemicznych i fizykochemicznych
w poziomach gytiowych podobnie jak w przypadku właściwości fizycznych wynika nie ze stopnia odwodnienia a z różnorodności osadów jeziornych [Markowski 1980, Okruszko, Piaścik 1990, Tobolski
1995, 2000, Myślińska 2005].
Zbadane gleby wykazują podobieństwo pod względem właściwości chemicznych i fizykochemicznych do gleb gytiowisk badanych
m.in. Łachacza i in. [2009], Sowińskiego i Lemkowską [2010], czy
Goneta i in. [2010]. Podobieństwa te dotyczą przede wszystkim wartości gęstości objętościowej i właściwej oraz zawartości węgla organicznego i azotu ogółem w poziomach powierzchniowych gleb słabiej
odwodnionych (profile 1 i 2).
Podsumowanie
Warunkiem powstania i rozwoju gleb znajdujących się na terenie
dawnego dna Jezior Sumowskich było częściowe osuszenie i zmeliorowanie fragmentów niecki jeziornej. Różny stopień odwodnienia
a także charakter skały macierzystej (zróżnicowanie dennych osadów
jeziornych) wpłynął na morfologię, właściwości fizyczne i fizykochemiczne badanych gleb. Największe różnice obserwowano w poziomach powierzchniowych i dotyczą przede wszystkim ilości materii
organicznej (w tym także wartości stosunku C:N) i odczynu.
Literatura
1. Burak S., Flanz S., Kurowska I., Pawski A. 2005. Ekosystemy wodne. [W:]
Plan Ochrony BPK do roku 2025, Toruń: 9–25.
2. Churski Z. 1988. Wpływ gospodarczej działalności człowieka na zmiany jezior i mokradeł na Pojezierzu Brodnickim. [W:] Z. Churski (red.). Naturalne i antropogeniczne przemiany jezior i mokradeł w Polsce. Wyd. UMK.
Toruń: 182–183.
326
Wpływ stopnia odwodnienia na właściwości gleb wytworzonych z osadów jeziornych
3. Gonet S., Markiewicz M., Marszelewski W., Dziamski A. 2010. Soil transformations in catchment of disappearing Sumówko Lake (Brodnickie Lake
District, Poland). Limnological Review 10, 3–4: 133–137.
4. Kalinowska K. 1961. Zanikanie jezior w Polsce. Przegląd Geograficzny
23(3): 511–518.
5. Lal R., 1997. Effects of N fertilizer treatments on biologically active N pools in
soils under plow and no tillage. Biol. Fertil. Soils. 24: 4: 406–412.
6. Łachacz A., Nitkiewicz M., Pisarek W. 2009. Soil conditions and vegetation
on gyttja lands in the Masurian Lakeland. [W:] Wetlands – their functions
and protection. A. Łachacz (Ed.), Department of Land Reclamation and
Environmental Management, University of Warmia and Mazury in
Olsztyn: 61–94.
7. Markowski S. 1980. Struktura i właściwości podtorfowych osadów jeziornych
rozprzestrzenionych na Pomorzu Zachodnim jako podstawa ich rozpoznawania i klasyfikacji. [W:] Kreda jeziorna i gytie, materiały pokonferencyjne.
Lubniewice 8-10 XI 1979 r. Urząd Wojewódzki w Gorzowie Wlkp.: 44–55.
8. Marszelewski W. 2005. Zmiany warunków abiotycznych w jeziorach Polski
Północno-Wschodniej. Wyd. UMK. Toruń: 7–12.
9. Myślińska E. 2001. Grunty organiczne i laboratoryjne metody ich badania.
Wyd. Nauk. PWN. Warszawa: 69–152.
10. Okruszko H., Piaścik H. 1990. Charakterystyka gleb hydrogenicznych.
Wyd. ART. Olsztyn.
11. Sowiński P. Lemkowska B. 2010. Makroskładniki w glebach obniżeń pojeziernych na Pojezierzu Olsztyńskim. Rocz. Glebozn., 61(2): 87–94.
12. Systematyka gleb Polski. 2011. Rocz. Glebozn. 63. 3.
13. Tobolski K. 1995. Osady denne. [W:] A. Choiński (red.). Zarys limnologii
fizycznej Polski. Wyd. Nauk. UAM. Poznań: 181–203.
14. Tobolski K. 2000. Przegląd ujęć klasyfikujących torfy i osady jeziorne. [W:]
Przewodnik do oznaczania torfów i osadów jeziornych. Wyd. Nauk.
PWN. Warszawa: 117–125.
Promotor: dr hab. Zbigniew Podgórski, prof. UMK
327
Adam Michalski
EPISTEME
18/2013, t. 3
s. 329-337
ISSN 1895-2241
PRoblem ochrony zasobów węgla
organicznego w Glebach ornych
Międzywala Dolnej Wisły
The PROBLem OF protection of Organic
carbon Stocks in plough soils of the Lower
Vistula floodplain
Abstrakt. Celem badań było określenie zróżnicowania przestrzennego zasobów węgla organicznego w ornych glebach aluwialnych (Fluvisols) oraz
zasygnalizowanie problemu zmniejszenia jego zasobów w warunkach uprawy płużnej. Badaniami objęto prawobrzeżny fragment międzywala dolnej
Wisły w gminie Zławieś Wielka (województwo kujawsko-pomorskie, Polska). W celu określenia zasięgu przestrzennego tych przemian przeanalizowano zmiany struktury użytkowania gleb w okresie 1932–2010. Analizy
przestrzenne wykonano w oprogramowaniu ArcGIS, wykorzystując mapy
topograficzne i zdjęcia satelitarne. Z trzech profili glebowych pobrano próbki do analiz laboratoryjnych. Oznaczono w nich podstawowe właściwości
chemiczne i fizykochemiczne. Obliczono zasoby węgla organicznego do
głębokości około 40 cm. Wahają się one od 17.7 t·ha-1 w Haplic Fluvisol do
102.4 t·ha-1 w Mollic Fluvisol. W ostatnim 30-leciu większość łąk, pastwisk
i zarośli przekształcono w grunty orne. Około 64% powierzchni równi zalewowej pokryte jest glebami narażonymi na stopniowe zmniejszanie zasobów węgla organicznego (OC).
Słowa kluczowe: gleby aluwialne, zasoby węgla organicznego, równia zalewowa, dolna Wisła
Summary. The aim of the study was to determine spatial differentiation of
organic carbon (OC) stocks in plough alluvial soils (Fluvisols) of the Lower
Vistula floodplain. The problem of OC stocks decline in conditions of plough
tillage was also considered. Investigations were conducted on the rightbank part of the Lower Vistula floodplain in Zławieś Wielka district area
(Kujawsko-Pomorskie Voivodeship, Poland). Land use structure changes
in the period 1932–2010 were analysed to determine spatial distribution
of these transformations. Spatial analyses were done on the basis of topo329
Adam Michalski
graphic maps and satellite images using ArcGIS. Three soil profiles were chosen and samples were taken for laboratory analyses. The basic chemical and
physicochemical properties of soils were determined. OC stocks to a depth
of about 40 cm were calculated. They range from 17.7 t·ha-1 in Haplic Fluvisol to 102.4 t·ha-1 in Mollic Fluvisol. Most of meadows, pastures and bushes
were transformed into cultivated lands during last 30 years. About 64% of
the floodplain is covered with soils vulnerable to decline of OC stocks.
Key words: alluvial soils, agriculture, floodplain, the Lower Vistula
330
Problem ochrony zasobów węgla organicznego w Glebach ornych...
Introduction
Fluvisols (alluvial soils) are one of the most fertile soils in Poland and
in the world. This is why these soils are commonly used in agriculture. Soil properties are the effect of specific soil-forming factors, like
periodical inundations, frequent water table fluctuations, processes
of erosion and sedimentation and human activity.
Originally alluvial soils were the habitat of riparian forests, willow bushes or grass formations [Matuszkiewicz 2001]. Soils of the
Lower Vistula floodplain were for the most part covered with these
plant formations until the late 70’s of the 20th century. For 30 years
area of these formations has decreased. In many places soils covered
with natural or seminatural plant formations were ploughed. Land
use changes and traditional tillage influence processes of accumulation and decomposition of organic matter.
The aim of the study was to determine the spatial differentiation
of OC stocks in plough Fluvisols of the Lower Vistula floodplain. The
problem of organic carbon stocks decline in conditions of plough tillage was also considered.
Material and methods
Investigations were carried out on the right-bank part of the Lower
Vistula floodplain on the stretch Toporzysko-Czarnowo, KujawskoPomorskie Voivodeship, Poland (Fig. 1). For the purpose of this work
the term floodplain is used as an area periodically flooded, located
between embankments.
The area (without water basins) of the floodplain is about 220
ha. It is for the most part used in agriculture.
The floodplain is a young, Holocene landform [Tomczak 1982].
Embankments divide this area into two parts: non-flooded and flooded. Present embankments were built and strengthened in the 18th
and 19th centuries [Makowski 1997]. The most part of the floodplain
was formed after 1855. It was the result of river regulation works
[Babiński 1985, Kordowski 1997]. Both positive (river bars, river islands) and negative landforms (channels) can be found in the area
[Kordowski 1997]. Relief influences water conditions and directions
of soil-forming processes.
331
Adam Michalski
Fig. 1. Study area. Location of soil profiles.
During field works numerous hand drillings and soil pits were
done. Three representative soil profiles were chosen. These represent
similar position in relief and different land use categories (Tab. 1).
Profile No.
Altitude
m a.s.l.
Tab. 1. Site description and soil classification according
to IUSS Working Group WRB 2007.
Morpholithogenic
zone
Land use
category
in 1932
Land use
category
in 2010
former river
willow bush cluster of trees
island
former river
2 32.5
willow bush cultivated land
island
former river
3 32.5
willow bush cultivated land
bar
1 32.5
Soil classification
Mollic Fluvisol (Siltic)
Mollic Fluvisol (Siltic)
Haplic Fluvisol (Epiarenic,
Bathyhypogleyic)
The analysed profiles represent former forest or grassland soils
(profile 1 and 2) or soils directly ploughed after deforestation (profile
3). Samples were collected from all the genetic horizons and layers to
a depth of about 60 cm.
The basic properties of the soils were determined: texture by
combined sieve and the Bouyoucos method in modification of Casagrande and Prószyński, bulk density (BD) by the core method,
332
Problem ochrony zasobów węgla organicznego w Glebach ornych...
organic carbon content (OC) by Tiurin method, total nitrogen (Nt)
by Kjeldahl method, carbonates content by Scheibler method. Soil
pH was measured potentiometrically in H2O and 1M KCl using glass
electrode. Analyses were performed according to Bednarek [2005].
Land use structure changes in the period 1932–2010 were analysed on the basis of archival and modern topographic maps and satellite images from Google Earth using ArcGIS 9.3.1.
Results and discussion
Changes of land use structure. Transformations of the seminatural
landscape are the effect of increasing demands for fertile soils. Good indicator of these processes is analysis of land use changes (Tab. 2). In the
1930’s of the 20th century about 90% of the floodplain was occupied
by riparian forests, bushes and grasslands. Only the soils of the upper
parts of former river islands were ploughed. In the next decades the area
of cultivated lands was gradually increasing. Deforestation operations
intensified in the 80’s and 90’s of the 20th century. In this way the area
of cultivated lands have increased to 64% in 2010 (Tab. 2).
Tab. 2. Land use structure of the Lower Vistula floodplain
in the period 1932–2010.
1932
1980s
Land use category
1999
2010
Area
(ha)
(%)
(ha)
(%)
Riparian forests,
158.9 89.3 86.4 39.0
willow bushes
(ha)
(%)
(ha)
(%)
45.5
20.7
53.0
24.1
Grasslands,
2.0 1.1 52.9 23.9 67.0 30.5 25.9 11.8
swamps
Cultivated lands 17.1 9.6 82.5 37.2 107.1 48.8 141.1 64.1
Total area
178.0 100.0 221.8 100.0 219.6 100.0 220.0 100.0
Soil properties. The morphology of soil profiles and results of laboratory analyses indicate that alluvial soils differ in the small area
(Tab. 3). This is the result of both lithological conditions and other
soil-forming factors (Tab. 1). All the soils were classified as Fluvisols
[IUSS Working Group WRB 2007].
333
334
21
36
8
17
8
81
78
15 - 33
33 - 38
38 - 43
44 - 56
0 - 20
20 - 40
40 - 60
0 - 29
29 - 35
35 - 60
A
C1
C2
C3
Ap
A
C1
Ap
C1
C2
94
18
27
21
0 - 15
A
Sand
(%)
Sampling
depth
(cm)
Genetic
horizon
5
18
16
65
64
58
53
72
53
60
66
Silt
(%)
OC stocks
(t·ha-1)
12.5
13.8
7.2
19.8
43.6
Σ = 102.4
-
4.3
39.2
58.9
-
1.30
1.17
7.9
16.1
20.0
Σ = 88.7
41.9
46.8
Profile 2 Mollic Fluvisol (Siltic)
-
-
1.20
1.10
0.90
Profile 1 Mollic Fluvisol (Siltic)
BD (g·cmOC (g·kg-1)
3
)
0.77
1.44
1.73
1.10
1.34
0.75
1.83
3.75
Nt
(g·kg-1)
1
4
3
-
1.40
1.32
0.7
1.9
4.2
Σ = 17.7
1.6
16.1
0.06
0.17
0.35
Profile 3 Haplic Fluvisol (Epiarenic, Bathyhypogleyic)
17
28
25
20
20
11
19
13
Clay
(%)
Tab. 3. Basic properties of soils/
13
12
12
10
11
12
11
10
10
11
12
C/N
8.6
8.4
7.9
8.2
7.9
7.9
8.1
8.0
8.0
7.8
7.3
pH
H2O
8.1
7.8
7.4
7.4
7.2
7.2
7.2
7.2
7.4
7.1
7.1
pH
KCl
5.6
7.6
3.9
24.3
29.1
24.9
15.0
14.0
15.0
30.0
30.0
CaCO3
(g·kg-1)
Adam Michalski
Problem ochrony zasobów węgla organicznego w Glebach ornych...
Analysed soils have silt – profile 1 and 2 – or sandy-silt texture –
profile 3 (Tab. 3). Clay content varies from few to almost 30%. The organic carbon content in plough horizons differs in analysed Fluvisols.
There is 16.1–43.6 g·kg-1 of OC in the horizons of the soils with relatively high clay content (profile 1 and 2). In coarse-textured Fluvisols
(profile 3) OC content do not exceed 5.0 g·kg-1. Low values of C/N ratio
(10–12) indicate good conditions for humification and mineralisation
of organic matter (Laskowski 1986). All the investigated soils have
neutral or alkaline reaction. Carbonates content ranges from about
2 g·kg-1 in sands to 30 g·kg-1 in horizons developed from silts.
Haplic Fluvisols are light, organic matter-poor soils (about 18
t·ha-1 OC). They cover areas of former willow bushes. These plant
formations were probably regularly cut during river channel regulation works. In this way input of organic matter in situ was reduced. In the 80’s of the 20th century these areas were changed into
cultivated lands. Organic carbon losses with crops were probably
balanced by using organic manures and input of allochthonous
organic matter (floods). Nowadays at least three factors indicate
the possibility of OC decline. These are the elimination of organic
manuring and relatively long-term (at least 6 years) cultivation of
maize in monoculture. Degradation coefficient of soil organic matter (SOM) is very high (-1.12 t·ha-1·yr-1) for this plant [Kodeks Dobrej Praktyki Rolniczej 2002]. Moreover these soils are highly vulnerable to deflation of organic matter because of low clay content
(< 5%) and weakly developed granular or single grain structure [Józefaciuk, Józefaciuk 1995; Podsiadłowski 1995].
Organic matter-rich, heavy Mollic Fluvisols (89–102 t·ha-1 OC)
were in the past or are still in small areas covered with willow bushes
and remains of riparian forests (profile 1). After deforestation they
became grassland and finally plough soils (profile 2). Nowadays these
plough Fluvisols are covered with vegetables or maize monocultures. It is known that land use change from forest or grassland into
cultivated land cause decrease of OC stocks by 30–60% even in the
first few years [Gonet 2007]. Results of investigations indicate that
OC content in A horizons of both soils (profile 1 and 2) is different
(Tab.3). The influence of two factors should be considered: the effect
of OC input with litterfall in forest soil and OM mineralisation ac335
Adam Michalski
celerated by ploughing. Moreover, as shows Kodeks Dobrej Praktyki
Rolniczej [2002] losses of SOM can achieve in such plough, heavy soil
1.22 t·ha-1·yr-1. It suggests the need of further, detailed research on
differentation and protection of OC stocks.
3. Conclusions
1. The results of the studies undertaken in the agricultural landscape
of the Lower Vistula floodplain in the stretch Toporzysko-Czarnowo
can be summarized in the following points:
2. Fluvisols varying in properties can be found within the floodplain. OC stocks within the upper 60 cm of soil profiles range from
17.7 to 102.4 t·ha-1. It suggests the need of individual adapting tillage practices in order to reduce OC stocks decline.
3. About 64% of the floodplain area (without water basins) can
be vulnerable to OC stocks decline as a result of elimination or reduction of in situ input of organic matter (litterfall, roots biomass).
4. These investigations were financially supported by the National Science Centre, project No. N N305 304940.
Bibliography
1. Babiński Z. 1985. Hydromorficzne konsekwencje regulacji dolnej Wisły.
Przegląd Geograficzny, 57(4): 471–486.
2. Bednarek R. 2005. Zestawienie oraz interpretacja wyników badań terenowych i laboratoryjnych [w:] Bednarek R., Dziadowiec H., Pokojska U.,
Prusinkiewicz Z. (red.) Badania ekologiczno-gleboznawcze. Wydawnictwo Naukowe PWN. Warszawa.
3. IUSS Working Group, WRB 2007. World Reference Base for Soil Resources
2006. Update 2007. World Soil Resources Reports, No 103. FAO. Rome.
4. Gonet S.S. 2007. Ochrona zasobów materii organicznej gleb [w:] Gonet S.S.,
Markiewicz M. (red.) Rola materii organicznej w środowisku. PTSH.
Wrocław.
5. Józefaciuk A., Józefaciuk C. 1995. Erozja agroekosystemów. PIOŚ. Warszawa. s. 131–140.
6. Kodeks Dobrej Praktyki Rolniczej. MRiRW, MŚ. Warszawa. s. 88.
7. Kordowski J. 1997. Morfologia i budowa geologiczna równiny zalewowej Wisły
na odcinku Solec Kujawski-Strzelce Dolne. Wydawnictwo Top Kurier. Toruń.
336
Problem ochrony zasobów węgla organicznego w Glebach ornych...
8. Laskowski S. 1986. Powstawanie i rozwój oraz właściwości gleb aluwialnych
Doliny Środkowej Odry. Wydawnictwo AR. Wrocław. s. 51–55.
9. Makowski J. 1998. Dolna Wisła i jej obwałowania, historyczne kształtowanie,
obecny stan i zachowanie w czasie znacznych wezbrań. Cz. 2. Odcinek od
Torunia do Białej Góry. IBW PAN. Gdańsk. s. 64–70, 81–84.
10. Mapy topograficzne w skali 1:10 000 w układach PUWG 1965 (arkusze: Solec Kujawski Zachód, Wschód, Strzyżawa, Zławieś Wielka)
i 1992 (arkusze: Czarnowo, Toporzysko).
11. Mapa topograficzna WIG w skali 1:25 000 (arkusz Fordon).
12. Matuszkiewicz J. M. 2001. Zespoły leśne Polski. Wydawnictwo Naukowe
PWN. Warszawa. s. 273–282.
13. Podsiadłowski S. 1995. Rola uprawy mechanicznej w stymulacji procesu
erozji eolicznej gleb lekkich. Roczniki AR w Poznaniu, 264. Poznań.
14. Tomczak A. 1982. The evolution of the Vistula River valley between Toruń
and Solec Kujawski during the Late Glacial and Holocene [w:] Starkel L.
(red.) Evolution of the Vistula River valley during the last 15 000 years.
Geographical Studies. Special Issue, 4(2): 207–231.
Adam Michalski
Uniwersytet Mikołaja Kopernika
Katedra Gleboznawstwa i Kształtowania Krajobrazu
e-mail: [email protected]
Promotor: prof. dr hab. Renata Bednarek
337
Łukasz Musielok
EPISTEME
18/2013, t. 3
s. 339-347
ISSN 1895-2241
CHEMICZNE I MIKROBIOLOGICZNE WŁAŚCIWOŚCI
PRÓCHNIC GLEB POD RÓŻNOWIEKOWYMI
DRZEWOSTANAMI BUKOWYMI I ŚWIERKOWYMI
W POŁUDNIOWEJ CZĘŚCI GÓR STOŁOWYCH (SUDETY)
Abstrakt. Ze względu na rolę materii organicznej jako wskaźnika przemian
środowiska badania próchnic są ważnym elementem współczesnej gospodarki leśnej. Szczególnie istotne jest prowadzenie badań w kontekście wieku
i zróżnicowania gatunkowego drzewostanów, co pozwala określić wpływ gospodarki na kształtowanie siedlisk leśnych. Badania mają na celu określenie
wpływu drzewostanów i ich wieku na chemiczne i mikrobiologiczne właściwości próchnic. Próbki glebowe pobierano pod różnowiekowymi buczynami
i świerczynami. Stwierdzono zależność między gatunkiem drzew a zawartością materii organicznej i pH gleby. Różnice w tempie respiracji i zawartości biomasy mikroorganizmów mogą wskazywać na związek z gatunkiem
drzewa. Wpływ wieku zaznacza się prawdopodobnie w zawartości materii
organicznej w poziomach ektopróchnicznych oraz w wykształceniu i miąższości próchnic. Pozostałe analizowane właściwości nie wykazują związku
z wiekiem drzewostanu. Aktywność mikroorganizmów glebowych prawdopodobnie wiąże się również z czynnikami lokalnymi.
Słowa kluczowe: próchnice leśne, gatunki drzew, wiek drzew, Sudety
Summary. Due to significant role of organic matter as an indicator of environment change the research on soil organic horizons are a crucial element
of recent forest management. Particularly significant is to conduct research
in the context of different tree species of different age, which allows to define the influence of management on forest habitats formation. The aim of
the research is to define the influence of tree species and its age on chemical
and microbiological properties of forest ecto– and endohumus horizons. Soil
samples were taken under beech and spruce of different age. A relationship
between tree species, organic matter content and soil pH was observed. Differences of respiration rate and microorganisms biomass content may indicate a relationship with tree species. The influence of age is probably emphasized by differences of organic matter content in ectohumus horizons under
spruce and in the development and thickness of soil organic horizons. The
other analysed properties don’t exhibit relation with the age of a tree. The
activity of soil microorganisms is probably dependant also on local factors.
Key words: forest soil organic horizons, tree species, tree age, Sudetes
339
Łukasz Musielok
Wstęp
Wieloaspektowe badania dotyczące próchnic leśnych ze względu na
rolę materii organicznej jako wskaźnika przemian środowiska przyrodniczego są ważnym elementem współcześnie prowadzonej gospodarki leśnej. Istotne jest zwłaszcza prowadzenie badań w kontekście
drzewostanów o różnym wieku [Emmer i Sevink 1994, Aubert i in.
2004] i współwystępujących rożnych gatunków [Augusto i in. 1998,
Berg 2000, Raich i Tufekcioglu 2000, Borken i Beese 2005, Boruvka
i in. 2005, Vesterdal i in. 2012], co pozwala na określenie wpływu jaki
gospodarka człowieka wywiera na kształtowanie siedlisk leśnych.
Przebudowa wieku i gatunku drzewostanu może istotnie wpływać na
zmianę właściwości próchnic leśnych i środowiska glebowego, a tym
samym całego siedliska. Góry Stołowe są przykładem obszaru, na
którym zbiorowiska leśne zostały znacząco przekształcone wskutek
działalności gospodarczej człowieka. Naturalne dla tego obszaru lasy
jodłowo-bukowe zostały w dużym stopniu zastąpione przez monokultury lasów świerkowych [Marek 1998].
Przeprowadzone badania miały na celu określenie wpływu różnych gatunków drzew i ich zróżnicowanego wieku na wybrane chemiczne i mikrobiologiczne właściwości próchnic leśnych.
Materiały i metody
Badania terenowe były prowadzone w południowej części Gór Stołowych (N50° 26’ 39”, E16° 27’ 43”), w obszarze występowania skał
piaskowcowych wieku kredowego oraz zlepieńców i piaskowców
permskich [Wojewoda i in. 2011]. Stanowiska badawcze zostały zlokalizowane na wysokości 500–580 m n. p. m. pod różnowiekowymi
drzewostanami bukowymi (uważanymi za naturalne) i monokulturami świerkowymi, na stokach o ekspozycji północnej i południowej.
Wykonano sześć odkrywek glebowych, z czego trzy zostały zlokalizowane pod bukami (dwie pod drzewostanem ok. 70-letnim, jedna
pod ok. 100-letnim), a trzy pod świerkami (dwie pod drzewostanem
ok. 90-letnim, jedna pod ok. 70-letnim). Z poziomów ektopróchnicznych (Ol, Of, Oh) i endopróchnicznych (A) pobrano ponadstandardowo duże próbki objętościowe do analiz laboratoryjnych. Próbki
340
Chemiczne i mikrobiologiczne właściwości próchnic gleb...
te zostały zanalizowane pod względem zawartości materii organicznej metodą straty żarowej w 400°C [Nelson i Sommers 1996] oraz
zawartości węgla organicznego metodą oksydometryczną Tiurina
[Oleksynowa i in. 1987]. Zmierzona została wartość pH w roztworze
wodnym w stosunku 1:1 dla poziomów endopróchnicznych i w paście
nasyconej dla poziomów ektopróchnicznych oraz w 0,01-molowym
roztworze CaCl2 w stosunku 1:2 [van Reeuwijk 2002]. Próbki z poziomów ektopróchnicznych analizowano pod względem aktywności
mikrobiologicznej metodą respiracji podstawowej [Dilly i Nannipieri 2001] i biomasy mikroorganizmów glebowych metodą respiracji
indukowanej substratem w pięciu powtórzeniach [Priha i in. 1999].
Na podstawie opisu morfologii próchnic w terenie i wyników analiz
laboratoryjnych ustalono ich typ i podtyp zgodnie z kryteriami Klasyfikacji gleb leśnych Polski [2000] (Tab. 1).
Wyniki i dyskusja
Analizowane profile glebowe, rozwinięte z piaskowców i zlepieńców,
należą do typu gleb bielicowych (profile GS1, GS2, GS4) i bielic (profil GS3) oraz gleb brunatnych dystroficznych typowych (profile GS5
i GS6), które według Kabały i in. (2011) są typami gleb powszechnie występującymi na tym podłożu skalnym w omawianej części Gór
Stołowych (Tab. 1). Próchnice występujące pod buczynami należą do
typów moder (drzewostan ok. 70-letni) i moder-mor (drzewostan
ok. 100-letni), natomiast próchnice rozwijające się pod świerczynami to moder-mull (drzewostan ok. 70-letni) oraz mor i moder-mor
(drzewostan ok. 90-letni) (Tab. 1). Rozwój poziomów organicznych
w badanym terenie jest związany z wiekiem drzewostanu [por. Klasyfikacja gleb leśnych Polski 2000].
Miąższość poziomów ektopróchnicznych wzrasta wraz z wiekiem drzewostanu i tak w buczynie różnica miąższości ektopróchnicy
pod drzewostanem ok. 70-letnim i ok. 100-letnim wynosi 1–2 cm,
a w świerczynach między stanowiskiem ok. 70-letnim i ok. 90-letnim
różnica ta wynosi 3–7 cm. Pozostaje to w zgodzie z wynikami przedstawionymi dla lasów sosnowych w chronosekwencji na wydmach
Hulshorsterzand w Holandii [Emmer i Sevink 1994]. Duże różnice
w przypadku stanowisk pod świerczyną mogą wynikać prawdopo341
Łukasz Musielok
GS2
GS3
GS4
GS5
GS6
0-1
1-4
4-7
0-1
1-3
3-8
0-1
1-7
7-9
9-18
0-3
3-5
5-10
0-1
1-3
3-5
5-9
0-2
Ol
Ofh
A
Ol
Ofh
A
Ol
Of
Oh
AE
Olf
Oh
A
Ol
Of
Oh
Ah
Ofh
2-7
A
Typ i podtyp
próchnicy wg
Klasyfikacji gleb
leśnych Polski
[2000]
Gatunek i
wiek drzewostanu
moder świeży
buczyna
ok. 70-letnia
moder świeży
buczyna
ok. 70-letnia
mor świeży
właściwy
świerczyna
ok. 90-letnia
świerczyna
moder-mor
świeży właści- ok. 90-letwy
nia
moder-mor
świeży właściwy
moder-mull
świeży
Typ i podtyp
gleby wg
Systematyki
gleb Polski
[2011]
Podłoże geologiczne
Symbol
poziomu
GS1
Głębokość
(cm)
Profil
Tab. 1. Morfologia i typologia analizowanych próchnic leśnych.
gleby
bielicowe
typowe
bielice
typowe
piaskowce
kredowe
gleby
bielicowe
typowe
buczyna
ok.
100-letnia
gleby
brunatne zlepieńce
dystroficzne permskie
świerczyna
typowe
ok. 70-letnia
dobnie z zaburzenia rozwoju poziomów ektopróchnicznych w profilu
GS6 wskutek prowadzonej gospodarki leśnej lub naturalnego wykrotowania. Wpływ wieku drzewostanu zaznacza się również we wzroście zawartości zakumulowanej materii organicznej w poziomach
organicznych, podobnie jak w badaniach Aubert’a i in. [2004] prowadzonych w lasach bukowych. Wyższą zawartość materii organicznej w tych poziomach uzyskano pod starszymi świerkami i bukami
w stosunku do młodszych drzewostanów (Tab. 2). Zależność ta jest
spełniona także dla poziomów endopróchnicznych rozwijających się
pod bukami, natomiast pod świerkami zawartość materii organicznej
w starszym drzewostanie jest niższa. Może to wynikać z większego
342
Chemiczne i mikrobiologiczne właściwości próchnic gleb...
zaawansowania procesów eluwialnych pod monokulturami świerkowymi jak w badaniach Maciaszka i in. [2000] w Beskidzie Żywieckim
lub z innych właściwości gleby, np. uziarnienia lub pojemności wymiany kationów, jak w przypadku badań Augusto i in. [1998]. Podobnie do wyników uzyskanych przez Emmer’a i Sevink’a [1994] nie
zaobserwowano wpływu wieku drzewostanu na pH gleby.
Tab. 2. Właściwości chemiczne analizowanych próchnic.
Profil
Głębokość
(cm)
0–1
1–4
4–7
0–1
GS2
1–3
3–8
0–1
1–7
GS3
7–9
9–18
0–3
GS4
3–5
5–10
0–1
1–3
GS5
3–5
5–9
0–2
GS6
2–7
n.a. – nie analizowano
GS1
Strata żarowa
(%)
Węgiel organiczny (%)
pH H2O
pH CaCl2
26,95
17,80
8,92
80,85
20,37
5,51
68,04
74,50
30,73
2,56
55,88
18,14
5,16
82,25
57,54
44,97
14,68
28,90
6,83
n.a.
n.a.
4,61
n.a.
n.a.
2,75
n.a.
n.a.
n.a.
1,10
n.a.
n.a.
1,76
n.a.
n.a.
n.a.
5,64
n.a.
2,43
4,3
4,0
3,9
4,7
3,2
3,6
4,2
3,1
2,9
3,7
3,7
3,0
3,5
4,7
4,7
3,3
4,0
4,2
4,0
3,8
3,4
3,2
4,4
3,1
3,0
3,9
2,9
2,8
3,1
3,4
2,8
3,0
4,5
3,9
3,1
3,3
3,8
3,4
Występujące różnice miąższości poziomów ektopróchnicznych
można wiązać z rodzajem opadu z drzew. Ściółki świerkowe, zawierające duże ilości składników trudno ulegających dekompozycji, tworzą
bardziej miąższe niż pod bukami poziomy nadkładowe [Berg 2000].
Analizowane ektopróchnice świerkowe mają 2–9 cm miąższości, podczas gdy pod bukami osiągają one 3–5 cm. Na zależność z występują343
Łukasz Musielok
cym gatunkiem drzew wskazują również wartości pH gleby mierzone
w roztworze wodnym (Tab. 2) mieszczące się w przedziale 3,2–4,7
dla stanowisk pod bukami i 2,9–4,2 dla świerków. pH poziomów organicznych rozwijających się pod świerkami jest niższe niż pod bukami, co może wynikać m. in. z większej ilości kwasów humusowych
i zwiększonej mobilności glinu w ściółkach szpilkowych [por. Augusto
i in. 1998, Boruvka i in. 2005]. Kolejnymi właściwościami, na które
ma wpływ gatunek drzewa są: tempo respiracji i zawartość biomasy
mikroorganizmów glebowych w materii organicznej zgromadzonej
w poziomach ektopróchnicznych (Tab. 3). Na stoku o ekspozycji północnej wyraźnie większe tempo respiracji i większą zawartość biomasy w przeliczeniu na objętość poziomów ektopróchnicznych stwierdzono pod bukami w porównaniu ze stanowiskiem pod świerkami.
Potwierdza to obserwacje Raich’a i Tufekcioglu [2000] oraz Borken’a
i Beese’a [2005], którzy większe tempo respiracji i zawartość biomasy mikroorganizmów wiążą z występowaniem ściółki bukowej, która
jest bogata w składniki odżywcze i łatwo ulega dekompozycji.
Profil
Tab. 3. Właściwości mikrobiologiczne analizowanych ektopróchnic.
GS1
GS2
GS3
GS4
GS5
GS6
Miąższość
Średnie tempo
Średnia biomasa mikropoziomów ekrespiracji ± odchyl.
organizmów glebowych
topróchnicz- standard. (mmol CO2 ·
± odchyl. standard.
nych (cm)
m-3 · 24 h-1)
(mg · cm-3 mat. org.)
0–4
0–3
0–9
0–5
0–5
0–2
0,261 ± 0,043
0,163 ± 0,026
0,029 ± 0,001
0,082 ± 0,000
0,165 ± 0,011
0,660 ± 0,019
30,494 ± 3,069
17,904 ± 2,048
2,451 ± 0,127
7,203 ± 0,513
18,730 ± 1,109
72,247 ± 5,236
Ekspozycja
stoku
N
N
N
N
SSE
SSE
Stwierdzono, że próchnice gleb pod świerkami rozwijające się
na stokach o ekspozycji południowej charakteryzują się większym
tempem respiracji i zawartością biomasy od tych na stokach o ekspozycji północnej. Różnice te można wiązać z odmiennymi warunkami termicznymi na stokach dosłonecznych, które mogą sprzyjać
zwiększonej aktywności mikrobiologicznej, na co zwracają uwagę
Vogel i in. [2005] oraz Martin i Bolstad [2009] w badaniach dotyczących pośredniego wpływu ekspozycji stoku i rzeźby terenu na tempo
344
Chemiczne i mikrobiologiczne właściwości próchnic gleb...
respiracji i zawartość biomasy. W przypadku analizowanego profilu
GS6 zwiększone tempo respiracji i duża zawartość biomasy wynika
prawdopodobnie w największym stopniu z oddziaływania zespołu
czynników związanych z małą objętością poziomu ektopróchnicznego, jego aeracją i stopniem uwilgotnienia. Potwierdza to obserwacje
Vesterdal’a i in. [2012], którzy zjawisko zwiększonej respiracji gleby
pod świerczyną w porównaniu z drzewostanami liściastymi wiążą
z jakością ściółki, gęstością korzeni oraz wpływem temperatury i wilgotności gleby.
Wnioski
Analiza uzyskanych wyników pokazuje, że wiek drzewostanu odzwierciedla się m. in. w miąższości poziomów ekto- i endopróchnicznych i wpływa na wzrost zawartości materii organicznej w poziomach ektopróchnicznych. Stwierdzono, że ściółka świerkowa obniża
pH poziomów organicznych silniej niż ściółka bukowa i być może
w sposób pośredni wpływać na intensyfikację procesów eluwiacji materii organicznej z poziomów endopróchnicznych. Badania pokazały,
że aktywność i biomasa mikroorganizmów glebowych w poziomach
ektopróchnicznych może być związana z występującym gatunkiem
drzewa, jak również z oddziaływaniem czynników lokalnych, takich
jak ekspozycja stoku i związanymi z nią warunkami mikroklimatycznymi oraz z innymi właściwościami górnych poziomów gleby.
Zastosowanie różnych metod badawczych pokazało, że – zgodnie z wymową wielu cytowanych prac – zagadnienie wpływu wieku
i gatunku drzewostanu na właściwości chemiczne i mikrobiologiczne
próchnic leśnych jest bardzo złożone. Zaprezentowane zależności warto sprawdzić w innych sytuacjach lub przy zastosowaniu innej metodyki badawczej umożliwiającej zastosowanie metod statystycznych.
Podziękowania
Dziękuję Markowi Drewnikowi za pomoc w badaniach terenowych
i za wskazówki dotyczące analizy wyników oraz Beacie Klimek za pomoc w badaniach laboratoryjnych, a także anonimowemu recenzentowi za cenne uwagi.
345
Łukasz Musielok
Bibliografia
1. Aubert M. Bureau F. Alard D. Bardat J. 2004. Effect of tree mixture on humic epipedon and vegetation diversity in managed beech forests (Normandy, France). Canadian Journal of Forest Research, 34:
233–248.
2. Augusto L. Bonnaud P. Ranger J. 1998. Impact of tree species on forest soil
acidification. Forest Ecology and Management, 105: 67–78.
3. Berg B. 2000. Litter decomposition and organic matter turnover in northern
forest soils. Forest Ecology and Management, 133: 13–22.
4. Borken W. Beese F. 2005. Soil respiration in pure and mixed stands of European beech and Norway spruce following removal of organic horizons. Canadian Journal of Forest Research, 35: 2756–2764.
5. Boruvka L. Mladkova L. Drabek O. 2005. Factors controlling spatial distribution of soil acidification and Al. forms in forest soils. Journal of Inorganic Biochemistry, 99: 1796–1806.
6. Dilly O. Nannipieri P. 2001. Response of ATP content, respiration rate and
enzyme activities in an arable and a forest soil to nutrient additions. Biology and Fertility of Soils, 34: 64−72.
7. Emmer I. M. Sevink J. 1994. Temporal and vertical changes in the humus
form profile during a primary succession of Pinus sylvestris. Plant and Soil,
167: 281–295.
8. Kabała C. Chodak T. Bogacz A. Łabaz B. Jezierski P. Gałka B. Kaszubkiewicz J. Glina B. 2011. Przestrzenne zróżnicowanie gleb
i siedlisk Parku Narodowego Gór Stołowych. [w:] Chodak T. i in. (red.).
Geoekologiczne warunki środowiska przyrodniczego Parku Narodowego Gór Stołowych. WIND. Wrocław. pp. 141–168.
9. Klasyfikacja gleb leśnych Polski. 2000. Praca zbiorowa pod red.: A. Kowalkowski, D. Czępińska-Kamińska, A. Krzyżanowski, M. Sokołowicz,
J. Chojnicki. Centrum Informacyjne Lasów Państwowych. Warszawa.
10. K. Oleksynowa J. Tokaj J. Jakubiec T. Komornicki (red.). 1987. Przewodnik do ćwiczeń z gleboznawstwa i geologii. Część II – metody laboratoryjne analizy gleby. AR. Kraków.
11. Maciaszek W. Gruba P. Januszek K. Lasota J. Wanic T. Zwydak M. 2000.
Degradacja i re-degradacja gleb pod wpływem gospodarki leśnej na terenie Żywiecczyzny. Wydawnictwo Akademii Rolniczej w Krakowie.
12. Marek S. 1998. Rozwój Wielkiego Torfowiska Batorowskiego w świetle badań biostratygraficznych. Szczeliniec, nr 2.
13. Martin J. G. Bolstad P. V. 2009. Variation of soil respiration at three
spatial scales: Components within measurements, intra-site variation
346
Chemiczne i mikrobiologiczne właściwości próchnic gleb...
and patterns on the landscape. Soil Biology and Biochemistry, 41:
530–543.
14. Nelson D.W. Sommers L.E. 1996. Total Carbon, Organic Carbon, and Organic Matter. [w:] D.L. Sparks et al. (Eds.). Methods of Soil Analysis.
Part 3. Chemical Methods-SSSA Book Series no. 5. SSSA and ASA.
Madison. WI. USA. 961–1010.
15. Priha O. Hallantie T. Smolander A. 1999. Comparing microbial biomass,
denitrification enzyme activity, and numbers of nitrifiers in the rhizospheres of Pinus sylvestris, Picea abies and Betula pendula seedlings by microscale methods. Biology and Fertility of Soils, 30: 14–19.
16. Raich J. W. Tufekcioglu A. 2000. Vegetation and soil respiration: correlations and controls. Biogeochemistry 48: 71–90.
17. Systematyka gleb Polski. 2011. Marcinek J. Komisarek J. Bednarek R. Mocek A. Skiba S. Wiatrowska K. Roczniki Gleboznawcze, 62 (3): 1–178.
18. Van Reeuwijk L.P. (red.) 2002. Procedures for Soil Analysis. International
Soil Reference and Information Centre Technical Paper 9. Wageningen.
19. Vesterdal L. Elberling B. Christiansen J. R. Callesen I. Schmidt I. K. 2012.
Soil respiration and rates of soil carbon turnover differ among six common
European tree species. Forest Ecology and Management, 264: 185–196.
20. Vogel J. G. Valentine D. W. Ruess R. W. 2005. Soil and root respiration in
mature Alaskan black spruce forests that vary in soil organic matter decomposition rates. Canadian Journal of Forest Research, 35: 161–174.
21. Wojewoda J. Białek D. Bucha M. Głuszyński A. Gotowała R. Krawczewski J. Schutty B. 2011. Geologia Parku Narodowego Gór Stołowych – wybrane zagadnienia. [w:] Chodak T. i in. (red.). Geoekologiczne warunki
środowiska przyrodniczego Parku Narodowego Gór Stołowych. WIND.
Wrocław. pp. 53–96.
mgr Łukasz Musielok
Zakład Gleboznawstwa i Geografii Gleb
Instytut Geografii i Gospodarki Przestrzennej
Uniwersytet Jagielloński w Krakowie
e-mail: [email protected]
Opiekun naukowy: dr hab. Marek Drewnik
347
Beata Ochał1, Katarzyna Macnar2
Marek Grabowski, Jan Błaszczyk
EPISTEME
18/2013, t. 3
s. 349–355
ISSN 1895-2241
PORÓWNANIE JAKOŚCI WIN
WYPRODUKOWANYCH Z CZTERECH ODMIAN
WINOROŚLI UPRAWIANYCH W WARUNKACH
POLSKI POŁUDNIOWEJ
COMPARISON OF THE QUALITY OF WINES MADE
FROM FOUR GRAPE VARIETIES GROWN IN
SOUTHERN POLAND
Abstrakt. Celem prowadzonych badań było porównanie zawartości antocyjanów, ekstraktu oraz kwasowości ogólnej w jednorocznych i dwuletnich
winach uzyskanych z czterech odmian winorośli. Wina otrzymane z odmiany ‘Marechal Foch’ wykazywały dużą rozbieżność w zawartości antocyjanów
w zależności od roku produkcji (od 36,16 do 82,21 mg×100g-1). Natomiast
dla win uzyskanych z odmiany Regent zawartość antocyjanów nie różniła
się istotnie statystycznie. Kwasowość ogólna w przeliczeniu na kwas winowy w badanych winach różniła się istotnie statystycznie w zależności od
odmiany, z której uzyskano surowiec, jak również w zależności od roku produkcji i wynosiła od 4,50 (‘Regent’) do 11,15 g×l-1 (‘Jutrzenka’). Najwyższą
zawartość ekstraktu uzyskano dla dwuletniego wina otrzymanego z odmiany Marechal Foch.
Słowa kluczowe: wino, antocyjany, kwasowość ogólna, ekstrakt
Summary. The aim of this study was to compare the anthocyanin content,
soluble solid content and titratable acidity in one year and two year old wines
made from four grape varieties. The wines made from the variety ‘Marechal
Foch’ showed large discrepancies between anthocyanin contents depending
on the year of vintage (from 36,16 to 82,21 mg×100g-1). However, no statistically significant differences were found for anthocyanin concentration for
wines made from the cultivar Regent. The titratable acidity of the tested wines
expressed through tartaric acid ranging from 4,50 (‘Regent’) to 11,15 g×l-1
(‘Jutrzenka’) was differentiated at a statistical significance level depending on
the grape variety and the year of vintage. The highest value of soluble solid
content was obtained for the wine made for the variety Marechal Foch.
Key words: wine, anthocyanins, titratable acidity, soluble solid content
349
Beata Ochał, Katarzyna Macnar, Marek Grabowski, Jan Błaszczyk
WSTĘP
W ostatnich latach widoczny jest wyraźny wzrost zainteresowania
produkcją win. Nie bez znaczenia są tutaj ich właściwości prozdrowotne. W latach siedemdziesiątych XX w. rozpoczęto intensywne
badania w tym zakresie, po tym jak skojarzono niski wskaźnik umieralności na choroby układu krążenia we Francji, pomimo dużego
spożycia tłuszczów zwierzęcych, z dużym spożyciem wina w tym
kraju [Renauld i De Lorgeril 1992, Bohm i in. 2002]. Winogrona,
a także czerwone wina są bogatym źródłem związków wykazujących
m.in. działanie antyoksydacyjne i przeciwmiażdżycowe, takich jak
resweratrol, czy antocyjany [Olas 2006, Kopeć i in. 2011, Piątkowska i in. 2011]. Tradycje uprawy winorośli i wyrobu wina z winogron sięgają w Polsce XII wieku. Ze względu na dogodne warunki
klimatyczne większość winnic w tamtym okresie była lokalizowana
w rejonach Polski południowej, południowo-zachodniej i zachodniej
[Burkot i Kulisz 2008]. W 2005 roku decyzją Rady UE Polska została
zaliczona do strefy A uprawy winorośli, uznana więc została za kraj
o potencjale winiarskim. Ze względu na duże zainteresowanie rolników uprawą winorośli przewiduje się, że szacowana na ponad 300
ha powierzchnia winnic w Polsce może się w bardzo szybkim tempie
podwoić [Tarko 2010]. Istotnym czynnikiem dla uzyskania win dobrej jakości jest dobór odpowiednich odmian winorośli. Ze względu
na warunki klimatyczne panujące w Polsce lepsze efekty daje uprawa międzygatunkowych mieszańców, takich jak np.: ‘Marechal Foch’,
‘Regent’, ‘Sibera’, niż winorośl szlachetna. W winnicach spotykane
są także odmiany lokale, takie jak ‘Jutrzenka’ [Lisek 2007]. Celem
prowadzonych badań było porównanie wybranych cech jakościowych
jednorocznych i dwuletnich win uzyskanych z czterech odmian winorośli uprawianych w rejonie Polski południowej.
MATERIAŁ I METODY
Materiał do badań stanowiły wina z 2011 i 2012 roku uzyskane
z czterech odmian winorośli. Do produkcji win wykorzystano odmiany o białych gronach – ‘Jutrzenka’, ‘Sibera’, oraz odmiany czerwono-gronowe – ‘Marechal Foch’ oraz ‘Regent’, uprawiane od 2006 roku
350
Porównanie jakości win wyprodukowanych z czterech odmian winorośli...
w Stacji Doświadczalnej Uniwersytetu Rolniczego w Garlicy Murowanej. Warunki atmosferyczne z lat 2011 i 2012, pozyskane z lokalnej stacji meteorologicznej przedstawiono na wykresie, zestawienie średnich sum opadów i temperatury wykonano po przeliczeniu
w stosunku 1°C: 4,5 mm opadów (ryc. 1). Winogrona zbierano ręcznie
w czasie suchej pogody i odszypułkowywano. Moszcz poddano procesowi siarkowania podając 7 g pirosiarczanu potasu na 100 kg owoców. Siarkowanie powtórzono po pierwszym obciągu dodając 10 g
pirosiarczanu potasu na 100 l. Każde 100 l nastawu zaszczepiono 20 g
szlachetnych kultur Saccharomyces cerevisiae. Dla odmiany Jutrzenka wykorzystano drożdże typu CK S102 wyselekcjonowane w Val de
Loire z winogron Sauvignon Blanc. Pozostałe odmiany zaszczepiono
szlachetnymi drożdżami firmy Enartis. Typ Red Friut wykorzystano
dla odmian czerwono-gronowych, natomiast typ Aroma White dla
odmiany Sibera. Wino dojrzewało w szklanych zbiornikach w stabilnej i stosunkowo niskiej temperaturze (12°C).
Ryc. 1. Przebieg temperatury i opadów w 2011 i 2012 roku.
W jednorocznych i dwuletnich winach uzyskanych z poszczególnych odmian winorośli zbadano zawartość antocyjanów, ekstraktu
oraz kwasowość ogólną. Zawartość antocyjanów oznaczono metodą
zróżnicowanego pH w przeliczeniu na cyjanidyno-3-glukozyd [Giusti
i Wrolstad 2005]. Pomiar absorbancji wykonano w roztworach buforowych o dwóch wartościach pH (1,0; 4,5) przy długości fali 520
i 700 nm za pomocą spektrofotometru PHARO 100 firmy MERC.
351
Beata Ochał, Katarzyna Macnar, Marek Grabowski, Jan Błaszczyk
Kwasowość ogólną win oznaczono metodą miareczkowania potencjometrycznego w przeliczeniu na kwas winowy z wykorzystaniem
pHmetru Jenway 3020. Zawartość ekstraktu w winach zmierzono
za pomocą refraktometru elektronicznego ATAGO PR-100 o zakresie pomiarowym 0,0–32,0%. Uzyskane wyniki poddano obliczeniom
statystycznym w programie STATISTICA 10 metodą analizy wariancji
z zastosowaniem testu NIR Fishera przy poziomie istotności
α = 0,05. Określono też barwę poszczególnych win według wzornika
kolorów Royal Horticultural Society Fifth Edition.
WYNIKI I DYSKUSJA
Wina otrzymane z odmiany ‘Marechal Foch’ wykazywały dużą rozbieżność w zawartości antocyjanów (od 36,16 do 82,21 mg×100g-1)
w zależności od roku produkcji, a ich barwa odpowiadała różnym
grupom barwnym. Natomiast dla jednorocznych i dwuletnich win
uzyskanych z odmiany Regent zawartość antocyjanów nie różniła się
istotnie statystycznie i wyniosła od 79,60 do 82,45 mg×100g-1. Wina
te zostały sklasyfikowane w obrębie tej samej grupy barwnej (tab. 1).
Wina otrzymywane z czerwonych winogron są głównym źródłem pozyskiwania antocyjanów w skali światowej [Piątkowska i in. 2011].
Tab. 1. Zawartość antocyjanów oraz klasyfikacja barwna
w jednorocznych i dwuletnich winach uzyskanych z poszczególnych
odmian winorośli.
Wino
Zawartość antocyjanów [mg×100g-1]
'Jutrzenka' 2011
'Jutrzenka' 2012
'Sibera' 2011
'Sibera' 2012
'Regent' 2011
‘Regent’ 2012
‘Marechal Foch’ 2011
‘Marechal Foch’ 2012
0,06 a*
0,15 a
0,36 a
0,10 a
82,45 c
79,60 c
82,21 c
36,16 b
Barwa wina
155 B White Group
NN 155 A White Group
158 Yellow-White Group
155 B White Group
187 A Greyed-Purple Group
187 C Greyed-Purple Group
183 A Greyed-Purple Group
172 A Greyed-Orange Group
*średnie oznaczone tą samą literą nie różnią się istotnie przy
α = 0,05 testu NIR Fishera
352
Porównanie jakości win wyprodukowanych z czterech odmian winorośli...
Według Borkowskiej [2003] wina czerwone zawierają średnio od
30 do 750 mg×100g-1 antocyjanów. Występują one głównie w winogronach czerwonych, od ich zawartości zależy barwa wina [Czech
i in. 2009], co jest zgodne z otrzymanymi wynikami. Szczególnie widoczne jest to na przykładzie wina uzyskanego z odmiany ‘Marechal
Foch’. Wino dwuletnie o wyższej zawartości antocyjanów charakteryzowało się intensywniejszą barwą, przez co zostało zakwalifikowane
do Greyed-Purple Group, gdy tymczasem wino jednoroczne sklasyfikowano do Greyed-Orange Group. W winach białych uzyskano śladowe ilości antocyjanów, których zawartość nie wykazywała istotnych
różnic statystycznych.
Kwasowość całkowita w badanych winach różniła się istotnie statystycznie w zależności od odmiany, z której uzyskano surowiec, jak
również w zależności od roku produkcji i wynosiła od 4,50 do 11,15 g×l-1
(tab. 2). Wina jednoroczne charakteryzowały się wyższą kwasowością
ogólną w stosunku do win dwuletnich. Wyższe statystycznie wartości badanego parametru uzyskano dla win otrzymanych z odmian
o białych gronach. Wyjątek stanowiło dwuletnie wino z odmiany Marechal Foch, jego kwasowość nie różniła się istotnie statystycznie od
kwasowości dwuletniego wina wyprodukowanego z odmiany Sibera.
Najwyższą wartość badanego parametru uzyskano zarówno dla win
jednorocznych, jak i dwuletnich otrzymanych z odmiany Jutrzenka.
Zdaniem Bosaka [2006] wino uzyskane z winogron odmiany Jutrzenka odznacza się dobrą jakością, posiada charakterystyczny aromat
i zrównoważoną kwasowość. Jest to w tym momencie jedyna polska
odmiana rokująca nadzieje na szersze wykorzystanie w profesjonalnej produkcji winiarskiej. Pomimo, że polskie wina charakteryzują
się stosunkowo wysoką kwasowością, związaną z warunkami klimatycznymi (niskie temperatury, małe nasłonecznienie), spełniają one
międzynarodowe standardy wymagań dla tego rodzaju produktów
[Tarko i in. 2010].
Zawartość ekstraktu w analizowanym materiale wynosiła od 7,17
do 9,10% (tab. 2). Najwyższą wartość badanego parametru uzyskano
dla dwuletniego wina otrzymanego z odmiany Marechal Foch. Według
Liska [2007] wino wytworzone z w pełni dojrzałych owoców tej odmiany charakteryzuje się zrównoważoną zawartością cukrów i kwasów.
Wina dwuletnie charakteryzowały się wyższą zawartością ekstraktu
niż wina jednoroczne. W roku 2012 w okresie dojrzewania i zbioru
353
Beata Ochał, Katarzyna Macnar, Marek Grabowski, Jan Błaszczyk
winorośli odnotowano wyższe opady niż w roku poprzednim (ryc.1).
Nadmiar wody w fazie dojrzewania owoców powoduje nadmierny
wzrost jagód, zmniejszenie stężenia cukrów i substancji aromatycznych, a także spowalnia redukcję stężenia kwasów [Bosak 2008].
Tab. 2. Kwasowość całkowita i zawartość ekstraktu w jednorocznych
i dwuletnich winach uzyskanych z poszczególnych odmian winorośli.
Wino
'Jutrzenka' 2011
'Jutrzenka' 2012
'Sibera' 2011
'Sibera' 2012
'Regent' 2011
‘Regent’ 2012
‘Marechal Foch’ 2011
‘Marechal Foch’ 2012
Kwasowość ogólna
[g×l-1]
Zawartość ekstraktu
[%]
8,39 f*
11,15 g
6,51 b
7,66 e
4,50 a
6,80 c
6,53 b
6,98 d
8,03 c*
7,37 b
8,80 d
7,17 a
8,73 d
7,20 a
9,10 e
7,30 b
* średnie oznaczone tą samą literą nie różnią się istotnie przy
α = 0,05 testu NIR Fishera
WNIOSKI
1. Wśród win uzyskanych z odmian winorośli o czerwonych owocach
wyższą zawartością antocyjanów odznaczały się wina otrzymane z odmiany Regent.
2. Wina wyprodukowane z odmiany Jutrzenka charakteryzowały się najwyższą kwasowością ogólną.
3. Kwasowość ogólna oraz zawartość ekstraktu w badanych winach różniły się w zależności od roku produkcji, co prawdopodobnie
miało związek z warunkami atmosferycznymi panującymi w okresie
dojrzewania owoców.
BIBLIOGRAFIA
1. Bohm M., Rosenkrantz S., Laufs U. 2002. The „French Paradox“. Dtsch.
Med. Wochenschr. 127: 2748–2756.
2. Borkowska J. 2003. Owoce i warzywa jako źródło naturalnych przeciwutleniaczy. Przem. Ferm. i Owoc.-Warz. 5: 11–12.
354
Porównanie jakości win wyprodukowanych z czterech odmian winorośli...
3. Bosak W. 2006. Winorośl i wino w małym gospodarstwie w Małopolsce. Małopolska Agencja Rozwoju Regionalnego S.A.. Kraków.
4. Bosak W., 2008. Produkcja win gronowych w małym gospodarstwie. Poprawa
jakości win białych. Polski Instytut Winorośli i Wina, Kraków.
5. Burkot P., Kulisz B. 2008. Rynek wina w Polsce. Biuletyn Informacyjny
ARR, 12: 19–26.
6. Czech A., Malik A., Pitucha I., Woźnica A. 2009. Porównanie zawartości związków bioaktywnych w winach czerwonych pochodzących
z różnych krajów europejskich. Żywność. Nauka. Technologia. Jakość
4 (65): 142–148.
7. Giusti M.M., Wrolstad R.E. 2005. Characterization and measurement of
anthocyanins by UV-visiblespectroscopy. In: Handbook of food analytical chemistry – pigment, colorants, flavors, texture, andbioactive food
components, ed. Wrolstad R.E. John Wiley & Sons Inc, New York.
8. Kopeć A., Piątkowska E., Leszczyńska T., Bieżanowska-Kopeć 2011.
Prozdrowotne właściwości resweratrolu. Żywność. Nauka. Technologia.
Jakość 5 (78): 5–15.
9. Lisek J. 2007. Winorośl w uprawie przydomowej i towarowej. Hortpress.
Warszawa.
10. Olas B. 2006. Resweratrol jako dobroczyńca w profilaktyce chorób układu
krążenia. Kosmos. Problemy Nauk Biologicznych 55 (271–272): 1–9.
11. Piątkowska E., Kopeć A., Leszczyńska T. 2011. Antocyjany – charakterystyka, występowanie i oddziaływanie na organizm człowieka. Żywność.
Nauka. Technologia. Jakość 4 (77): 24–35.
12. Renauld S., De Lorgeril M. 1992. Wine, alcohol, platelets, and the French
paradox for coronary heart disease. Lancet 339: 1523–1526.
13. Tarko T., Duda-Chodak A., Dojniczek I. 2010. Produkcja win gronowych
w Polsce – uwarunkowania przyrodnicze, ekonomiczne i prawne. Przem.
Ferm. i Owoc.-Warz. 11 (12): 24–25.
14. Tarko T., Duda-Chodak A., Sroka P., Satora P., Jurasz A. 2010. Polish
wines: Characteristics of cool-climate wines. Journal of Food Composition and Analysis 23: 463–468.
Opiekun naukowy: dr hab. Jan Błaszczyk1, prof. dr hab. Marek Grabowski2
355
Éva Pájtli
Ágnes Zámbó
László Palkovics
EPISTEME
18/2013, t. 3
s. 357–366
ISSN 1895-2241
Studia nad wirusem S (PVS) ziemniaka
węgierskiego
RECOMBINATION STUDIES ON A HUNGARIAN POTATO
VIRUS S (PVS) ISOLATE
Abstrakt. Na Węgrzech przeprowadzono stosunkowo mało badań nad wirusem ziemniaka S. Celem niniejszej pracy była analiza rekombinacji węgierskiego izolatu wirusa. Analizę rekombinacji przeprowadzono z pełnych genomów dostępnych w bazie danych NCBI, wszystkie analizy wykazały, że
PVS HU jest rekombinowana, a wyniki były zgodne z tymi przedstawionymi
przez de Sousa Geraldino Duarte (2012).
Słowa kluczowe: wirus ziemniaków S (PVS), rekombinacja, szczep PVSO,
kompletny genom, białka otoczki
Summary. In Hungary relatively little research has been done on Potato
virus S. The aim of the present work was the recombination analysis of
a Hungarian virus isolate. When recombination analysis was performed
with the complete genomes available in the NCBI database, all the analyses indicated that PVS HU is not recombinant and the results were in agreement with those reported by de Sousa Geraldino Duarte and co-workers
(2012). If Brasilian isolate was omitted from the analysis, the Hungarian
isolate participated in the recombination of German and Czech isolates in
the ORF1 region. In the German isolate the breakpoint was located between nucleotide positions 1204–1313 (major parent: FJ813512 USA isolate,
minor parent PVS HU). In the Czech isolate recombination the breakpoint
was between nucleotide bases 1114–1313 (major parent: FJ813512 USA
isolate, minor parent: PVS HU). A further two breakpoints could be detected in this analysis at the beginning of the sequence (1–63) and the other
from position 6146 to the end of the sequence. In this case the sequence
was classified as being of unknown origin. When the recombination analysis was repeated with the addition of Y15625 Czech and D00461 Peruvian
sequence sections, the same result was obtained as reported by de Sousa
Geraldino Duarte and co-workers (2012).
Key words: Potato virus S (PVS), recombination, Hungarian isolate, PVSO
strain, complete genome, coat protein
357
Éva Pájtli, Ágnes Zámbó, László Palkovics
Introduction
Potato virus S (PVS) was first identified in the Netherlands in 1951
[Bruyn Ouboter 1952], but its presence has since been reported from
all parts of the world [de Bokx 1970]. It causes weak or latent symptoms on potato and its significance lies in the over 20% reduction in
the tuber yield. The extent of damage is generally low, depending on
the variety and virus strain. In the case of complex infection, however, the damage may be much greater. The majority of the strains are
spread by aphid species in a non-persistent manner, and by mechanical and tuber transmission [Munster and Pelet 1954, Rozendaal and
Brust 1955, Macarthur 1956]. Seed transmission is unknown. PVS
belongs to the Carlavirus genus of the Betaflexiviridae family in the
Tymovirales order [Carstens 2010]. The filamentous virion has helical
symmetry and a magnitude of 650 × 12 nm. The viral genome consists of a positive single-stranded RNA ~8.5 kb in length [Mackenzie
et. al 1989], with a polyadenylated region at the 3’ end. The genome
includes six open reading frames (ORF), coding for RNA polymerase (223K), helicase-NTPase (25K) and coat protein (34K), and three
other proteins (12K, 7K, 11K) [Foster 1992, Foster and Mills 1992].
PVS can be basically divided into two strains, the common strain
(PVSO) and the Andean strain (PVSA) [Hinostroza-Orihuela 1973].
The two strains can be distinguished on the basis of the symptoms
induced on Chenopodium spp. Isolates belonging to the PVSA strain
cause systemic symptoms on Chenopodium quinoa and are transmitted not only by several aphid species but also mechanically, so they
have greater economic significance than members of the PVSO strain
[Rose 1983, Slack 1983, Wardrop et al.,1989, Fletcher 1996]. Central
European isolates exhibit a close relationship with members of the
PVSO strain, but also induce systemic symptoms on Ch. quinoa [Matousek 2005]. Cox and Jones (2010) recommended the designation
of a PVSO-CS (CS = ‘Chenopodium’-systemic) group for isolates that
cannot be classified in the PVSA strain, but nevertheless induce systemic symptoms on Chenopodium species [Lambert and Scott 2012].
Recombinations may give virus strains better adaptability, raising new challenges for plant protection specialists. Knowledge of recombination hot spots is important not only in the study of virus
358
Recombination studies on a hungarian potato virus s (pvs) isolate
evolution, but also for the reliable diagnosis of the virus. De Sousa
Geraldino Duarte and co-workers (2012) performed recombination
analysis using the complete sequences available in the NCBI database
and a sequence from which only ORF1 was missing. The results suggested the occurrence of a recombination event in the Czech isolate
(AJ863510). When only part of the genome was analysed, a breakpoint was demonstrated in the Czech isolate between nucleotide positions 4914 and 6102, found to originate from the German isolate
(AJ863509, minor parent 99.1%), while the end of the sequence appeared to be derived from the Peruvian isolate (D00461, major parent 100%). When the complete sequences were analysed, recombination was detected in the 6125–8324 region in the Czech isolate.
A sequence of unknown origin was observed in the 6511–6611 region, while the remainder originated from the Brazilian isolate
(JQ647830) (major parent the German isolate, 97.4%; minor parent
the Brazilian isolate, 88.4%).
In Hungary relatively little research has been done on Potato
virus S and no sequence data are available. The aim of the present
work was to clone the genetic material of a Hungarian virus isolate
to determine the complete nucleic acid sequence and upload it to the
international database. The nucleotide sequence of the Hungarian
isolate was compared with sequences already available in the database, and phylogenetic trees reflecting the genetic relationships of
the isolate were prepared.
Materials and methods
Total RNA was extracted with a Spectrum Plant Total RNA Kit (Sigma-Aldrich), following the manufacturer’s instructions. The primers
were designed based on the potato S virus nucleic acid sequences available in the NCBI database (tab. 1, tab. 2).
Reverse primers and RevertAid™ Premium Reverse Transcriptase (Fermentas, Biocenter) were used for cDNA synthesis, after which
the virus genome was amplified in five overlapping regions by optimising the PCR conditions. Taq DNA polymerase (Fermentas, Biocenter) was used in the reactions. The purified PCR products (High
Pure PCR Product Purification Kit, Roche) were cloned into pGEM-T
359
Éva Pájtli, Ágnes Zámbó, László Palkovics
Tab. 1. Primers designed for determining the genomic RNA sequence
of the AJ863509 isolate.
Primer
PVS1.for
PVS173.rev
PVS1105.rev
PVS1579.rev
PVS1530.for
PVS2776.rev
PVS2663.for
PVS3300.for
PVS4608.rev
PVS4535.for
PVS5138.for
PVS6010.rev
PVS6666.for
PVS6765.rev
PVS7149.for
PVS7882.rev
Poly T2.rev
Sequence
Gene
5’-GATAAACACTCCCGAAAATAATT-3’
5’-GTAGCAAAACCAGGCGAAGTTATC-3’
5’-CACTTGGCTCTGGGCACATC-3’
5’-CCTTCTGTGCACATACTATCCACG-3’
5’-GCATAGATTTTCAGCGGATCAAGTT-3’
5’-CCCCTGTGAAGTGCGAGATG-3’
5’-GATGCCCACCACACACGAGA-3’
5’-GCAAGGATCATATTGAGCATTGTAAG-3’
5’-ACCATTCCTCACCAAGTTCAACAA-3’
5’-GAGGGTGATCCGTGGTTGAAA-3’
5’-GACAATCGGTTCAGGGATGCG-3’
5’-CCCGGGACACTATGAACAACTATWG-3’
5’-ATATTGTGCCCTGATGCCACTTAC-3’
5’-CAACAATTGGCAGTGTACTCCTAGTG-3’
5’-GGGCCGTTGAAGCACCTTTAG-3’
5’-GCAGCCCCATTAGTCACATAATCG-3’
5’-CGGGGATCCTCGAGAAGCTTTTTTTTTTTTTTTTT-3’
UTR
ORF1
ORF1
ORF1
ORF1
ORF1
ORF1
ORF1
ORF1
ORF1
ORF1
ORF2
ORF2
ORF3
ORF4
ORF5
UTR
Tab. 2. Sequences used in the analyses.
Accession number
Isolate
Country
Srtain
HF571059
FJ813512
FJ813513
AJ863509
AJ863510
JQ647830
D00461*
Y15625*
PVS HU
WaDef
Id4106
Leona
Vltava
BB-AND
Kobra
Hungary
USA
USA
Germany
Czech Republic
Brazil
Peru
Czech Republic
PVSO
PVSO
PVSO
PVSO
PVSA
PVSA
PVSA
PVSO
*partial genomes
Easy Vector plasmids (Promega, Bio-Science) and transformed into
Escherichia coli DH5α cells. Bacterium colonies containing recombinant plasmids carrying the virus sequence were selected using blue360
Recombination studies on a hungarian potato virus s (pvs) isolate
-white screening. The recombinant plasmids were purified and the
sequences of the clones were determined. Only five complete PVS
genomic sequences are available in the international database. Pairwise comparison between the new isolate and these sequences was
performed by means of EMBOSS Needle Pairwise Sequence Alignment, while the sequences were aligned and analysed with the software packages CLC DNA Workbench 6.6 and MEGA 5.1 [Tamura et
al.,2011]. Maximum Likelihood and UPGMA (Unweighted Pair Group Method) analyses were employed to prepare the phylogenetic trees. Recombination analysis was performed with the RDP3 program
[Martin 2010].
Results and discussion
The Hungarian isolate (accession no. HF571059) was found to be
8485 bp in length and to contain 6 open reading frames (ORF).
A phylogenetic tree was compiled for all the complete coat protein
gene sequences available in the international database and when
these were compared with the Hungarian isolate the latter was seen
to belong to the PVSO strain. When the coat protein regions was analysed, PVS HU exhibited the closest relationship with one Syrian and
two Iranian isolates and was thus classified in the first (PVSO-1) of
the PVSO genotype groups described by Salari and co-workers (2011).
When the whole genome was analysed, the Hungarian isolate
exhibited the closest relationship (92.63% and 92.74% homology)
with two American isolates, which were also closest to the Hungarian isolate phylogenetically. PVS HU was 92.31% homologous to the
German isolate and 89.39% to the Czech isolate, but exhibited only
78.61% homology with the Brazilian isolate, representing a difference of 1828 nucleotides in terms of the whole genome. The two
American isolates exhibited 97.99% homology with each other.
At the nucleotide level, PVS HU exhibited over 95% homology
with European and North American isolates for 5’ UTR, as opposed to
only 91.95% with the Brazilian isolate. There was a very low (76.9%)
level of homology with the Brazilian isolate for ORF1, while this figure
was around 90% for the European and North American isolates. In the
ORF2 region the Hungarian isolate only exhibited over 90% similar361
362
99,0
99,0
99,0
94,1
92,2
nt
aa
93,6
94,7
97,9
81,9
86,2
94,4
95,4
96,5
82,8
82,3
nt
aa
95,9
96,3
96,3
93,5
93,2
93,8
93,7
93,4
81,0
79,8
nt
aa
97,0
95,5
97,0
82,1
89,4
95,0
93,5
94,0
82,1
81,8
nt
aa
97,2
97,2
96,3
94,4
96,5
91,1
90,8
91,4
82,3
82,3
nt
aa
95,9
97,1
97,1
94,7
94,2
94,4
94,5
93,6
87,0
84,7
nt
aa
94,2
94,3
92,8
90,3
84,3
92,1
91,9
91,5
91,7
76,9
nt
nt
96,8
96,8
95,2
95,2
91,9
nt
92,74
92,63
92,31
89,39
78,61
8485
8485
8478
8464
8485
FJ813512
FJ813513
AJ863509
AJ863510
JQ647830
ORF6
ORF5
ORF4
ORF3
ORF2
ORF1
5’ UTR
CG
Genome
size
nt
Isolate
Tab. 3. Comparison of the PVS HU isolate with the complete PVS sequences in the NCBI database.
3’UTR
Éva Pájtli, Ágnes Zámbó, László Palkovics
ity to Leona, among the European isolates,
while for ORF3–ORF6 its homology with
Vltava was as low as with the Brazilian isolate, suggesting the occurrence of a recombination event (tab. 3).
When recombination analysis was
performed with the complete genomes
available in the NCBI database, all the
analyses indicated that PVS HU was not
a recombinant. When all five of the NCBI
complete sequences were used, the results
were in agreement with those reported by
de Sousa Geraldino Duarte and co-workers
(2012) (fig. 1. A). If the Brazilian isolate
was omitted from the analysis, the Hungarian isolate participated in the recombination in the ORF1 region of Leona and
Vltava. In the German isolate the breakpoint was located between nucleotide positions 1204–1313. The major parent was
FJ813512 (94.1%) and the minor parent
PVS HU (93.6%). In the AJ863510 recombination the breakpoint was between nucleotide bases 1114–1313 (major parent
FJ813512: 93.7%, minor parent PVS HU:
94%). A further two breakpoints could be
detected in this analysis, the first right at
the beginning of the sequence (1–63) and
the other from position 6146 to the end
of the sequence. In this case the sequence
was classified as being of unknown origin
(fig. 1. B). When the recombination analysis was repeated with the addition of the
Czech (Y15625) and Peruvian (D00461)
sequence sections, the same result was obtained as reported by de Sousa Geraldino
Duarte and co-workers (2012). In the
Recombination studies on a hungarian potato virus s (pvs) isolate
A
B
363
Éva Pájtli, Ágnes Zámbó, László Palkovics
C
Fig. 1. Recombination analyses with PVS HU using the RDP3 program
package. (A) Analysis on all the complete PVS sequences available
in the NCBI database, (B) on all the complete sequences with the exception
of the Brazilian sequence, and (C) on all the complete sequences together
with the sequences Y15625 and D00461.
Czech isolate, however, a further breakpoint was found between
8389 and the end of the sequence, where the German isolate was the
minor parent (99%) and the Peruvian the major parent (100%). In this
case PVS HU was not involved in the recombination (fig. 1. C). In the
recombination analysis, the nucleotide positions are given with respect to PVS HU.
Acknowledgements
This project was funded from grants Nos. NKTN-TECH-09-A3-2009-0210, TÁMOP-4.2.1./B-09/1-KMR-2010-0005 and
TÁMOP-4.2.2./B-10/1-2010-0023.
364
Recombination studies on a hungarian potato virus s (pvs) isolate
References
1. Bruyn Ouboter M. P. de 1952. A new potato virus. Proc. Conference on
potato virus diseases, 13–17. Augustus 1951: 83–84.
2. Carstens E. B. 2010. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2009). Arch Virol, 155:
133–146.
3. Cox B. A. Jones R.A.C. 2010. Genetic variability in the coat protein gene of
Potato virus S isolates and distinguishing its biologically distinct strains.
Arch Virol 155:1163–1169.
4. De Bokx J. A. (1970): Reactions of various plant species to inoculation with
potato virus S Neth J Plant Pathol, 76: 70–78.
5. De Sousa Geraldino Duarte P. Galvino-Costa S.B.F. de Paula Ribeiro S.R.R.
Figueira A.R. 2012. Complete genome sequence of the first Andean strain
of potato virus S from Brazil and evidence of recombination between PVS
strains. Arch Virol, 157: 1357-1364.
6. Fletcher J. D. 1996. Potato virus SA – characteristics of an isolate from New
Zealand. New Zealand J Crop Hort Sci, 24: 335–339.
7. Foster G. D. 1992. The structure and expression of the genome of carlaviruses.
Res Virol, 143: 103–112.
8. Foster G. D. Mills P.R. 1992. The nucleotide sequence of the 3’ – terminal
region of an ordinary strain of potato virus S. Virus Genes, 6: 213–220.
9. Hinostroza-Orihuela A. M. 1973. Some properties of potato virus
S isolated from Peruvian potato varieties. Potato Res, 16: 244–250.
10. Lambert S. J. and Scott J.B. 2012. Strain characterization of Potato virus S
isolates from Tasmania, Australia. Plant Disease, 96: 813–819.
11. Macarthur A. W. 1956. Ibid. 1956, 27–36.
12. Mackenzie D. J. Tremaine J.H. Stace-Smith R. 1989. Organization and
interviral homologies of the 3’-terminal portion of Potato virus S RNA.
J Gen Virol, 70: 1053–1063.
13. Martin D. P. Lemey P. Lott M., Moulton V. Posada D. Lefeuvre P. 2010.
RDP3: A flexible and fast computer program for analyzing recombination.
Bioinforma, 26: 2462–2463.
14. Matousek J. Schubert J. Pta´cek J. Kozlova´ P. Dedic P. 2005. Complete nucleotide sequence and molecular probing of potato virus
S genome. Acta Virol, 49: 195–205.
15. Munster J. Pelet F. 1954. Annu. agric. Suisse, N.S. 3: 931–6.
16. Rose D. G. 1983. Some properties of an unusual isolate of potato virus S.
Potato Res 26: 49–62.
365
Éva Pájtli, Ágnes Zámbó, László Palkovics
17. Rozendaal A. Brust J.H. 1955. The significance of potato virus S in seed
potato culture. Proc. Second Int. Conference on Potato Virus Diseases. Lisse-Wageningen, 25–29 June 1954: 120–123.
18. Salari K. Massumi H. Heydarnejad J. Hosseini Pour A. Varsani A. 2011.
Analysis of Iranian Potato virus S isolates. 43: 281–288.
19. Slack S. A. 1983. Identification of an isolate of the Andean strain of potato
virus S in North America. Plant Dis, 67: 786–789.
20. Tamura K. Peterson D. Peterson N. Stecher G. Nei M. Kumar S. 2011.
MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol
Evo, 28: 2731–2739.
21. Wardrop E. A. Gray A.B. Singh R.P. Peterson J.F. 1989. Aphid transmission of Potato virus S. Am Potato J, 66: 449–459.
ÉVA PÁJTLI, ÁGNES ZÁMBÓ, LÁSZLÓ PALKOVICS, PhD, DSC
Department of Plant Pathology
Faculty of Horticultural Sciences
Corvinus University of Budapest
e-mail: [email protected]
Scientific supervisor: László Palkovics PhD, DSc
366
Ewa Pora1, Jarosław Kaszubkiewicz
Mateusz Cuske2, Leszek Gersztyn2
EPISTEME
18/2013, t. 3
s. 367–374
ISSN 1895-2241
Wpływ nacisku gleby oraz zasolenia
roztworu glebowego na właściwości
retencyjne superabsorbentów
Influence of soil pressure and soil solution
salinity on retention properties
of superabsorbents
Abstrakt. Główną zaletą superabsorbentów (hydrożeli) jest zdolność absorbcji dużych ilości wody. Dzięki tej właściwości znalazły zastosowanie
w rolnictwie i ogrodnictwie, gdzie deficyt wody w glebie stanowi poważny
problem. Celem przeprowadzonych badań było określenie wpływu dwóch
czynników na właściwości retencyjne superabsorbentów: nacisku masy gleby oraz zasolenia roztworu glebowego. Doświadczenie przeprowadzono na
5 superabsorbentach zbudowanych z usieciowanego poliakrylanu potasu
różniących się rozdrobnieniem w stanie suchym (postać granul lub pudru)
oraz strukturą po nawilżeniu (różnej wielkości grudki lub postać żelu). Badania zostały wykonane w kontrolowanych warunkach laboratoryjnych.
Zastosowano nacisk od 0 do 1814 N/m2 (co odpowiada umieszczeniu hydrożelu w górnej lub środkowej części poziomu akumulacyjnego gleby) oraz
roztwór glebowy o zasoleniu 347 mg•dm-3. Zarówno nacisk jak i zasolenie
ograniczają możliwość retencji wody przez SAP-y.
Słowa kluczowe: superabsorbent, retencja, nacisk, gleba
Summary. Main property of superabsorbents (SAPs) is the ability to absorb large amount of water. With this capability SAPs are used in agriculture
and horticulture, where the soil water deficit is a serious problem. The aim
of this study was to determine the effect of two factors on the retention
properties of SAPs: the pressure of the soil mass residual above the sorbent and salinity of the soil solution. The experiment was performed on
5 superabsorbents composed of cross-linked potassium polyacrylate with
different grinding in a dry state (a form of granules or powder), and the
structure after the moistening (various size lumps, or a gel). The tests were
performed under controlled laboratory conditions. Applied pressure of 0 to
1814 N/m2 (corresponding to hydrogel placed in the upper or middle part
of the accumulation horizon) and soil solution salinity of 347 mg·dm-3.
Pressure and salinity limit the possibility of water retention by the SAPs.
Key words: superabsorbent, retention, pressure, soil
367
Ewa Pora, Jarosław Kaszubkiewicz, Mateusz Cuske, Leszek Gersztyn
Wstęp
Główną zaletą superabsorbentów (hydrożeli) jest zdolność absorbcji
dużych ilości wody. Wynika to z ich jonowego charakteru oraz budowy
z luźno usieciowanych, trójwymiarowych sieci elastycznych łańcuchów
polimerowych [Kiatkamjornwong 2007]. Dzięki tej zdolności znalazły
zastosowanie w rolnictwie i ogrodnictwie, gdzie deficyt wody w glebie
stanowi poważny problem [Hayai i Ali 2004]. Oprócz magazynowania
wody SAPy poprawiają właściwości wodne i powietrzne gleb [Ptach
i in. 2009; Paluszek i Żembrowski 2006]. Mogą również być nośnikiem
środków ochrony roślin i nawozów [Ekebafe i in. 2011; Benedycka i in.
1998], jednocześnie zapobiegając wypłukiwaniu tych związków z gleby [Lejcuś i in. 2008]. Celem przeprowadzonych badań było określenie
wpływu dwóch czynników na właściwości retencyjne superabsorbentów: nacisku masy gleby oraz zasolenia roztworu glebowego.
Materiał i metody
Do badań użyto 5 superabsorbentów różniących się rozdrobnieniem
w stanie suchym (postać granul lub pudru) oraz strukturą po nawilżeniu (różnej wielkości grudki lub postać żelu). Właściwości poszczególnych sorbentów (otrzymane z doświadczeń laboratoryjnych oraz
z kart charakterystyk SAPów) przedstawiono w tab. 1.
Dla każdego superabsorbentu określono wpływ nacisku na retencję wody destylowanej oraz jednoczesnego działania nacisku
i roztworu glebowego o określonym zasoleniu. Retencję wyrażono za
pomocą pęcznienia sorbentów (w milimetrach).
Badania zostały przeprowadzone za pomocą Aparatów Wasiliewa w kontrolowanych warunkach laboratoryjnych. W Aparacie
umieszczano 0,3g sorbentu w stanie suchym, nałożono na niego obciążenie a następnie doprowadzano roztwór lub wodę destylowaną.
Pomiary były dokonywane po upływie 24 godzin. Każdy pomiar został wykonany dwa razy a następnie wyniki uśredniono. Zastosowano nacisk od 0 do 1814 N/m2 (co odpowiada umieszczeniu hydrożelu
w górnej lub środkowej części poziomu akumulacyjnego gleby) oraz
wodę destylowaną (o zawartości soli 11 mg·dm-3) i roztwór glebowy
o zasoleniu 347 mg·dm-3. Roztwór glebowy pobrano z poziomu aku368
Wpływ nacisku gleby oraz zasolenia roztworu glebowego na właściwości...
Tab. 1. Właściwości badanych supersorbentów.
Superabsorbent (nazwa
handlowa)
Aquasorb
3005 S
Stockosorb
500 Micro
Aquaterra
20–40
Aquasorb
3005 KL
Luquasorb
1280 RL
Postać
w stanie suchym
Skład chemiczny
Postać w
stanie wilgotnym
usieciowiony kopolimer akrylamibiały puder
żel
du z akrylanem potasu
usieciowiony kopolimer poliakry- białe granulki grudki o Ø
loamidu i poliakrylanu potasu
o Ø ok 1mm ok. 4 mm
białe granulki grudki o Ø
usieciowiony poliakrylan potasu
o Ø ok 2mm ok. 10 mm
usieciowiony kopolimer akrylami- białe granulki grudki o Ø
du z akrylanem potasu
o Ø ok 3mm ok. 25 mm
białe granulki grudki o Ø
usieciowiony poliakrylan potasu
o Ø ok 4mm ok. 20 mm
mulacyjnego (A) gleby należącej do typu czarnych ziem o składzie
granulometrycznym gliny średniej pylastej. Skład granulometryczny
gleby określono metodą Casagrande’a w modyfikacji Prószyńskiego.
Roztwór pozyskiwano przy zastosowaniu podciśnienia 20–50 kPa.
Otrzymane wyniki przedstawiono w formie wykresów (Ryc.1–5).
Do otrzymanych punktów dopasowano linię trendu metodą najmniejszych kwadratów według równania:
y = a / (x+b)
gdzie: y – oznacza liniowy przyrost objętości superabsorbentu wyrażony w mm
x – nacisk wywierany na sorbent wyrażony w N/m2
a,b – współczynniki liczbowe równania
Wartości współczynników a i b dla poszczególnych sorbentów
oraz retencjowanego roztworu przedstawiono w tab. 2.
Tab. 2. Wartości współczynników a i b linii trendu wg metody
najmniejszych kwadratów.
Aquasorb
3005 S
a
b
Stockosorb
500 micro
a
b
Aquaterra
20–40
Aquasorb
3005 KL
a
a
b
Luquasorb
1280 RL
b
a
b
Woda 6011,8 472,5 4496,5 224,4 17257,1 864,4 13999,7 619,8 13590,9 528,7
Roztwór 4266,6 383,9 3380,8 265,1 13302,2 893,9 10974,5 855,8 5441,9 330,2
369
Ewa Pora, Jarosław Kaszubkiewicz, Mateusz Cuske, Leszek Gersztyn
Wyniki i dyskusja
Sorbenty wykazują największe zdolności gromadzenia wody podczas
swobodnego pęcznienia [Wack i Ulbricht 2007]. Magazynowanie
wody przez SAPy narasta w czasie i ustaje po około 4 godzinach [Xie
i Wang 2009]. Wyniki w omawianych doświadczeniach uzyskiwano
po upływie 24 godzin, w związku z tym przedstawiono końcowy efekt
sorpcji. Wykonane analizy wykazały, że zdolność retencji sorbentów
maleje wraz ze wzrostem zastosowanego nacisku. Również wielkość
cząstek sorbentów wpływa na zróżnicowanie wyników. W przypadku
SAPów o drobnej granulacji (Aquasorb 3005 S, Stockosorb 500 micro), wyraźny spadek retencji występuje przy zastosowaniu nacisku
ok. 400 N/m2. Dla hydrożeli o większej średnicy (Aquaterra 20–40,
Aquasorb 3005 KL, Luquasorb 1280 RL) obserwujemy spadek retencji przy nacisku 600–800 N/m2.
Dodatek soli również negatywnie oddziaływuje na skuteczność
sorbentów [Hadam i Karaczun 2010]. Roztwór glebowy o zasoleniu
347 mg·dm-3 wpływa niekorzystnie na właściwości SAPów. Efekt ten
związany jest z wyższym potencjałem osmotycznym zasolonego
roztworu [Sadeghi i Koutchakzadeh 2007]. Wykreślona krzywa linii
trendu sorbowanej wody destylowanej jest zawsze powyżej krzywej
dla zasolonego roztworu glebowego. Podobne wyniki uzyskali Zhao
i in. [2005]. Najbardziej widoczna różnica między sorpcją wody, a
roztworu występuje w hydrożelach o największym uziarnieniu (Luquasorb 1280 RL oraz Aquasorb 3005 KL) (Ryc. 4 i 5). Najmniejszą
różnicę wykazuje sorbent w postaci pudru (Aquasorb 3005 S) (Ryc. 1).
Różnica sorpcji między wodą a roztworem glebowym przy zerowym
nacisku wynosi dla Luquasorb 1280 RL 9,5 mm a dla Aquasorb 3005
S 0,25 mm. Jak podają Shimei i in. [2006] hydrożele o niskim stosunku grup anionowych do kationowych wykazują większą tolerancję na
zasolenie.
Wielkość uziarnienia istotnie wpływa na zdolności retencyjne
superabsorbentów. Największą ilością zaabsorbowanej wody wykazał się sorbent o największym uziarnieniu (Luquasorb 1280 RL)
pęczniejąc 26,5 mm, natomiast najmniej wody jest w stanie zmagazynować sorbent w postaci pudru (Aquasorb 3005 S) 13,75 mm. Ta
sama zależność występuje w przypadku roztworów.
370
Wpływ nacisku gleby oraz zasolenia roztworu glebowego na właściwości...
Ryc. 1. Pęcznienie sorbentu Aquasorb 3005 S pod naciskiem
z zastosowaniem wody destylowanej oraz roztworu glebowego.
Ryc. 2. Pęcznienie sorbentu Stockosorb 500 micro pod naciskiem
z zastosowaniem wody destylowanej oraz roztworu glebowego.
Ryc. 3. Pęcznienie sorbentu Aquaterra 20–40 pod naciskiem
z zastosowaniem wody destylowanej oraz roztworu glebowego.
371
Ewa Pora, Jarosław Kaszubkiewicz, Mateusz Cuske, Leszek Gersztyn
Ryc. 4. Pęcznienie sorbentu Aquasorb 3005 KL pod naciskiem
z zastosowaniem wody destylowanej oraz roztworu glebowego.
Ryc. 5. Pęcznienie sorbentu Luquasorb 1280 RL pod naciskiem
z zastosowaniem wody destylowanej oraz roztworu glebowego.
Wnioski
1. Hydrożele należy umieszczać na stosunkowo niewielkiej głębokości, ponieważ nacisk gleby istotnie wpływa na wielkość pęcznienia,
a w związku z tym retencję roztworu przez superabsorbenty.
2. Wielkość sorpcji zależy od składu chemicznego pobieranego
roztworu. Nawet niewielkie zasolenie roztworu glebowego wpływa
ograniczająco na wielkość retencji SAPów.
3. Wielkość cząstek sorbentu wykazuje istotne zróżnicowanie
w ilości sorbowanych roztworów. Sorbenty o średnicy granul powyżej
372
Wpływ nacisku gleby oraz zasolenia roztworu glebowego na właściwości...
2 mm są w stanie zmagazynować od 30–50% więcej wody niż sorbent
w postraci pudru.
Podziękowania: Praca była wspierana z grantu naukowego
POIG.01.03.01-00-181/09-00, współfinansowanego przez Unię Europejską z Europejskiego Funduszu Rozwoju Regionalnego.
Bibliografia
1. Benedycka Z., Nowak G. A., Kozikowski A. 1998. Ekosorb jako źródło składników mineralnych dla roślin. Zeszyty Problemowe Postępów Nauk Rolniczych z. 461: 131–136.
2. Ekebafe L. O., Ogbeifun D.E., Okieimen F.E. 2011. Polymer applications In
agriculture. Biokemistri Vol. 23 No.2: 81–89.
3. Hadam A., Karaczun Z. 2010. Wpływ zasolenia na działanie hydrożelu na
przykładzie reakcji traw gazonowych. V Konferencja Młodych Uczonych,
Kraków 2010.
4. Hayat R., Ali S. 2004. Water absorption by synthetic polimer (Aquasorb) and
its effect on soil properties and tomato yield. Int. Agi. Biol., Vol. 6, No. 6:
998–1002.
5. Karta charakterystyki Aquasorb 3005: www.snf-group.com/IMG/pdf/Agriculture-AQUASORB_E.pdf (strona dostępna 11.02.2012).
6. Karta charakterystyki Aquaterra: www.hydrogel.pl/dokumenty/aquaterra/AQUATERRA_karta_charakterystyki.pdf (strona dostępna
11.02.2012).
7. Karta charakterystyki Luquasorb 1280: www.polymer.cn/PY10755/product_detail_21375.html (strona dostępna 11.02.2012).
8. Karta charakterystyki Stockosorb 500: http://www.creasorb.com/sites/
dc/Downloadcenter/Evonik/Product/CREASORB/en/STOCKOSORB/
Creasorb_037_Stockosorb_500_englisch_Aufl7_DB.pdf (strona dostępna 11.02.2012).
9. Kiatkamjornwond S. 2007. Superabsorbent polymers and superabsorbent
polymer composites. Science Asia 33 Supplement 1: 39–43.
10. Lejcuś K., Orzeszyna H., Pawłowski A., Garlikowski D. 2008. Wykorzystanie superabsorbentów w zabezpieczeniach przeciwerozyjnych. Infrastruktura i Ekologia Terenów Wiejskich Nr 9/2008: 189–194.
11. Paluszek J., Żemrowski W. 2006. Wpływ polimeru żelowego Stockosorb
na właściwości wodne i powietrzne erodowanych gleb płowych. Acta Agrophysica 8(4): 903–913.
373
Ewa Pora, Jarosław Kaszubkiewicz, Mateusz Cuske, Leszek Gersztyn
12. Ptach W., Boczoń A., Wróbel M. 2009. The use of hydrożel in afforestation
of postindustrial areas. J. Water Land Dev. No. 13b: 125–135.
13. Sadeghi M., Koutchakzadeh G. 2007. Swelling kinetics study of hydrolyzed
carboxymethylcellulose-poly (sodium acrylate-co-acrylamide) superabsorbent hydrogel with salt-sensitivity properties. J. Sci. I. A. U, Vol.17, No.64:
19–26.
14. Shimei X., Ronglan W., Xiaojuan H., Liqin C., Jide W. 2006. Effect of
the anionic-group/cationic-group ratio on the swelling behavior and controlled release of agrochemicals on the amphoteric, superabsorbent polymer
poly(acrylic acid-co-diallyldimethylammonium chloride). Journal of Applied Polymer Science, Vol. 102: 986–991.
15. Wack H., Ulbricht M. 2007. Gel bloking effects during the swelling of polimetric hydrogels. Proceedings of the First International Conference on Self
Healing Materials 18–20 April 2007, Noordwijak aan Zee, The Netherlands.
16. Xie Y., Wang A. 2009. Effect of modified vermiculite on water absorbency and
swelling behavior of chitosan-g-poly (acrylic acid)/ vermiculite superabsorbent composite. Journal of Composite Materials, Vol. 43, No. 21: 1–17.
17. Zhao Y., Su H., Fang L., Tan T. 2005. Superabsorbent hydrogels from
poly(aspartic acid) with salt-, temperature- and pH-responsiveness properties. Polymer 46: 5368–5376.
Ewa Pora
Instytut Nauk o Glebie i Ochrony Środowska
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
Promotor:
1: prof. dr hab. inż. Jarosław Kaszubkiewicz 2: prof. dr hab. inż. Anna
Karczewska
374
Elżbieta Rymar
EPISTEME
18/2013, t. 3
s. 375–387
ISSN 1895-2241
Ocena odporności na parcha jabłoni
wybranych odmian jabłoni
w kontekście ogrodnictwa ekologicznego
na obszarze Podkarpacia
EVALUATION OF resistance to apple scab
of SELECTED apple CULTIVARs
in the context of organic horticulture
ON SUBCARPATHIAN AREA
Abstrakt. Odmiany jabłoni: Liberty, Freedom, Novamac i Champion mają
zróżnicowaną odporność na parcha jabłoni w warunkach ogrodnictwa ekologicznego. Również niektóre z nich są całkowicie odporne na choroby przy
całkowitym braku stosowania środków ochrony roślin. Jest to bardzo ważna cecha wpływająca na opłacalność produkcji tych odmian jabłek. Celem
badań w latach 2000–2012 była ocena odporności odmian jabłek na parcha
jabłoni i odpowiedź na następujące pytania: W jakim stopniu wybrane odmiany jabłek aklimatyzują się do kwaśnych gleb, które dominują w obszarze
podkarpackim? Które z badanych odmian są najbardziej odporne na parcha
jabłoni? Która z tych odmian jabłek ma najniższą odporność na choroby?
Podstawą badań są zebrane dane z badań terenowych cyklu dziesięcioletnim. Podczas całego okresu trwania badania nie zostały wykorzystane żadne pestycydy ani nawozy konwencjonalne. Dane obejmują: wzrost drzew
(sadzonek), cechy liści i owoców, wielkość plonów owoców, ogólny stan
drzew oraz stosowanie wsiewek między rzędami drzew w sadzie.
Słowa kluczowe: parch jabłoni, odmiany jabłoni: Liberty, Freedom, Novamac,
Champion, odporność jabłoni
Summary. Apple cultivars: Liberty, Freedom, Nova Mac and Champion
have varied resistance to apple scab in organic horticulture conditions. Also
some of varieties are completely resistant to the disease in a total lack of
application plant protection products. This is a very important feature affecting the profitability of production of these apple varieties. The aim of
research in the years 2000–2012 was to evaluate the resistance of apple
375
Elżbieta Rymar
varieties to apple scab and to answer to the following questions: To what
extent the selected apple varieties acclimate to the acidic soils that dominate in Subcarpathian area? Which of the tested varieties are most resistant
to apple scab? Which of these apple varieties have the lowest resistance to
the disease? The basis of research are the collected data of the field study of
ten-year cycle. During the entire study period were not used any pesticides
or conventional fertilizers. Data include: growth of trees, foliage and fruit
characteristics, fruit yield quantity, general condition of the trees and a usage of undersown between tree-rows of the orchard.
Key words: apple scab, apple cultivars: Liberty, Freedom, Novamac, Champion,
apple immunity
376
Ocena odporności na parcha jabłoni wybranych odmian jabłoni...
Wstęp
Rolnictwo, które nadal jest głównym sektorem gospodarki na obszarach wiejskich ma istotny wpływ na przekształcenia struktury
przestrzennej, jest czynnikiem silnie wpływającym na krajobraz oraz
na stan środowiska naturalnego [Bański J., 2009]. Według danych
Wojewódzkiego Inspektoratu Ochrony Środowiska w Rzeszowie rolnicy na Podkarpaciu dysponują powierzchnią 967 257 ha użytków
rolnych – jest to stan na dzień 1.01.2009 r. Stanowi to 52,2% ogólnej
powierzchni województwa, przy czym grunty orne stanowią 629 808
ha, czyli zajmują 65,1% powierzchni użytków rolnych. Znaczna większość użytków rolnych należy do właścicieli prywatnych. Przeciętna
powierzchnia jednego gospodarstwa rolnego prowadzącego działalność rolniczą wynosiła 3,25 ha, natomiast użytków rolnych 2,69 ha
[GUS Rzeszów, 2010]. W kraju przeciętna powierzchnia jednego gospodarstwa była ponad dwa razy większa i wynosiła 7,57 ha, a użytków rolnych 6,63 ha.
Czynnikiem najmocniej obniżającym jakość gleb jest ich nadmierne zakwaszenie, które w niektórych powiatach obejmuje 72–91%
gleb użytkowanych rolniczo.
Z badań prowadzonych w ciągu ostatnich 2 lat wynika, że na
terenie województwa podkarpackiego przeważają gleby zakwaszone
(66%), w tym o odczynie bardzo kwaśnym 35%, kwaśnym 31%, lekko
kwaśnym 20%, obojętnym i zasadowym 14%.
Bez względu na rodzaj skały macierzystej i skład granulometryczny poziom zakwaszenia jest zbliżony (wysoki) zarówno w północnej jak i południowej części województwa. Najwięcej gleb o pH
poniżej 5,5 (bardzo kwaśnych i kwaśnych) stwierdzono na terenie
powiatów: bieszczadzki, brzozowski, dębicki, kolbuszowski, leski, niżański i sanocki (72–91%).
Przeprowadzone przez Wojewódzki Inspektorat Ochrony Środowiska w Rzeszowie badania wykazały, że zawartość metali ciężkich
w glebach Podkarpacia oscyluje wokół wartości przyjętych za naturalne. Problemem jednak jest fakt, że istnieje bardzo duży udział gleb
o zakwaszeniu umożliwiającym pobieranie metali ciężkich przez rośliny oraz ich migrację do wód gruntowych, co stwarza zagrożenie dla
zdrowia ludzi i zwierząt. Na uwagę zasługuje ważny fakt, stwierdza377
Elżbieta Rymar
jący że gleby o pH poniżej 6,6 stanowią w województwie podkarpackim 86% gleb użytkowanych rolniczo.
Cel pracy
Celem badań w latach 2000–2012 była ocena odporności odmian jabłek na parcha jabłoni i określenie wielkości owocowania wybranych
odmian jabłoni w warunkach glebowych i klimatycznych Podkarpacia, które z badanych odmian są najbardziej odporne na parcha jabłoni oraz która z tych badanych odmian ma najniższą odporność na
choroby?
Podstawą badań są zebrane dane z badań terenowych w cyklu
dziesięcioletnim.
Materiał i metody
Badania prowadzone były na obszarze 1,1 ha sadu jabłoniowego w gospodarstwie ekologicznym w miejscowości Jabłonica Polska w okolicach Krosna w województwie podkarpackim. Nasadzenia zostały
dokonane w okresie dostosowywania gospodarstwa do wymagań
ekologicznych. Obserwacje prowadzone były w latach 200–2012.
Odnotowywano wielkość zbiorów jabłek w danym roku, prowadzone
były obserwacje drzew z uwzględnieniem ilości sztuk zdrowych i zainfekowanych drzew. Obserwacje dotyczyły również wielkości przyrostu pni drzew. Dane obejmują również: cechy liści i owoców, ogólny
stan drzew oraz stosowanie wsiewek między rzędami drzew w sadzie.
Podczas całego okresu trwania badania nie były stosowane żadne pestycydy ani nawozy konwencjonalne.
Materiał do nasadzeń został przygotowany na zamówienie w Zakładzie Szkółkarskim w Albigowej. Sadzonki z dwuletnią częścią szlachetną wysadzone zostały do dołków, do których dosypywano torf
uniwersalny w ilości 8–10l/sadzonkę. Obficie podlewano. Ze względu
na odpowiednią wilgotność gleby i występujące opady, podlewanie
wykonywane było w stopniu niewielkim (raz na kilka dni). Przeprowadzone przez Okręgową Stację Chemiczno-Rolniczą w Rzeszowie
badania gleby przeprowadzone przed sadzeniem wykazały, że występują tam gleby kwaśne i bardzo kwaśne – kwasowość w skali pH
378
Ocena odporności na parcha jabłoni wybranych odmian jabłoni...
od 4,17 do 4,71 (według badania przeprowadzonego przez Stację
Chemiczno – Rolniczą w Rzeszowie. W pierwszych czterech latach
(drugi i czwarty rok) po wykonaniu nasadzeń wykonane było dwukrotne wapnowanie gleby w ilości 5 ton wapna na hektar sadu. Badania gleby przeprowadzone w 2006 roku również przez Okręgową
Stację Chemiczno-Rolniczą w Rzeszowie wykazały kwasowość gleby
od 4,37 pH do 6,42 pH.
W międzyrzędziach wysiana zastała mieszanka traw z koniczyną
białą i czerwoną Sad został ogrodzony siatką metalową. Prowadzane były zabiegi agrotechniczne: systematyczne, kilkakrotne w ciągu
roku wykaszanie międzyrzędzi i przestrzeni dookoła drzew. Skoszona trawa była kompostowana poza obrębem sadu. Korony drzew były
formowane i prześwietlane podczas cięć zimowych (luty-marzec).
W początkowych latach wzrostu drzew (pierwsze 2 lata wzrostu),
w okresach suszy sad był nawadniany. Nie stosowano żadnych środków ochrony roślin ani nawożenia. W miarę dojrzewania owoców
prowadzono zbiory jabłek i odnotowywano ich wielkość w zależności
od odmiany. W sadzie zostały wysadzone jabłonie odmian: Liberty,
Freedom, Novamac, Champion. Drzewka były sadzone w podwójnych rzędach, naprzemiennie. Odległość między poszczególnymi rzędami wynosiła 6m, odległość pomiędzy drzewami (pomiędzy jednym
a drugim rzędem w każdym podwójnym rzędzie wynosiła 2,5 m, odległość pomiędzy drzewami wzdłuż podwójnego rzędu wynosiła 4m.
Powstało w ten sposób pięć podwójnych rzędów, po około 240 drzew
w każdym rzędzie. Łącznie wysadzonych zostało 1200 drzewek.
W tym jabłoni odmiany Liberty wysadzono 400 sztuk, Freedom 250
sztuk, Novamac 300 sztuk, Champion 250 sztuk. Przeprowadzono
analizę porównawczą wielkości zbiorów owoców z każdej z odmian
w odniesieniu do pozostałych odmian oraz procentowych wartości
zakażenia drzew parchem jabłoni. Podczas zbierania danych do badania, ograniczony został wpływ nieistotnych czynników zewnętrznych. Wykluczone zostały wszelkie zależności, wpływające na zróżnicowanie środowiska zbieranych danych: badane sadzonki uprawiane
były w jednakowych warunkach, z takim samym poziomem nawodnienia, w tych samych warunkach klimatycznych i atmosferycznych.
Dzięki temu podczas analizy można było skupić się na określeniu
faktycznych elementów wpływających na jabłonie i ich zachowanie
379
Elżbieta Rymar
względem działających na nie czynników chorobotwórczych. Badania
skupiły się na jednej, konkretnej chorobie – parchu jabłoni, ponieważ
jest to choroba występująca w całym regionie, który objęty został
badaniem i wyrządzająca bardzo dużo szkód. Dzięki ujednoliceniu
warunków środowiskowych drzew, możliwym było ustalenie rzeczywistej odporności badanych odmian na zakażenie parchem jabłoni.
Jako wskaźnik obrazujący wpływ zakażenia parchem na sadzonki
danej odmiany użyta została uśredniona liczba zebranych owoców
podana w kilogramach, przeliczona na jedno drzewo danej odmiany.
Podczas analizy wykluczony został wpływ anomalii pogodowych – jak
susza, przymrozek – w kilku latach (2007/2008, 2009, 2011), które
nawiedziły cały kraj, gdyż spowodowały one spadek liczby plonów nie
tylko w badanym regionie. Dane zostały przedstawione w tabelach.
W poniższej tabeli przedstawione zostały średnie wielkości zbiorów owoców z jednego drzewa badanych odmian w poszczególnych
latach 2000–2012.
Tab. 1. Średni zbiór owoców z jednego drzewa w kg
w latach 2000–2012.
Odmiana
Data [lata] 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012
Liberty 0,4 10,5 47 31,5 43 25
Freedom 0,4 9 46 37 39 21
Novamac 0,3
Champion 0,2
50
30
42
29
2,5 0,8
2
0,8
42
0,7
47
47
0,6
33
3
25 22 31 14 31 28 0,9 0,5 24 0,2 21,5
8
32
25
35
12
24
26
0,5 0,4
21
0,3
0
Źródło: opracowanie własne.
Tab. 2. Porównanie procentowe wielkości owocowania.
Liberty
Freedom
Novamac
Champion
Liberty
Freedom
Novamac
Champion
100,0
92,9
61,0
55,8
107,7
100,0
65,6
60,1
164,1
152,3
100,0
91,6
179,2
166,4
109,2
100,0
Źródło: opracowanie własne.
Sadzonki jabłoni odmiany Liberty przygotowano na podkładce
M-9. Drzewa w drugim roku rozpoczynały okres owocowania. Owoce
380
Ocena odporności na parcha jabłoni wybranych odmian jabłoni...
były ładnie wybarwione w kolorze ciemno czerwonym i bordowym,
z białym i białoróżowym miąższem, soczyste lekko kwaskowe. Bardzo smaczne i okazale wyglądające. Nadające się do sprzedaży jako
jabłka konsumpcyjne. Owoce drobne i spady przeznaczane były do
sprzedaży jako jabłka przemysłowe. Drzewa dawały średnio silne
przyrosty. Liście były niezbyt duże: Średnia długość liścia to około
4,5cm długości, o barwie intensywnie zielonej, połyskujące. Przeprowadzona analiza porównawcza pokazała, że w ciągu całego okresu
trwania badań wartość średniej masy owocowania z 1 drzewa odmiany Liberty stanowiła 107,7% masy owocowania 1 drzewa odmiany
Freedom, 164,1% masy owocowania z 1 drzewa odmiany Novamac
i 179,2% odmiany Champion. Jabłonie odmiany Freedom przygotowane zostały na podkładce M-9. Drzewa tworzyły większe przyrosty
niż odmiana Liberty, dlatego wymagały silniejszego cięcia. Przeprowadzane były cięcia zimowe (luty, marzec). Po rozpoczęciu większego
owocowania w drugim roku po nasadzeniu pojawiły się owoce kulisto
stożkowate, zwężające się ku kielichowi, lekko asymetryczne, o gładkiej skórce, czerwono-żółtawej, z paskowanym rumieńcem. Drzewa
owocowały obficie, prawie co roku. Wykazywały dużą wytrzymałość
na mróz, który w niewielkim procencie zmniejszał wielkość produkowanych owoców. U starszych drzew (od 2004 roku) została zaobserwowana lekko zaznaczona przemienność owocowania. Owocowanie
było, podobnie jak przy odmianie Liberty, zróżnicowane w zależności
od warunków pogodowych (przymrozki 2008, 2009, 2011). Przeprowadzona analiza porównawcza pokazała, że w ciągu całego okresu
trwania badań wartość średniej masy owocowania z 1 drzewa odmiany Freedom stanowiła 92,9% masy owocowania 1 drzewa odmiany
Liberty, 152,3% masy owocowania z 1 drzewa odmiany Novamac
i 166,4% odmiany Champion.
Jabłonie odmiany Novamac przygotowane zostały na podkładce
M-9. Obserwacje prowadzone w latach 2000–2012 wykazały, że w warunkach glebowych i klimatycznych Podkarpacia drzewa odmiany
Novamac rosły średnio silnie a nawet słabo, tworząc wzniesione, średnio zagęszczone korony, z dużą liczbą krótkich pędów. W okres owocowania wchodziły w drugim roku po posadzeniu. Owocowały umiarkowanie obficie ale raczej regularnie. Liście odmiany Novamac były
średnio duże, prostopadle ustawione do pędu, brzegiem piłkowane,
381
Elżbieta Rymar
osadzone na krótkim lub średnio długim ogonku liściowym. Kwiaty małe, z wolnostojącymi płatkami korony. Podczas kwitnienia pąki
kwiatowe i kwiaty były kilkakrotnie uszkodzone przez przymrozki
wiosenne. Owoce były średniej wielkości, niekiedy małe. W części
sadu mocno wystawionej na ekspozycję słońca (południowe zbocze) i dobrze nawodnionej owoce były największe i najlepiej wybarwione. Owoce miały kształt kulisty, lekko spłaszczony, regularny
i wyrównany. Skórka średnio gruba, błyszcząca, zielonkawożółta,
ze słabym nalotem woskowym, pokryta na większości powierzchni
ciemnoczerwonym, wiśniowym, rozmyto-paskowanym rumieńcem.
Miąższ owoców był kremowobiały lub biały, z lekkim zielonkawym
odcieniem, drobnoziarnisty, luźny, soczysty, kwaskowaty, lekko aromatyczny, smaczny. Dojrzałość zbiorczą osiągały w połowie września. Owoce miały tendencję do opadania przed zbiorem. Dojrzałość
konsumpcyjną osiągały pod koniec września. Niesprzyjające warunki
klimatyczne – występujące przymrozki wiosenne, spowodowały kilkakrotne zmniejszenie plonowania. Przeprowadzona analiza porównawcza pokazała, że w ciągu całego okresu trwania badań wartość
średniej masy owocowania z 1 drzewa odmiany Novamac stanowiła
61% masy owocowania 1 drzewa odmiany Liberty, 65,6% masy owocowania z 1 drzewa odmiany Freedom i 109,2% odmiany Champion.
Jabłonie odmiany Champion przygotowane zostały na podkładce M-9. Rozpoczęły owocowanie w drugim roku po posadzeniu. Korony drzew miały kształt stożkowaty, na konarach wyrastały liczne
krótkopędy. Owoce były duże lub średniej wielkości kulisto-stożkowate. Lekko żebrowane przy kielichu, o gładkiej skórce, zielonkawożółtej pokrytej w ponad połowie rozmyto-paskowanym rumieńcem
o koralowo-czerwonym zabarwieniu. Liczne przetchlinki, małe i jasnoszare. Owoce miały miąższ soczysty, słodki, delikatnie kwaskowaty, aromatyczny i bardzo smaczny. Osiągały dojrzałość zbiorczą
w drugiej dekadzie września, a dojrzałość konsumpcyjną na początku
października. Drzewa rosły średnio silnie, po wejściu w okres owocowania ich wzrost osłabł. Przeprowadzona analiza porównawcza pokazała, że w latach 2000–2012 wartość średniej masy owocowania
z 1 drzewa odmiany Champion stanowiła 55,8% masy owocowania
1 drzewa odmiany Liberty, 60,1% masy owocowania z 1 drzewa odmiany Freedom i 91,6% odmiany Novamac.
382
Ocena odporności na parcha jabłoni wybranych odmian jabłoni...
Tab. 3. Ilość drzew odmian Liberty, Freedom, Novamac, Champion
zarażonych parchem jabłoni i innymi chorobami w latach 2000–2012.
Data
[lata]
Parch
jabłoni
Ilość
chorych
drzew/rok
Parch
jabłoni
Ilość
chorych
drzew/rok
Parch
jabłoni
Champion
[250 szt.]
Ilość
chorych
drzew/rok
Novamac
[300 szt.]
Parch
jabłoni
Freedom
[250 szt.]
Ilość
chorych
drzew/rok
Liberty
[400 szt.]
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
8
4
5
8
0
4
2
7
6
5
3
3
0
0
0
0
0
0
0
0
0
0
0
0
9
3
18
11
7
15
6
17
12
13
8
16
0
0
0
0
0
1
0
0
3
1
0
2
23
14
7
18
23
19
8
13
32
17
19
21
0
0
0
7
0
0
8
0
2
6
4
5
57
41
0
12
21
0
0
12
44
0
45
0
57
34
0
5
16
0
0
8
23
0
15
0
2012
2
0
7
1
17
3
18
4
Razem
57
0
142
8
231
35
250
162
%
14,3
0,0
56,8
3,2
77,0
11,7
100,0
64,8
Źródło: opracowanie własne.
Odmiana Liberty wykazała trwałą odporność na parcha jabłoni.
W czasie całego cyklu prowadzenia obserwacji nie odnotowano ani
jednego przypadku zarażenia parchem jabłoni drzew odmiany Liberty. nie odnotowano wymarzania drzew z powodu mrozów zimowych.
Nie miało to wpływu na rozwój chorób wśród drzew jabłoni odmiany
Liberty. Okresowo występujące silne wiatry spowodowały przewrócenie 8 drzew, co stanowi 2% populacji.
U jabłoni odmiany Freedom zaobserwowane zostało zmniejszanie się w niewielkim stopniu odporności na występowanie parcha jabłoni. W czasie okresu badawczego parch został zaobserwowany na
383
Elżbieta Rymar
8 drzewach odmiany Freedom. Pojawiły się również inne choroby:
mączniak jabłoni, drobna plamistość jabłoni, rak bakteryjny, łącznie na 142 drzewach, co stanowiło 56,8% całej populacji odmiany
Freedom. W tym drzewa zainfekowane parchem jabłoni stanowiły
3,2%populacji.
Jabłonie odmiany Novamac wykazały znaczną odporność na
parcha jabłoni. W pierwszych latach po posadzeniu odporność była
całkowita. Po 7 latach od momentu nasadzenia pojawiły się objawy
parcha jabłoni na kilku drzewach (7sztuk), co stanowi 2,5% populacji. W 2012 roku wszystkich drzew z objawami zarażenia parchem
jabłoni było 35, czyli 11,7% wszystkich posadzonych drzew odmiany Novamac. Zaobserwowano również inne choroby kory i drewna,
takie jak rak jabłoni, mączniak, drobna plamistość jabłoni. Łącznie
wszystkich zainfekowanych drzew było 112 sztuk, co stanowi 37,3%
wszystkich drzew jabłoni odmiany Novamac.
Prowadzona obserwacja pozwoliła stwierdzić, że jabłonie odmiany Champion były najbardziej podatne na zarażenia chorobami,
w tym również na parcha jabłoni. Objawy występowania parcha jabłoni stwierdzone zostały w 162 przypadkach, co stanowi 64,8%
wszystkich drzew tej odmiany. Zaobserwowane były również inne
choroby, takie jak rak jabłoni, mączniak, drobna plamistość jabłoni.
W roku 2012 na wszystkich jabłoniach odmiany Champion
stwierdzone zostały choroby, co stanowi 100% wysadzonych drzew
tej odmiany.
Przeprowadzone w latach 2000–2012 badania wykazały, że odmiana Liberty wykazała całkowitą odporność na parcha jabłoni, bardzo małą podatność na choroby kory i drewna.
W czasie całego czasu prowadzenia obserwacji nie stwierdzono
żadnego przypadku zachorowania jabłoni odmiany Liberty na parcha jabłoni. Odnotowano pojedyncze przypadki przewrócenia drzew
przez silny wiatr. W czasie trwania obserwacji zauważono, że niektóre drzewa zaatakowane zostały przez szkodniki i inne choroby.
Najczęściej zakażenia występowały łącznie – na jednym drzewie pojawiał się parch oraz inne choroby: mączniak jabłoni, drobna plamistość jabłoni, rak bakteryjny.
384
Ocena odporności na parcha jabłoni wybranych odmian jabłoni...
Podsumowanie i wnioski
Prowadzone w latach 2000–2012 obserwacje pozwoliły stwierdzić,
że odmiany jabłoni: Liberty, Novamac, Freedom i Champion wykazały zróżnicowaną odporność na parcha jabłoni. Aklimatyzacja w warunkach glebowych i klimatycznych Podkarpacia również przebiegała w zróżnicowany sposób. Odmianą najmniej odporną na choroby,
w tym na parcha jabłoni okazała się odmiana Champion, która w ostatnim roku obserwacji w 100% została zaatakowana przez choroby
i szkodniki. Przy ograniczonych możliwościach stosowania środków
ochrony roślin w sadownictwie ekologicznym nie jest możliwe całkowite wyeliminowanie wszystkich szkodliwych czynników zagrażających tej odmianie. Również klimat Podkarpacia i występujące tu często wiosenne przymrozki zmniejszają owocowanie jabłoni odmiany
Champion. Z tych względów nie jest ona polecana do uprawy ekologicznej w warunkach Podkarpacia.
Nieco bardziej odporną okazała się odmiana Novamac. Jednak
w latach od 2003 do 2012 również pojawiła się zmniejszona odporność na parcha jabłoni, który skutecznie zaatakował 35 drzew,
co stanowiło 11,7% wszystkich posadzonych jabłoni tej odmiany.
Pojawiające się wiosenne przymrozki miały wpływ na zmniejszenie
owocowania w latach 2001, 2008, 2009, 2011. Dlatego też odmiana
Novamac powinna być ostrożnie wprowadzana do sadów ekologicznych na terenie Podkarpacia. Pod jej nasadzenia wskazane są tereny
osłonięte od wiatru i ewentualnych przymrozków wiosennych. Należy liczyć się z możliwością zanikania odporności na parcha jabłoni
w miarę starzenia się sadu.
Odmiana Freedom jest bardziej odporna na parcha jabłoni niż
dwie poprzednie odmiany. W czasie całego czasu obserwacji zarażeniu parchem uległo 8 drzew, co stanowi 3,2% wszystkich wysadzonych jabłoni tej odmiany. Drzewa charakteryzują się średnią wrażliwością na wiosenne przymrozki, które w latach 2008, 2009, 2011
wpłynęły na zmniejszenie owocowania drzew odmiany Freedom. Odmiana ta jest polecana do uprawy w sadach ekologicznych na terenie
Podkarpacia na działkach osłoniętych od silnego wiatru i przymrozków wiosennych.
Jabłonie odmiany Liberty okazały się najbardziej odporne na
zagrożenie parchem jabłoni. W całym sadzie nie pojawiły się objawy
385
Elżbieta Rymar
zarażenia drzew tej odmiany parchem jabłoni (0%). Również pozostałe warunki glebowe i klimatyczne nie sprawiły tej odmianie trudności w czasie aklimatyzacji, wzrostu i owocowania. Odporność na
parcha jabłoni okazała się trwała. Wiosenne przymrozki wpłynęły na
zmniejszenie plonów w latach 2008, 2009, 2011, co nasuwa wniosek,
że jabłonie odmiany Liberty należy sadzić na terenach osłoniętych
od silnych wiatrów, które mogą wyłamać drzewa (wytwarzają one
płytki system korzeniowy), oraz od przymrozków wiosennych, które mogą obniżyć plonowanie. Odmiana jabłoni Liberty jest odmianą
najbardziej polecaną spośród ocenianych tu odmian do uprawy ekologicznej. Nie wymaga stosowania środków ochrony roślin, owoce są
smaczne i ładnie wybarwione. Prowadzone w sadzie ekologicznym
zabiegi pozwalają ochronić drzewa tej odmiany przed parchem jabłoni. Wpływa to bezpośrednio na koszty uprawy i cenę produktów ekologicznych na rynku [Biuletyn Statystyczny, 2009–2010]. Według
danych statystycznych GUS uprawy sadownicze – sady jabłoniowe
na Podkarpaciu zajmują obszar 4114 ha. Plony jabłek w 2010 roku
z tego areału wyniosły 175 812 dt (deka ton). Ze względu na silne
zakwaszenie gleby oraz niezbyt sprzyjające warunki klimatyczne
(dłuższe, ostrzejsze zimy), należy poszukiwać takich odmian jabłoni, które sprawdzą się w takich właśnie warunkach, dając obfite plony bez stosowania chemizacji, co jest ważnym elementem. nowych
kierunków rozwoju rolnictwa [Bukowski M., 2009]. Nowe możliwości rozwoju sadownictwa pozwalają stworzyć warunki do rozwoju wielofunkcyjności gospodarstw rolnych na terenie Podkarpacia
[A. Czudec, 2009]. Wizja rolnictwa europejskiego kojarzy się z tzw.
europejskim modelem rolnictwa, którego główne atrybuty to wielofunkcyjność i zrównoważenie [FIR, 2010]. Ważnym czynnikiem dla
rozwoju sadownictwa są uwarunkowania klimatyczne [Kuś J., Krasowicz S., Igras J.,2009]. Odmiana Liberty i Freedom dobrze sprawdza
się w warunkach klimatycznych Podkarpacia.
literatura
1. Bański J., 2009, Typy obszarów funkcjonalnych w Polsce. IGiPZK PAN, Warszawa: 16.
2. Biuletyn Statystyczny, GUS, Warszawa 2009–2010.
386
Ocena odporności na parcha jabłoni wybranych odmian jabłoni...
3. Bukowski M. Zastosowanie strukturalnego modelu gospodarki polskiej klasy
DSGE. [w:] Ocena skutków potencjalnych zmian WPR oraz uwarunkowań
makroekonomicznych na polski sektor rolno-żywnościowy na podstawie wyników modelowania. IERiGś-PIB, Warszawa 2009: 49.
4. Charakterystyka obszarów wiejskich w 2008 r., Główny Urząd Statystyczny, Urząd Statystyczny w Rzeszowie, Rzeszów 2010.
5. A. Czudec, Ekonomiczne uwarunkowania rozwoju wielofunkcyjnego rolnictwa, Wydawnictwo Uniwersytetu Rzeszowskiego, Rzeszów 2009: 160.
6. Krajowy Plan Strategiczny Rozwoju Obszarów Wiejskich na lata 2007–
2013, MRiRW, listopad 2009.
7. Kuś J., Krasowicz S., Igras J., Perspektywiczne kierunki zmian produkcji rolniczej w Polsce. Studia i Raporty IUNG-PIB, 2009: 27.
8. Odnowiona strategia zrównoważonego rozwoju UE (przyjęta przez Radę
Europejską 15/16 czerwca 2006 r.). [CEU, DG I,1017/06, Brussels, 26
June 2006].
9. FIR, 2010, Wspólna Polityka Rolna po 2013 roku. Propozycje zmian.
Forum Inicjatyw Rozwojowych FEFRWP, Wieś i Rolnictwo nr 2(147),
2010: 2.
mgr Elżbieta Rymar
Katedra Fizjologii i Biotechnologii Roślin
Uniwersytet Rzeszowski
e-mail: [email protected]
Promotor: dr hab. inż. prof. UR Wojciech Litwińczuk
387
Annamária Tóth
Marietta Petróczy
László Palkovics
EPISTEME
18/2013, t. 3
s. 389–396
ISSN 1895-2241
Przeciwgrzybicowe działanie olejków
eterycznych wobec patogenów wiśni antraknoza
Antifungal activity of essential oils against
the pathogen of sour cherry anthracnose
Abstrakt. Antraknoza spowodowana Colletotrichum acutatum, powoduje
znaczne staty wiśni i truskawek na Węgrzech. Tylko kilka środków przeciwdziałaących można zastosować 7–10 dni przed zbiorem. Wykorzystanie
ekstraktów roślinnych i olejków eterycznych do ochrony roślin znalazło się
w centrum zainteresowania w ostatnich latach. W naszym badaniu in vitro
skuteczności 16 olejków eterycznych testowano przeciwko Colletotrichum
acutatum. Fungicydów konwencjonalnych zostały również zaangażowane
jako kontrole. Aktywność przeciwgrzybicza olejków porównano techniką
rozcieńczania agarowego, na podstawie zahamowania wzrostu grzybni i zarodników kiełkowania. W różnych stężeniach obserwowano znaczne różnice w skuteczności. Colletotrichum acutatum został całkowicie zahamowany
w stężeniu 0,1% przez olejki z anyżu, bazylii, goździki, cubeba, kopru, mięty
i róży palmowej. Na najniższym badanym stężeniu (0,01%), tylko olejek
tymiankowy spowodował całkowite zahamowanie.
Słowa kluczowe: Colletotrichum acutatum, antraknoza, olejki eteryczne,
przeciwgrzybicze
Summary. Anthracnose caused by Colletotrichum acutatum, causes significant damage on sour cherry and on strawberry in Hungary. Only few fungicides are allowed to apply 7–10 days before harvest, so the usage of plant
extracts and essential oils in plant protection got into the focus of interest
in the past years. In our survey in vitro effectiveness of 16 essential oils
were tested against Colletotrichum acutatum. Conventional fungicides were
also involved as controls. The antifungal activity of the essential oils was
compared by agar dilution technique, on the basis of the inhibition of mycelial growth and conidial germination. Great differences were observed in
effectiveness at different concentrations. Colletotrichum acutatum was completely inhibited in 0.1% concentration by the essential oil of anise, basil,
clove, cubeba, fennel, palm rose and spearmint. At the lowest tested concentration (0.01%) only thyme oil caused complete inhibition.
Key words: Colletotrichum acutatum, anthracnose, essential oils, antifungal
389
Annamária Tóth, Marietta Petróczy, László Palkovics
Introduction
The genus Colletotrichum (teleomorph Glomerella) contains large
number of plant pathogens. Two types of diseases caused by these
fungi can be separated: preharvest and postharvest. The ability to
cause latent infections has grouped Colletotrichum species among the
most important postharvest pathogens [Bailey and Jeger, 1992]. The
anthracnose caused by Colletotrichum acutatum Simmonds ex. Simmonds constitutes a major problem in Hungary. The pathogen is widespread in Hungarian sour cherry orchards, and strawberry plantations. Symptoms of the disease, enlarging brown sunken spots, occur
on the ripening fruits.
In a survey essential oil of Salvia macrochlamys and Salvia recognita proved to effective against growth and development of reproductive stroma of Colletotrichum acutatum, and two other Colletotrichum species [Tabanca et al., 2006]. Antifungal activity of Scaligeria
tripartita oil was observed against the strawberry anthracnose-causing fungal plant pathogens Colletotrichum acutatum [Tabanca et al.,
2007]. In the study of Alzate et al. [2009] essential oil of thyme and
lemongrass was found effective against the pathogen. Rozwalka et
al. [2010] evaluated the effect of essential oils on the conidia of two
Colletotrichum species. Essential oils of Cinnamomum sp., Cymbopogon citratus, Eugenia caryophyllata, Cymbopogon martinii and Thymus
vulgaris presented direct fungitoxic action by causing severe damage
to cellular ultrastructure of the conidia. Duduk et al. [2010] tested
the effects of the volatile phase of thyme, cinnamon and clove essential oils on C. acutatum. Mycelial growth was totally inhibited by
thyme oil in the concentration of 76 μl/l of air. The same results were
obtained by cinnamon and clove oil in higher concentrations. Prieto
et al. [2011] in their study demonstrated that Zanthoxylum essential
oils exhibit important antifungal effect on C. acutatum. Zanthoxylum
fagara showed the highest activity on the fungi.
This study aimed to evaluate the in vitro effectiveness of different essential oils against mycelial growth and conidial germination
of Hungarian C. acutatum isolates.
390
Antifungal activity of essential oils against the pathogen of sour cherry anthracnose
Materials and methods
The experiments were performed in the Laboratory of Department
of Plant Pathology, Corvinus University of Budapest, Hungary. Isolates of Colletotrichum acutatum were originated from naturally infected sour cherry (cv. ‘Újfehértói fürtös’; origin: Soponya, Hungary;
year of isolation: 2011) and (cv. ‘Asia’; origin: Lajosmizse, Hungary;
year of isolation: 2012) strawberry fruits. The isolates were routinely
cultured on potato dextrose agar (PDA), in growth chambers at 24°C
in dark.
Molecular identification of the pathogen
DNA extraction was based on the method of Dellaporte et al.
[1983] with modifications. Universal primers (ITS5 and NL4) were
used to amplify the ITS regions of the ribosomal DNA (ITS1-5.8SITS2) for identification. The length of the amplified product was about 1200 bp. Approximately, 100 ng of DNA was amplified in PCR reaction buffer containing 250 µM of each dNTP, 7.5 mM MgCl2, 20 pM
primers, and 2.5 units Taq DNA polymerase in a total volume of 50
µl. In all cases, the PCR reactions were carried out in a Perkin-Elmer
9700 thermocycler with initial denaturation at 94°C for 3 min, followed by 35 cycles of 94°C for 30 s, 55°C for 1 min, and elongation
at 72°C for 1.5 min, and final elongation at 72°C for 10 min. Amplified products were separated by electrophoresis in 1% agarose gels in
1x TBE buffer, stained with Gel Red (Biotium), visualized under UV
light, using a BioDoc-It Imaging System (UVP). PCR products were
purified using High Pure PCR Product Purification Kit (Bio-Rad) and
sent to Biomi Kft. for sequencing by ABI PRISM BigDye Terminator
Cycle Sequencing kit and ABI PRISM 310 instrument with ITS5 forward and NL4 reverse primers.
Pathogenicity test
Pathogenicity studies were carried out on 10-10 sour cherry and
strawberry fruits. The fruit surface was disinfested with 70% ethanol
then rinsing it with sterile distilled water. Plugs from 7-day-old colonies were inserted into a wound made by a sterile needle under the
fruit skin. Sterile potato dextrose agar plugs were used as controls.
The inoculated fruits were sprayed lightly with sterile distilled water
391
Annamária Tóth, Marietta Petróczy, László Palkovics
and placed in separate large glass vessels containing wet sheets of
filter paper at the bottom. Inoculated fruits were incubated at 24°C.
Fruits were examined 5–7 days after inoculation.
Essential oils
During evaluation of the effectiveness of essential oils on C. acutatum, anise (Pimpinella anisum), basil (Ocimum basalicum), bergamot (Aetheroleum bergamottae), camphor (Cinnamomum camphora), citronella (Cymbopogon nardus), clove (Syzygium aromaticum),
coriander (Coriandrium sativum), cubeba (Litsea cubeba), fennel (Foeniculum vulgare), indian lemongrass (Cymbopogon citratus), lavender
(Lavandula angustifola), niaouli (Melaleuca viridiflora), orange blossom (Citrus sinensis), palmarosa (Cymbopogon martinii), patchouli
(Pogostemon sp.), rosemary (Rosmarinus officinalis), sage muscat (Salvia sclarea), spearmint (Mentha spicata) and thyme (Thymus vulgaris)
essential oils were selected. Antifungal activity was tested in three
dilutions (1%, 0.1% and 0,01%) against mycelial growth and conidial
germination. Essential oils were stemmed from trade (Aromax Zrt.).
In vitro antifungal activity
Agar dilution method was applied for testing antifungal activity of essential oils against mycelia growth and conidial germination.
PDA plates containing essential oils in different concentrations were
prepared with plastic Petri dishes (90 x 15 mm). Agar plugs from actively growing pure cultures were placed in the middle of poisoned
agar plates. Plates were sealed with Parafilm and incubated at 24°C
in dark. The diameter of fungal colonies was measured and compared
with the untreated control. For testing efficacy of essential oils 5µl
conidial suspension (containing about 0.6 x 102 conidia/µl) was spread on the surface of poisoned agar plates. After incubation, developing colonies were counted and compared with the untreated control.
Tests were replicated four times in each treatment. In addition, three
fungicides Teldor 500SC (fenhexamid), Orius 20EW (tebuconazole)
and Dithane M45 (mancozeb) were employed as chemical controls
in the assay. Antifungal activity was expressed estimating the EC90
(Effective Concentration) value.
392
Antifungal activity of essential oils against the pathogen of sour cherry anthracnose
Results and Discussion
Identification and pathogenicity of the isolates
Both isolates were identified as Colletotrichum acutatum based on
the ITS region of the fungus. In Norway all isolates of the pathogen from sour cherry showing typical symptoms of anthracnose have
been confirmed as C. acutatum by PCR analysis [Børve and Stensvand
2006]. In Hungary it has been proven that C. acutatum is responsible
for the past years’ epidemics [Tóth et al., 2012]. The pathogenicity of
the isolates was confirmed. Surface-sterilized fruits inoculated with
each isolate developed typical anthracnose symptoms, while control
fruits remained healthy. The first symptoms occurred 5–8 days after
inoculation. Pathogens were re-isolated from the inoculated fruits.
In vitro antifungal activity of essential oils
In case of agar dilution technique method, great differences were
observed in effectiveness among essential oils at different concentrations. Between the two isolates relevant differences were not noticed.
Concerning mycelial growth of Colletotrichum acutatum almost
all oils in a 1% concentration caused total inhibition, except lavender,
orange blossom, patchouli and sage-muscat (Fig. 1). At 0.1% dilution
the efficacy of citronella, coriander, niaouli, camphor and rosemary
decreased significantly. The EC 90 value was under 0.1% in case of
palm rose, kube, clove, thyme, spearmint, Indian lemongrass, basil,
fennel, anise and bergamot. At the tested lowest dilution only essential oil of thyme inhibited totally the mycelial growth of the fungus.
Thyme oil at 0.01% was as affective as tebuconazole and mancozeb
active agents. Alzate et al. [2009] found thyme oil effective against
the pathogen as well in their study. Clove oil showed considerable
fungistatic activity as well at 0.01% concentration, while fenhexamide, a licenced active agent against anthracnose, reduced the colony
development of fungus less than 50% in practical dose (Fig. 1). In the
survey of Duduk et al. [2010] mycelial growth was inhibited by clove
oil as well.
Considering conidial germination the same tendencies have been
observed (Fig. 2). Essential oils of lavender, orange blossom, patchouli inhibited less the germination of conidia. EC90 values were betwe393
Annamária Tóth, Marietta Petróczy, László Palkovics
Fig. 1. Antifungal activity of 19 essential oils (in 1, 0.1, 0.01% dilutions)
and 3 active agents (in practical dose, as control) against mycelia growth
of Colletotrichum acutatum.
Fig. 2. Antifungal activity of 19 essential oils (in 1, 0.1, 0.01% dilutions)
and 3 active agents (in practical dose, as control) conidial germination
of Colletotrichum acutatum.
en 1% and 0.1% in case of sage-muscat, citronella, coriander, niaouli,
camphor and bergamot oils. At 0.1% concentration rosemary, palm
rose, kube, clove, thyme, spearmint, Indian lemongrass, basil, fennel
and anise held back the conidial germination during 14 days observation. These essential oils yielded better results than fenhexamide.
In case of thyme oil, complete fungistatic activity has been observed
at the lowest dilution, like tebuconazole and mancozeb containing
fungicides, so the EC90 value is below 0.01% (Fig. 2). Rozwalka et al.
[2010] established that thyme oil present causing severe damage to
cellular ultrastructure of the conidia.
394
Antifungal activity of essential oils against the pathogen of sour cherry anthracnose
Conclusions
Summarising our results the essential oils of thyme and clove presented antifungal activity against the Hungarian Colletotrichum acutatum isolates among in vitro conditions. Thyme oil at the lowest dilution was as affective as Orius 20EW and Dithane M45 fungicides,
and it was more potent than conventional fungicide Teldor 500SC. In
conclusion, these oils could be promising source of a biological fungicide, applied directly before harvest.
Acknowledgements
The authors acknowledge the financial support granted by the OTKAPD100425, TÁMOP- 4.2.1./B-09/1-KMR-2010-0005 and TÁMOP4.2.2./B-10/1-2010-0023 tenders.
References
1. Alzate O. D. A. Mier M G. I. Afanador K. L. Durango R. D. L. García C. M.
2009. Evaluation of phytotoxicity and antifungal activity against Colletotrichum acutatum of essential oils of thyme (Thymus vulgaris), lemongrass
(Cymbopogon citratus), and its main constituents Vitae, 16: 1.
2. Bailey. J. A. Jeger. M. J. 1992. Colletotrichum biology. Pathology and Control. CAB International, Wallingford, UK.
3. Børve J. Stensvand A. 2006. Timing of fungicide applications against anthracnose in sweet and sour cherry production in Norway. Crop Protection,
25: 781–787.
4. Dellaporte S. L. Wood J. Hicks J. B. 1983. A plant DNA minipreparation:
version II. Plant Molecular Biology Reporter, 1: 19–23.
5. Duduk N. Obradović A. Ivanović M. 2010. Uticaj etarskih ulja timijana,
cimeta i karanfilića na porast micelije Colletotrichum acutatum. Pesticidi
i Fitomedicina, 25(2): 151–156.
6. Prieto J. A. Patiño O. J. Delgado W. A. Moreno J. P. Cuca L. E. 2011. Chemical composition, insecticidal, and antifungal activities of fruit essential oils
of three colombian Zanthoxylum species. Chilean Journal of Agricultural
Research, 71(1): 73–82.
7. Rozwalka L. C. Alves E. Carvalho do Amaralb D. 2010. Ultrastructural study of conidia of Colletotrichum gloeosporioides and Colletotrichum musae
treated with essential oils. Interciencia, 35: 912–915.
395
Annamária Tóth, Marietta Petróczy, László Palkovics
8. Tabanca N. Demirci B. Husnu Can Baser K. Aytac Z. Ekici M. Khan S. I.
Jacob M. R. Wedge D. E. 2006. Chemical composition and antifungal activity of Salvia macrochlamys and Salvia recognita essential oils. Journal of
Agricultural and Food Chemistry, 54 (18): 6593–6597.
9. Tabanca N. Demirci B. Husnu Can Baser K. Mincsovics E. Khan S.I. Jacob
M.R. Wedge D.E. 2007. Characterization of volatile constituents of Scaligeria tripartita and studies on the antifungal activity against phytopathogenic fungi. Journal of Chromatography B Analytical Technologies in
the Biomedical and Life Sciences, 850: 221–229.
10. Tóth A. Salamon P. Petróczy M. Hegedűs M. Ádám A. Nagygyörgy E. Palkovics L. 2012. Colletotrichum acutatum izolátumok morfológiai és molekuláris jellemzése. 58. Növényvédelmi Tudományos Napok, Budapest, 42.
Annamária Tóth MSc
Corvinus University of Budapest
Department of Plant Patology
e-mail: [email protected]
Marietta Petróczy PhD
Corvinus University of Budapest
Department of Plant Patology
e-mail: [email protected] uni-corvinus.hu
László Palkovics DSc
Corvinus University of Budapest
Department of Plant Patology
e-mail: [email protected] uni-corvinus.hu
Scientific supervisor: Marietta Petróczy PhD, László Palkovics DSc
396
Urszula WALIGÓRA
EPISTEME
18/2013, t. 3
s. 397–405
ISSN 1895-2241
SYRPHIDAE W SIEDLISKU ŁĄKOWYM
GMINY KOZŁÓW
SYRPHIDAE IN THE MEADOW HABITAT
OF KOZLOW AREA
Abstrakt. Określono skład gatunkowy owadów z rodziny Syrphidae w siedlisku łąkowym gminy Kozłów (powiat miechowski). Odłowy prowadzono
od maja do września w latach 2011–2012. Odłowiono 420 owadów z rodziny Syrphidae, wśród których rozpoznano 61 gatunków należących do podrodzin: Syrphinae, Milesinae i Eristalinae. Ponad 78% z nich stanowiły gatunki
drapieżne, których larwy żywią się mszycami. Eudominantami były: Episyrphus balteatus (Deg.) i Spherophoria scripta (L.). Dominantami były: Eupeodes
corollae (Fabr.) Melanostoma scalare (Fabr.), Spherophoria menthastri (L.), Syrita pipiens (L.).
Słowa kluczowe: Syrphidae, Episyrphus balteatus, drapieżcy
Summary. The research was carried out to determine the composition of
insects’ species of the Syrphidae family in the meadow habitat of Kozłów
area near Miechów in the years 2011–2012. Diptera were collected with
sweeping net, using the method of hand collection at the specific time from
May to September. 420 insects of the Syrphidae family were collected. During two years of investigation total amount of 61 species belonging to the
subfamilies: Syrphinae, Milesinae and Eristalinae were recognized. Over 78%
of them were the predatory species which larvae feed on aphids. The most
numerous were Episyrphus balteatus (Deg.) and Sphaerophoria scripta (L.),
followed by Eupeodes corollae (Fabr.), Melanostoma scalare (Fabr.), Spherophoria menthastri (L.), Syrita pipiens (L.).
Key words: Syrphidae, Episyrphus balteatus, predators
397
Urszula Waligóra
WSTĘP
W Polsce bzygowate są dobrze opracowane pod względem faunistycznym [Bańkowska 1963]. Ponad jedna trzecia larw tej rodziny
prowadzi drapieżny tryb życia. Odżywiają się mszycami i czerwcami.
Regulują i redukują ich liczebność. Przedstawiciele tej grupy zasiedlają większość znanych ekosystemów naturalnych i kształtowanych
przez człowieka. W zależności od środowiska mają odmienny skład
gatunkowy i biorą udział w zapylaniu wielu roślin uprawnych i dziko
rosnących [Wnuk 1973, Wnuk i in. 2009]. Znaczenie biotopów obfitujących w kwitnącą roślinność dla postaci dorosłych bzygowatych,
które odżywiają się pyłkiem i nektarem kwiatów podkreśla Pollard
[1971]. Wysoki udział Syrphidae na łące (35–51%) wśród badanych
owadów drapieżnych stwierdziła [Pankanin-Franczyk i Bilewicz-Pawińska 2000]. Pomimo licznych badań i prowadzonych obserwacji,
wiedza o wielu gatunkach Syrphidae, ich roli w ekosystemach jest
w Polsce nadal nie wystarczająca.
Celem niniejszego opracowania jest ocena składu gatunkowego
i struktury grup troficznych fauny Syrphidae ze szczególnym uwzględnieniem drapieżców z podrodziny Syrphinae występujących w siedlisku łąkowym gminy Kozłów.
MATERIAŁ I METODY
Badania prowadzone były od maja do września w latach 2011–2012
na terenie siedliska łąkowego Marcinowice (gmina Kozłów, powiat
Miechów). Analizowane środowisko o powierzchni 66 ha obfitowało
w zróżnicowaną pod względem gatunkowym roślinność dziko rosnącą
(Caltha palustris L, Taraxacum officinale F. H. Wigg., Centaurea jacea L.,
Plantago major L., Potentilla anserina L., Galium mollugo L.), Achillea millefolium L., Prunella vulgaris L., Rumex crispus L.). Wśród nie koszonych
traw dominowała Dactylis glomerata L., Arrhenatherum elatius (L.), Festuca pratensis Huds. oraz Poa pratensis L. z rodziny wiechlinowate. Od
strony południowej rozciągały się zarośla leśne. W celu określenia składu gatunkowego i liczebności Syrphidae osobniki dorosłe odławiane
były siatką entomologiczną „metodą na upatrzonego w określonym
czasie”. Odłowy prowadzono dwukrotnie w każdym miesiącu w godzi398
Syrphidae w siedlisku łąkowym gminy kozłów
nach od 9–11. Próbę stanowiły wszystkie odłowione muchówki w danym dniu w ciągu 20 minut. Przynależność gatunkową oznaczono przy
pomocy klucza do oznaczania owadów [Bańkowska 1963, Soszyński
1991, 2007]. Dominację gatunków określono na podstawie ich udziału
procentowego. Klasy dominacji przyjęto według Dicklera [1968]. Eudominanci: udział powyżej 10%, dominanci: 5,1–10%, subdominanci:
2,1–5,0%, recedenci: 1,1–2,0% oraz subrecedenci: udział poniżej 1,0%.
Stałość występowania gatunku w badanym środowisku oceniono według skali Tichlera [1949], cyt. za Trojanem [1980]. Uwzględniając
stosunek liczby prób zawierających badany gatunek do liczby wszystkich prób przyjęto następujące klasy stałości: I – gatunki przypadkowe
(frekwencja 0–25%), II – gatunki akcesoryczne (frekwencja 26–50%),
III – gatunki stałe (frekwencja 51–75%), IV – gatunki absolutnie stałe
(frekwencja powyżej 75%).
WYNIKI I DYSKUSJA
W latach 2011–2012 odłowiono ogółem 420 muchówek w tym:
Syrphini 62,38%, Chrysotoxini 1,19%, Paragini 0,24%, Bacchini
14,76%. Pozostałe stanowiły 21,4% w tym: Volucellini 0,48%, Eumerini 0,48%, Eristalini 14,05%, Milesiini 5,95%, Cheilosiini 0,24%,
Brachyopini 0,24% (ryc. 1). W badanym środowisku łąkowym stwierdzono 61 gatunków (tab. 1). Eudominantami były: Spherophoria
scripta (L.), Episyrphus balteatus (Deg.). Występują one pospolicie
w całej Polsce [Barczak i in. 2000] i mają największe znaczenie jako
wyspecjalizowani drapieżcy mszyc. Dominantami okazały się Melanostoma scalare (Fabr.), Eupeodes corollae (Fabr.), Spherophoria menthastri (L.) oraz Syrita pipiens (L.). Dominacja gatunków zmieniała
się na przestrzeni roku w poszczególnych miesiącach. W maju na łące
charakteryzującej się niskim pokrojem traw i dziko rosnących roślin,
wysokim udziałem procentowym wykazywała się Melanostoma scalare (Fabr.), w czerwcu i lipcu Spherophoria scripta (L.). Wraz ze wzrostem pokrycia łąkowego, zwiększał się procent gatunków większych.
Z początkiem sierpnia dominował Episyrphus balteatus (Deg.), we
wrześniu Eristalis arbustorum (L.). [Wnuk 2005] podaje, że czynnikami decydującymi o roli gatunku dla mszycożernych bzygowatych jest
środowisko, pora roku związana z rozwojem mszyc i wysokość roślin.
399
Lp.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
Myolepta nigritarsis (Coe.)
Eristalinus eneus (Scop.)
Eristalinus sepulchlaris (L.)
Eristalis arbustorum (L.)
Eristalis interrupta (Poda.)
Eristalis lineata (Harr.
Eristalis pertinax (Scop.)
Eristalis rupium (Fabr.)
Eristalis similis (Fall.)
Eristalis tenax (L.)
Helophilus hibridus (Loew.)
Helophilus pendulus (L.)
Helophilus trivittatus (Fabr.)
Myathropa florea (L.)
Xylota segnis (L.)
Cheilosia variabilis (Panzer.)
Eumerus funeralis (Meig.)
Syrita pipiens (L.)
Vollucella inanis (L.)
Vollucella bombylans (L.)
GATUNEK
2
1
1
1
1
V
1
2
VI
3
1
1
2
1
1
1
3
1
2
2
1
4
1
1
2
1
2
2
3
3
1
VII VIII IX
ROK: 2011
1
3
1
1
1
V
3
1
4
2
1
VI
3
1
1
3
3
2
1
1
3
1
1
1
3
VII VIII IX
ROK: 2012
Razem
1
2
2
18
2
1
7
2
2
18
2
1
1
1
1
1
2
24
1
1
%
0,24%
0,48%
0,48%
4,29%
0,48%
0,24%
1,67%
0,48%
0,48%
4,29%
0,48%
0,24%
0,24%
0,24%
0,24%
0,24%
0,48%
5,71%
0,24%
0,24%
KL
SR
SR
SR
SD
SR
SR
SR
SR
SR
SD
SR
SR
SR
SR
SR
SR
SR
D
SR
SR
Grupa
Trof.
KL
5% I
10% I
10% I
40% II
10% I
5% I
20% I
10% I
10% I
50% II
10% I
5% I
5% I
5% I
5% I
5% I
Fitofagi
10% I
50% II Koprofagi
5% I
Pasożyty
5% I
%
400
Saprofagi
Tab. 1. Gatunki Syrphidae odłowione w siedlisku łąkowym (Marcinowice 2011-2012 r.).
Urszula Waligóra
Lp.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
Myolepta nigritarsis (Coe.)
Eristalinus eneus (Scop.)
Eristalinus sepulchlaris (L.)
Eristalis arbustorum (L.)
Eristalis interrupta (Poda.)
Eristalis lineata (Harr.
Eristalis pertinax (Scop.)
Eristalis rupium (Fabr.)
Eristalis similis (Fall.)
Eristalis tenax (L.)
Helophilus hibridus (Loew.)
Helophilus pendulus (L.)
Helophilus trivittatus (Fabr.)
Myathropa florea (L.)
Xylota segnis (L.)
Cheilosia variabilis (Panzer.)
Eumerus funeralis (Meig.)
Syrita pipiens (L.)
Vollucella inanis (L.)
Vollucella bombylans (L.)
GATUNEK
2
1
1
1
1
V
1
2
VI
3
1
1
2
1
1
1
3
1
2
1
4
1
1
2
1
2
2
2
3
3
1
VII VIII IX
ROK: 2011
1
3
1
1
1
V
3
1
4
2
1
VI
3
1
1
3
3
2
1
1
3
1
1
1
3
VII VIII IX
ROK: 2012
Razem
1
2
2
18
2
1
7
2
2
18
2
1
1
1
1
1
2
24
1
1
%
0,24%
0,48%
0,48%
4,29%
0,48%
0,24%
1,67%
0,48%
0,48%
4,29%
0,48%
0,24%
0,24%
0,24%
0,24%
0,24%
0,48%
5,71%
0,24%
0,24%
KL
SR
SR
SR
SD
SR
SR
SR
SR
SR
SD
SR
SR
SR
SR
SR
SR
SR
D
SR
SR
KL
%
5% I
10% I
10% I
40% II
10% I
5% I
20% I
10% I
10% I
50% II
10% I
5% I
5% I
5% I
5% I
5% I
Fitofagi
10% I
50% II Koprofagi
5% I
Pasożyty
5% I
Grupa
Trof.
Saprofagi
Tab. 1. Gatunki Syrphidae odłowione w siedlisku łąkowym (Marcinowice 2011-2012 r.).
Syrphidae w siedlisku łąkowym gminy kozłów
401
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
Parasyrphus annulatus (Zett.)
Parasyrphus nigritarsis (Zett.)
Platycheirus albimanus (Fabr.)
Platycheirus angustatus (Zett.)
Platycheirus clypeatus (Meig.)
Platycheirus manicatus (Meig.)
Platycheirus melanopsis (Loew.)
Platycheirus peltatus (Meig.)
Platycheirus podagratus (Zett.)
Platycheirus scambus (Staeg.)
Platycheirus scutatus (Meig.)
Sceva pyrastrii (L.)
Sceva selenitica (Meig.)
Spherophoria menthastri (L.)
Spherophoria rueppelli (Wied.)
Spherophoria scripta (L.)
Syrphus ribesii (L.)
Syrphus vitripennis Meig.
Xanthograma pedisseguum (Harr.)
SUMA:
LICZBA GATUNKÓW
ŚREDNIA W PRÓBIE
402
1
5
1
10
1
1
1
1
18
1
1
6
1
1
1
1
4
1
1
4
3
1
2
1
36 53 76 25 19
16 25 26 11 12
18 27,5 38 12,5 9,5
5
4
1
1
1
1
1
1
2
36
13
18
5
1
4
3
1
1
9
1
19
1
1
1
1
1
54 75
23 21
27 37,5
1
1
4
1
9
1
1
2
1
2
8
4
2
1
1
5
1
1
2
1
4
2
3
1 41
1
4
2
3 76
2
1
6
3
29 18 420
14 11
14,5 9
0,48%
0,24%
1,90%
0,95%
0,48%
0,24%
0,24%
1,19%
0,24%
0,48%
0,24%
0,95%
0,48%
9,76%
0,95%
18,1%
0,48%
1,43%
0,71%
100%
SR
SR
R
SR
SR
SR
SR
R
SR
SR
SR
SR
SR
D
SR
ED
SR
R
SR
10% I
5% I
25% I
20% I
10% I
5% I
5% I
15% I
5% I
10% I
5% I
20% I
10% I
50% II
20% I
50% II
10% I
30% II
15% I
Urszula Waligóra
Drapieżcy
Syrphidae w siedlisku łąkowym gminy kozłów
Syrphini i Chrysotoxini
Milesiini
Bacchini i Paragini
Eristalini i Brachyopini
Cheilosiini, Eumerini, Volucellini
Ryc. 1. Udział procentowy owadów podrodziny Syrphinae, Milesinae i
Eristalinae (Marcinowice 2011-2012 r.).
Drapieżcy Koprofagi Saprofagi Fitofagi Pasożyty
Ryc. 2. Udział procentowy grup troficznych Syrphidae
(Marcinowice 2011–2012 r.).
Gatunki z rodzaju Melanostoma, Spherophoria są typowe dla biotopów
łąkowych i bardziej związane z niską roślinnością Bańkowska [1963].
W trakcie obserwacji na badanym terenie nie stwierdzono gatunku
absolutnie stałego, a większość z nich zaliczono do gatunków przypadkowych. Pozostałe do gatunków akcesorycznych. Najwięcej muchówek odławianych było w czerwcu i lipcu (tab. 1), co zbiegało się
z obfitością kwitnienia roślin. Atrakcyjność roślin dziko rosnących
w przywabianiu Syrphidae potwierdzają [Wnuk i Gut 1994]. Większą
liczebność populacji owadów w pobliżu źródeł pożywienia stwierdził
Pollard [1971]. Z końcem lata i we wrześniu liczba owadów uległa
znacznemu obniżeniu. Niewątpliwie miało to związek z przekwitaniem wielu roślin łąkowych, ograniczeniem pyłku oraz bionomią Syrphidae. Bzygowate zaliczono do pięciu grup troficznych. Drapieżce,
stanowiły ponad 78% ogółu wszystkich zebranych owadów (41 gatunków), saprofagi – 14,5% (15 gatunków), koprofagi – 5,7% (1 gatunek), fitofagi – 0,7% (2 gatunki), pasożyty – 0,5% (2 gatunki), (ryc. 2).
403
Urszula Waligóra
WNIOSKI
1. Najbardziej przywabiane były gatunki mszycożerne wśród których
eudominantami były: Episyrphus balteatus (Deg.) i Spherophoria scripta (L.), dominantami Eupeodes corollae (Fabr.) Melanostoma scalare
(Fabr.), Spherophoria menthastri (L.).
2. Bogactwo roślin dziko rosnących z różnych rodzin botanicznych stwarza korzystne warunki do przywabiania gatunków afidofagicznych i innych owadów zapylających kwiaty oraz zachowania
bioróżnorodności.
3. Sąsiedztwo siedliska łąkowego stanowi ważny element oporu biologicznego ze strony środowiska, może decydować o obfitości
pożytecznej entomofauny, poprawiać populację wrogów naturalnych
i wymaga dalszych badań nad oceną oddziaływania na występowanie
mszycożernych bzygowatych w koloniach mszyc pobliskich upraw.
BIBLIOGRAFIA
1. Bańkowska R., 1963, Klucze do oznaczania owadów Polski, cz. 28, Muchówki-Diptera, Zeszyt 34, Syrphidae, PWN Warszawa, ss 236.
2. Barczak T., Kaczorowski G., Bennewicz J., Krasicka-Korczyńska E., 2000,
Znaczenie zarośli śródpolnych jako rezerwuarów naturalnych wrogów
mszyc. WU Akademii Techniczno-Rolniczej, Bydgoszcz.
3. Dickler E., 1968, Untersuchungen zur Besiedlung von wiesennahen Leguminosekulturen durch Rüsselkäfer, Zeit. F. Angew. Ent., 55, 20: 129–192.
4. Pankanin-Franczyk M., Bilewicz-Pawińska T., 2000, Drapieżne owady (Chrysopidae, Coccinellidae, Nabidae, Anthocoridae, Syrphidae)
w śródpolnych zbiorowiskach trawiastych. Wiad.Ent. 19(1): 29–36.
5. Polard E., 1971. Habitat diversity and crops pest: a study of Brevicoryne brassicae and its syrphid predators. J Appl Ecol., 8: 751–780.
6. Soszyński B. 1991. Syrphidae, w: Razowski J., Wykaz zwierząt Polski. II.
Zakł. Narodowy im. Ossolińskich. Wyd. PAN, Wrocław, Warszawa, Kraków: 162–169.
7. Soszyński B. 2007. Bzygowate Syrphidae. w: Bogdanowicz W., Chudzińska
E., Pilipiuk I., Skibińska E. (eds.). Fauna Polski: 102–105; 193–197.
8. Trojan P., 1980. Ekologia ogólna, wyd. IV. PWN, Warszawa, 419 str.
9. Wnuk A., 1973, Materiały do znajomości biologii mszycożernych bzygowatych
(Diptera, Syrphidae), Zesz. Probl. Post. Nauk Rol. z. 144: 291–297.
10. Wnuk A., 2005, Roślinność w łańcuchu pokarmowym dla mszycożernych
bzygowatych (Diptera, Syrphidae) [w:] Ochrona Środowiska Naturalne404
Syrphidae w siedlisku łąkowym gminy kozłów
go w XXI wieku-Nowe Wyzwania i Zagrożenia. Wyd. Fundacja na Rzecz
Wspierania Badań Naukowych Wydz. Ogrod. AR im. Hugona Kołłątaja
w Krakowie 95–104.
11. Wnuk A., Gut B., 1994, Atrakcyjność kwiatów dziko rosnących Umbelliferae dla mszycożernych Syrphidae (Diptera). Pol. Pis. Ent. 63:
197–206.
12. Wnuk A., Wojciechowicz-Żytko E., Waligóra U., 2009, Atrakcyjność
kwiatów facelii błękitnej (Phacelia tanacetifolia BENTH.) w przywabianiu
mszycożernych bzygowatych (Diptera, Syrphidae). Zesz. Probl.Post. Nauk
Rolniczych z. 539: 743–751.
Urszula Waligóra
Katedra Ochrony Roślin
Uniwersytet Rolniczy w Krakowie
29 Listopada 54, 31–425 Kraków
e-mail: [email protected]
Opiekun naukowy: prof. dr hab. Andrzej Wnuk
405
Karolina Konieczna
Tomasz Olbrycht
EPISTEME
18/2013, t. 3
s. 407–417
ISSN 1895-2241
PARK PODMIEJSKI JAKO SIEDLISKO WYSTĘPOWANIA
DRAPIEŻNYCH BIEGACZOWATYCH (COL., CARABIDAE)
SUBURBAN PARK AS A HABITAT OF PREDACIOUS
GROUND BEETLES (COL., CARABIDAE)
Abstrakt. Środowisko miejskie podlegające ciągłym oddziaływaniom czynników antropogenicznych, predysponuje zmiany zarówno flory, jak i fauny.
Do zwierząt występujących w środowisku naturalnym, jak i w przekształconym, a równocześnie będących bioindykatorami, można zaliczyć chrząszcze
z rodziny biegaczowatych (Carabidae). Właściwości ekologiczne tej grupy
owadów pozwalają na ocenę siedliska i wnioskowanie na temat zmian zachodzących w ekosystemie miejskim. Parki miejskie, jako substytuty biotopów
leśnych, pełnią istotne funkcje architektoniczne, społeczne, edukacyjne,
a przede wszystkim ekologiczne. Badania prowadzono w dwóch sezonach
wegetacyjnych (2011 i 2012) na terenie parku Zalesie w Rzeszowie. Celem
badań było przedstawienie składu gatunkowego oraz struktury ilościowej
biegaczowatych występujących na terenie parku. Podjęto również próbę
ustalenia, w jaki sposób czynniki antropogeniczne wpływają na kształtowanie zgrupowań karabidofauny. Uzyskane dane porównano z wynikami
otrzymanymi na tym terenie w latach 2008–2009, co pozwoliło analizować
fluktuacje występowania Carabidae na obszarze parku.
Słowa kluczowe: park podmiejski, miasto, biegaczowate, Carabidae
Summary. The urban environment is constantly impacts of anthropogenic factors, which predisposes changes in flora and fauna of urbicenosis.To
animals being found in a natural environment, as well as in transformed,
and at the same time being bioindicators, include beetles from the family
of ground beetles (Carabidae). Ecological characteristics of this group of insects that inhabit urban green areas, allow the assessment of habitats and
reasoning about changes in the urban ecosystem. City Parks, as a substitute
for forest habitats, perform the essential functions of architectural, social,
educational, and above all ecological. The study was conducted in two seasons (2011 and 2012) in the Zalesie Park. The study was present composition and structure of ground beetles occurring in the park and the test how
the anthropogenic factors affecting the structure of carabidofauna. In this
paper, a comparison with the results obtained in this area in 2008–2009,
allowing to analyze the occurrence of Carabidae fluctuations in the park.
Key words: suburban park, city, ground beetles, Carabidae
407
Karolina Konieczna, Tomasz Olbrycht
WSTĘP
Środowisko miejskie podlegające ciągle nieustannym oddziaływaniom czynników antropogenicznych, predysponuje zmiany zarówno
flory, jak i fauny. Do zwierząt występujących w środowisku naturalnym, jak i w przekształconym, a reagujących na czynniki o charakterze urbanizacyjnym należą chrząszcze z rodziny biegaczowatych
(Col., Carabidae). Ta właśnie cecha, jak i znajomość ekologii i etologii
tych owadów, pozwoliła uznawać je za bioindykatory, dzięki którym
można podjąć próbę oceny siedliska i wnioskować na temat zmian zachodzących w ekosystemie miejskim [Czechowski 1982; Szyszko 2002].
Tereny zielone miast, szczególnie parki, stanowią bardzo specyficzne biocenozy. Zasługują one na uwagę ze względu na właściwości
ekologiczne: pełnią funkcje rezerwuarów dla miejskiej entomofauny,
przyczyniają się do jej rozprzestrzeniania, co potwierdza teorię wysp
i korytarzy ekologicznych, a także wzbogacają bioróżnorodność. Stanowią również substytuty biotopów leśnych, co uwidacznia się występowaniem w mieście gatunków preferujących lasy [Czerniakowski
2005; Rychling i Solon 2002; Trojan i Winiarska 2001].
Karabidofauna miast nie została jeszcze zbadana dostatecznie
i dotyczy wybranych miast Polski: Warszawy [Czechowski 1982a],
Bydgoszczy [Żelazna i Błażejewicz-Zawadzińska 2001, 2003], Olsztyna [Aleksandrowicz i Krzętowski 2004; Aleksandrowicz 2008] czy
Rzeszowa [Czerniakowski i Olbrycht 2004, 2009; Olbrycht 2005,
2009]. Natomiast badania dotyczące entomofauny parków miejskich
sensu stricte mają charakter wybitnie fragmentaryczny i bazują na
nielicznych krajowych publikacjach [Jałoszyński i Konwerski 2001;
Kosewska i in. 2011; Stachowiak 2008a, Żelazna i Błażejewicz-Zawadzińska 2006].
Wyniki przedstawione w niniejszej publikacji stanowią kontynuację obserwacji prowadzonych przez Olbrychta [2011] a jednocześnie
próbę określenia wpływu czynników antropogenicznych kształtujących strukturę Carabidae w parku w Zalesiu (UTM EA 73).
MATERIAŁ I METODY
Obserwacje nad biegaczowatymi parku miejskiego prowadzono
w dwóch sezonach wegetacyjnych (2011 i 2012) na terenie dzielni408
Park podmiejski jako siedlisko występowania drapieżnych biegaczowatych
cy Zalesie, usytuowanej w południowej części Rzeszowa. Park, o powierzchni 2,5 ha został założony pod koniec XIX wieku i należał do
rodziny Gumińskich. Potok Młynkówka dzieli park na dwie części:
północną i południową. Południowa część parku jest najstarszym
fragmentem założenia dworskiego, w którym splatają się dwie, odmienne cechy tego terenu: z jednej strony mamy do czynienia z obszarem intensywnie użytkowanym rekreacyjnie przez mieszkańców
oraz studentów Uniwersytetu Rzeszowskiego, z drugiej zaś, istotne
przyrodniczo walory w postaci zabytkowego drzewostanu. W skład
cennej dendroflory wchodzą m.in. lipy drobnolistne i szerokolistne,
jesiony, graby, platan klonolistny, a także wierzba krucha odmiany
zwisającej [Piórecki 1996; Marcinkowski 2003].
Epigeiczne chrząszcze odławiano przy użyciu pułapek glebowych
Barbera, opróżnianych co dwa tygodnie. Pułapki stanowiły plastikowe pojemniki o średnicy 9 cm, wkopane równo z powierzchnią gleby,
napełnione do 1/3 objętości roztworem glikolu etylenowego. Na badanym terenie rozstawiono po 4 pułapki, kontrolowane od maja do października. W 2011 roku wykonano 11, zaś w 2012 12 prób. Zebrany
materiał entomologiczny opracowano w warunkach laboratoryjnych.
Oznaczeń chrząszczy biegaczowatych dokonano korzystając
z pracy Hurki [1996]. Układ systematyczny Carabidae przyjęto zgodnie z opracowaniem Stachowiaka [2008]. Strukturę dominacji (D)
opisano przyjmując klasy dominacji zaproponowane przez Kasprzaka
i Niedbałę [1981]: eudominanty D5 (> 10% osobników zgrupowania), dominanty D4 (5,1–10%), subdominanty D3 (2,1–5%), recedenty D2 (1,1–2%), subrecedenty D1 (< 1%) [Trojan 1980]. Indeks
bogactwa gatunkowego Simpsona (d) określono za Szujeckim [1980],
a charakterystykę ekologiczną biegaczowatych w oparciu o prace Burakowskiego i wsp. [1973, 1974] oraz Leśniaka [1984]. Charakterystykę zoogeograficzną przyjęto za Leśniakiem [1987].
WYNIKI
Ogółem zebrano 792 chrząszcze, zaliczone do 17 rodzajów i 27 oznaczonych gatunków. Cztery osobniki z rodzaju Harpalus, jeden z rodzaju Pterostichus oraz jeden z rodzaju Agonum nie zostały oznaczone
do gatunku ze względu na uszkodzenia uniemożliwiające precyzyjną
klasyfikację taksonomiczną.
409
Karolina Konieczna, Tomasz Olbrycht
Tab.1. Struktura jakościowa biegaczowatych (Col., Carabidae) odłowionych
w dwóch sezonach wegetacyjnych.
Rok / Year
Łącznie
2011 2012 Total
Liczba osobników / Number of individuals
381
411
792
Liczba rodzajów / Number of genuses
11
13
17
Liczba gatunków / Number of species
21
25
27
Indeks Simpsona d / Simpson’s index d
8,1
9,6
Dane liczbowe z poszczególnych sezonów badawczych zostały
przedstawione w tabeli 1. W 2011 roku odnotowano 381 okazów, zaś
w sezonie następnym liczba odłowionych biegaczowatych była niewiele wyższa i wyniosła 411 osobników.
Najliczniej występującymi przedstawicielami Carabidae były: Nebria brevicollis, Pterostichus niger, P. melanarius oraz Limodromus assimilis, które w obydwu sezonach badawczych stanowiły klasę eudominantów. Struktura dominacji biegaczowatych oraz charakterystyka
ekologiczna zostały przedstawione w tabeli 2.
Analiza struktury troficznej wykazała duży udział małych zoofagów, które stanowiły 62,9% zgrupowania (17 gatunków) oraz
mniejszą liczbę dużych zoofagów 25,9% (7 gatunków). Udział hemizoofagów wyniósł 11,1% (3 gatunki). Dominacja gatunków drapieżnych, zarówno ilościowa jak i jakościowa jest istotna z ekologicznego
punktu widzenia, gdyż może stanowić opór środowiska. Ograniczają,
bowiem w znaczny sposób liczebność gatunków fitofagicznych zagrażającym drzewostanom. Drapieżne biegaczowate, jako gatunki w dużej mierze entomofagiczne, pełnią funkcje regulacyjne w populacjach
szkodliwych agrofagów, w tym szkodników roślinności parkowej.
Większość odłowionych biegaczowatych (40,7%) stanowiły gatunki leśne, a 18,5% gatunki ekotonowe (częściowo związane z terenami zadrzewionymi).
Zaobserwowana przewaga gatunków preferujących lub tolerujących stanowiska z drzewami lub krzewami potwierdza istotną rolę
parków w środowisku miejskim. Tego typu enklawy zieleni stanowią
rezerwuary pożytecznej entomofauny oraz są centrami ich rozprze410
Park podmiejski jako siedlisko występowania drapieżnych biegaczowatych
strzeniania na tereny sąsiednie. Liczne (37%) były także gatunki
charakterystyczne dla terenów otwartych. Chrząszcze te w miejscach
zadrzewionych szukają zarówno schronienia, jak i pożywienia, co jest
zgodne ze zdolnościami migracyjnymi Carabidae. Najmniej liczne były
gatunki nadwodne, które reprezentował tylko Pterostichus nigrita.
Ze względu na obecność potoku na badanym terenie, poddano
analizie wymagania wilgotnościowe odnotowanych chrząszczy. Badania wykazały, że 96,2% chrząszczy wykazuje preferencje względem
wilgotnego środowiska: 51,8% gatunków to osobniki wilgociolubne,
44,4% gatunków to mezohigrofile. Zaledwie jeden gatunek, Amara
aenea, jest reprezentantem gatunków sucholubnych (kserofilnych)
i na badanym terenie może być traktowany jako okaz akcesoryczny.
Odłowione chrząszcze scharakteryzowano ze względu na typ
rozwojowy. 74% gatunków to przedstawiciele wiosennego typu rozwojowego, natomiast 26 % reprezentuje typ jesienny. Potwierdzeniem zróżnicowania fenologii jest różnica dynamiki łowności poszczególnych gatunków, gdzie największą liczebność oraz fluktuacje
odnotowano w miesiącach wiosennych i letnich. W badanej populacji
najliczniej wystąpiły elementy palearktyczny (51,8%) i eurosyberysjki (40,7%). Najmniej liczne były chrząszcze reprezentujące element
euro-arktyczny oraz górski europejski prowincji leśnej (po 3,7%).
DYSKUSJA I WNIOSKI
Otrzymane wyniki pokrywają się częściowo z danymi zebranymi przez
Olbrychta [2011]. Limodromus assimilis i Pterostichus melanarius tworzyły również klasę eudominantów, co pozwala określić je jako charakterystyczne dla tego terenu. Natomiast wykazany przez Olbrychta [2011] Asaphidion flavipes, będący także gatunkiem dominujących,
w przedstawionych badaniach wystąpił tylko w 2011 roku, reprezentując klasę subrecedentów. Może to świadczyć o niekorzystnym wpływie
urbanizacji, jak i o niskiej tolerancji ekologicznej tego gatunku.
411
Karolina Konieczna, Tomasz Olbrycht
Tab. 2. Struktura dominacji i charakterystyka ekologiczna Carabidae
odłowionych w dwóch sezonach wegetacyjnych na terenie parku Zalesie.
Lp.
No.
Gatunek
Species
Charakterystyka ekologiczna
Ecological characteristic
I
II
III
IV
V
Struktura
dominacji
odłowionych
chrząszczy D
[%] Dominance structure
of caught
beetles D [%]
2011 2012
1
2
3
4
5
6
7
8
9
1
Leistus rufomarginatus (DUFT.)
L
Zm
Mh
J
Esyb
-
0,3
2
Nebria brevicollis (F.)
L
Zm
Wilg
J
Ear
14,4
11,5
3
Carabus granulatus L.
ToiZ
Zd
Wilg
W
Esyb
2,8
1,5
4
Carabus ulrichii GERMAR
To
Zd
Mh
W
Esyb
1,1
1,3
5
Carabus violaceus (L.)
L
Zd
Mh
W
Pal
3,1
0,9
6
Asaphidion flavipes (L.)
To
Zm
Mh
W
Pal
0,8
-
7
Metallina lampros (HERBST)
To
Zm
Mh
W
Pal
0,5
-
8
Anisodactylus binotatus (F.)
To
Zm
Wilg
W
Pal
0,5
-
9
Harpalus sp.
-
-
-
-
-
1,1
1,5
10 Harpalus rufipes (DE GEER)
To
Hz
Term
J
Pal
5,3
4,6
11 Harpalus latus (L.)
L
Hz
Mh
W
Pal
0,5
0,5
12 Poecilus versicolor (STURM)
To
Zm
Wilg
W
Pal
0,3
-
-
-
-
-
-
0,3
-
14 Pterostichus vernalis (PANZ.) ToiZ
Zm
Wilg
W
Pal
-
0,5
15 Pterostichus oblongopunctatus (F.)
L
Zm
Mh
W
Pal
0,8
1,5
16 Pterostichus niger (SCHALL.)
L
Zd
Mh
J
Esyb
13,6
21,6
Zd
Mh
W
Esyb
21,3
23,9
13 Pterostichus sp.
17 Pterostichus melanarius (ILL.) ToiZ
412
Park podmiejski jako siedlisko występowania drapieżnych biegaczowatych
18 Pterostichus nigrita (PAYK.)
Nw
Zm
Wilg
W
Esyb
-
0,5
19
Pterostichus ovoideus
(STURM)
To
Zm
Wilg
W
Esyb
2,1
1,5
20
Abax parallelepipedus
(PILL. et MITT.)
L
Zd
Wilg
W
Esyb
1,3
0,5
21 Abax parallelus (DUFT.)
L
Zd
Wilg
J
Esyb
5,2
4,6
22 Abax carinatus (DUFT.)
L
Zm
Mh
J
GEPL
0,3
0,7
23 Calathus fuscipes GOEZE
To
Zm
Wilg
J
Pal
-
1,5
-
-
-
-
-
-
0,3
ToiZ
Zm
Wilg
W
Pal
-
0,3
24 Agonum sp.
25 Agonum muelleri (HERBST)
26
Limodromus assimilis
(PAYK.)
L
Zm
Wilg
W
Pal
24,5
19,3
27
Anchomenus dorsalis
(PONT.)
ToiZ
Zm
Mh
W
Pal
-
0,3
28 Amara aenea (DE GEER)
To
Hz
S
W
Pal
-
0,3
29
Chlaenius nitidulus
(SCHRANK)
To
Zm
Wilg
W
Esyb
0,3
0,3
30
Badister lacertcosus
(STURM)
L
Zm
Wilg
W
Esyb
-
0,3
Legenda: Charakterystyka ekologiczna – Ecological characteristic:
I – środowisko życia – habitat: L – las – forest, ToiZ – tereny otwarte
i zadrzewienia – open area and forest, To – tereny otwarte – open area, Nw
– tereny nadwodne – riparian;
II – grupa troficzna – feeding habits: Zd – duże zoofagi – large zoophages,
Zm – małe zoofagi – small zoophages, Hz – hemizoofagi – hemizoophages
III – higropreferencje – hogropreferences: Wilg – wilgociolubny – hygrophilous, Mh – mezohigrofilny – mesophilous, S – sucholubny – xerophilous;
IV – fenologia – phenology: W – wiosenny – spring, J – jesienny – autumn;
V – charakterystyka zoogeograficzna – zoogeographical characteristic:
Pal – palearktyczny – palearctic, Ear – euroartktyczny – Euro-Arctic, Esyb –
euro syberyjski – Euro-Siberian, GEPL – górska europejska prowincja leśna
– European Forest Province Montane.
413
Karolina Konieczna, Tomasz Olbrycht
Tab. 3. Podział Carabidae odłowionych w dwóch sezonach wegetacyjnych na
terenie parku Zalesie według klas dominacji.
Park Zalesie
D
Olbrycht [2011]
2011
Gatunek / Species
D [%]
Limidromus
assimilis
Pterostichus
melanarius
Asaphidion flavipes
41,1
D4
Nebria brevicollis
Pterostichus niger
5,4
5,2
Harpalus rufipes
Abax parallelus
5,3
5,2
D3
Abax parallelus
4,4
Carabus violaceus
Carabus granulatus
Pterostichus
ovoideus
3,1
2,8
2,1
D5
D2
D1
Notiophilus
biguttatus
Pterostichus
oblongopuctatus
16 gatunków
19,5
14,2
1,1
1,1
7,9
Gatunek / Species
2012
Limidromus
assimilis
Pterostichus
melanarius
Nebria brevicollis
Pterostichus niger
Abax
parallelepipedus
Carabus ulrichii
Harpalus sp.
10 gatunków
D [%] Gatunek / Species
24,5
21,3
14,4
13,6
1,3
1,1
1,1
5,3
Pterostichus
melanarius
Pterostichus niger
Limodromus
assimilis
Nebria brevicollis
nie wystąpiły
Harpalus rufipes
Abax parallelus
Carabus
granulatus
Carabus ulrichii
Harpalus sp.
Pterostichus
oblongopunctatus
Pterostichus
ovoideus
Calathus fuscipes
15 gatunków
D [%]
23,9
21,6
19,3
11,5
-
4,6
4,6
1,5
1,5
1,5
1,5
1,5
1,5
7,2
Różnice składu gatunkowego, których odzwierciedleniem są
zmiany w poszczególnych klasach dominacji, mogą być spowodowane również przez inne czynniki. Poza zdolnościami adaptacyjnymi poszczególnych gatunków do warunków środowiska, należy
uwzględnić także takie elementy jak: czynniki abiotyczne (różnice
temperatur efektywnych i poziom opadów w poszczególnych sezonach), czynniki biotyczne (dostępność bazy pokarmowej i możliwości migracyjne biegaczowatych), a także lokalizację miejsca badań.
Przeprowadzenie badań na różnych stanowiskach zlokalizowanych
na terenie tego samego parku, pozwala na wykazanie różnic w struk414
Park podmiejski jako siedlisko występowania drapieżnych biegaczowatych
turze jakościowej odłowionych chrząszczy Potwierdza to tendencje
owadów do wykazywania silnych preferencji siedliskowych. W sezonie wegetacyjnym 2011–2012 pułapki zostały wkopane w ściółce starodrzewu otoczonej koszonymi trawnikami, natomiast obserwacje
z lat wcześniejszych [Olbrycht 2011] były prowadzone w miejscach
o znikomej antropopresji.
LITERATURA
Aleksandrowicz O. 2008. Biegaczowate (Coleoptera: Carabidae) grądu lasu
miejskiego w Olsztynie. Słupskie Prace Biologiczne 5: 5–14.
Aleksandrowicz O., Krzętowski B. 2004. Zgrupowania epigeicznych chrząszczy
(Insecta: Coleoptera) na skarpie Łyny w Olsztynie, [w:] Fauna Miast Europy Środkowej 21. wieku. Indykiewicz P., Barczak T. (red.). Wyd. LOGO,
Bydgoszcz: 213–224.
Burakowski B., Mroczkowski M., Stefańska J. 1973. Chrząszcze Coleoptera, Biegaczowate – Carabidae. Katalog Fauny Polski. PWN, Warszawa,
XXIII, 2, 233 ss.
Burakowski B., Mroczkowski M., Stefańska J. 1974. Chrząszcze Coleoptera, Biegaczowate – Carabidae. Katalog Fauny Polski. PWN, Warszawa,
XXIII, 3, 430 ss.
Czechowski W. 1982: Wpływ urbanizacji środowiska na dynamikę sezonową
biegaczowatych (Carabidae, Coleoptera). Przegl. zool., 26 (1): 69–74.
Czechowski W. 1982a. Occurence of carabids Coleoptera, Carabidae in the
Urban greenery of Warsaw according to the land utilization and cultivation.
Memorabilia Zoologica, Polish Academy of science, Institute of Zoology, 39: 108 ss.
Czerniakowski Z. W. 2005. Wyspy i korytarze ekologiczne na terenie Rzeszowa.
Zeszyty Naukowe Południowo-Wschodniego Oddziału Polskiego Towarzystwa Inżynierii Ekologicznej z siedzibą w Rzeszowie i Polskiego
Towarzystwa Gleboznawczego Oddział w Rzeszowie 6: 21–25.
Czerniakowski Z. W., Olbrycht T. 2004. Różnorodność gatunkowa biegaczowatych (Col., Carabidae) w wybranych biotopach południowo-wschodniej
Polski. Progress in Plant Protection/Postępy w Ochronie Roślin 44(1):
22–27.
Czerniakowski Z. W., Olbrycht T. 2009. Ground beetles (Coleoptera, Carabidae) in the short-rotation biomass plantations. Zeszyty Naukowe Południowo-Wschodniego Oddziału Polskiego Towarzystwa Inżynierii
Ekologicznej z siedzibą w Rzeszowie i Polskiego Towarzystwa Gleboznawczego Oddział w Rzeszowie 11: 39–42.
415
Karolina Konieczna, Tomasz Olbrycht
Hùrka K. 1996. Carabidae of the Czech and Slovak Republics. Kabourek, Zlin,
565 pp.
Jałoszyński P., Konwerski Sz. 2001. Znaczenie parków śródmiejskich
w zachowaniu różnorodności gatunkowej chrząszczy (Coleoptera) na przykładzie parku „Cytadela” w Poznaniu, [w:] Indykiewicz P., Barczak T.,
Kaczorowski G. (red.). Bioróżnorodność i ekologia populacji zwierzęcych
w środowiskach zurbanizowanych. Wyd. NICE. Bydgoszcz. s. 46–51.
Kasprzak K., Niedbała W. 1981. Wskaźniki biocenotyczne stosowane przy
porządkowaniu i analizie danych w badanych ilościowych. s. 397–409,
w: Metody Stosowane w Zoologii Gleby, Górny M., Grüm L. (red.).
PWN, Warszawa, 483 ss.
Kosewska A., Nietupski M., Damszel M., Ciepielewska D. 2011. Park miejski i cmentarze jako siedliska występowania naziemnych biegaczowatych
(Col., Carabidae). Zeszyty Problemowe Postepów Nauk Rolniczych 562:
95–105.
Leśniak A. 1984. Biegaczowate (Carabidae, Col.) lasów Karkonoskiego Parku
Narodowego. Prace Karkonoskiego Towarzystwa Naukowego, 41: 37–70.
Leśniak A. 1987. Zoogeographical analysis of the Carabidae (Coleoptera) of Poland. Fragm.
Marcinkowski M. 2003. To wszystko działo się w Zalesiu. Część I. Moje rodzinne Zalesie. Rzeszów, 276 ss.
Olbrycht T. 2005. Występowanie chrząszczy z rodzaju Carabus (Col. Carabidae) na terenie Podkarpacia. Zeszyty Naukowe Południowo-Wschodniego Oddziału Polskiego Towarzystwa Inżynierii Ekologicznej z siedzibą
w Rzeszowie i Polskiego Towarzystwa Gleboznawczego Oddział w Rzeszowie 6: 71–76.
Olbrycht T. 2009. Ground beetles (Coleoptera, Carabidae) on fallow stands
near Rzeszów. Zeszyty Naukowe Południowo-Wschodniego Oddziału
Polskiego Towarzystwa Inżynierii Ekologicznej z siedzibą w Rzeszowie
i Polskiego Towarzystwa Gleboznawczego Oddział w Rzeszowie 11:
199–204.
Olbrycht T. 2011. Chrząszcze biegaczowate (Coleoptera, Carbidae) w wybranych parkach Rzeszowa. Zeszyty Problemowe Postepów Nauk Rolniczych 568: 81–90.
Piórecki J. 1996. Zabytkowe ogrody i parki województwa rzeszowskiego. Zakład Fizjografii i Arboretum w Bolestraszycach. Bolestraszyce, 219 ss.
Rychling A., Solon J. 2002. Ekologia krajobrazu. PWN Warszawa.
Stachowiak M. 2008a. Biegaczowate (Coleoptera, Carabidae) zespołu pałacowo-parkowego w Lubostroniu, [w:] Przyroda parku pałacowego w Lubo-
416
Park podmiejski jako siedlisko występowania drapieżnych biegaczowatych
stroniu. Banaszak J., Ratyńska H. (red.). Oficyna Wydawnicza Branta,
Bydgoszcz–Poznań: 123–132.
Stachowiak M. 2008. Przegląd systematyczny biegaczowatych Polski (Coleoptera, Carabidae) – wersja skrócona. http://www.entomo.pl/coleoptera/
carabidae/index.php, dostęp: 08.02.2013.
Szujecki A. 1980. Ekologia Owadów Leśnych. PWN, Warszawa, 603 ss.
Szyszko J. 2002. Carabids as an efficient indicator of the quality and functioning
of forest ecosystems useful in forestry management. How to protect or what
we know about Carabid Beetles. Warsaw Agricultural University Press:
301–318.
Trojan P. 1980. Ekologia Ogólna. Wyd. IV. PWN, Warszawa, 419 ss.
Trojan P., Winiarska G. 2001. Miasto jako archipelag wysp śródlądowych. [W:]
Indykiewicz P., Barczak T., Kaczorowski G. (red.). Bioróżnorodność
i ekologia populacji zwierzęcych w środowiskach zurbanizowanych.
Wyd. NICE. Bydgoszcz. s. 10–16.
Żelazna E., Błażejewicz-Zawadzińska M. 2001. Zgrupowania biegaczowatych
wybranych terenów zielonych Bydgoszczy, w: Bioróżnorodność i ekologia
populacji zwierzęcych w środowiskach zurbanizowanych. Indykiewicz P.,
Barczak T., Kaczorowski G. (red.). NICE, Bydgoszcz: 57–61.
Żelazna E., Błażejewicz-Zawadzińska M. 2003. Ground beetles (Coleoptera:
Carabidae) of the Bydgoszcz green belts and suburban wood complexes. Baltic J. Coleopterol., 3 (2): 121–127.
Żelazna E., Błażejewicz-Zawadzińska M. 2006. Zróżnicowanie gatunkowe biegaczowatych (Coleoptera: Carabidae) terenów parkowych Bydgoszczy oraz
wybranych kompleksów leśnych i zadrzewień śródpolnych obszaru kujawsko-pomorskiego. Wiad. entomol. 25, supl. 1: 129–140.
mgr Karolina Konieczna
dr inż. Tomasz Olbrycht
Katedra Agroekologii i Architektury Krajobrazu
Uniwersytet Rzeszowski
ul. Ćwiklińskiej 2, Rzeszów 35–601
e-mail: [email protected]
Promotor: dr hab. inż. prof. UR Zbigniew W. Czerniakowski
417
Leszek Gersztyn
Mateusz Cuske
Anna Karczewska
Bernard Galka
EPISTEME
18/2013, t. 3
s. 419–427
ISSN 1895-2241
Wpływ zakwaszenia i alkalizacji
na rozpuszczalność cynku
w osadach poflotacyjnych
The influence of acidification and
alkalization on zinc Solubility in mine tailings
Abstrakt. Celem badań było określenie wpływu pH na zmiany rozpuszczalności cynku w osadach poflotacyjnych górnictwa miedzi. Do doświadczenia
użyte zostały osady poflotacyjne pozyskane ze składowisk Żelazny Most
oraz Iwiny III. Materiał różnił się pod względem składu granulometrycznego, pH, zawartości węglanu wapnia oraz zawartości Zn. Do próbek osadów
poflotacyjnych wprowadzono, w obecności CaCl2, różne dawki 1M HCl oraz
1M NaOH. W pozyskanych ekstraktach oznaczono pH oraz zawartość cynku. Zmiany pH wpłynęły na rozpuszczalność cynku w osadach poflotacyjnych. Dodatek HCl wpłynął na wzrost rozpuszczalności cynku, natomiast
dodatek roztworu NaOH powodował spadek rozpuszczalności Zn. Buforujące właściwości osadów poflotacyjnych związane były z ich składem granulometrycznym oraz zawartością CaCO3.
Słowa kluczowe: cynk, pH, rozpuszczalność, osady poflotacyjne
Summary. The aim of the study was to determine the influence of pH on
the changes in solubility of zinc in copper mine tailings. For the purpose of
the experiment, samples of tailings collected from Żelazny Most and Iwiny
III impoundments were used. They varied in texture, pH, total CaCO3 content and Zn concentrations. The samples of tailings were subjected to the
treatment with various doses of HCl and NaOH,. in the presence of 0.01 M
CaCl2. In the extracts obtained from the experiment, pH and zinc concentrations were determinated. Changes in pH affected the solubility of zinc in the
copper mine tailings. The addition of HCl resulted in increased zinc solubility, while the addition of NaOH solutions caused reduction of zinc solubility.
Buffering capacity of tailings depended on their texture and CaCO3 content.
Key words: zinc, pH, solubility, mine tailings
419
Leszek Gersztyn, Mateusz Cuske, Anna Karczewska, Bernard Galka
Wstęp
Składowiska osadów poflotacyjnych górnictwa miedzi wywierają
olbrzymi wpływ na otaczające je środowisko naturalne. Szczególnie
niebezpiecznym czynnikiem jest erozja wietrzna, w wyniku której do
środowiska, wraz z wywiewanym materiałem, przedostają się metale
ciężkie [Kabała i in. 2008]. Aby zminimalizować proces erozji wietrznej składowiska powinny być poddane natychmiastowej rekultywacji
zaraz po zakończeniu eksploatacji [Siuta 2005].
Proces rekultywacji może doprowadzić do nieoczekiwanych zmian
w nowo tworzonym siedlisku, na powierzchni osadnika. Osady poflotacyjne deponowane na składowiskach osadów poflotacyjnych są
ubogie w składniki pokarmowe [Spiak, Gediga 2009], a metale ciężkie
znajdujące sie w materiale nie są mobilne [Bogda i in. 2003, Kijewski
1995]. Wprowadzanie substancji organicznej, roślinności czy nawożenie może jednak spowodować zmiany we właściwościach fizycznych
i chemicznych osadów poflotacyjnych, powodując przez to zmiany rozpuszczalności obecnych w nich metali ciężkich [Karczewska i in. 2011].
Celem pracy jest określenie wpływu procesu zakwaszenia bądź
alkalizacji na zmiany rozpuszczalności cynku w osadach poflotacyjnych górnictwa miedzi.
Metodyka
W doświadczeniu użyto dwóch osadów poflotacyjnych pozyskanych
ze składowisk Żelazny Most (ZM) oraz Iwiny III (Iw). Przed rozpoczęciem doświadczenia określono podstawowe właściwości osadów
poflotacyjnych: skład granulometryczny, zawartość węglanów oraz
całkowitą zawartość Zn. Zastosowano standardowe metody wykorzystywane w gleboznawstwie [Ostrowska i in. 1999]. Podstawowe
właściwości osadów poflotacyjnych przedstawiono w tabeli 1.
Przeprowadzono testy ekstrakcji polegające na wprowadzeniu do
5 g osadu poflotacyjnego, w obecności roztworu 0,01M CaCl2, sześciu
dawek 1M NaOH (0,1cm3, 0,2 cm3, 0,5 cm3, 1 cm3, 2 cm3, 5 cm3) oraz,
ze względu na wysokie zawartości CaCO3, 8 dawek 1M HCl (dawki jak
dla NaOH oraz dodatkowo 10 cm3 i 25 cm3). Każdy wariant doświadczenia został przygotowany w trzech powtórzeniach.
420
Wpływ zakwaszenia i alkalizacji na rozpuszczalność cynku w osadach poflotacyjnych
Osad poflo- Grupa granu- Udział frakcji iłu
tacyjny
lometryczna (<0,002 mm) [%]
CaCO3 Zawartość cyn[%]
ku [mg ▪ kg-1]
ZM
Piasek luźny
2
9,5
68
Iw
Pył gliniasty
9
46
50
Tab. 1. Podstawowe właściwości osadów poflotacyjnych.
W uzyskanych po przesączeniu ekstraktach, oznaczono pH, natomiast stężenia cynku oznaczono metodą płomieniowej atomowej
spektroskopii absorpcyjnej, na aparacie Varian SpectrAA 400 plus.
Jako próby zerowe, porównawcze, zastosowano roztwory samych odczynników, bez osadów poflotacyjnych. Uzyskane wyniki zostały poddane weryfikacji statystycznej przy użyciu testu Duncana.
Wyniki i dyskusja
Wpływ dodatków HCl i NaOH na zmianę pH osadów poflotacyjnych. Analizy pH wykazały różnice pomiędzy osadami poflotacyjnymi
a próbą zerową (rys. 1). Dodatek 1M NaOH do osadów poflotacyjnych
oraz do próby kontrolnej wykazał niskie zdolności buforujące osadów
ZM oraz Iw, natomiast wprowadzanie różnych dawek 1M HCl wykazało duże zdolności buforujace osadów poflotacyjnych. Zdolności te
wynikały z wysokiej zawartości CaCO3 (tab. 1), który działał neutralizująco wobec wprowadzonego kwasu. Po całkowitym rozkładzie węglanów (który nastąpił po zastosowaniu około 5 cm3 1M HCl w przypadku
osadów ZM oraz 25 cm3 dla osadów Iw) wartości pH ekstraktów były
zbliżone do uzyskanych dla próby kontrolnej.
Rys. 1. Wpływ dodatku 1M HCl i 1M NaOH na wartość pH próby kontrolnej (z wodą destylowaną) oraz ekstraktów osadów poflotacyjnych.
421
Leszek Gersztyn, Mateusz Cuske, Anna Karczewska, Bernard Galka
Wpływ zmiany pH na rozpuszczalność cynku. Aplikacja różnych
dawek 1M HCl i 1M NaOH spowodowała zmiany rozpuszczalności
cynku w osadach poflotacyjnych. Wzrastające dawki kwasu solnego,
wpływając na spadek pH, powodowały wzrost rozpuszczalności cynku w osadach poflotacyjnych. Najwyższą rozpuszczalność Zn w osadach ZM odnotowano po aplikacji 5, 10 i 25 cm3 HCl. Było to związane z radykalnym spadkiem wartości pH ekstraktów, do wartości
z zakresu pH <0,1–0,5, oraz wcześniejszym całkowitym rozkładem
nie tylko węglanu wapnia, ale także związków żelaza i manganu zawierających okludowany i chemicznie związany cynk. W ekstraktach
pozyskanych z dodatkiem 1M NaOH, stężenia cynku były istotnie
niższe niż w ekstraktach z próbki „zerowej”, to jest z osadów o niezmienionym odczynie (rys. 2).
Rys. 2. Wpływ zmian pH na rozpuszczalnośc cynku w osadzie
poflotacyjnym Żelazny Most.
422
Wpływ zakwaszenia i alkalizacji na rozpuszczalność cynku w osadach poflotacyjnych
Dla osadów poflotacyjnych Iw odnotowano podobne zależności
jak te opisane wyżej dla osadów ZM (rys. 3). Dodatek kwasu solnego
skutkował na istotnymi zmianami w rozpuszczalności cynku względem próbki kontrolnej. Również w przypadku tego osadu po całkowitym rozłożeniu węglanu wapnia (aplikacja 25 cm3 HCl) nastąpił
gwałtowny wzrost stężenia Zn w ekstraktach w następstwie rozkładu CaCO3 oraz roztworzenia związków żelaza i manganu. Zmiany pH
w zakresie odczynu alkalicznego nie wpływały na istotne zmiany rozpuszczalności cynku. Należy to głównie wiązać z nieobecnością substancji organicznej w osadach poflotacyjnych. Roztwarzanie związków próchnicznych w warunkach bardzo wysokiego pH mogłoby
prowadzić do wzrostu rozpuszczalności Zn.
Rys. 3. Wpływ zmian pH na rozpuszczalność cynku w osadzie
poflotacyjnym Iwiny III.
423
Leszek Gersztyn, Mateusz Cuske, Anna Karczewska, Bernard Galka
Wprowadzenie dużych ilości 1M HCl do osadów poflotacyjnych
prowadziło do radykalnego wzrostu rozpuszczalności cynku i jego
uwalniania z fazy stałej do ekstraktu (rys. 4). Maksymalne ilości Zn
uwolnionego w ten sposób sięgały około 37% całkowitej zawartości Zn – w przypadku osadu ZM oraz 42% całkowitej zawartości Zn
w przypadku osadu Iw (rys. 4).
Rys. 4. Udział cynku uwolnionego z osadów poflotacyjnch ZM i Iw w stosunku do całkowiej zawartości Zn zależnie od wprowadzonej dawki zasady
(w dół od zera) oraz kwasu (w górę od zera).
424
Wpływ zakwaszenia i alkalizacji na rozpuszczalność cynku w osadach poflotacyjnych
Wpływ zmian pH na rozpuszczalność cynku w aspekcie procesów rekultywacji. Całkowita zawartość cynku w badanych osadach
poflotacyjnych nie przekracza tła geochemicznego podanego przez
Kabatę-Pendias i Pendiasa [1999], jednak zawartości cynku w osadach ZM kształtuje się powyżej średniej dla gleb piaszczystych (średnia 30 mg ▪ kg-1), natomiast osady Iw zawierają ilości Zn zbliżone do
średniej wyznaczonej dla gleb pylastych (średnia 50 mg ▪ kg-1) [Kabata-Pendias, Pendias 1999]. Na podstawie tych właściwości przyporządkowano osady do utworów zasobnych (ZM), bądź średnio zasobnych
(Iw) w cynk, jednakże stężenia mobilnych form cynku (rozpuszczalnych w H2O) kształtują sie na poziomie 0,2–0,5 mg ▪ kg-1, co powoduje iż cynk jest praktycznie niedostępny dla roślin i mikroorganizmów.
W procesie rekultywacji osadów poflotacyjnych, jak i innych
utworów bezglebowych, zalecane jest wprowadzenie substancji organicznej [Siuta 2005]. Zabiegi takie wymagają ostrożności, gdyż
niskocząsteczkowa substancja organiczna może spowodować wzrost
rozpuszczalności metali ciężkich znajdujących się w osadach[Karczewska i in 2012]. Kolejne zagrożenia związane z rekultywacją składowisk osadów poflotacyjnych mogą wynikać z zastosowania nawożenia mineralnego, gdyż wprowadzenie do rekultywowanego materiału
kwaśnych fizjologicznie nawozów mineralnych (jak siarczan amonu)
może również prowadzić do powolnego spadku pH i uwalniania metali [Fotyma, Igras 2006]. Jednak ze względu na bardzo niskie stężenia
mobilnych form cynku w osadach poflotacyjnych, oraz silne właściwości buforujące samych osadów, o dostępności tego ważnego mikroelementu, jakim jest cynk, dla roślinności nie będą decydowały zmiany
odczynu, a właśnie wprowadzane nawozy mineralne czy organiczne.
Wnioski
Osady poflotacyjne górnictwa miedzi charakteryzują się silnymi właściwościami buforowymi wobec kwasów, determinowanymi głównie
przez wysoką zawartość CaCO3, a w mniejszym stopniu – przez zawartość frakcji ilastej w składzie granulometrycznym
Wzrost dawek HCl powodował istotny wzrost rozpuszczalności
cynku, zwłaszcza w następstwie rozkładu węglanu wapnia, natomiast
425
Leszek Gersztyn, Mateusz Cuske, Anna Karczewska, Bernard Galka
dodatek NaOH w przypadku osadów Iw nie powodował istotnych
zmian rozpuszczalności Zn, a w przypadku osadów ZM powodował
niewielki, ale statystycznie istotny spadek rozpuszczalności cynku.
Duże zdolności buforujące osadów poflotacyjnych powodują znikome zagrożenie związane z możliwym uwalnianiem cynku do roztworu glebowego w wyniku zakwaszania. W procesach rekultywacji
o dostępności cynku dla roślin decydować mogą dodatkowe efekty
wynikające z zastosowania nawożenia, zwłaszcza organicznego.
Literatura
Bogda A., Szopka K., Karczewska A. 2003. Zawartość i rozpuszczalność wybranych metali ciężkich w osadach poflotacyjnych górnictwa miedzi. [W:]
Gworek B., Misiak J. (red.): Obieg pierwiastków w przyrodzie: bioakumulacja, toksyczność, przeciwdziałanie. T. II. Wydawn. IOŚ, Warszawa:
238–241.
Fotyma M., Igras J. 2006. Narodowy program wapnowania gleb w Polsce na
lata 2007–2013. Wybrane aspekty agrochemicznych badań gleb. IUNG PIB
Puławy. 1: 45–48.
Kabała C., Medyńska A., Chodak T., Jezierski P., Gałka B. 2008. Zmiany zawartości miedzi i arsenu w glebach wokół składowiska odpadów po flotacji
rud miedzi w 12-letnim cyklu badań monitoringowych. Roczn. Gleb. 58
(3–4): 81–88.
Kabata-Pendias A., Pendias H. 1999. Biogeochemia pierwiastków śladowych.
Wydawn. Nauk. PWN, Warszawa.
Karczewska A., Gersztyn L., Galka B. 2011. Wpływ różnie ustabilizowanych
osadów ściekowych na rozpuszczalność Cu, Pb i As w osadach poflotacyjnych przemysłu miedziowego i arsenowego. Zesz. Probl. Post. Nauk Rol.
564, 103–114.
Kijewski P. 1995. Występowanie metali ciężkich na obszarze Środkowego Nadodrza w strefie oddziaływania przemysłu miedziowego. Fizykochem.
Probl. Mineral. 29: 47–54.
Ostrowska A., Gawliński Z., Szczubiałka Z. 1991. Metody analizy i oceny właściwości gleb i roślin. IOŚ. Warszawa.
Siuta J. 2005. Rekultywacyjna efektywność osadów ściekowych na składowiskach odpadów przemysłowych Acta Agrophys, 5(2): 417–425.
Spiak Z., Gediga K. 2009. Usefulness of selected mineral wastes for reclamation
of copper industry dumping site. Environ. Prot. Eng. 35 (1): 79–88.
426
Wpływ zakwaszenia i alkalizacji na rozpuszczalność cynku w osadach poflotacyjnych
Leszek Gersztyn, Mateusz Cuske
Anna Karczewska, Bernard Galka
Instytut Nauk o Glebie i Ochrony Środowiska
Uniwersytet Przyrodniczy we Wrocławiu
427
János Ádám1, István Tóbiás2
Asztéria Almási2, Zdeno Šubr3
Alžbeta Nagyová3, Miroslav Glasa3
László Palkovics1
EPISTEME
18/2013, t. 3
s. 429–436
ISSN 1895-2241
Obecność choroby Sharka na drzewach pestkowych w węgiersko – słowackim regionie
przygranicznym
The presence of Sharka disease on stone fruit TREES in the Hungarian-Slovak cross-border region
Abstrakt. Badanie choroby Sharka, spowodowane przez wirusa ospy Plum
(PPV) przeprowadzono w słowacko-węgierskim regionie przygranicznym
w latach 2010–2012. Głównym celem badania było skartografowanie tego
regionu oraz określenie dominujących tam szczepów PPV. Do identyfikacji
szczepów zostało użyto trzy sposoby: inokulacja roślin wskaźnikowych,
RT-PCR w dwóch regionów genomowych i analizę RFLP przy użyciu EcoRI
i Ddel enzymów restrykcyjnych EcoRV w regionie genomowym 3’P3-6K15’CIP. Wyniki wskazują, że PPV jest obecny we wszystkich badanych roślinach. Dominujące szczepy PPV-alarmu i PPV-D w tym regionie, ale PPV-M
także zidentyfikowane. Na sporządzonej mapie dominujące szczepy były
oznaczone w każdym regionie.
Słowa kluczowe: szarkę, szczep, badania, transgraniczne, PPV- M , PPV- D, PPV -REC
Summary. A survey of sharka disease, caused by Plum pox virus (PPV) was
conducted in the Slovak-Hungarian border region during 2010–2012. The
main objective of the survey was to map this region and to identify the dominant PPV strains. Leaf samples were taken from different places of the
region from stone fruit trees, showing the symptoms of PPV. To identify the
strains three methods were used: inoculation of indicator plants, RT-PCR
in two genomic regions and RFLP analysis using EcoRI, DdeI and EcoRV restriction enzymes in the 3’P3-6K1-5’CIP genomic region. The results indicated that PPV is present in all examined plants, the apricot orchards were
less infected than plum orchards. The dominant strains are the PPV-Rec and
PPV-D in this region, but PPV-M was also identified. After the survey maps
were prepared, the dominant isolates were marked in each region. From the
results a booklet was also published especially for producers including all
important knowledge about the virus and the disease prevention.
Key words: Plum pox virus, strain, survey, cross-border, PPV-M, PPV-D, PPV-Rec
429
János Ádám, István Tóbiás, Asztéria Almási, Zdeno Šubr, Alžbeta Nagyová
Introduction
A survey of sharka disease, caused by Plum pox virus (PPV), was conducted in the Slovak-Hungarian cross-border region during 2010–2012.
The aim of the survey was to study the cross-border region, identify
the strains and help the orchard owners and authorities with this study. Plum pox virus is a member of the Potyviridae family, transmitted by
aphids in a non-persistent manner and it is the most devastating viral
causative agent on stone fruit trees. The first symptoms were observed
in 1917–18 on plums in Bulgaria, and the first report was taken in 1932
by Atanasoff. Since then the virus has spread on all continent except
Australia. In our days there are seven identified PPV strains (D, M, Rec,
EA, C, W and T) however, 2 additional strains were observed very recently. First one is the PPV-CR (Cherry Russian) containing unusual
isolates naturally infecting sour cherry in Russia [Glasa et al.,2012],
and the other is represented by the ancestral, non-recombined PPV-M
isolate found in Albania (PPV-M-An) [Palmisano et al.,2012]. PPV-D
(Dideron), PPV-M (Marcus) [Kerlan and Dunez 1979] and PPV-Rec
(Recombinant) [Glasa et al.,2004] are the most current types in the
world [Candresse and Cambra 2006; Serçe et al., 2009].
Before using molecular methods, according to manifestation of
the symptoms on indicator plants three types were differentiated,
which were the yellow (Y), the necrotic (N) and the intermediate group (Y/N) [Šutić et al.,1971].
Materials and methods
During the survey more than 200 leaf samples were collected from
stone fruit trees, from different places in the Slovak-Hungarian cross-border region, which were show the symptoms of PPV. The surveyed
species were peaches, apricots and plums at large scale and small scale farming, and blackthorn at natural surroundings. Biotest method
with indicator plants, RT-PCR followed by RFLP, RT-PCR with strain
specific primers and RT-PCR with Potyvirus specific primers followed
by sequence analysis were used to identify the strains.
Obtained samples were subjected to biological assays with indicator plants. The test plants were Chenopodium foetidum, Nicotiana
benthamiana and N. clevelandii.
430
The presence of Sharka disease on stone fruit trees...
To identify the strains more than one genomic region were studied
(fig. 1). At the 3’ P3–6K1–5’CIP genomic region the molecular method
was conventional reverse transcription polymerase chain reaction (RT-PCR) after total RNA extraction with Spectrum Plant Total RNA Kit
(Sigma-Aldrich) according the manufacturer’s instruction. For the RT-PCR the reverse primer was the PCI (tab. 1). At the PCR reaction we
used PP3-PCI primer pair (tab.1) which amplified the 3’P3–6K1–5’CIP
genomic region. For the PCR amplifications we mixed 50 µl reaction
volumes containing 3 µl cDNA, 5 µl 10x Taq buffer, 3 µl 25 mM MgCl2,
2 µl 5 mM dNTPs mix, 20 pM of each primer and 2,5 unit Taq DNA
polymerase. The thermal cycle in this case consisted of initial denaturation of 94°C for 5 minutes followed by 40 cycles of denaturation at
94°C for 60 s, primer hybridization at 50°C for 60 s and elongation at
72°C for 60 s. The final elongation step at 72°C for 10 minutes completed the program [Glasa et al., 2002]. Restriction Fragment Length Polymorphism [Wetzel et al.,1991] analysis (RFLP) was performed with
the amplified PRC products (3’P3–6K1–5’CIP) and with EcoRI, EcoRV
restriction enzymes. This method based on work of Glasa et al. (2002)
extended the EcoRV restriction enzyme.
Fig. 1. The genome of PPV and the studied genomic regions with the used
primers.
At the NIb-CP genomic region strain specific primers were used
(tab. 1, fig. 1). The recombinant breakpoint situated in the 3-terminal
part of the viral replicase (NIb) gene. RT-PCR was carried out with
2.5 U of Taq DNA polymerase in a reaction buffer containing 2 mmol/l MgCl2, 10 mmol/l dNTPs and 100 nmoles of each primer (mM5,
mM3, mD5 and mD3). The thermal cycle consisted of initial denaturation at 94°C for 3 minutes, 35 cycles of 94°C for 45 s (denaturation), 60°C for 30 s (annealing), and 72°C for 60 s (elongation) and
final extension at 72°C for 7 minutes [Šubr et al.,2004].
431
János Ádám, István Tóbiás, Asztéria Almási, Zdeno Šubr, Alžbeta Nagyová
Primer
Sequence (5’–3’)
Orientation
References
PP3
TTATCTCCACCAGGA(AG)TTGGAGC
sense
(for)
Glasa et al.
2002
PCI
TTGAGTCAAATGG(AG)ACAGTTGG
antisense
(rev)
Glasa et al.
2002
mM5
GCTACAAAGAACTGCTGAGAG
sense
(for)
Šubr et al.
2004
mM3
CATTTCCATAAACTCCAAAAGAC
antisense
(rev)
Šubr et al.
2004
mD5
TATGTCACATAAAGGCGTTCTC
sense
(for)
Šubr et al.
2004
mD3
GACGTCCCTGTCTCTGTTTG
antisense
(rev)
Šubr et al.
2004
Poty7941
GGAATTCCCGCGG(AGCT)AA
(CT)AA(CT)AG(CT)GG(AGCT)CA(AG)CC
sense
(for)
Salamon and
Palkovics 2005
PolyT2
CGGGGATCCTCGAGAAGCTTTTTTTTTTTTTTTTT
antisense Salamon and
(rev)
Palkovics 2005
Tab. 1. This table contains the names of the used primers, the sequences of
the oligonucleotides in the orientation 5’–3’, and the references.
Another method was applied to identify the strains with RT-PCR
with universal Potyvirus specific primers in the 3’NIb-CP-3’UTR region
(fig. 1) followed by sequence analysis. The primers were the Poty7941
(forward) and PolyT2 (reverse) (tab. 1) [Salamon and Palkovics 2005].
After RT-PCR sequence analysis was performed. The PCR thermal cycle: 94°C for 3 minutes (initial denaturation), 40 cycles of 94°C for 15 s
(denaturation), 50°C for 30 s (annealing), 72°C for 3 minutes (elongation) and final extension at 72°C for 10 minutes. To identify the strains
well studied isolates were used for comparison from NCBI.
The results indicated that PPV is present in the border region
on the examined stone fruits. The apricot and peach orchards in the
region are less infected than the plum orchards, and approximately
half of the studied blackthorn samples were positive to the virus according to molecular testing.
432
The presence of Sharka disease on stone fruit trees...
Results and discussion
All tested PPV isolates belonged to the intermediate group [Šutić et
al., 1971] according to the symptoms on the indicator plants. Based
on our results, we established that in the northern counties of Hungary the two most current strains of the PPV, the PPV-D and the PPV-Rec are in the majority, and some representative of the PPV-M was
found as well. The PPV-D strain is dominant at the eastern region
and the recombinant isolates are current in the central areas (fig. 2).
Fig. 2. The identified strains in northern Hungary. PPV-Rec (black),
D (white) and M (grey).
In the southern region of Slovakia there are three different parts.
In the West PPV-M strain is the dominant but recombinant isolates
were observed as well. The PPV-Rec type is current in the northern
region of the country. In the eastern and the central region of the
country the PPV-D strain is the dominant (fig. 3).
We could say that in the studied regions the PPV-M strain is not
as far common as we thought it years ago. In Hungary the PPV-Rec
strain is more dominant than the PPV-D on fields, but at the same
time the PPV-D is in the majority in Slovakia. During the laboratory
433
János Ádám, István Tóbiás, Asztéria Almási, Zdeno Šubr, Alžbeta Nagyová
study and sequence analysis of recombinant isolates we found a strain-specific feature, which makes it possible to differ from the other
PPV strains easily with RFLP.
Fig. 3. The identified strains in Slovakia. PPV-M (square), PPV-D (triangle)
and PPV-Rec (round).
Conclusion
A survey of sharka disease was conducted in the Slovak-Hungarian
border region during 2010–2012. The main objective of the survey
was to map this region, and to identify the PPV strains on woody
host plants. Three Plum pox virus strains were observed in the examined region, the PPV-M the PPV-D and the PPV-Rec. In Hungary
the PPV-Rec type is the dominant, in Slovakia the PPV-D isolates are
in the majority. In both countries the PPV-M strain is in evidence
as well. In the future PPV-C, PPV-CR and PPV-W strains have the
highest potential risk to get into the region based on geographical
location, but further study is necessary. The definition of the strains
is significant, because the isolates from different strains infected the
host plants, and spread in the orchards in different measures [Šutić
et al.,1976]. Strain-level testing would be suggested at the nurseries
and during the process of verifying.
After the survey maps were prepared, the identified isolates were
marked in each region. From the results, a bilingual booklet was also
434
The presence of Sharka disease on stone fruit trees...
published especially for producers including all important knowledge
about the virus and the disease prevention. During this survey various molecular methods of PPV strain identification were used.
Acknowledgements
The project was funded HUSK 0901/1.2.1/0126 (COSHARKA)
and TÁMOP-4.2.2./B-10/1-2010-0023.
References
Atanasoff D. 1932. Sarka po slivite, Edna nova virus a bolest. [Plum pox.
A new virus disease.] Yearbook University of Sofia, Faculty of Agriculture, 11: 49–70.
Candresse T. Cambra M. 2006. Causal agent of sharka disease: historical perspective and current status of Plum pox virus strains. EPPO Bulletin, 36
(2): 239–246.
Glasa M. Marie-Jeanne V. Moury B. Kúdela O. Quiot J.-B. 2002. Molecular
variability of the P3-6K1 genomic region among geographically and biologically distinct isolates of Plum pox virus. Archives of Virology, 147 (3):
563–575.
Glasa M. Palkovics L. Komínek P. Labonne G. Pittnerová S. Kúdela O. Candresse T. Šubr Z. 2004. Geographically and temporally distant natural
recombinant isolates of Plum pox virus (PPV) are genetically very similar
and form a unique PPV subgroup. Journal of General Virology, 85 (9):
2671–2681.
Glasa M. Prichodko Y. Zhivaeva T. Shneider Y. Predajňa L. Šubr Z. Candresse
T. 2012. Complete and partial genome sequences of the unusual Plum pox
virus (PPV) isolates from sour cherry in Russia suggest their classification
to a new PPV strain. 22nd International Conference on Virus and Other
Graft Transmissible Diseases of Fruit Crops Rome, June 3-8, 2012
Book of abstracts 37.
Kerlan C. Dunez J. 1979. Différentiation biologique et sérologique de souches du
virus de la Sharka. [Biological and serological differentiation of strains
of sharka virus.] Annales de Phytopathologie, 11 (2): 241–250.
Palmisano F. Boscia D. Minafra A. Myrta A. Candresse T. 2012. An atypical
Albanian isolate of Plum pox virus could be the progenitor of Marcus strain.
22nd International Conference on Virus and Other Graft Transmissible Diseases of Fruit Crops Rome, June 3-8, 2012 Book of abstracts 33.
435
János Ádám, István Tóbiás, Asztéria Almási, Zdeno Šubr, Alžbeta Nagyová
Salamon P. Palkovics L. 2005. Occurrence of Colombian datura virus (CDV) in
Brugmansia hybrids, Physalis peruviana L. and Solanum muricatum Ait. in
Hungary. Acta Virologica 49 (2): 117–122.
Serçe Ç.U. Candresse T. Svanella-Dumas L. Krizbai L. Gazel M. Kadriye
Çağlayan K. 2009. Further characterization of a new recombinant group of
Plum pox virus isolates, PPV-T, found in orchards in the Ankara province of
Turkey. Virus Research 142: 121–126.
Šubr Z. Pittnerová S. Glasa M. (2004). A simplified RT-PCR-based detection
of recombinant Plum pox virus isolates. Acta Virologica, 48 (3): 173–176.
Šutić D. Babović M. Marković S. (1976). Transmissibility of some sharka virus
strains by Myzus persicae Sulz. depending on various infection sources. Acta
Horticulturae, 67: 171–177.
Šutić D. Jordović M. Ranković M. Festić H. 1971. Comparative studies of
some sharka (plum pox) virus isolates. Annales de Phytopathologie, H.S.:
185–195.
Wetzel T. Candresse T. Ravelonandro M. Dunez J. 1991. A polymerase chain
reaction assay adapted to plum pox potyvirus detection. Journal of Virological Methods, 33 (3): 355–365.
Department of Plant Pathology
Faculty of Horticultural Sciences
Corvinus University of Budapest
János Ádám – [email protected]
László Palkovics, PhD, DSc – [email protected]
1
Plant Protection Institute
Agricultural Research Center
Hungarian Academy of Sciences
István Tóbiás, PhD, DSc – [email protected]
Asztéria Almási, PhD – [email protected]
2
Department of Plant Virology, Institute of Virology
Slovak Academy of Sciences
Zdeno Šubr, CSc – [email protected]
Alžbeta Nagyová – [email protected]
Miroslav Glasa, PhD – [email protected]
3
Scientific supervisor: László Palkovics PhD, DSc
436
Pelagia Biłka
Magda Pluta
Dr inż. Bartosz Mitka
EPISTEME
18/2013, t. 3
s. 437–443
ISSN 1895-2241
WYKORZYSTANIE NOWOCZESNYCH TECHNIK
POMIAROWYCH W MONITOROWANIU DUŻYCH
OBIEKTÓW HYDROTECHNICZNYCH
THE USING OF MODERN MEASUREMENT TECHNIQUES
IN MONITORING LARGE HYDROTECHNICAL OBJECTS
Abstrakt. Dynamicznie rozwijająca się technologia naziemnego skaningu laserowego coraz częściej znajduje zastosowanie w pomiarach strategicznych obiektów inżynierskich. Przedmiotem badań jest analiza zastosowania naziemnego skaningu laserowego do monitorowania budowli
hydrotechnicznych na przykładzie zapory wodnej Solina – Myczkowce. Cel
pracy stanowi analiza geometrii obiektu na podstawie danych pozyskanych
z naziemnego skaningu laserowego. Wielu autorów podejmuje dyskusję czy
duża liczba obserwacji jest w stanie zrekompensować niższą, w odniesieniu do metod tradycyjnych, precyzję pomiaru. Dzięki odpowiednio gęstej
chmurze punktów, postawiony w pracy cel, może być zrealizowany, dając
jednoznaczne wyniki. Artykuł prezentuje możliwości sporządzenia dokumentacji obiektu hydrotechnicznego, uzyskane dokładności oraz napotkane
problemy w trakcie opracowywania danych.
Słowa kluczowe: naziemny skaning laserowy, monitorowanie obiektów, zapora wodna
Summary. Rapidly growing terrestrial laser scanning technology is increasingly used in the measurement of strategic engineering objects. The subject
of research is the analysis of the application of terrestrial laser scanning for
monitoring hydrotechnical edifice on the example of dam Solina – Myczkowce.
Aim of the study is the analysis of the geometry of an object created on the
basis of cross-sections and the digital surface model of the object. Many authors take the discussion of the large number of observations is able to compensate for the lower, in relation to traditional methods, the precision of the
measurement. Thanks to a dense of point cloud put in the work goal can
be achieved by giving clear results. Sections present the results of a study by
a cloud points, which, in relation to the objectives of the project point to the
(non) compliance with the state of the current projected.
Key words: terrestrial laser scanning, engineer object monitoring, water dam
437
Pelagia Biłka, Magda Pluta, Bartosz Mitka
Wstęp
Artykuł prezentuje wyniki badań, które w opinii wielu autorów mogą
być poważnym wyzwaniem naukowym. Hipoteza badawcza brzmi:
czy możliwe jest wykorzystanie techniki naziemnego skaningu laserowego w monitorowaniu dużych obiektów inżynierskich, jakimi są
zapory wodne?
Monitorowanie statycznych zachowań zapór wodnych od zawsze stanowi poważny temat badań, wymagający ciągłości i precyzji
obserwacji, nie bez znaczenia jest bowiem wpływ, jaki budowle tego
typu mają na otaczający je krajobraz. Na przestrzeni dekad w dziedzinie geodezji nowe instrumenty pomiarowe, przynoszą nowe technologie, które pozwalają na permanentne obserwacje mechaniki budowli.
Niwelacje precyzyjne, czy też tachimetria wysokiej precyzji dostarczają
jednak niewielkiej ilości danych numerycznych punktów położonych
na czole zapory. Skaning laserowy jest zdolny pozyskać w krótkim
czasie chmurę punktów, która nie tylko zawiera dane numeryczne
punktów kontrolnych – stale zamarkowanych na płaszczyźnie budowli, lecz także wszystkich dostępnych dla wiązki lasera detali architektonicznych, miejsc bardziej lub mniej narażonych na deformacje,
lub niedostępnych dla tradycyjnych metod pomiarowych.
Współcześnie, naukowcy coraz częściej podejmują tematykę
zastosowania TLS (Terrestrial Laser Scanning) nie tylko do monitorowania zapór wodnych lecz także do określania ich przemieszczeń i odkształceń (Teskey, Bijon, 2005; Guarnieri, 2006). Aprobatę
zastosowanie TLS w geodezji inżynieryjnej prezentują także włoscy
naukowcy w publikacji poświęconej monitorowaniu zapory wodnej
Jeziora Cancano ( Alba i in., 2006). Prócz analizy dokładności i stabilności punktów georeferencyjnych, podejmują problem wykorzystania chmury punktów do komputerowego określania przemieszczeń
i odkształceń. Podobne zagadnienie podejmuje także (Schneider,
2006). W swojej publikacji proponuje określanie deformacji dużych
obiektów inżynierskich z wykorzystaniem TLS. Chmury punktów
z różnych okresów pomiarowych są porównywane do siebie, a także
są porównywane do modelu matematycznego budowli.
Głównym celem badań jest przeprowadzenie dyskusji na temat możliwości monitorowania geometrii elementów konstrukcji
zapory wodnej w Solinie, przy pomocy przekrojów poprzecznych
płaszczyzny spływu, wyznaczonych dwoma metodami.
438
Wykorzystanie nowoczesnych technik pomiarowych w monitorowaniu...
Materiały i metody
We wrześniu 2012 roku Koło Naukowe Geodetów Uniwersytetu
Rolniczego w Krakowie dokonało pomiaru metodą skaningu laserowego Zapory Wodnej Solina – Myczkowce. Zapora wodna w Solinie
jest największą budowlą hydrotechniczną w Polsce, obiektem strategicznym o długości 664 m, wysokości 82 mi objętości betonu 760
000 m3.
W ciągu 2 dni przeprowadzono pomiar skanerem laserowym
Leica ScanStation C10. Gęstość chmury punktów ustalono na poziomie 2 cm. Pomiary wykonano w układzie lokalny bez nawiązania
z 12 stanowisk, wraz z pomiarem tarcz celowniczych jednoznacznie identyfikowalnych na chmurze punktów. Ostatecznie z prac polowych otrzymano materiał badawczy w postaci chmur punktów.
Ryc. 1. Analizowany fragment zapory
Pierwsze prace kameralne wykonane zostały w programie Cyclone
7.3. Po imporcie danych, dokonano połączenia chmur punktów poprzez funkcję wpasowania chmura w chmurę przy wykorzystaniu modułu Rejestracja programu Cyclone 7.3, z dokładnością wpasowania na
poziomie 0,007 m. Następnym etapem prac było czyszczenie chmur
punktów. Po obróbce wstępnej materiału badawczego wyodrębniono
z całego modelu zapory wodnej tylko chmury punktów odnoszące się
do powierzchni spływów, dla których zaplanowano przeprowadzić
analizę geometrii. Po ustaleniu zakresu materiału badawczego,
439
Pelagia Biłka, Magda Pluta, Bartosz Mitka
korzystając z funkcji programu Cyclone 7.3 zdefiniowano lokalny układ
współrzędnych (ryc.1). W oparciu o zdefiniowany układ wyodrębniono fragmenty chmury punktów, będące przekrojami poprzecznymi
w układzie kartezjańskim. Przy pomocy narzędzi program Cyclone
7.3, z modelu spływu wycięto kolejno 9 plastrów chmur punktów
dla przekrojów poprzecznych, o szerokości 10 cm; a ich współrzędne
wyeksportowano do pliku tekstowego.
W celu zbadania geometrii spływu zapory wodnej w Solinie
zaplanowano wyznaczenie przekrojów dwoma metodami: metodą
statystyczną oraz metodą graficzną. Metodę statystyczną wykonano
z wykorzystaniem programu STATISTICA 10. Do nowego arkusza programu zaimportowano współrzędne kartezjańskie (X,Y), z wygenerowanych plików tekstowych, dla dziewięciu plastrów wyodrębnionych
w programie Cyclone 7.3.
Ryc. 2. Parametru przekroju
Dla każdego z nich wykonano wykres rozrzutu kwantyli (wartości
X względem Y) z dopasowaniem NKWW, określeniem współczynnika korelacji, równania regresji, z pasem regresji o poziomie ufności
97%. W przypadku kwantylowych wykresów rozrzutu, wykreślane
440
Wykorzystanie nowoczesnych technik pomiarowych w monitorowaniu...
są kwantyle jednej zmiennej w funkcji kwantyli drugiej zmiennej
w celu oceny symetrii rozkładów empirycznych dwóch zmiennych.
Jeśli punkty danych wypadają na linii regresji, wówczas możemy
wysnuć wniosek, że dane dwie zmienne podlegają temu samemu
rozkładowi. Uzyskane w ten sposób proste regresji dla każdego
z przypadków prezentowały statystyczną realizację geometrii przekroju, w każdym z dziewięciu pól testowych.
Metoda graficzna wyznaczenia przekrojów przeprowadzona
została w programie Microstation V8i firmy Bentley. Dla każdego
z dziewięciu plastrów zaimportowano współrzędne (X,Y) w układzie
kartezjańskim, a na ich podstawie wrysowano linę, która w ocenie
badacza najlepiej realizowała przekrój spływu.
W wyniku analizy otrzymano dla dziewięciu wyselekcjonowanych
plastrów współrzędnych: dziewięć przekrojów poprzecznych spływu
zapory wyznaczonych automatyczną metodą statystyczną; oraz dziewięć przekrojów wyznaczonych graficznie przez badacza. Kolejne
przekroje dwóch metod reprezentowały te same miejsca dziesięciocentymetrowego pasa spływu zapory.
Wyniki i dyskusja
Ryc. 3. Zestawienie przekrojów wyznaczonych metodą statystyczną
Ryc.4. Zestawienie przekrojów wyznaczonych metodą graficzną
441
Pelagia Biłka, Magda Pluta, Bartosz Mitka
Wykresy przedstawiają zbiór przekrojów wyznaczonych metodą
statystyczną (ryc.3) oraz graficzną (ryc.4 ). Poprzez nałożenie na siebie 9 linii przekrojów, dla każdej metody uzyskano odwzorowanie
rzeczywistego kształtu spływu zapory wodnej, jednocześnie możliwe
jest wyznaczenie największych różnić odległości pomiędzy liniami
przekrojowymi. Pomiar odległości pomiędzy przekrojami najbardziej
oddalonymi zarejestrowano dla asymptot pionowych x = {20, -10, 0, 10}.
Rezultaty prezentuje tab. 1:
Tab. 1. Różnice odległości pomiędzy przekrojami najbardziej oddalonymi
Na podstawie tab.1 można zauważyć, iż największa różnica
odległości występuje pomiędzy przekrojem 1 a przekrojem 8, zarówno dla metody graficznej jak i statystycznej. Ponadto na podstawie
uzyskanych wartości zauważano, że większe rozproszenie przekrojów występuje w przypadku zastosowania metody graficznej.
Średnia różnica odległości pomiędzy przekrojami dla metody graficznej wynosi 0,20 m, a dla metody statystycznej 0,14 m. Uzyskane
wartości wskazują na większą unifikację kształtu spływu zapory
w przypadku metody statystycznej.
Wnioski
Monitorowanie kształtu dużych obiektów hydrotechnicznych można, z powodzeniem prowadzić na podstawie przekrojów z chmury
punktów, pozyskanej metodą naziemnego skaningu laserowego. Omówione w artykule metody stanowią dobre rozwiązania dla
tworzenia przekrojów. Metoda statystyczna znajduje zastosowanie
w przypadku wyznaczania przekrojów dla elementów o nieskom442
Wykorzystanie nowoczesnych technik pomiarowych w monitorowaniu...
plikowanej geometrii. Poprzez automatyzacje procesu wpasowania
linii ( krzywej ) w fragment chmury punktów wykluczony zostaje
subiektywizm badacza. W metodzie graficznej indywidualna ocena
badacza stanowi podstawę wyznaczenia linii przekroju, co jest dobrym rozwiązaniem dla elementów konstrukcji budowli o złożonej
geometrii.
Literatura
Alba, M., Giussani, A., Roncoroni, F., Scaioni, M., Valgoi, P., 2006. Geometric
Modelling of a Large Dam by Terrestrial Laser Scanning. In Proc. of FIG
Mondial Congress, Germany.
Guarnieri, A., Pirotti, F., Pontin, M., and A. Vettore, 2006. 3D Surveying for
Structural Analysis Applications. In: Proc. of 3rd IAG/12th FIG Symp.,
Baden, Austria.
Ingensand, H. 2006. Metrological Aspects in Laser-Scanning Technology. In:
Proc. of 3rd IAG/12th FIG Symp., Baden, Austria.
Sieber, 1999. SAR interferometry for structural changes detection:
Amdemonstration test on a dam. In: Proc.of IGARSS.
Teskey, B., Bijoy, P., 2005. New Instrumentation and Methodology for
Deformation Monitoring. In: Proc. of Optical 3D MeasurementTechniques, Vol II, Vienna, Austria.
mgr inż. Pelagia Biłka
Uniwersytet Rolniczy w Krakowie
WIŚiG, Katedra Geodezji
e-mail: [email protected]
mgr inż. Magda Pluta
Uniwersytet Rolniczy w Krakowie
WIŚiG, Katedra Geodezji Rolnej, Katastru i Fotogrametrii
e-mail: [email protected]
443
Mariusz Antolak
Anna Mazur
Marzena Płaza
Katarzyna Ruszczycka
EPISTEME
18/2013, t. 3
s. 445–451
ISSN 1895-2241
WARMIŃSKIE KAPLICZKI OLSZTYNA
WARMIA’S SHRINES OF OLSZTYN
Abstrakt. Kapliczki warmińskie na terenie Olsztyna są niezwykle ważnym elementem dziedzictwa kulturowego całego regionu i na stałe wpisały
się w rodzimy krajobraz. Współczesne zagrożenia bezpośrednio wpływają
na postępującą degradację tych reliktów przeszłości, a to pociąga za sobą
konieczność podejmowania zdecydowanych działań ochronnych. Zasadniczym celem podjętych badań było ukazanie stanu zachowania najbliższego
otoczenia czternastu olsztyńskich kapliczek wpisanych do rejestru zabytków. Jednym z ważniejszych niebezpieczeństw są zmiany przestrzenne zachodzące wskutek dynamicznie, nierzadko chaotycznie rozbudowującej się
tkanki miejskiej. W rezultacie pierwotne zależności przestrzenne kapliczek
z otoczeniem stają się nieczytelne, co sprawia, że ich odbiór wizualny jest
zaburzony. Podjęte badania terenowe i przeprowadzone analizy dostępnych
materiałów źródłowych potwierdziły negatywne tendencje w kształtowaniu
przestrzeni wokół kapliczek.
Słowa kluczowe: dziedzictwo kulturowe Warmii, obiekty kultu religijnego
w Olsztynie, zagrożenia otoczenia zabytków, zmiany układu przestrzennego
Summary. Warmia’s shrines in Olsztyn are an extremely important part
of the cultural heritage of the region and permanently etched into the native landscape. Modern threats directly affect the progressive degradation of
these relics of the past, and this implies the need to take decisive protective
action. The main aim of the study was to show the state of preservation of
the nearest environment of fourteen Olsztyn’s shrines entered in the register of monuments. One of the major dangers are spatial changes that occur
as a result of dynamic, often chaotic urban space expansion. As a result, the
original spatial relationship of the shrines with the surroundings become
unreadable, which makes their visual perception is impaired. The undertaken fieldwork and analysis carried out of the available source material confirmed the negative trends in the area around the shrines.
Key words: Warmia cultural heritage, religious objects in Olsztyn, threats to
the environment of monuments spatial layout changes
445
Mariusz Antolak, Anna Mazur, Marzena Płaza, Katarzyna Ruszczycka
Wstęp
Tereny Warmii to ziemie pogranicza kulturowego, na których od dawien dawna spotykały się różne kultury, wyznania, zwyczaje. Ten
swoisty tygiel kulturowy pozwolił na stworzenie nowej jakości, przejawiającej się w elementach krajobrazu kulturowego wpisanych w pofalowany, zielony krajobraz tej krainy.
Jednym z charakterystycznych obiektów często spotykanym
w krajobrazie Warmii są przydrożne kapliczki. Budowane dawniej
w miejscach oddalonych od kościołów, pełniły funkcję miejsc spotkań
ludzi na wspólnej modlitwie. Wznoszono je także jako obiekty dziękczynne czy upamiętniające ważne dla społeczności wydarzenie. Niekiedy o budowie kapliczki decydowały zupełnie inne pobudki. Była to
chęć „pokazania” się przed sąsiadami. Dlatego dość często spotkać je
można w pobliżu zabudowań, w ogrodach chłopskich gospodarstw,
czy przy domach [Bojenko i Brosch 2011].
Historia kapliczek warmińskich sięga XVII wieku. Najstarszy
obiekt pochodzi z 1601 roku i znajduje się w Dobrągu. Kuprjaniuk
– badacz warmińskiego krajobrazu, regionalista – zaznacza, że zapewne istniały przed nią inne, ale do naszych czasów żadna z nich
się nie zachowała i nie ma jakiejkolwiek wzmianki w dokumentach
potwierdzającej ten fakt. Najwięcej zachowanych obiektów pochodzi
z XIX stulecia i prezentuje styl neogotycki [www.domwarmiński.pl].
Do naszych czasów zachowała się tylko część kapliczek, jednak
dokładna ich liczba nie jest znana. Według danych Służb Ochrony
zabytków zachowało się około 700 kapliczek, Kuprjaniuk podaje
liczbę dwukrotnie większą, natomiast zdaniem Jasińskiego może
być ich nawet 1600 [Stowarzyszenie Dom Warmiński]. Na terenie Olsztyna znajduje się obecnie czternaście kapliczek wpisanych
do rejestru zabytków. Z biegiem czasu znaczenie kapliczek traciło
na wadze, co szybko odbiło się na ich stanie technicznym. Obecnie
jednak sytuacja ta powoli ulega zmianie. Wzrost świadomości kulturowej mieszkańców Warmii, utożsamianie się ich z miejscem zamieszkania i poszanowanie tradycji, wpływa na podejmowanie szeregu zabiegów w zakresie rewaloryzacji tych obiektów. W 2003 roku
Starostwo Powiatowe w Olsztynie przy udziale Wspólnoty Dawnych
Mieszkańców Powiatu Olsztyńskiego w Niemczech zainicjowało
program „Ratujmy Kapliczki Warmińskie”. Zakłada on renowację
446
Warmińskie kapliczki Olsztyna
i rewaloryzację najcenniejszych obiektów. Podejmowane działania
bez wątpienia stanowią pozytywny przykład aktywności społecznej
w tym zakresie, jednak są niewystarczające. Skupiają się jedynie na
samym obiekcie architektonicznym, nie uwzględniając przy tym niezwykle ważnego aspektu związanego z przeobrażeniami przestrzennymi zachodzącymi w bezpośrednim otoczeniu kapliczek.
Materiał i metody
Badaniami objęto czternaście kapliczek warmińskich usytuowanych
w obrębie Olsztyna, wpisanych do rejestru zabytków. Na wstępie
przeprowadzono kwerendę materiałów źródłowych. Wykorzystano
białe karty obiektów pozyskane z olsztyńskiego oddziału Krajowego
Ośrodka Dokumentacji Zabytków, archiwalną mapę Olsztyna z 1936
roku udostępnioną przez Odział Wojewódzki Służby Ochrony Zabytków w Olsztynie, współczesne mapy i zdjęcia satelitarne miasta
oraz literaturę przedmiotu. Na potrzeby opracowania sporządzono
też fototekę. Metodą wywiadu pozyskano szereg cennych informacji
od Wiktora Knercera – historyka, pracownika Służby Ochrony Zabytków w Olsztynie. Zapoznano się też ze stanem aktualnym obiektów:
sporządzono inwentaryzację obszaru badań oraz przeprowadzono
analizę krajobrazową. Wyniki skonfrontowano z dostępnymi mapami archiwalnymi. Zrealizowane badania pozwoliły na sformułowanie
ostatecznych wniosków dotyczących przestrzeni wokół kapliczek.
Wyniki
Otoczenie wszystkich olsztyńskich kapliczek poddanych badaniom
terenowym i analizom kompozycyjno-krajobrazowym uległo negatywnym zmianom przestrzennym. Każde z nich jednak prezentuje
różny stopień degradacji. Przyczyn tego stanu jest wiele, ale najbardziej istotne są zmiany wynikające z przekształceń struktury miasta
i wciąż niewystarczające zainteresowanie tymi obiektami. Najbardziej zagrożone są te, znajdujące się w szybko rozwijających się
dzielnicach miasta. Przykładami takimi są między innymi kapliczki
usytuowane przy ulicach: Wilczyńskiego, Wincentego Pstrowskiego i Jagiellończyka. Otaczają je wielkogabarytowe budynki bloków
447
Mariusz Antolak, Anna Mazur, Marzena Płaza, Katarzyna Ruszczycka
mieszkalnych i nowoczesnych budynków usługowych. Duża kubatura zabudowy dysharmonizuje otoczenie kapliczek, zaburzając jednocześnie ich prawidłowy odbiór. Budynki zdają się całkowicie dominować w otoczeniu. Zastosowana zbyt duża skala zabudowy w stosunku
do kapliczek powoduje poważne dysproporcje. W takim układzie kapliczki zatraciły funkcje akcentu kulturowego w krajobrazie. Dodatkowo zakłócenia te pogłębia niewłaściwie dobrana kolorystyka. Zbyt
intensywne barwy elewacji lub dachów skutecznie odwracają uwagę
od zabytkowych obiektów. W przypadku trzeciej z wymienionych kapliczek poważnym problemem jest także bliskie sąsiedztwo ruchliwej
drogi oraz salonu samochodowego. Mimo, że zachowała swe pierwotne usytuowanie przy skrzyżowaniu, jest niewłaściwie wyeksponowana. Parking samochodowy stanowiący pstrokate tło obiektu wysuwa
się na plan pierwszy. Kolejnym przykładem potwierdzającym niekorzystną tendencję degradacji przestrzeni wokół obiektów jest kapliczka przydrożna z dzwonniczką przy ulicy Bartąskiej. W jej bezpośrednim otoczeniu powstaje jedno z największych osiedli mieszkaniowych.
Stosunkowo niewielkie zmiany zaszły w dzielnicach charakteryzujących się ekstensywną zabudową, na przykład w Łupstychu, czy
Gutkowie. Tam przydrożne kapliczki zachowały pierwotną lokalizację, a powoli rozrastająca się tkanka miejska nie oddziałuje tak negatywnie, jak w wyżej omówionych sytuacjach. Zauważalne są natomiast inne problemy. Bezpośrednio przy kapliczkach wprowadza się
elementy infrastruktury technicznej, takie jak: słupy energetyczne,
hydranty, barierki ochronne, kosze na śmieci, znaki drogowe, lampy
uliczne, przystanki autobusowe, kioski i tym podobne. Przy kapliczce
w Gutkowie postawiono betonowy słup energetyczny z linią wysokiego napięcia, rozpiętą bezpośrednio nad zabytkowym obiektem.
Podobnych przypadków w Olsztynie jest więcej. Tuż przy kapliczce
przydrożnej przy ulicy Jagiellońskiej wybudowano wiatę przystanku
autobusowego, tę nad Jeziorem Skanda zasłania barierka ochronna
i słupy drogowe, a otoczenie obiektu przy ulicy Wincentego Pstrowskiego dysharmonizuje metalowy płot z rozwieszonymi na nim kolorowymi banerami reklamowymi. Kapliczka przy ulicy Bałtyckiej
(droga wylotowa w kierunku Morąga) nie zmieniła miejsca swojej
pierwotnej lokalizacji, natomiast wskutek późniejszych podziałów
geodezyjnych znalazła się w linii ogrodzenia prywatnej posesji. Nale448
Warmińskie kapliczki Olsztyna
ży też wspomnieć o kapliczce usytuowanej na cmentarzu parafii pod
wezwaniem Świętego Wawrzyńca. Duże zagęszczenie kwater spowodowało „wchłonięcie” kapliczki w strukturę cmentarza, co sprawia,
że trudno ją zauważyć.
Wyniki badań terenowych wskazują na nasilający się problem
związany z utrzymaniem dobrego stanu zieleni wokół kapliczek. Dotyczy wykonywania niewłaściwych zabiegów pielęgnacyjnych, wprowadzania nowych, źle dobranych nasadzeń, czy w ogóle nie podejmowania żadnych działań w tym zakresie. Obserwuje się nadmierne
wykorzystywanie tak popularnych dziś ozdobnych drzew i krzewów
iglastych. Najczęściej można spotkać różne odmiany żywotników
(Thuja sp.), czy świerków (Picea sp.), między innymi w Gutkowie przy
ulicy Żurawiej, na osiedlu Dajtki przy ulicy Sielskiej, czy przy ulicy
Wincentego Pstrowskiego. Niekiedy nowe nasadzenia wprowadzane
są zbyt blisko zabytkowych obiektów, co tworzy niekorzystny klimat
sprzyjający rozwojowi mchów. Pocieszającym jest fakt, że w otoczeniu niektórych kapliczek zachowały się jeszcze pierwotne nasadzenia. Kapliczka przy ulicy Bałtyckiej nadal otoczona jest czterema starymi lipami (Tilia sp.), a kapliczka przy ulicy Poprzecznej znajduje
się na terenie dawnego parku, wśród resztek starodrzewu. Niektóre
obiekty są całkowicie pozbawione opieki. Tereny wokół nich są zaniedbane i narażone na postępującą sukcesję roślinności. Widać to
dobrze przy ulicy Bartąskiej, gdzie w otoczeniu kapliczki rozrastają się samosiewy. Podobnie teren przy kapliczce na trasie Łupstych
– Gutkowo wymaga pilnego uporządkowania.
Dyskusja i wnioski
Obecny stopień świadomości kulturowej i współczesna doktryna konserwatorska nie pozwalają pomijać zabytkowych kapliczek
w ochronie dziedzictwa całego regionu. Obowiązujące zapisy Ustawy
z dnia 23 lipca 2003 roku o ochronie zabytków i opiece nad zabytkami nakłada obowiązek na Ministra Kultury i Dziedzictwa Narodowego przy pomocy Generalnego Konserwatora Zabytków sporządzenia
krajowego programu ochrony zabytków i opieki nad zabytkami [red.
Wysocki 2009]. Zabytkowe kapliczki, jako obiekty kultu religijnego i relikty dziedzictwa kulturowego Warmii doskonale wpisują się
449
Mariusz Antolak, Anna Mazur, Marzena Płaza, Katarzyna Ruszczycka
w wymienione powyżej plany ochrony. Jednakże faktyczna realizacja założeń wspomnianych programów dalece odbiega od postulatów
głoszonych w tych dokumentach. Otoczenie zabytkowych obiektów
wciąż pomijane jest w planach ochronnych, pozostawiając problem
zagospodarowania terenów wokół kapliczek nadal nierozwiązanym.
Wśród opracowanych białych kart badanych obiektów tylko jedna zawiera wytyczne odnoszące się do otoczenia kapliczek, ale i tak traktuje zagadnienie marginalnie.
Obecne przedsięwzięcia i decyzje planistyczne podejmowane
przez władze miasta zdają się traktować warmińskie kapliczki, jako
elementy krajobrazu utrudniające prowadzenie inwestycji związanych z rozwojem przestrzennym. Zaobserwowane w ostatnim czasie
realizacje nie tylko pomijają omawiane obiekty historyczne w planach, ale negatywnie na nie oddziałują, prowadząc w konsekwencji
do ich degradacji przestrzennej. Brak zainteresowania otoczeniem
zabytkowych kapliczek podkreślają także Bojenko i Brosch, twierdząc, iż jest to problem zbyt rzadko podejmowany. Współcześnie
tereny wokół kapliczek kształtuje się w sposób niekontrolowany, często chaotyczny i bez jakiejkolwiek prawidłowości kompozycyjnej. Zapomina się jednocześnie o pierwotnym – historycznym charakterze
tych wspaniałych, milczących świadectw bogactwa kultury ludowej
Warmii [Drej 2007]. Tradycyjnie „wszystkim towarzyszyły drzewa
szlachetnych gatunków, zazwyczaj dęby, jako symbol bohaterstwa
i siły” [Liżewska 2007]. Stosowano też lipy (Tilia sp.). Kapliczki obsadzano dwoma lub czterema drzewami bądź też grupą krzewów [Liżewska 2007]. Współczesne nasadzenia zieleni wokół tych obiektów
nie nawiązują w żaden sposób do pierwotnych układów.
Przedstawione wyniki badań potwierdzają zły stan otoczenia
warmińskich kapliczek Olsztyna oraz identyfikują zagrożenia powodujące ich degradację przestrzenną. Kapliczki zdają się być niewidoczne, nieobecne w miejskiej przestrzeni. Powodem są zaniedbania
wynikające z prowadzenia złej polityki przestrzennej miasta. W wyniku sukcesywnych przekształceń tkanki miejskiej zaburzeniu uległy
pierwotne relacje przestrzenne kapliczek z ich otoczeniem. Została
zachwiana prawidłowa percepcja omawianych obiektów poprzez zatarcie otwarć widokowych, czy zniekształcenie proporcji w bezpośrednim ich sąsiedztwie.
450
Warmińskie kapliczki Olsztyna
Zaobserwowane tendencje w sposobie traktowania otoczenia
omawianych budowli świadczą o potrzebie natychmiastowej poprawy ich sytuacji. Z tego powodu wiele z kapliczek zginęło już z warmińskiego pejzażu bezpowrotnie. Jeśli nie podejmie się odpowiednio
szybko działań ochronnych, to te wciąż żywe zabytki sztuki sakralnej
podzielą ich los [red. Magdziarz 1999].
Literatura
Bojenko M. Brosch A. 2011. Warmińskie kapliczki, cz. I. Drukarnia TINTA Z.
Szymański. Działdowo.
Drej S. 2007. Święta Warmia. Pracownia Wydawnicza ElSet. Olsztyn. Dziedzictwo kulturowe Warmii – Mazur – Powiśla. Stan zachowania, potencjały i problemy. 2009. Pod red. Wysocki J. Drukarnia Księży Werbistów. Olsztyn.
Kościoły i kaplice Archidiecezji Warmińskiej. 1999. Pod red. Ks. Magdziarz B.
tom II. Kuria Metropolitalna Archidiecezji Warmińskiej. Olsztyn.
Mirek Z. Piękoś-Mirkowa H. Zając A. Zając M. 1997, Vascular plants of Poland – a chekclist. Krytyczna lista roślin naczyniowych Polski. IB PAN.
Kraków.
Liżewska I. 2007. Tradycyjne budownictwo wiejskie na Warmii i Mazurach. Borussia. Olsztyn.
www.domwarmiński.pl (stan z dnia 29.01.2013 r.)
mgr inż. arch. kraj. Mariusz Antolak
mgr inż. arch. kraj Anna Mazur
mgr inż. arch. kraj Katarzyna Ruszczycka
mgr inż. arch. kraj Marzena Płaza
Katedra Architektury Krajobrazu i Agroturystyki,
Uniwersytet Warmińsko-Mazurski w Olsztynie
e-mail: [email protected], [email protected],
[email protected], [email protected]
Promotor:
Prof. dr hab. Krzysztof Młynarczyk, dr hab. Maria Lubocka-Hoffmann
451
Grażyna Kaczyńska
Aneta Lipińska
EPISTEME
18/2013, t. 3
s. 453–461
ISSN 1895-2241
Wpływ zanieczyszczenia gleby metalami
ciężkimi na drobnoustroje
THE INFLUENCE OF SOIL HEAVY METALS
POLLUTION ON SOIL MICROORGANISMS
Abstrakt. Celem badań była ocena wpływu zanieczyszczenia gleby metalami ciężkimi na liczebność grzybów i bakterii oligotroficznych. Doświadczenie
wykonano w trzech powtórzeniach w warunkach laboratoryjnych. Do badań
wykorzystano piasek gliniasty o pH 6,6. Czynnikami zmiennymi były: rodzaj
metalu ciężkiego: cynk, miedź, kadm; stopień zanieczyszczenia gleby: 0, 120,
240 i 480 mg Me2 + · kg-1 s.m. gleby; czas inkubacji gleby: 7, 70, 140 i 280
dni. Próbki gleby inkubowano w temperaturze 25˚C i wilgotności równej 50%
maksymalnej kapilarnej pojemności wodnej. W wyniku badań wykazano, że
głównym czynnikiem limitującym liczebność mikroorganizmów glebowych
był czas ekspozycji na działanie badanych metali ciężkich. Grzyby były bardziej oporną grupą drobnoustrojów na zanieczyszczenia gleby metalami ciężkimi niż bakterie oligotroficzne. Szereg toksyczności metali wobec badanych
grup drobnoustrojów przedstawiał się następująco: Zn > Cd > Cu.
Słowa kluczowe: toksyczność, metale ciężkie, cynk, kadm, miedź, liczebność
drobnoustrojów
Summary. The objective of study was to determine the effect of soil contamination with heavy metals on soil community of fungi and oligotrophic
bacteria. Laboratory experiment was carried out in three replications, using
samples of sandy loam of pH 6,6. The experimental variables were: types of
heavy metals: zinc, copper, cadmium; degree of soil contamination: 0, 120,
240, and 480 mg Me2+ · kg-1 d.m. soil, time of soil incubation: 7, 70, 140 and
280 days. Soil samples were incubated at 25°C and 50% maximum water-holding capacity. Fungi were more resistant to contamination by heavy metals than oligotrophic bacteria. Toxicity of heavy metal to microorganisms
depends mainly on the time of exposure. Results of investigation proved
that relative negative effects on the number of selected groups of microorganisms can be ranked as follows: Zn > Cd > Cu.
Key words: toxicity of heavy metals, copper, zinc, cadmium, number of microorganisms
453
Grażyna Kaczyńska, Aneta Lipińska
Wstęp
Weryfikacja stanu jakości gleby stanowi poważny problem, bowiem
brak jest sprecyzowanych wytycznych i opracowanych modeli zależności pomiędzy tak dużą liczbą zmiennych [Franzlubbers i Haney
2006]. Niezmiernie ważna w ocenie stanu jakości gleby jest identyfikacja wskaźników biologicznych [Abawi i Widmer 2000]. Jakość
gleby jest silnie skorelowana z procesami biologicznymi zachodzącymi w glebie. Szczególne znaczenie mają te wskaźniki, które ulegają
zmianie bezpośrednio po zadziałaniu czynnika stresowego [Romig
i in. 1995]. Kryterium jakim jest liczebność mikroorganizmów glebowych wykazuje dużą wrażliwość na zmiany o genezie naturalnej jak
i antropologicznej [Lupwayi i in. 2010]. Metale ciężkie rozpatrywane
w kontekście zanieczyszczeń są substancjami bardzo genotoksycznymi, jednakże w niskich stężeniach to również niezwykle ważne
mikroelementy. Ze względu na toksyczność metale można podzielić
na: istotne i stosunkowo nietoksyczne (cynk), istotne ale bardzo cytotoksyczne (miedź) oraz zbędne i bardzo toksyczne (kadm) [Thele
1992 cyt. za Horn 1984]. Wykazano, że narażenie na metale ciężkie
niezależnie od czasu ekspozycji powoduje zmniejszenie różnorodności i aktywności biologicznej gleby [Akmal i in. 2005]. Celem doświadczenia było określenie wpływu zanieczyszczenia gleby cynkiem,
miedzią i kadmem na liczebność bakterii oligotroficznych i grzybów.
Materiał i metody
Badania przeprowadzono na piasku gliniastym o pHKCl – 6,6. Jednorodne próbki gleby o masie 100 g, zanieczyszczono wodnymi roztworami ZnCl2, CuSO4·5 H2O, CdCl2·21/2 H2O w ilości: 120, 240, 480 mg
Me2+ · kg-1 s.m. gleby. Po dokładnym wymieszaniu materiał glebowy
został zwilżony do 50% maksymalnej kapilarnej pojemności wodnej.
Próbki inkubowano w temperaturze 25°
Wyniki
Mikroorganizmy glebowe są kluczowym elementem prawidłowego
przebiegu wielu procesów zachodzących w środowisku, do których
454
Wpływ zanieczyszczenia gleby metalami ciężkimi na drobnoustroje
można zaliczyć między innymi: obieg składników pokarmowych,
utrzymanie struktury gleby, degradację agrochemikaliów i zanieczyszczeń czy biologiczne zwalczanie szkodników. Dlatego też monitorowanie aktywności biologicznej gleby jest istotnym parametrem określającym stan jakości ekosystemu środowiska. Rozpatrując
zmianę liczebności grzybów i bakterii oligotroficznych stwierdzono,
iż głównym czynnikiem limitującym rozwój omawianych populacji
był czas inkubacji. Zależność ta najbardziej widoczna była w próbkach gleby zanieczyszczonej cynkiem (tab. 1 i 2). Zarówno w przypadku grzybów jak i bakterii oligotroficznych liczebność populacji
malała wraz z wydłużeniem czasu inkubacji, co potwierdzają ujemne,
z wyjątkiem jednego obiektu, współczynniki korelacji linowej Pearsona między liczbą tych drobnoustrojów a czasem zalegania metali
w glebie. Analizując zmianę liczebności stwierdzono, iż grzyby bardziej negatywnie reagowały na nadmiar cynku w 70 dniu trwania doświadczenia, natomiast bakterie oligotroficzne w 140 dniu.
Efekt toksyczny determinowany przez jony miedzi wywoływał
podobny poziom szkodliwości. W przypadku miedzi stwierdzono
najmniejszą liczbę grzybów i bakterii oligotroficznych w 280 dniu inkubacji. Grzyby dość dobrze znosiły różne poziomy zanieczyszczenia
gleby miedzią. Natomiast oligotrofy bardzo negatywnie zareagowały na zastosowane dawki tego metalu ciężkiego. Wszystkie poziomy
zanieczyszczenia wpływały inhibicyjnie na namnażanie się bakterii
oligotroficznych w 70 i 140 dniu trwania doświadczenia.
W przypadku zanieczyszczenia gleby kadmem liczebność grzybów i bakterii oligotroficznych była modyfikowana nie tylko dawką
metalu ale również czasem ekspozycji próbek gleby na kadm. Nadmiar kadmu w glebie stymulował namnażanie grzybów, a jedynie
w 70 dniu doświadczenia hamował ich liczebność. Z kolei w przypadku liczebności bakterii oligotroficznych negatywne działanie tego
metalu stwierdzono w 70, 140 i 280 dniu. Tylko w próbkach gleby
inkubowanych przez 7 dni odnotowano stymulujący wpływ kadmu na liczebność bakterii. Zarówno liczebność grzybów jak i bakterii zmniejszała się wraz z wydłużaniem się czasu inkubacji gleby.
Średnio, niezależnie od stopnia zanieczyszczenia gleby kadmem,
najmniejszą liczbę grzybów i bakterii oligotroficznych stwierdzono
w 280 dniu doświadczenia.
455
Grażyna Kaczyńska, Aneta Lipińska
Dyskusja
Największą wrażliwość, grzyby i bakterie oligotroficzne wykazały
w stosunku do cynku, następnie kadmu i miedzi. Analizując liczebność badanych mikroorganizmów stwierdzono, że grzyby były mniej
oporne na zastosowane dawki metali ciężkich niż bakterie oligotroficzne. Michalcewicz i Wieczorek [2006] tłumaczą to zjawisko
uszkodzeniem mechanizmów obronnych, a tym samym obniżeniem
zdolności adaptacji do niekorzystnych warunków środowiskowych.
Również Kavamura i Esposito [2010] potwierdzają istotne zmniejszenie biomasy, wielkości grzybni i zarodników oraz składu gatunkowego populacji grzybów pod wpływem wysokich stężeń jonów miedzi i cynku. Według Zaborowskiej i in. [2006] inhibicyjne działanie
cynku zależy od poziomu zanieczyszczenia oraz od formy w jakiej
występuje on w środowisku. Uzyskane przez autorów dane wskazują,
że zanieczyszczenie cynkiem było bardzo niekorzystne wobec bakterii oligotroficznych. Zwracają oni szczególną uwagę na dawkę cynku
wynoszącą 400 mg Zn2+ · kg-1 s.m. gleby, jako dawkę o istotnie negatywnym działaniu. W badaniach własnych najmniejszą liczebność
bakterii oligotroficznych odnotowano w próbkach gleby zanieczyszczonych 240 mg Zn2+ · kg-1s.m. gleby.
Zjawisko wzrostu drobnoustrojów w środowisku o różnych stężeniach metali ciężkich jest możliwy dzięki kilku ważnym mechanizmom. Istnieje pięć dominujących szlaków ułatwiających usuwanie
metali ze środowiska bytowania drobnoustrojów [Trevors i in. 1985].
Najbardziej znanym przykładem jest ulatnianie się związków rtęci.
Jest to mechanizm bardzo rozpowszechniony wśród bakterii np.:
Escherichia coli, Shigella czy Acinetobacter [Lund i in. 1986]. Wiele
mikroorganizmów produkuje zewnątrzkomórkowe polimery, bądź
polisacharydy. Substancje te mogą wiązać metale ciężkie i ograniczać toksyczność poprzez zmianę biodostępności ksenobiotyków.
Produkcja zewnątrzkomórkowych egzopolisachrydów pozwala na
utrzymanie toksykanta w odległości bezpiecznej od błon biologicznych, ograniczając w ten sposób ryzyko ich uszkodzenia. Mechanizm
ten zaobserwowano u Klebsiella aeurogenes [Kawai i in. 1992]. Tolerancję wobec metali ciężkich drobnoustroje osiągają również poprzez
pozakomórkowe wiązanie jonów przy zastosowaniu szczawianów,
456
Wpływ zanieczyszczenia gleby metalami ciężkimi na drobnoustroje
fosforanów i siarczków [Jarosz-Wilkołazka i in. 2006]. Proces ten polega na immobilizacji metali przy pomocy odpowiednich produktów
przemiany materii. Za przykład posłużyć może siarkowodór syntezowany przez bakterie siarkowe np.: Desulfovibrio sp. Inną metodą
jest akumulacja metali ciężkich, która odbywa się na terenie komórki
za pomocą metalotionein. Ich synteza jest wynikiem stresu wywołanego przekroczeniem bezpiecznego stężenia toksykantów. Stres
powodowany nadmierną akumulacją metali ciężkich w środowisku
glebowym przyczynia się również w sposób istotny do obniżenia
bioróżnorodności bytujących w nim mikroorganizmów. W związku
z tym może to doprowadzić do zakłócenia, a następnie do zahamowania przemian biologicznych zachodzących w pedosferze [Wysocki
i Tamás 2010].
Abstrahując od czasu zalegania miedzi w glebie wykazano, że
metal ten zwiększał liczebność grzybów, a znacznie zmniejszał liczbę
bakterii oligotroficznych. Badania przeprowadzone przez Kucharskiego i in. [2001] oraz Wyszkowską i Kucharskiego [2003] wykazały,
że miedź stymuluje namnażanie się grzybów, natomiast liczebność
bakterii oligotroficznych była ujemnie istotnie skorelowana ze stopniem zanieczyszczenia gleby miedzią. Tolerancję grzybów mikroskopowych [Penicilium sp. i Aspergillus sp.] wobec jonów miedzi tłumaczy
się brakiem przepuszczalności ściany komórkowej drobnoustrojów
[Chmielowski 1985].
Kadm zalicza się do najbardziej niebezpiecznych metali ciężkich, został wpisany przez Amerykańską Agencję do spraw Ochrony
Środowiska na listę 126 priorytetowych zanieczyszczeń środowiska
[Henkler i in. 2010]. W ujęciu relatywnym, bardziej wrażliwe na jony
kadmu w środowisku były bakterie oligotroficzne niż grzyby. Średnio, niezależnie od czasu inkubacji gleby, liczebność bakterii oligotroficznych istotnie zmniejszyła się pod wpływem wszystkich dawek
kadmu, natomiast negatywne działanie tego metalu na grzyby wykazano tylko w próbkach z dodatkiem 120 mg Cd2+ · kg-1 s.m. gleby.
Różnica w oporności drobnoustrojów wobec metali ciężkich wynika z odmiennych procesów metabolicznych charakteryzujących te
dwie grupy. Grzyby w swoich komórkach posiadają wyższe ciśnienie
osmotyczne, co pozwala im przetrwać w bardzo niekorzystnych warunkach środowiskowych [Wyszkowska i Kucharski 2003].
457
Grażyna Kaczyńska, Aneta Lipińska
Tab. 1. Liczebności grzybów (106 jtk · kg-1 s.m. gleby) w glebie
zanieczyszczonej metalami ciężkimi
Cd2+
Cu2+
Zn2+
Dawka metalu
[mg Me2+ · kg-1
s.m. gleby]
Czas inkubacji [dni]
7
70
140
280
0
14,29
52,97
17,45
10,98
23,92
-0,37
120
39,06
18,73
27,67
22,85
27,08
-0,52
240
11,70
16,30
29,41
23,39
20,20
0,67
480
52,34
16,61
24,43
13,18
26,64
-0,74
29,35
26,15
24,74
17,60
-
-
r
0,66
-0,71
0,41
-0,03
-
-
0
14,29
52,97
17,45
10,98
23,92
-0,37
120
14,33
34,27
75,21
9,94
33,44
-0,08
240
14,43
29,69
44,59
16,24
26,23
-0,01
480
14,40
23,01
54,13
17,03
27,15
0,09
14,36
34,98
47,85
13,55
-
-
r
0,80
-0,90
0,37
0,85
-
-
0
14,29
52,97
17,45
10,98
23,92
-0,37
120
18,64
18,74
16,75
27,39
20,38
0,79
240
52,64
13,79
45,42
21,02
33,22
-0,45
480
31,29
14,49
34,19
16,68
24,16
-0,37
29,22
25,00
28,45
19,02
-
-
0,51
-0,73
0,63
0,08
-
-
r
r
NIR0,01 dla: a – dawki metalu, b – czasu inkubacji
*
458
NIR0,01*
a – 5,57;
b – 5,57;
a · b – 11,14
a – 2,84;
b – 2,84;
a · b – 5,68
a – 4,18;
b – 4,18;
a · b – 8,36
Wpływ zanieczyszczenia gleby metalami ciężkimi na drobnoustroje
Tab. 2. Liczebność bakterii oligotroficznych (108 jtk · kg-1 s.m. gleby)
w glebie zanieczyszczonej metalami ciężkimi
Cu2+
Zn2+
Dawka metalu
[mg Me2+ · kg-1
s.m. gleby]
140
280
68,68 104,17
69,67 31,10
15,24 40,40
106,78 41,00
59,69
16,32
11,69
7,79
24,44
10,19
22,68
17,81
64,24
31,82
22,50
43,35
-0,78
-0,85
-0,06
-0,76
65,09
54,17
23,87
18,78
-
-
r
0,37
-0,60
-0,78
-0,14
-
-
0
120
240
480
68,68
38,69
55,59
90,99
104,17
51,94
63,97
70,80
59,69
28,47
31,14
28,66
24,44
26,98
18,02
28,04
64,24
36,52
37,68
54,62
-0,78
-0,67
-0,94
-0,88
63,49
72,72
36,99
40,47
-
-
0,61
-0,40
-0,69
0,19
-
-
68,68 104,17
58,40 19,80
149,90 28,28
87,62 25,10
59,69
22,33
20,19
6,63
24,44
25,64
11,04
22,35
64,24
31,54
52,35
35,43
-0,78
-0,56
-0,74
-0,64
91,15
44,34
27,21
20,87
-
-
0,34
-0,65
-0,87
-0,26
-
-
0
120
240
480
r
Cd2+
Czas inkubacji [dni]
0
120
240
480
r
7
70
r
NIR0,01*
a – 15,44;
b – 15,44;
a · b – 30,88
a – 17,30;
b – 17,30;
a · b – 34,60
a – 16,38;
b – 16,38;
a · b – 32,76
objaśnienia podano pod tab. 1
*
Innym sposobem zmniejszania toksyczności metali ciężkich jest
wydzielanie do środowiska substancji organicznych zdolnych do wiązania jonów metali. U Aspergillus niger powyższą funkcję pełni kwas
cytrynowy. Determinację tolerancji na jony metali wywołują także
związki wewnątrzkomórkowe jak np.: związki sulfhydrylowe w komórkach miedzioopornych drożdży [Chmielowski 1985].
459
Grażyna Kaczyńska, Aneta Lipińska
Wnioski
Zanieczyszczenie próbek gleby cynkiem, miedzią i kadmem w ilości
120–480 mg · kg-1 s.m. modyfikowało namnażanie grzybów i bakterii
oligotroficznych.
Bakterie oligotroficzne były bardziej wrażliwe na nadmiar metali
ciężkich w glebie niż grzyby.
Metale ciężkie pod względem toksyczności wobec bakterii oligotroficznych można uszeregować następująco: Zn > Cd > Cu.
LITERATURA
Abawi G. S., Widmer T. L. 2000. Impact of soil health management practices
on soil borne pathogens, nematodes and root diseases of vegetables crops.
Applied Soil Ecology, 15: 37–47.
Akmal M., Wang H. Z., Wu J. J., Xu J. M., Xu D. F. 2005. Changes in enzymes
activity, substrate utilization pattern and diversity of soil microbial communities under cadmium pollution. Journal of Environmental Sciences,
17(5): 802–807.
Chmielowski J. 1985. Akumulacja metali przez drobnoustroje. Acta Biologica
Silesiana, 1: 227–235.
Franzlubbers A. J., Haney R. L. 2006. Assessing soil quality in organic agriculture. USDA Agricultural Research Service, 1–17.
Henkler F., Brinkmann J., Luch A. 2010. The Role of Oxidative Stress in Carcinogenesis Induced by Metals and Xenobiotics. Cancers, 2, 376–396.
Jarosz-Wilkołazka A., Graz M., Braha B., Menge S., Schlosser D., Krauss G.
J. 2006. Species-specific Cd-stress response in the white rot basidiomycetes
Abortiporus biennis and Cerrena unicolor. Biometals 19: 39–49.
Kavamura V. N., Esposito E. 2010. Biotechnological strategies applied to the
decontamination of soils polluted with heavy metals. Biotechnology Advances 28: 61–69.
Kawai K., Isobe Y., Horbe M., Tokuda J., Tokuno I., Endo K., Kawai F. 1992.
Production of novel extracellular polysaccharide by a Bacillus strain isolated
from soil. Biosci. Biotechnology and Applied Biochemistry, 56: 853–857.
Kucharski J., Wyszkowska J., Hłasko A. 2001. Liczebność drobnoustrojów
w glebie zanieczyszczonej miedzią. Zeszyty Problemowe Postępów Nauk
Rolniczych, 476: 165–172.
Lund P. A., Ford S. J., Brown N. L. 1986. Transcriptional regulation of mercury-resistance genes of transposon Tn 501. Journal of General Microbiology, 132: 465–480.
460
Wpływ zanieczyszczenia gleby metalami ciężkimi na drobnoustroje
Lupwayi N., Hamel C., Tollefson T. 2010. Soil biology of the canadian prairies.
Agricultural Soils of the Prairies PS&C Prairie Soils & Crops Journal,
16–24.
Martin J. 1950. Use of acid rose Bengal and streptomycin in the plate method for
estimated soil fungi. Soil Science, 69: 215–233.
Michalcewicz W., Wieczorek T. 2006. Wpływ ołowiu na oddychanie wybranych
gatunków grzybów glebowych. Acta Agraria et Silvestria, Series Agraria,
49: 339–342.
Onta H., Hattori T. 1983. Oligotrofic bacteria on organic debris and plant rot in
paddy field. Soil Biology & Biochemistry, 1: 1–8.
Romig D. E., Garlynd M. J., Harris R. F., McSweeney K. 1995. How farmers
assess soil health and quality. Journal of Soil and Water Conservation,
50: 229–236.
Thele D. 1992. Metal-regulated transcription in eukaryotes. Nucleic Acids Research, 20: 1183–1191.
Trevors J. T., Oddie K. M., Belliveau B. H. 1985. Metal resistance in bacteria.
FEMS Microbiology Reviews, 32: 39–54.
Wysocki R., Tamás M. J. 2010. How Saccharomyces cerevisiae copes with toxic
metals and metalloids. FEMS Microbiology Reviews, 34: 925–951.
Wyszkowska J., Kucharski J. 2003. Liczebność drobnoustrojów w glebie zanieczyszczonej metalami ciężkimi. Zeszyty Problemowe Postępów Nauk
Rolniczych, 492: 427–433.
Zaborowska M., Wyszkowska J., Kucharski J., Baćmaga M. 2006. Wpływ
cynku na rozwój drobnoustrojów w podłożach sztucznych. Acta Agraria et
Silvestria, Series Agraria, 49: 527–539.
mgr inż. Grażyna Kaczyńska
mgr inż. Aneta Lipińska
Katedra Mikrobiologii
Uniwersytet Warmińsko-Mazurski w Olsztynie
e-mail: [email protected],
[email protected]
Opiekunowie naukowi: prof. dr hab. Jadwiga Wyszkowska
prof. dr hab. Jan Kucharski
461
Aneta Lipińska*
Grażyna Kaczyńska
EPISTEME
18/2013, t. 3
s. 463–470
ISSN 1895-2241
LICZEBNOŚĆ BAKTERII ORGANOTROFICZNYCH
W GLEBIE PODDANEJ PRESJI WWA
THE NUMBER OF ORGANOTROPHIC BACTERIAS IN
SOIL CONTAMINATED WITH PAHS
Abstrakt. Celem pracy było określenie liczebności bakterii organotroficznych w glebie poddanej presji czterech wielopierścieniowych węglowodorów
aromatycznych: naftalenu, fenantrenu, antracenu i pirenu w ilości: 0, 1000,
2000 i 4000 mg kg-1 s.m. gleby. W celu złagodzenia ewentualnych negatywnych skutków działania WWA, do próbek glebowych dodano substancje
organiczne w formie celulozy i sacharozy. Oznaczenia wykonano w 4. i 16.
tygodniu inkubacji gleby (gliny piaszczystej). W wyniku przeprowadzonych
badań stwierdzono, że zanieczyszczenie gleby WWA różnicowało liczebność
bakterii organotroficznych. Aplikacja do gleby sacharozy i celulozy spowodowała zwiększenie liczebności badanych mikroorganizmów.
Słowa kluczowe: WWA, bakterie organotroficzne, sacharoza, celuloza
Summary. The aim of the study was to determine the number of organotrophic bacterias in soil contaminated with: naphthalene, phenanthrene,
anthracene and pyrene in the amount of: 0, 1000, 2000 and 4000 mg · kg-1
DM soil. Organic substances in the form of cellulose and sucrose were added
to the soil samples, in order to reduce the possible negative effects of PAHs.
Research was performed after 4 and 16 weeks of soil incubation, and the soil
material was sandy loam. The research found that PAHs contamination of
soil diversified number of organotrophic bacterias. The addition of sucrose
and cellulose increased the number of microorganisms.
Key words: PAHs, organotrophic bacterias, sucrose, cellulose
463
Aneta Lipińska, Grażyna Kaczyńska
Wstęp
Rozwój cywilizacji i stale rosnący postęp przemysłowy, gospodarczy
i techniczny, powodują wzrost zanieczyszczeń środowiska naturalnego. Wśród tych zanieczyszczeń szczególnie niebezpieczne, ze względu
na wysoką trwałość w glebie, toksyczność, naturalne właściwości kancerogenne oraz hydrofobowość, są wielopierścieniowe węglowodory
aromatyczne [Bamforth i Singleton 2005]. Największym miejscem
gromadzenia się WWA jest gleba, w której związki te ulegają sorpcji
zarówno na koloidach organicznych, jak i mineralnych, a ich trwałość
zwiększa się wraz ze wzrostem masy cząsteczkowej poszczególnych
węglowodorów. W związku z dużym potencjałem WWA do akumulacji w środowisku glebowym i równoczesnym oporem do biodegradacji, zanieczyszczenie gleby wielopierścieniowymi węglowodorami
aromatycznymi może prowadzić do znacznych zmian parametrów
biologicznych, takich jak: liczebność drobnoustrojów czy aktywność
enzymów glebowych [Perez-Leblic 2010]. Zanieczyszczenia gleby
związkami organicznymi wywierają wpływ na mikroorganizmy, które są najlepszymi indykatorami środowiska glebowego ze względu
na stały kontakt z otoczeniem, dużą wrażliwość na zanieczyszczenia oraz natychmiastową odpowiedź na wszelkie zmiany zachodzące
w glebie. Poprzez wahania w populacjach i zmiany w liczebności,
drobnoustroje pełnią kluczowe funkcje w odzwierciedlaniu stanu jakości środowiska glebowego [Pankhurst i in. 1998].
Celem badań było określenie wpływu zanieczyszczenia gleby
naftalenem, fenantrenem, antracenem i pirenem na liczebność bakterii organotroficznych oraz próba ewentualnego złagodzenia negatywnych skutków oddziaływania WWA poprzez wprowadzenie do
gleby sacharozy i celulozy.
Materiał i metody
W doświadczeniu laboratoryjnym określano wpływ czterech wielopierścieniowych węglowodorów aromatycznych: naftalenu, fenantrenu, antracenu i pirenu na liczebność bakterii organotroficznych.
Doświadczenie zostało założone w trzech powtórzeniach. Po 100 materiału glebowego, o składzie granulometrycznym gliny piaszczystej
464
Liczebność bakterii organotroficznych w glebie poddanej presji WWA
o pHKCl – 7,15, umieszczono w szklanych zlewkach o pojemności 150
cm3. Do każdej z próbek glebowych dodano NH4NO3 (100 mg · kg-1
s.m. gleby), po czym zanieczyszczono je WWA w ilościach: 0, 1000,
2000 i 4000 mg · kg-1 s.m. gleby. Węglowodory wprowadzono do gleby w formie stałej, w postaci naważek o odpowiedniej masie. Zaaplikowano również celulozę i sacharozę w ilości: 0 i 9 g · kg-1 s.m. gleby.
Tak przygotowany materiał glebowy inkubowano przez okres 4 i 16
tygodni, utrzymując wilgotność na poziomie 50% kapilarnej pojemności wodnej. Po 4 i 16 tygodniach inkubacji w glebie określono liczebność bakterii organotroficznych z wykorzystaniem licznika kolonii, na podłożu Bunta i Roviry [1955] według następującego wzoru:
jtk =
· 103
gdzie „a” oznacza liczbę wyrosłych kolonii na płytce, „n” – odwrotność rozcieńczenia, 100 · %-1 s.m. to współczynnik przeliczeniowy na suchą masę gleby, natomiast 103 to przelicznik na 1 kg gleby.
Wyniki zostały opracowane statystycznie, z wykorzystaniem analizy
wariancji wieloczynnikowej ANOVA z pakietu Statistica 9.1.
Wyniki i dyskusja
Aktywność mikrobiologiczna gleb zanieczyszczonych WWA jest uzależniona od szeregu czynników, do których można zaliczyć m.in.:
pH gleby, stopień jej zanieczyszczenia, wilgotność, temperaturę oraz
czas inkubacji [Baran i in. 2004]. Potwierdzeniem tego faktu są badania własne wskazujące na istotne zależności pomiędzy liczebnością
bakterii organotroficznych a dawką WWA, terminem badań i rodzajem substancji organicznej.
W wyniku przeprowadzonych badań stwierdzono, że zanieczyszczenie gleby naftalenem, fenantrenem, antracenem i pirenem w obecności celulozy i sacharozy różnicowało liczebność bakterii organotroficznych. Istotnym elementem była liczba pierścieni benzenowych
znajdujących się w cząsteczkach poszczególnych węglowodorów.
Analizując liczebność bakterii organotroficznych w glebie zanieczyszczonej WWA po 4 tygodniach inkubacji, ale bez dodatku substancji
organicznych, wykazano, że najmniej tych bakterii było w próbkach
465
Aneta Lipińska, Grażyna Kaczyńska
glebowych zanieczyszczonych pirenem – węglowodorem o czterech
pierścieniach benzenowych w cząsteczce, których liczba jest ściśle
związana z biodostępnością WWA dla drobnoustrojów [Baran i in.
2004; Boopathy 2000]. Biodostępność wielopierścieniowych węglowodorów aromatycznych jest tym mniejsza im dłuższy jest łańcuch
węglowodorowy, w związku z czym prawdopodobieństwo rozkładu
pirenu przez mikroorganizmy było mniejsze niż w przypadku naftalenu (o dwóch pierścieniach benzenowych), fenantrenu i antracenu
(o trzech pierścieniach benzenowych). Stopień zanieczyszczenia gleby WWA był w większości obiektów istotnie skorelowany z liczebnością mikroorganizmów. W serii kontrolnej, liczebność drobnoustrojów zwiększała się wraz ze stopniem zanieczyszczenia gleby WWA
w próbkach z naftalenem, gdzie zastosowanie węglowodoru w dawce
4000 mg · kg -1 s.m. gleby spowodowało 77% zwiększenie liczebności
bakterii w stosunku do próbki kontrolnej, niezależnie od czasu inkubacji. W glebie poddanej presji antracenu i pirenu odnotowano zwiększenie liczebności mikroorganizmów odpowiednio o 71% i 15%, natomiast w glebie zanieczyszczonej fenantrenem – 12% zmniejszenie
(tab. 1). W doświadczeniu Muratovej i in. [2009], w którym została
poruszona kwestia wpływu fenantrenu w ilości 10 i 100 mg · kg-1 s.m.
gleby na wydzieliny korzeniowe Sorghum bicolor, zanotowano wzrost
liczebności mikroorganizmów w strefie korzeniowej sorgo.
Istotną zależność wykazano pomiędzy terminem inkubacji
a liczebnością badanej grupy mikroorganizmów (tab. 1), która zwiększała się wraz z upływem czasu pod wpływem działania wszystkich
WWA, co może być związane ze stopniową adaptacją bakterii organotroficznych do nowych warunków środowiskowych. Drobnoustroje
wymagające większego zapotrzebowania energetycznego, w wyniku
intensywnego metabolizmu, są w stanie wykorzystywać ksenobiotyki jako dodatkowe źródło energii i węgla [Baran i in. 2004; Boopathy
2000].
Zastosowanie celulozy i sacharozy istotnie zwiększało liczebność bakterii organotroficznych, czego odzwierciedleniem jest fakt
dodatniego oddziaływania tych substancji. Pod wpływem działania
celulozy, liczebność bakterii organotroficznych (ryc. 1) w próbkach
glebowych zanieczyszczonych naftalenem zwiększyła się 4,6-krotnie, fenantrenem – 3,6-krotnie, antracenem – 3,9-krotnie i pirenem
466
Liczebność bakterii organotroficznych w glebie poddanej presji WWA
– 5,1-krotnie. W przypadku aplikacji do gleby sacharozy, największy
wzrost liczebności (5,4-krotny w stosunku do kontroli) zanotowano
w glebie zanieczyszczonej pirenem. Wprowadzenie do gleby substancji organicznych w postaci celulozy i sacharozy stworzyło mikroorganizmom lepsze możliwości rozwoju, czego potwierdzeniem było
zwiększenie liczebności bakterii. Celuloza jako polisacharyd jest
związkiem trudno rozkładalnym, jednak jej stopniowy rozkład zapewnia mikroorganizmom stały dopływ energii. Sacharoza jako substancja łatwo przyswajalna, jest dodatkowym źródłem węgla i energii
dla drobnoustrojów. Fakt pozytywnego oddziaływania różnych dodatków organicznych na aktywność biochemiczną i mikrobiologiczną
gleb jest poruszany w licznych pracach badawczych [Cai i in. 2007;
Sayara i in. 2010; Tejada i in. 2008; Wyszkowska, Wyszkowski 2010].
Wnioski
W glebach zanieczyszczonych naftalenem, fenantrenem, antracenem
i pirenem bakterie organotroficzne rozwijają się intensywniej niż
w glebach pozbawionych WWA.
Aplikacja do gleby celulozy i sacharozy stymuluje rozwój mikroorganizmów autochtonicznych.
Ryc. 1. Liczebność bakterii organotroficznych w glebie, niezależnie od
dawki WWA i terminu badań (109 jtk · kg-1 s.m. gleby).
467
Aneta Lipińska, Grażyna Kaczyńska
Tab. 1. Liczebność bakterii organotroficznych w glebie poddanej presji WWA.
Dawka
WWA
(mg · kg-1
s.m. gleby)
0
1000
2000
4000
średnia
r
Naftalen
Fenantren
Antracen
Piren
kontrola
czas inkubacji gleby w tygodniach
4
16
4
16
4
16
4
16
16,0
20,0
35,0
29,0
25,0
0,70
36,0
21,0
66,0
63,0
46,5
0,71
16,0
25,0
29,0
29,0
24,7
0,82
36,0
11,0
8,0
17,0
18,0
-0,48
18,0
16,0
14,0
10,0
14,5
-1,00
34,0
38,0
65,0
79,0
54,0
0,96
18,0
11,0
10,0
10,0
12,2
-0,74
34,0
36,0
43,0
50,0
40,7
0,98
32,0
37,0
39,0
44,0
38,0
0,98
128,0
219,0
225,0
141,0
178,2
-0,05
32,0
39,0
45,0
55,0
42,7
0,99
128,0
101,0
211,0
354,0
198,5
0,94
57,0
101,0
112,0
146,0
104,0
0,96
88,0
125,0
161,0
181,0
138,7
0,95
57,0
166,0
149,0
119,0
122,7
0,32
88,0
89,0
107,0
142,0
106,5
0,97
celuloza
0
1000
2000
4000
średnia
r
29,0
51,0
48,0
41,0
42,2
0,30
124,0
312,0
344,0
343,0
280,7
0,75
29,0
38,0
44,0
55,0
41,5
0,99
124,0
303,0
332,0
304,0
265,7
0,65
sacharoza
0
1000
2000
4000
średnia
r
NIR0,01*
47,0
57,0
90,0
99,0
73,2
0,93
91,0
114,0
120,0
123,0
112,0
0,83
47,0
48,0
48,0
49,0
48,0
0,95
91,0
90,0
101,0
118,0
100,0
0,96
a – 1,6; b – 1,1; a – 1,6; b – 1,2; a – 1,7; b – 1,2; a – 1,5; b – 1,1;
c – 1,4; a·b – c – 1,5; a·b – 2,4; c – 1,3; a·b –
c – 1,3; a·b –
2,1; a·c – 2,6;
a·c – 3,0;
2,3; a·c – 2,8;
2,1; a·c – 2,6;
b·c – 1,9;
b·c – 2,1;
b·c – 2,0;
b·c – 1,8;
a·b·c – 3,7
a·b·c – 4,2
a·b·c – 4,0
a·b·c – 3,7
*NIR0,01 dla: a – dawki WWA, b – czasu inkubacji, c – rodzaju substancji
organicznej; r – współczynnik korelacji
468
Liczebność bakterii organotroficznych w glebie poddanej presji WWA
LITERATURA
Bamforth S. M., Singleton I. 2005. Review. Bioremediation of polycyclic aromatic hydrocarbons: current knowledge and future directions. Journal of
Chemical Technology and Biotechnology, 80: 723–736.
Baran S., Bielińska J. E., Oleszczuk P. 2004. Enzymatic activity in an airfield
soil polluted with polycyclic aromatic hydrocarbons. Geoderma, 118: 221–
232.
Boopathy R. 2000. Factors limiting bioremediation technologies. Bioresource
Technology, 74: 63–67.
Bunt Y.S., Rovira A.D. 1955. Microbiological studies of some subarctic soils. Journal of Soil Science, 6: 119–128.
Cai Q. Y., Mob C. H., Wu Q. T., Zeng Q. Y., Katsoyiannis A., F´Erard J.F. 2007.
Bioremediation of polycyclic aromatic hydrocarbons (PAHs)-contaminated
sewage sludge by different composting processes. Journal of Hazardous
Materials, 142: 535–542.
Muratova A., Golubev S., Wittenmayer L., Dmitrieva T., Bondarenkova A.,
Hirche F., Merbach W., Turkovskaya O. 2009. Effect of the polycyclic aromatic hydrocarbon phenanthrene on Root exudation of Sorghum bicolor (L.)
Moench. Environmental and Experimental Botany, 66: 514–521.
Pankhurst C. E., Rogers S.L., Gupta V. S. R. 1998. Microbial parameters for
monitoring soil pollution. Environmental Biomonitoring, red. J.M. Lynch,
A. Wiseman, Cambridge University Press, UK: 46–69.
Pérez-Leblic M. I., Turmero A., Hernández M., Hernández A. J., Pastor J.,
Ball A. S., Rodríguez J., Arias M.E. 2010. Influence of xenobiotic contaminants on landfill soil microbial activity and diversity. Journal of Environmental Management, 30: 285–290.
Sayara T., Sarra M., Sanchez A. 2010. Effects of compost stability and contaminant concentration on the bioremediation of PAHs contaminated soil
through composting. Journal of Hazardous Materials, 179: 999–1006.
StatSoft, Inc. 2010. STATISTICA (data analysis software system), version
9.1. www.statsoft.com.
Tejada M., Gonzalez J. L., Hernandez M. T., Garcia C. 2008. Application of
different organic amendments in a gasoline contaminated soil: Effect on soil
microbial properties. Bioresource Technology, 99: 2872–2880.
Wyszkowska J., Wyszkowski M. 2010. Activity of soil dehydrogenases, urease
and acid and alkaline phosphatases in soil polluted with petroleum. Journal
of Toxicoogy and Environmenatal Health, 73: 1202–1210.
469
Aneta Lipińska, Grażyna Kaczyńska
mgr inż. Aneta Lipińska*
mgr inż. Grażyna Kaczyńska
Katedra Mikrobiologii
Uniwersytet Warmińsko-Mazurski
e-mail: [email protected],
[email protected]
*Stypendystka w ramach projektu “Dr INNO 3. Stypendia doktoranckie”
organizowanego przez Instytut Rozrodu Zwierząt i Badań Żywności
PAN w Olsztynie i współfinansowanego przez Unię Europejską w
ramach Europejskiego Funduszu Społecznego.
Opiekunowie naukowi: prof. dr hab. Jan Kucharski
prof. dr hab. Jadwiga Wyszkowska
470
Katarzyna Olczak
Monika Petrynka
Marek Tischner
EPISTEME
18/2013, t. 3
s. 471–477
ISSN 1895-2241
WPŁYW PRZERWY W SZKOLENIU PODSTAWOWYM
NA REAKCJE STRESOWE U MŁODYCH KONI
HUCULSKICH
EFFECT OF INTERRUPTION IN BASIC TRAINING ON
stress response in YOUNG Hutsul HORSES
Abstrakt. Ocena zachowania i badanie psychiki koni stały się ważnym tematem badawczym w kontekście ich przydatności do pracy. Rośnie zainteresowanie procesami poznawczymi i pamięciowymi, a wiedza ta może znaleźć
szerokie zastosowanie w praktyce. Doświadczenie zostało przeprowadzone
w celu wpływu 15-nasto-tygodniowej przerwy w treningu młodych koni
huculskich na ich późniejsze reakcje stresowe. Trening składał się z trzech
zadań: szczotkowania, czyszczenia kopyt oraz siodłania. Przez 10 tygodni
prowadzono regularne szkolenie przyzwyczajające konie do nowych sytuacji. W trakcie treningu dokonywano pomiarów tętna jako wskaźnika stresu.
Następnie szkolenie zostało wstrzymane na 15 tygodni, po czym wznowiono je wraz z pomiarami tętna. Badania wykazały, że przerwa w szkoleniu
nie wpłynęła na poziom stresu u młodych ogierków.
Słowa kluczowe: konie, trening, pamięć, stres
Summary. Assessing of horses behavior and psychology in terms of their
suitability for work has become increasingly undertaken by scientists topic.
There is a growing interest in horses’ cognitive processes and memorization.
This knowledge can be widely used in practice, however there is insufficient
amount of researches. This study was done in order to determine whether
the 15 weeks break in basic training of horses will have a negative effect on
stress intensity of young hucul colts. The training consisted three exercises: brushing, hooves cleaning and saddling. Horses were regularly trained
during 10 weeks. The heart rate as an indicator of stress was measured. Then
the training has been suspended for 15 weeks, after this time the training
with heart rate measurements was repeated. Results have shown that if the
horses were once used to new situations 15 week break has not affected the
horses stress level.
Key words: horses, training, stress, memory
471
Katarzyna Olczak, Monika Petrynka, Marek Tischner
Wstęp
Wczesna ewaluacja przydatności koni do różnego rodzaju pracy jest
ważna, ze względu na umożliwienie wybrania właściwych koni do
konkretnych zadań, jeszcze wtedy gdy są one młode. Przy tego rodzaju ocenie istotne są zarówno aspekty fizyczne, jak i behawioralne.
Visser [2001] podkreśla jak istotna jest wczesna ocena temperamentu koni ze względu na zupełnie inne oczekiwania wobec koni
rekreacyjnych, cyrkowych, wyścigowych, skokowych, czy pracujących
przy hipoterapii. Odpowiednie dobranie koni do pracy jest ważne
nie tylko ze względu na korzyści płynące dla człowieka, ale również
dla zapewnienia zdrowia psychicznego i fizycznego koni [Visser i in.
2001]. Ponadto, w celu poprawienia skuteczności treningów i poprawy bezpieczeństwa koni i ludzi rośnie zainteresowanie procesami
poznawczymi i pamięciowymi u tych zwierząt, jednak wiedza z tego
zakresu jest wciąż uboga. Dotychczasowe badania wykazały, że konie
mają zdolność do odnowienia reakcji wyuczonych w labiryncie po tygodniu [Marinier i Alexander 1994]. Pamiętają prawidłowe wybory
w teście dyskryminacji po upływie kilku miesięcy oraz przechowywują
w pamięci pewne kategoryzacje i koncepcje nawet powyżej dziesięciu
lat [Hanggi i Ingersoll 2009].
Pomimo, iż regularne szkolenie jest priorytetem często zdarzają
się sytuacje, które zmuszają trenera lub właściciela do przerwania
dotychczasowego szkolenia. Niniejsze doświadczenie przeprowadzono w celu sprawdzenia, czy przerwanie na 15 tygodni treningu podstawowego młodych koni huculskich wpłynie na poziom stresu po
wznowieniu szkolenia.
Materiał i metody
Zwierzęta doświadczalne. Do badań wybrano sześć nigdy nie trenowanych, trzyletnich ogierków huculskich. Zwierzęta do stadniny, w której konie przebywają cały rok na pastwiskach. Osobniki
doświadczalne utrzymywane były w stadzie składającym się z 11 ogierów (dziewiętnastoletniego ogiera czołowego, dwóch koni czteroletnich, sześciu trzylatków wybranych do badań oraz dwóch roczniaków) oraz 1 samca osła. Wybrane do doświadczeń osobniki zostały
wcześniej przyuczone do prowadzenia w ręce z założonym kantarem.
472
Wpływ przerwy w szkoleniu podstawowym na reakcje stresowe...
Przebywając na pastwisku, konie miały kontakt z człowiekiem dwa
razy dziennie w trakcie karmienia oraz podczas przeprowadzania
ich na nowe kwatery pastwiskowe. Zwierzęta miały stały dostęp do
wody.
Metoda badawcza
Eksperyment składał się z dwóch faz, w trakcie których konie
wykonywały trzy zadania. Wybrano je z uwagi na praktyczne zastosowanie w przyszłości. W trakcie sesji treningowych przeznaczano
maksymalnie 3 minuty na jedno ćwiczenie.
Szczotkowanie sierści – przy pomocy zgrzebła i miękkiej włosianej szczotki czyszczono całe ciało konia zaczynając od głowy, poprzez
kłodę, kończąc na kończynach zadnich.
Rozczyszczanie kopyt – według ustalonego schematu, roz-poczynając od przedniej lewej nogi, podnoszono koniom kończyny,
a następnie przy użyciu kopystki usuwano brud z kopyt.
Siodłanie – w pierwszej kolejności zakładano czaprak, następnie
siodło oraz zapinano popręg stopniowo zwiększając siłę jego dociągania.
Podczas treningu dokonywano pomiarów częstotliwości
skurczów serca (zwanych dalej tętnem) jako wskaźnika poziomu reakcji stresowej. Do pomiarów wykorzystano urządzenie Polar
Horse Trainer S810i. Aby określić poziom stresu mierzono tętno
spoczynkowe 10 minut przed rozpoczęciem treningu oraz w trakcie
wykonywania poszczególnych zadań.
Trening przygotowawczy. Sesje treningowe odbywały się raz w tygodniu przez 10 tygodni i składały się z wyżej wymienionych ćwiczeń.
Przed rozpoczęciem pierwszej sesji przez dwa dni przyzwyczajano
konie do noszenia aparatury pomiarowej, ponadto za każdym razem
10 min przed rozpoczęciem szkolenia zakładano koniom pulsometr
w celu zmierzenia tętna spoczynkowego (zwierzę stało przywiązane
do koniowiązu bez interakcji z człowiekiem). Sesje trwały do momentu, w którym tętno ogierków w trakcie wykonywania zadań nie
różniło się od tętna spoczynkowego. Tętno zbliżone do spoczynkowego było wskaźnikiem świadczącym o przystosowaniu się zwierząt do
zaistniałej sytuacji. W tym samym czasie trener obserwował reakcję
473
Katarzyna Olczak, Monika Petrynka, Marek Tischner
behawioralną koni – trening zakończono w momencie, gdy konie
stały spokojnie podczas wykonywania każdego z wyżej wymienonych
ćwiczeń, oraz podawały nogę na komendę głosową „noga”.
Faza kontrolna. W celu określenia, czy występuje u koni pamięć
długotrwała i czy przerwa w treningu wpłynie na stan emocjonalny
koni przerwano trening na 15 tygodni. Po tym czasie trening wraz
z pomiarami powtórzono.
Statystyka. Analizy statystycznej dokonano przy użyciu programu
STATISTICA. Do obliczeń użyto różnicy pomiędzy tętnem spoczynkowym, a tętnem w trakcie wykonywania zadania HRR (eng.
heart rate reserve). W celu sprawdzenia skuteczności fazy przystosowawczej porównano dane pomiędzy 1 a 10 tygodniem dla każdej
czynności wykorzystując korelację Pearsona. Następnie w celu ewaluacji efektu pamięci długotrwałej wykorzystano test Wilcoxona dla par
wiązanych. Porównano najpierw tydzień 1 z 10, a następnie 10 z 25.
Wyniki
Wraz z upływem kolejnych tygodni treningu HRR ulegało wyraźnym
zmianom (wyk.1). Korelacja Pearsona potwierdza tendencję
spadkową dla każdego ćwiczenia w fazie przystosowawczej: szczotkowanie sierści r = -0,2; rozczyszczanie kopyt r = -0,5; oraz siodłanie
r = -0,2. Wyniki istotne uzyskano dla dwóch zadań: rozczyszczania
kopyt p=0.0002 oraz siodłania p=0.0405. Wykazano brak istotnych
zależności w odniesieniu do czyszczenia p=0.1086.
Wyniki testu Wilcoxona dla par wiązanych między 1 i 10 treningiem również potwierdzają skuteczność treningu przygotowawczego.
Dla rozczyszczania kopyt oraz siodłania stwierdzono istotne różnice,
które wynosiły kolejno: Z=2.023; p=0.043 oraz Z=2.023; p=0.0431.
Dla czyszczenia nie stwierdzono istotnych różnic: Z=1.214; p=0.225.
Test Wilcoxona dla par wiązanych pomiędzy 10 i 25tygodniem
potwierdził istnienie pamięci długotrwałej oraz brak negatywnego
wpływu przerwy na stan emocjonalny koni. Dla żadnego z trzech ćwiczeń nie wykazano istotnych różnic: rozczyszczania kopyt Z=1.214;
p=0.225, siodłanie Z=0.135; p=0.893, czyszczenie Z=0.674; p=0.500.
474
Wpływ przerwy w szkoleniu podstawowym na reakcje stresowe...
[ud/min] Częstotliwość uderzeń serca jako miernik reakcji stresowej
Wyk. 1. Wykres wskazujący o ile wzrosło tętno u koni podczas wykonywania poszczególnych zadań w kolejnych tygodniach szkolenia. 15 tygodni
przerwy zaznaczono przerywaną czarną linią. Słupki błędu wskazują błąd
standardowy.
Dyskusja
Badania dotyczące pamięci i procesów poznawczych koni stają się
coraz popularniejsze ze względu na ich praktyczne zastosowanie.
W celu oceny pamięci długotrwałej u koni oraz poziomu stresu
na podstawie częstotliwości skurczów serca u młodych ogierków
w niniejszym doświadczeniu wybrano trzy zadania, które mają
później zastosowanie w praktyce. Wyniki pokazały, że regularny
trening obniża reakcję stresową koni na nowe sytuacje, a 15 tygodni
przerwy w treningu nie wpłynęło na poziom tętna, co sugeruje, brak
oddziaływania na poziom stresu. Obiektywne spostrzeżenia trenera
sugerują, że konie pamiętały również kolejność następujących po
sobie ćwiczeń. Podobne rezultaty uzyskano w odniesieniu do innych
elementów szkolenia [Olczak i Tischner 2012]. Ponadto brak istotnej zmiany w częstotliwości skurczów serca podczas szczotkowania
sugeruje, że to zadanie nie powodowało u koni odpowiedzi emocjonalnej, a wręcz mogło zwierzęta uspokajać. Pomimo odmiennej
metodyki prowadzonych badań liczni autorzy potwierdzają istnienie
pamięci długotrwałej u koni. Gabor i Gerken [2012] wykazali, że
konie pamiętają wyuczone zadania nawet przez 10 lat. Ponadto Wolff
475
Katarzyna Olczak, Monika Petrynka, Marek Tischner
i Hausberger [1996] udowodniły, że jedne konie lepiej wykonują
zadania angażujące pamięć przestrzenną, a inne lepiej uczą się
poprzez warunkowanie instrumentalne. Dodatkowo wykazały, że
w obu sytuacjach konie po miesiącu przerwy są w stanie wykonać
zadania szybciej niż za pierwszym razem. Co więcej konie mają bardzo silnie zakorzenioną potrzebę więzi socjalnych. Badania dowodzą,
że potrafią przez lata zapamiętać inne osobniki i zależności jakie
między nimi panowały [Sankey i in. 2010]. Z jednej strony wykazano,
że konie pamiętają trenera miesiącami i istnieją dowody, że ich reakcje wobec znanej osoby będą inne. Z drugiej strony stwierdzono, że
u koni następuje generalizacja bodźców, przez co ich zachowanie
wobec nowych osób nie wiele różni się w porównaniu do znanych.
Pozytywne zapamiętanie trenera przekłada się na późniejsze relacje
koni z innymi ludźmi i ma pozytywny wpływ na dobre użytkowanie
koni. Ponadto Visser i in. [2002] wykazali, że konie które były
wcześniej trenowały reagowały mniej emocjonalnie na nowe obiekty w porównaniu do osobników nigdy nie trenowanych. Wnioski te
pokrywają się z wynikami badań przedstawionych w tym artykule
i dowodzą, że wraz z kolejnymi treningami stabilizuje się reakcja
emocjonalna koni.
Bibliografia
Gabor V., Gerken M. 2012. Cognitive testing in horses using a computer based
apparatus. Applied Animal Behaviour Science, 139 (3–4): 242–250. doi:
10.1016/j.applanim.2012.04.010.
Hanggi E. B., Ingersoll J. F. 2009. Long-term memory for categories and concepts in horses (Equus caballus). Animal cognition, 12 (3): 451–62. doi:
10.1007/s10071-008-0205-9.
Marinier S. L., Alexander A. J. 1994. The use of a maze in testing learning and
memory in horses. Applied Animal Behaviour Science, 39 (2): 177–182.
doi: 10.1016/0168-1591(94)90137-6.
Olczak K., Tischner M. Stress intensity in young hucul horses during grooming and training. Science for Sustainability (International Scientific
Conference for PhD Students in Győr), 411–414.
Sankey C., Richard-Yris M.-A., Leroy H., Henry S., Hausberger M. 2010.
Positive interactions lead to lasting positive memories in horses, Equus
caballus. Animal Behaviour, 79(4): 869–875. doi: 10.1016/j.anbehav.2009.12.037.
476
Wpływ przerwy w szkoleniu podstawowym na reakcje stresowe...
Visser E., Van Reenen C., Hopster H., Schilder M. B., Knaap J., Barneveld,
Blokhuis H. 2001. Quantifying aspects of young horses’ temperament:
consistency of behavioural variables. Applied Animal Behaviour Science,
74(4): 241–258. doi:10.1016/S0168-1591(01)00177-0.
Visser E. K., Van Reenen C. G., Van der Werf J. T. N., Schilder M. B. H., Knaap
J. H., Barneveld Blokhuis H. J. 2002. Heart rate and heart rate variability
during a novel object test and a handling test in young horses. Physiology
& behavior, 76(2): 289–96. www.ncbi.nlm.nih.gov/pubmed/12044602
Wolff A., Hausberger M. 1996. Learning and memorisation of two different
tasks in horses: the effects of age, sex and sire. Applied Animal Behaviour
Science ,46: 137–143.
mgr inż. Katarzyna Olczak
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
mgr inż. Monika Petrynka
Katedra Hodowli Trzody Chlewnej i Małych Przeżuwaczy
Uniwersytet Rolniczy w Krakowie
e-mail: [email protected]
dr wet. Marek Tischner
Katedra Rozrodu i Anatomii Zwierząt
Uniwersytet Rolniczy w Krakowie
Opiekun naukowy: dr wet. Marek Tischner
477
Anna Kapczyńska
Joanna Morys-Orządała
Karolina Wietnik
EPISTEME
18/2013, t. 3
s. 479–489
ISSN 1895-2241
UKORZENIANIE KARŁOWYCH ODMIAN TAWUŁY
JAPOŃSKIEJ I BERBERYSU THUNBERGA
ROOTING OF DWORF FORMS OF JAPANESE
MEADOWSWEET AND BARBERRY
Abstrakt. Celem doświadczenia przeprowadzonego w 2008 roku było
określenie procentu ukorzenianych sadzonek półzdrewniałych pobranych
z wybranych karłowych odmian berberysów i tawuł (Berberis thunbergii ‘Bonanza Gold’, ‘Bagatelle’, ‘Kobold’; Spiraea japonica ‘Magic Carpet’,
‘Japanese Dwarf’) oraz ocena ukorzenionego materiału. Analizując rodzaj
berberys stwierdzono, że w zależności od odmiany, rośliny ukorzeniły się
w zakresie od 86% (‘Bagatelle’) do 99% (’Kobold’). W przypadku tawuł wynik
mieścił się w zakresie od 85% (‘Magic Carpet’) do 95% (‘Japanese Dwarf’).
Aż u 90% roślin berberysu Thunberga ‘Kobold’ zanotowano korzenie o długości 8.1–12.0 cm. Najdłuższe korzenie u badanych tawuł mieściły się w zakresie 4.1–8.0 cm. Liczba wytworzonych korzeni zależała od badanych odmian.
Słowa kluczowe: Berberis, Spiraea, krzewy ozdobne, sadzonki
Summary. The aim of the experiment carried out in 2008 was to evaluate whether plant genotype influenced rooting of semi hard cuttings of
dwarf shrubs: Berberis thunbergii ‘Bonanza Gold’,‘Bagatelle’, ‘Kobold’ and
Spiraea japonica ‘Magic Carpet’, ‘Japanese Dwarf’. In Berberis the percentage of rooting ranged from 99% for ’Kobold’ to 86% to ‘Bagatelle’, in Spiraea
from 95% for ‘Japanese Dwarf’ to 85% for ‘Magic Carpet’. 90% of barberry
‘Kobold’ cuttings amounted to 8.1–12.0 cm of root length. The longest roots
of meadowsweet cultivars achieved 4.1–8.0 cm. The number of roots depended on the cultivar in both tested species.
Key words: Berberis, Spiraea, cuttings, ornamental shrubs
479
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
WSTĘP
Małe przestrzenie ogrodowe są wyjątkowo trudnym obszarem do
aranżacji zielenią. Chcąc uwzględnić w projekcie różne odmiany
drzew i krzewów ozdobnych musimy brać pod uwagę dynamikę
wzrostu tych gatunków, które niejednokrotnie już po kilku latach
osiągają zbyt duże rozmiary, wymuszając na właścicielach ogrodów
intensywne cięcie, a czasem nawet zupełną zmianę aranżacji
przestrzeni ogrodowej. Obecnie asortyment gatunków krzewów ozdobnych oferowanych przez szkółkarzy jest niezwykle bogaty. Wśród
nich można znaleźć gatunki roślin charakteryzujących się powolnym
wzrostem lub osiągające docelowo niewielkie rozmiary (tzw. formy
karłowe). Wybór gatunków i odmian, które świetnie sprawdzają się
w małych ogrodach, jest ogromny. Do tej grupy zaliczamy szereg
odmian berberysów i tawuł – rośliny te dzięki barwnemu ulistnieniu wprowadzają niezwykłe efekty kolorystyczne do kompozycji
ogrodowej, ponadto świetnie znoszą nasze warunki klimatyczne.
Drzewa karłowe (głównie iglaste) uzyskuje się przede wszystkim
przez szczepienie, natomiast karłowe odmiany berberysów i tawuł
przez sadzonki półzdrewniałe. Sadzonkowanie jest stosowane
w szkółkarstwie ozdobnym głownie ze względów ekonomicznych
– uzyskane w ten sposób rośliny dorastają szybciej do rozmiarów
umożliwiających ich sprzedaż (wcześniej wchodzą w stan kwitnienia), ponadto nie różnią się od roślin matecznych (Szydło 2006).
Z odmian berberysu Thunberga o barwnych liściach powszechnie rozmnaża się z siewu tylko ‘Atropurpurea’ – jako jedna z nielicznych
powtarza zabarwienie liści w ponad 90%. Wszystkie inne odmiany
o określonych cechach, np. barwnych liściach, pogiętych pędach
lub niskim wzroście, zaleca się rozmnażać wyłącznie wegetatywnie
(Waźbińska i in. 2008).
W niniejszej pracy skupiono się przede wszystkim na zbadaniu
jaki wpływ na proces ukorzeniania sadzonek wywiera genotyp –
określano zdolności ukorzeniania sadzonek pobranych z wybranych
odmian berberysów i tawuł, oraz dokonano oceny ukorzenionego
materiału.
480
Ukorzenianie karłowych odmian Tawuły japońskiej i Berberysu thunberga
MATERIAŁ I METODY
Badania przeprowadzono na terenie Szkółki Krzewów Ozdobnych
Hajdrowscy w Mnikowie pod Krakowem. Materiałem badawczym były sadzonki trzech karłowych odmian berberysu Thunberga
(Berberis thunbergii DC.): ‘Bonanza Gold’, ‘Bagatelle’ i ‘Kobold’
o odpowiednio żółtym, czerwonym i zielonym zabarwieniu liści oraz
dwóch odmian tawuły japońskiej (Spiraea japonica L.f.): żółtolistna
‘Magic Carpet’ i zielona ‘Japanese Dwarf’.
Doświadczenie trwało rok kalendarzowy. Założone zostało 15
lipca 2008 roku. Wykorzystano 200 sadzonek pobranych z każdej
odmiany – po 50 sztuk w czterech powtórzeniach. Sadzonki pobrano
z matecznika znajdującego się w wyżej wymienionej szkółce. Materiał
był wyrównany i wolny od chorób wirusowych, grzybowych oraz bez
żadnych uszkodzeń mechanicznych. Sporządzono sadzonki pędowe
półzdrewniałe (4–5 węzłowe), przycięte skośnie na dole tuż pod
najniższym węzłem i równolegle u góry nad najwyższym. Na każdej
z sadzonek pozostawiano po kilka liści.
Sadzonki ukorzeniano w specjalnie do tego celu przygotowanym tunelu foliowym o podwójnych nadmuchiwanych ścianach.
Pojemnikami do ukorzeniania były plastikowe kuwety o wymiarach
45:36:9 cm, wypełnione specjalistycznym podłożem do ukorzeniania
krzewów liściastych U1 firmy Holas (skład: torf cegiełkowy, frakcja
0–10mm – 85%, perlit – 15%, nawóz PGMix – 0,5 kg/ m3, mikroelementy – 0,2 kg/ m3, pH 4,0–5,0). Jest to podłoże przeznaczone
specjalnie do roślin trudno ukorzeniających się, o łatwo łamiących się
pędach. Wszystkie kuwety przed nasypaniem podłoża zostały umyte
i odkażone preparatem Agrigerm 2000.
Sadzonki umieszczono w podłożu na głębokość ok. 2 cm, wcześniej dolne ich części (ok. 0,5 cm) zanurzając w ukorzeniaczu AB do
sadzonek zdrewniałych i półzdrewniałych (skład: kwas 1-naftylooctowy 0,2%, kwas 4-indol-3-ilomasłowy 0,1%, amid kwasu 1-naftylooctowego 0,1%).
Przez cały okres ukorzeniania sadzonki były cieniowane oraz
zamgławiane (w upalane dni co 15 min przez 20 sekund, w dni pochmurne 20 sekund co 2 godziny, nocą zamgławianie było wyłączone).
Temperatura w upalne dni utrzymywała się na poziome 28–30oC,
w pochmurne 20–25 oC. Dodatkowo co 2 tygodnie stosowano
481
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
zapobiegawczo naprzemiennie oprysk fungicydami: Rovral 50 WP,
Ronilan 50 WP, Topisn M 70 – profilaktyczne traktowanie takimi preparatami ma ogromny w pływ na właściwy przebieg procesu ukorzeniania (Pacholczak and Szydło 2008).
Ukorzenianie sadzonek trwało do 15 października 2008 roku.
Następnie sadzonki zostały złożone do chłodni po wcześniejszym
oprysku fungicydem Topisn M70. Temperatura w chłodni była stała
przez cały okres zimowania i wynosiła -0,5 oC.
10 kwietnia 2009 roku rośliny zostały wyciągnięte z chłodni,
opryskane fungicydem Rovral 50 WP i przeniesione do ogrzewanego
tunelu foliowego w celu ich rozbudzenia. Okres ten trwał 3 miesiące.
10 lipca 2009 roku zostały wyciągnięte z tunelu i przeniesione do
pracowni. Wyciągnięto je z podłoża, oczyszczono korzenie i dokonano pomiarów. Określono procent ukorzenionych roślin każdej
badanej odmiany oraz jakość systemu korzeniowego. Mierzono
długość korzeni u każdej rośliny w obrębie poszczególnej odmiany.
Sadzonki wyraźnie różniły się długością Zmierzone rośliny zakwalifikowano do 3 grup, biorąc pod uwagę średnią długość korzeni na
sadzonce: I grupa 0,1–4,0 cm, II grupa 4,1–8,0 cm, III grupa 8,1–
12,0 cm. Następnie określano liczbę korzeni wytworzonych przez
rośliny z poszczególnych grup.
Uzyskane wyniki opracowano statystycznie metodą analizy wariancji przy użyciu testu Duncana, z uwzględnieniem poziomu istotności α = 0,05.
WYNIKI I DYSKUSJA
Liczbę ukorzenionych sadzonek berberysów i tawuł wyrażoną w procentach przedstawiono na rycinie 1. Uzyskane wyniki wskazują, że
genotyp badanych roślin istotnie wpływa na efektywność badanego
procesu. Analizując rodzaj Berberis stwierdzono, że sadzonki zielonolistnej odmiany ‘Kobold’ uzyskały najwyższy współczynnik ukorzeniania – 99%. Trzeba jednak zaznaczyć, że wszystkie badane odmiany berberysów wykazały wysoki stopień ukorzeniania, przekraczając
wartość 85%. Podobne efekty uzyskali Pacholczak i Szydło (2008)
ukorzeniając sadzonki Berberis thunbergii ‘Green Carpet’ – stosując
ukorzeniacz AB, uzyskali 99% ukorzenionych roślin. Davidescou i in.
482
Ukorzenianie karłowych odmian Tawuły japońskiej i Berberysu thunberga
(2003) opisują przebieg procesu ukorzeniania w szkółce – sadzonki
Berberis thunbergii ‘Atropurpurea’ pobrane w lipcu i potraktowane
ukorzeniaczem ukorzeniły się w 69%. Znacznie niższe wartości
zanotowali Majid Ali i in. (2008) ukorzeniając pędy Berberis aristata – w zależności od zastosowanej dawki ukorzeniacza od 10 do
50% badanych roślin wytworzyło korzenie. W badaniach własnych
analizując rodzaj Spiraea – uzyskano od 85 do 95% ukorzenionych
roślin, ale lepsza pod tym względem okazała się zielonolistna odmiana ‘Japanese Dwarf’. W omawianym doświadczeniu wszystkie
sadzonki traktowano identycznie, zatem uzyskane wyniki wskazują
na to, że zdolność ukorzeniania zależy od właściwości genetycznych
badanych odmian. Wpływ genotypu na proces ukorzeniania sadzonek półzdrewniałych był wielokrotnie podkreślany w badaniach
naukowych (Kibbler i in. 2004, Aminual Islam i in. 2010). Denaxa
i in. (2011) uzyskali istotne różnice (sięgające nawet 90 punktów
procentowych) ukorzeniając pędy trzech odmian oliwki europejskiej. Autorzy ci zwrócili również uwagę na rolę podłoża w procesie
ukorzeniania, twierdząc iż najlepsze efekty daje podłoże organiczne.
Bhusal i in (2001) badając ukorzenianie półzdrewniałych sadzonek
kilkunastu odmian pomarańczy zanotowali ogromne zróżnicowanie
przebiegu tego procesu – procent ukorzenionych roślin był istotnie
różny w przypadku każdej odmiany. Ponadto autorzy podkreślają
wagę innych czynników wpływających na proces ukorzeniania
roślin, wśród nich poza genotypem, wymieniają: hormony wzrostu,
dojrzałość roślin matecznych, termin pobrania sadzonek, oraz czynniki środowiskowe. Pacholczak i in. (2006) twierdzą, że cieniowanie
roślin przed pobraniem sadzonek korzystnie wpływa na ukorzenianie berberysu Thunberga ‘Red Chief’. Nawiązując do substancji
stymulujących ukorzenianie warto podkreślić, że niewątpliwie
wspomagają one proces ryzogenezy u krzewów (Sandhu i in. 1989,
Szydło i Pacholczak 2003) ale w ostatnich badaniach (Pacholczak
et al. 2010, Szydło and Pacholczak 2010) naukowcy proponują stosowanie biopreparatów jako substancji alternatywnych do tradycyjnych sypkich ukorzeniaczy stosowanych przez lata w komercyjnej
produkcji roślin. Analizując jakość uzyskanego materiału stwierdzono, że ukorzenione sadzonki berberysów różnią się długością
i liczbą korzeni przypadających na jedną roślinę (Tab. 1, Fot. 1). Aż
483
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
90% ukorzenionych sadzonek odmiany ’Kobold’ wytworzyło korzenie o długości 8,1–12,0 cm (gr. III). Nie zanotowano u tej odmiany
korzeni najkrótszych tj. poniżej 4 cm. Ponadto do grupy I zaliczono
5% sadzonek odmiany ‘Bagatelle’ oraz 13% odmiany ‘Bonanza Gold’.
Pozostałe sadzonki tych odmian zakwalifikowano do grup, w których
rośliny wytworzyły korzenie o długości 4,1 do 12,0 cm. Majid Ali
i in. (2008) twierdzą, że na długość korzeni u roślin z rodzaju Berberis
może wpływać zarówno dawka auksyny, jak i miejsce pobrania sadzonki z rośliny matecznej. Wg tych autorów najdłuższe korzenie
(9,5 cm) wytworzyły pędy, które pobrano z wierzchołkowych części
krzewów i potraktowano hormonem IBA w stężeniu 5000 ppm, najkrótsze zaś (0,4 cm) uzyskano z sadzonek pobranych z dolnych partii krzewów i potraktowanych auksyną w stężeniu 7500 ppm.
W poszczególnych grupach rośliny wytwarzały różną liczbę korzeni (Tab. 1). W grupie I na jedną roślinę odmian: ‘Bonanza Gold’
oraz ‘Bagatelle’ przypadało 8 korzeni. Grupa II była wyrównana – genotyp nie wpłynął istotnie na badaną cechę, rośliny wytworzyły 8–11
korzeni. W grupie III najkorzystniej pod tym względem wypadła
odmiana ‘Kobold’ – średnio na jedną roślinę przypadało 20 korzeni
o długości 8,1–12,0 cm. Warto podkreślić, że rozwój systemu korzeniowego jest procesem długotrwałym. Niezwykle ważne jest, aby
podczas cyklu produkcyjnego, zwłaszcza na etapie przesadzania,
rośliny posiadały wystarczająco dużo przestrzeni w podłożu, tak by
system korzeniowy nie uległ deformacji, co mogłoby niekorzystnie
wpłynąć na dalszy rozwój materiału szkółkarskiego (Pacholczak i in.
2011).
Najdłuższe korzenie, jakie wytworzyły sadzonki tawuł, miały
4,1–8,0 cm – zaliczono do tej grupy 44–59% uzyskanych roślin (Tab.
2, Fot. 2). W ogóle nie zanotowano korzeni, które pozwoliłyby zakwalifikować wybraną partię materiału do grupy III. Najkrótsze korzenie (do 4,0 cm dł.) wytworzyło 36% sadzonek odmiany ‘Japanese
Dwarf’ oraz ponad 41% sadzonek odmiany ‘Magic Carpet’. Sadzonki
zielonolistnej odmiany ‘Japanese Dwarf’ wytworzyły więcej korzeni
w porównaniu do żółtolistnej ‘Magic Carpet’ – dotyczy to roślin
o krótszych (gr. I) oraz dłuższych (gr. II) korzeniach (Tab. 2). Aminul
Islam i in. (2010) badając rozmnażanie wegetatywne Jatropha curcas, stwierdzili, że na jakość systemu korzeniowego może wpływać
484
Ukorzenianie karłowych odmian Tawuły japońskiej i Berberysu thunberga
również stopień zdrewnienia sadzonek pędowych. Marks i Simpson
(2000) podkreślają, że schematy opisujące procesy ukorzeniania,
zarówno u roślin zielnych, jak i zdrewniałych powinny być szczegółowiej zbadane – pozwoliłoby to na zrozumienie roli jaką pełnią
hormony roślinne w tym skomplikowanym procesie. Co więcej, opisane w przyszłości schematy mogłyby wyjaśnić różnice istniejące
między łatwo (Forsythia × intermedia) i trudno (Syringa vulgaris)
ukorzeniającymi się krzewami ozdobnymi.
W badaniu analizowano ukorzenianie sadzonek półzdrewniałych
uzyskując wysoki wskaźnik ukorzeniania odmian berberysów i tawuł.
Wynik ten wskazuje na to, że przy zachowaniu właściwych metod
i stosowaniu odpowiedniego typu sadzonek, ogrodnicy mogą osiągnąć
zadawalające rezultaty, które powinny przełożyć się na pozytywne
efekty ekonomiczne w produkcji szkółkarskiej. Warto podkreślić,
że rozmnażanie wegetatywne roślin drzewiastych z wykorzystaniem właśnie sadzonek półzdrewniałych daje istotnie wyższe efekty
w porównaniu do sadzonek zielnych lub zdrewniałych (Aminul Islam
i in. 2010).
WNIOSKI
Badane odmiany wykazały wysoki stopień ukorzeniania sadzonek
półzdrewniałych, przekraczający 85%.
Spośród trzech odmian berberysu Thunberga najlepiej ukorzeniła się zielonolistna odmiana ‘Kobold’ (99%), a 90% uzyskanych
sadzonek posiadało najdłuższy oraz najbardziej rozrośnięty system
korzeniowy.
Spośród dwóch badanych odmian tawuły japońskiej najwyższy
procent ukorzenienia (99,5%) uzyskała zielonolistna ‘Japanese
Dwarf’, sadzonki tej odmiany wytworzyły również najlepszy system
korzeniowy oceniany liczbą korzeni.
Pragniemy podziękować Szkółce Krzewów Ozdobnych Hajdrowscy za
umożliwienie realizacji tego doświadczenia.
485
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
Tab 1. Jakość ukorzenionych sadzonek Berberis thunbergii.
Udział ukorzenionych
roślin w poszczególnych
grupach (%)
Odmiana
Liczba korzeni wytwarzanych przez jedną
roślinę
Gr. I
Gr. II
Gr. III
Gr. I
Gr. II
Gr. III
‘Bonanza Gold’
13,0 c *
41,0 c
39,0 a
8,0 b
11,5 a
14,2 a
‘Bagatelle’
5,5 b
22,5 b
58,5 b
8,0 b
8,5 a
16,5 a
‘Kobold’
0,0 a
9,0 a
90,0 c
0,0 a
8,5 a
20,2 b
*Średnie oznaczone w tymi samymi literami nie różnią się istotnie na poziomie istotności α=0.05.
Tab 2. Jakość ukorzenionych sadzonek Spiraea japonica.
Udział ukorzenionych
roślin w poszczególnych
grupach (%)
Odmiana
Liczba korzeni wytwarzanych przez jedną
roślinę
Gr. I
Gr. II
Gr. I
Gr. II
‘Japanese Dwarf’
36,0 a*
59,5 a
21,5 b
27,7 b
‘Magic Carpet’
41,5 b
44,0 a
14,2 a
19,2 a
*Uwaga: jak w tab. 1.
*Średnie oznaczone w tymi samymi literami nie różnią się istotnie na poziomie istotności α=0.05.
Ryc. 1. Procent ukorzenionych sadzonek.
486
Ukorzenianie karłowych odmian Tawuły japońskiej i Berberysu thunberga
a)b)c)
Fot. 1. Ukorzenione sadzonki Berberis thunbergii ‘Bagatelle’:
a) grupa I, b) grupa II, c) grupa III.
a)b)
Fot. 2. Ukorzenione sadzonki Spiraea japonica ‘Japanese Dwarf’:
a) grupa I, b) grupa II.
487
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
LITERATURA
Aminual Islam A. K. M., Yaakob Z., Anuar N., Osman M. 2010. Propagation
potentials of genotypes and different physiological ages of stem cuttings in
Jatropha curcas L. Journal of Agricultural Science, 2(4),75–82.
Bhusal R. C., Mizutani F. , Moon D., Rutto K.L. 2001. Propagation of citrus by
stem cuttings and seasonal variation in rooting capacity. Pakistan Journal
of Biological Sciences, 4 (11), 1294–1298.
Chojnowska E. 2004. Rozmnażamy drzewa i krzewy liściaste. Działkowiec,
Warszawa. Denaxa N. K., Vemmos S. N., Roussos P. A., Kostelenos
G. 2011. The effect of IBA, NAA and carbohydrates on rooting capacity of leafy cuttings in three olive cultivars (Olea europaeae L.). Acta
Horticulturae, 924, 101–109.
Davidescu V. E., caretu G., Madjar R. M., Stanica F., Peticila A. G., Dumitrascu
M. 2003. The influence of substrate and cutting period on the propagation
of some ornamental species. Acta Horticulturae, 608, 273–276.
Kibbler H., Johnston M.E., Williams R.R. 2004. Adventitious root formation
in cuttings of Backhousia citriodora F. Muell – 1. Plant genotype, juvenility
and characteristics of cuttings. Scientia Horticulturae, 102, 133–143.
Majid Ali, Malik A. R., Rai Sharma K. 2008. Vegetative propagation of Berberis aristata DC. An endangered Himalayan shrub. Journal of Medicinal
Plants Research, 2(12), 374–377.
Marks T. R., Simpson S.E. 2000. Rhizogenesis in Forsythia × intermedia and
Syringa vulgaris; application of a simple internode experimental system.
Plant Cell Reports, 19, 1171–1176.
Pacholczak A., Szydło W., Łukaszewska A. 2006. The effect of etiolation and
shading of stock plants on rooting in stem cutting of Berberis thunbergii DC.
‘Red Chief ’. Propagation of Ornamental Plants, 6(2), 100–107.
Pacholczak A., Szydło W. 2008. The influence of biological preparations Grevit
200 SL and Biochikol 020 PC on rooting of cuttings Berberis thunbergii
‘Green Carpet’ and Potentilla fruticosa ‘Goldfinger’. Annals of Warsaw
University of Life Sciences – SGGW, Horticulture and Landscape
Architecture, 29, 53–58.
Pacholczak A., Szydło W., Pijus J. 2010. Effect of Asahi SL preparation on
rhizogenesis in stem cuttings of Physocarpus opulifolius ‘Dart’s Gold’
and ‘Diabolo’. Annals of Warsaw University of Life Sciences – SGGW,
Horticulture and Landscape Architecture, 31, 11–17.
Pacholczak A., Szydło W., Deda K. 2011. The effect of Starter-Plus on shoot
growth and the development of root system of three ornamental shrubs during the first year after re-potting. Annals of Warsaw University of Life
Sciences – SGGW, Horticulture and Landscape Architecture, 32, 35–42.
488
Ukorzenianie karłowych odmian Tawuły japońskiej i Berberysu thunberga
Sandhu A. S., Singh S.N., Minhas P. P. S., Grewal G. P. S. 1989. Rhizogenesis
of Shoot Cuttings of Raspberry (Physalis Peruviana L.). Indian Journal of
Horticulture, 46(3), 376–378.
Szydło W. 2006. Szkółkarstwo ozdobne. Agencja Promocji Zieleni, Warszawa,
ss.114. Szydło W., Pacholczak A. 2003. Rhizogenesis in shoot cuttings of
several ornamental shrubs. Folia Horticulturae, 15(2), 191–201.
Szydło W., Pacholczak A. 2010. Effect biopreparations Asahi SL and fertilizer
Osmocote 5–6M on growth of Hydrangea arborescens ‘Anabelle’. Annals
of Warsaw University of Life Sciences – SGGW, Horticulture and
Landscape Architecture, 31, 3–9.
Waźbińska J., Kawecki Z., Płoszaj B. 2008. Drzewa i krzewy liściaste. UWM,
Olsztyn.
Anna Kapczyńska
Katedra Roślin Ozdobnych
Uniwersytet Rolniczy w Krakowie
Al. 29 Listopada 54, 31–427 Kraków
e-mail: [email protected]
489
Mariusz Adamski
Katarzyna Pisarska
EPISTEME
18/2013, t. 3
s. 491–497
ISSN 1895-2241
Ocena zróżnicowania endosymbiotycznych
bakterii zasiedlających komórki boczniaka
(Pleurotus (Fr.) P. Kumm) z wykorzystaniem
techniki MSSCP
The biodiversity determination of endosymbiotic
bacteria inhabiting oyster mushroom (Pleurotus
(Fr.) p. Kumm) cells using MSSCP method
Abstrakt. Opisano kilka przypadków endosymbiozy wśród grzybów. Celem
niniejszej pracy była ocena zróżnicowania endosymbiontów boczniaka ostrygowatego. Przebadano 8 linii tego grzyba pochodzących z różnych rejonów świata. Endosymbionty zostały wyizolowane na zmodyfikowanym
podłożu TSB. Całkowite DNA izolowane z grzybni oraz DNA izolatów
z boczniaka było analizowane za pomocą techniki PCR. Wykorzystano primery 799f i 1492r dla markera bateryjnego fragmentu 16S rRNA oraz P338f
i P518r dla oceny zróżnicowania endosymbiontów. Wszystkie analizowane
szczepy boczniaka wykazały obecność bakteryjnego fragmentu 16S rRNA.
Za pomocą techniki MSSCP (Multitemperature Single Strand Conformation
Polymorphism) wykazano istotne zróżnicowanie genetyczne pomiędzy izolatami. Spośród ośmiu tylko trzy wykazały zbliżony układ prążków. Każdy
z pozostałych pięciu posiada unikalny układ.
Słowa kluczowe: boczniak, endosymbionty, endobakterie, grzyby, zróżnocowanie
Summary. Several cases of endosymbiosis in fungal are reported. The aim
of this study was to determine the biodiversity of oyster mushroom endosymbionts. Studies cover eight oyster mushroom lines originating from different regions of the world. Endosymbionts were isolated on a modified TSB
medium. The isolates DNA, as well as total fungi DNA, was analyzed using
PCR techniques. Primers 799f & 1492r for bacterial 16S rRNA and P338f &
P518r for determination of bacteria diversity were used. For all tested fungal lines fragment of bacterial 16S rRNA were observed. Multitemperature
Single Strand Conformation Polymorphism (MSSCP) method revealed significant genetic differentation between isolates. Among eight isolates only
three shown similar bands pattern. Each of remaining five isolates demonstrate unique patterns.
Key words: oyster mushroom, endosymbionts, endobacteria, fungi, diversity
491
Mariusz Adamski, Katarzyna Pisarska
Wstęp
W obecnej chwili niewiele wiadomo o występowaniu i zróżnicowaniu
endosymbiotycznych bakterii w komórkach grzybów. Tego typu
zależność opisano tylko u nielicznych gatunków. Obecność endosymbiontów obserwowano głównie u grzybów ektomikoryzowych
z rodzaju Gigasporaceae [Bianciotto i in. 1996, Bonfante 2003, Cruz
i in. 2008]. Stwierdzono tu obecność nowego gatunku „Candidatus
Glomeribacter gigasporum” [Bianciotto i in. 2003]. Patogen upraw
Rhizopus microsporus jest z kolei zasiedlany przez nowe gatunki bakterii Burkholderia rhizoxinica sp. nov. i Burkholderia endofungorum
sp. nov [Partida-Martinez i in. 2007]. Wśród grzybów wyższych stwierdzono występowanie endosymbiotycznych bakterii z rodzaju Paenibacillus
u podstawczaka Laccaria bicolor. [Bertaux i in. 2003].
Literatura przedmiotu donosi o występowaniu bakterii
związanych z jednym szczepem boczniaka Pleurotus ostreatus [Yara
i in. 2006]. Adamski i Pisarska [2012] stwierdzili występowanie endosymbiontów w różnych liniach boczniaka pochodzących z różnych
rejonów geograficznych świata. Celem niniejszej pracy była analiza
ich zróżnicowania.
Materiały i metody: Przebadano 8 linii boczniaka ostrygowatego
pochodzących z różnych rejonów świata: PxS, PB 63S, P Bo6 S – Poznań; P234, P112 – Lublin; PB8, PB7’96 – Japonia, P USA S – Stany
Zjednoczone Ameryki Północnej. Linie zostały udostępnione przez
Katedrę Technologii Owoców, Warzyw i Grzybów Uniwersytetu
Przyrodniczego w Lublinie. Do analiz posłużyły grzyby z 10 dniowej
hodowli prowadzonej na podłożu cebulowym w 28ºC [za Kulnianin,
dane niepublikowane].
Izolację endosymbiontów przeprowadzono w dwóch etapach.
W pierwszym przeprowadzono hodowlę grzybów jak opisano powyżej.
Z hodowli pobrano krążek grzybni wraz z podłożem o średnicy 12 mm
i umieszczono na zmodyfikowanym podłożu TSA (Fluka, Niemcy) z dodatkiem 1% Tween 20 (AppliChem GmbH, Niemcy) tak by grzybnia
stykała się z podłożem. Płytki inkubowano 14 dni w 28ºC. W drugim
etapie pobrano fragment podłoża (50 mm2) zawierającego endosymbionty i inokulowano nim zmodyfikowane płynne podłoże TSB (Fluka,
Niemcy) z 1% Tween 20. Próby inkubowano 14 dni w 28ºC stacjonarnie. Uzyskane zawiesiny zwirowano przy 10 000 r.p.m. (15 min.). Tak
uzyskane izolaty wykorzystano do dalszych analiz.
492
Ocena zróżnicowania endosymbiotycznych bakterii zasiedlających komórki...
Namnożone mikroorganizmy poddano izolacji DNA za pomocą
zestawu Genomic Mini AX Bacteria Spin (AA Biotechnology, Polska)
zgodnie z protokołem. Całkowite DNA grzybów izolowano za pomocą PowerSoilTM Isolation Kit (MO BIO Laboratories, Inc., USA),
zgodnie z protokołem producenta.
W celu potwierdzenia obecności endosymbiontów w analizowanych liniach boczniaka, oraz ich bakteryjnej natury, przeprowadzono reakcję PCR z wykorzystaniem DNA pozyskanego
z izolatów, lub całkowitego DNA grzybowego, buforu 5x Hot FIREPol
Blend Master Mix (Solis Biodyne, Estonia) oraz primerów 799f
i 1492r. Primery te wykluczają amplifikację DNA mitochondrialnego,
dlatego wykorzystywane są w identyfikacji endofitów bakteryjnych
[Chelius i Triplett, 2001; Nissinen i in. 2012]. Kontrolę stanowiło
całkowite DNA wyizolowane z kukurydzy cv. Cyrkon (Zea mays L.)
oraz szczep Pseudomonas fluorescens PE16 pochodzące z kolekcji Zakładu
Mikrobiologii Rolniczej Uniwersytetu Przyrodniczego we Wrocławiu.
Produkt reakcji poddano elektroforezie w 0,8% żelu agarozowym (70
min., 100V). Żel barwiono 15 minut 5% roztworem bromku etydyny
(Sigma-Aldrich, USA). Wizualizację prążków oraz analizę wielkości
przeprowadzono za pomocą ciemni Dark Hood DH 40/50 i programu
GelixOne 1D Software (Biostep GmbH, Niemcy).
W celu oceny zróżnicowania izolatów wykorzystano technikę
MSSCP [Tomkczyk-Żak i in. 2012]. Przeprowadzono reakcję PCR
z DNA z izolatów oraz primerami P338f i P518r [Boon i in. 2002].
Jako kontrolę wykorzystano całkowite DNA z boczniaka (linie PxS
i P Bo6S) oraz szczepy Pseudomonas fluorescens PE16, Arthrobacter nicotinovorans A7, Staphyloccocus saprophyticus A99, Brachybacterium
conglomeratum A20, Bacillus aerophilus A61 pochodzące z kolekcji
ZMR UP we Wrocławiu i Fusarium oxysporum IOR1664 z Instytutu
Ochrony Roślin w Poznianiu. Obecność produktu reakcji sprawdzono za
pomocą elektroforezy w 1% żelu agarozowym (60 min., 100V). Produkt
poddano rozdziałowi z wykorzystaniem techniki MSSCP za pomocą
urządzenia DNA Pointer System (Krzysztof Kucharczyk Techniki
Elektroforetyczne Sp. z o.o., Polska). Próbki zdenaturowano zgodnie z zaleceniami producenta. Rozdział przeprowadzono w 20% żelu
poliakryloamidowym przy stałym napięciu 150V w temperaturach
60ºC, 35ºC i 10ºC przez 90 minut dla każdej temperatury. Żel wybarwiono i zwizualizowano jak wyżej.
493
Mariusz Adamski, Katarzyna Pisarska
Wyniki i dyskusja
Izolacja endosymbiontów z grzybni na stałym podłożu nie pozwoliła
na morfologiczne rozróżnienie uzyskanych izolatów. Niemożliwe
było również uzyskanie czystych kolonii pochodzących od pojedynczych komórek izolatów. Było to powodem przeprowadzenia drugiego etapu izolacji, który doprowadził do uzyskania z każdej linii
boczniaka izolatu będącego mieszaniną zasiedlających go endosymbiontów. Izolaty zostały oznaczone przez dodanie litery „b” do nazwy
linii z której zostały wyizolowane.
Produkt reakcji PCR z primerami dla fragmentu 16S rRNA, o wielkości 700 pz, został stwierdzony we wszystkich izolatach oraz liniach boczniaka (Ryc. 1). Jest on charakterystyczny tylko dla bakterii.
Wyniki te świadczą o bakteryjnej naturze izolatów. Wybór tej metody
przeprowadzenia doświadczenia podyktowany był brakiem w literaturze opisu podobnej metody dla analiz endosymbiontów grzybów.
Ryc. 1. Elektroforeza produktów reakcji PCR z primerami dla 16S rRNA.
Ścieżka 1: marker DirectLoadTM Step Ladder, 50 bp (SIGMA, USA);
2: PxSb; 3: P112b; 4: PB 63Sb; 5: PB7’96b; 6: P Bo6 Sb; 7: P234b;
8: PB8b; 9: P USA Sb; 10: kukurydza (prążek 1100 pz – 16S rRNA mitochondrium, 700 pz – 16S rRNA bakterii; 11: Pxs; 12: P112; 13: PB 63S; 14:
PB7’96; 15: P Bo6S; 16: P234; 17: PB8; 18: P USA S; 19: P. fluorescens PE16;
20: próba ślepa
Za pomocą rozdziału MSSCP produktów reakcji z primerami
P338f i P518r przeprowadzono analizę zróżnicowania izolatów
(Ryc. 2). Trzy izolaty (P112b, PB63Sb, P234b) wykazały podobny
układ prążków. Każdy z pozostałych pięciu izolatów wykazał unikalny wzór. Świadczy to o dużym zróżnicowaniu genetycznym i prawdopodobnie gatunkowym izolatów z poszczególnych linii boczniaka.
Jednocześnie zróżnicowanie te nie wykazuje związku z pochodzeniem analizowanych szczepów grzybów.
494
Ocena zróżnicowania endosymbiotycznych bakterii zasiedlających komórki...
Ryc. 2. Profile MSSCP. Ścieżka 1: P USA Sb; 2: PB8b; 3: P112b; 4: PB 63Sb;
5: P Bo6Sb; 6: PxSb; 7: PB7’96b; 8: P234b; 9: PxS; 10: P Bo6S; 11:
P. fluorescens PE16; 12: A. nicotinovorans A7; 13: S. saprophyticus A99; 14:
B. conglomeratum A20 15: B. aerophilus A61; 16: F. oxysporum 1664; 17:
próba ślepa.
Każdy z analizowanych izolatów daje wieloprążkowy obraz
po analizie MSSCP. Świadczyć to może o dużym zróżnicowaniu genetycznym w obrębie poszczególnych linii boczniaka. Uniemożliwia
to ich identyfikację za pomocą tradycyjnego sekwencjonowania fragmentu 16S rRNA. W celu ustalenia zróżnicowania gatunkowego
endosymbiontów uzyskane fragmenty 16S rRNA poddane zostaną
klonowaniu a uzyskane w ten sposób biblioteki klonów posłużą do
identyfikacji.
Wnioski
Izolaty ze wszystkich analizowanych linii boczniaka są blisko
spokrewnione z bakteriami.
Występuje duże zróżnicowanie pomiędzy izolatami z różnych
linii boczniaka.
Występuje duże zróżnicowanie izolatów w obrębie poszczególnych linii boczniaka.
Zróżnicowanie izolatów nie jest związane z pochodzeniem macierzystej linii boczniaka.
495
Mariusz Adamski, Katarzyna Pisarska
Literatura
Adamski M., Pisarska K. 2012. Występowanie endosymbiotycznych bakterii w komórkach boczniaka (Pleurotus (Fr.) P. Kumm). Materiały
pokonferencyjne I Międzynarodowej Konferencji Odktorantów
“Wielokierunkowość Badań w Rolnictwie i Leśnictwie”, EPISTEME,
14/2012: 155–160.
Bertaux J., Schmid M., Prevost-Boure N. C., Churin J. L., Hartmann A.,
Garbaye J., Frey-Klett P. 2003. In situ identification of intracellular bacteria related to Paenibacillus spp. in the mycelium of the ectomycorrhizal fungus Laccaria bicolor S238N. Appl Environ Microbiol. Jul; 69(7): 4243–8.
Bianciotto V., Bandi C., Minerdi D., Sironi M., Tichy H.V., Bonfante, P. 1996.
An obligately endosymbiotic mycorrhizal fungus itself harbors obligately intracellular bacteria. Appl. Environ. Microbiol. 62: 3005–3010.
Bianciotto V., Lumini E., Bonfante P., Vandamme P. 2003. ’Candidatus glomeribacter gigasporarum’ gen. nov., sp. nov., an endosymbiont of arbuscular
mycorrhizal fungi. Int J Syst Evol Microbiol. Jan; 53(Pt1): 121–4.
Bonfante P. 2003. Plants, mycorrhizal fungi and endobacteria: a dialog among
Cells and genomes. The Biological Bulletin, 204: 215–20.
Boon N., DeWindt W., Verstraete W., Top E. M. 2002. Evaluation of nested
PCR-DGGE (denaturing gradient gel electrophoresis) with group-specific
16S rRNA primers for the analysis of bacterial communities from different
wastewater treatment plants. FEMS Microbiology Ecology, 39: 101–112.
Chelius M. K., Triplett E. W. 2001. The diversity of archaea and bacteria in
association with the roots of Zea mays L. Microb Ecol, 41: 252–263.
Cruz A.F., Horii S., Ochiai S., Yasuda A., Ishii T. 2008. Isolation and analysis of
bacteria associated with spores of Gigaspora margarita. Journal of Applied
Microbiology, 104: 1711–1717.
Nissinen, R. M., Männistö, M. K., & Elsas, J. D. 2012. Endophytic bacterial
communities in three arctic plants from low arctic fell tundra are cold‐adapted and host‐plant specific. FEMS Microbiology Ecology, 82(2): 510–522.
Partida-Martinez L. P., Groth I., Schmitt I., Richter W., Roth M., Hertweck
C. 2007. Burkholderia rhizoxinica sp. nov. and Burkholderia endofungorum
sp. nov., bacterial endosymbionts of the plantpathogenic fungus Rhizopus
microsporus. Int J Syst Evol Microbiol, 57Pt 11): 2583–90.
Tomczyk-Żak K., Kaczanowski S., Górecka M. Zielenkiewicz U. 2012. Novel
application of the MSSCP method in biodiversity studies. Journal of Basic
Microbiology, 52: 104–109.
Yara R., Maccheroni W. Jr, Horii J., Azevedo J. L. 2006. A bacterium belonging
to the Burkholderia cepacia complex associated with Pleurotus ostreatus.
J Microbiol. Jun, 44(3): 263–8.
496
Ocena zróżnicowania endosymbiotycznych bakterii zasiedlających komórki...
*mgr. Mariusz Adamski
*mgr. Katarzyna Pisarska
Zakład Mikrobiologii Rolniczej
Katedra ochrony Roślin
Uniwersytet Przyrodniczy we Wrocławiu
e-mail: [email protected]
*Stypendysta programu „Przedsiębiorczy doktorant – inwestycja
w innowacyjny rozwój regionu”, realizowanego w ramach Programu Operacyjnego Kapitał Ludzki, Priorytet VIII Regionalne Kadry Gospodarki,
Działanie 8.2 Transfer Wiedzy, Poddziałania 8.2.2 Regionalne Strategie
Innowacji
Opiekun naukowy: prof. dr hab. Stanisław J. Pietr
497
Agata Fabiszewska
Krystyna Zielińska
EPISTEME
18/2013, t. 3
s. 499–505
ISSN 1895-2241
WPŁYW OBECNOŚCI OCHRATOKSYNY A
NA WZROST SZCZEPÓW Z RODZAJU LACTOBACILLUS
IMPACT OF OCHRATOXIN A PRESENCE IN MEDIA
ON LACTOBACILLUS SPECIES GROWTH
Abstrakt. Celem pracy była ocena wpływu ochratoksyny A, toksyny produkowanej przez grzyby strzępkowe, na wzrost pięciu szczepów bakterii fermentacji mlekowej (Lactobacillus buchnerii KKP 907 p, L. fermentum
N KKP 2020 p, L. plantarum C KKP 788 p, L. plantarum K KKP 593 p and
L. plantarum S KKP 880. Długość fazy adaptacyjnej wzrostu została określona w podłożu LYM za pomocą automatycznego systemu detekcji mikroorganizmów BacT/ALERT® (Biomerieux). Podłoża zawierały ochratoksynę
A (OTA) w stężeniu: 50, 75, 100 ppb, poza podłożem kontrolnym, które nie
zawierało dodatku OTA. Aby ocenić wpływ OTA na przebieg fazy wzrostu logarytmicznego, oznaczono liczbę bakterii po 48 h hodowli. Stwierdzono, że
obecność ochratoksyny A w podłożu w ilości 100 ppb, nie miała wpływu na
obie badane fazy wzrostu. Potwierdzono, że żaden z pięciu szczepów bakterii fermentacji mlekowej nie był wrażliwy na obecność OTA w badanym
zakresie stężeń.
Słowa kluczowe: Lactobacillus, BacT/ALERT®, ochratoksyna A
Summary. The objective of the study was to evaluate an impact of ochratoxin A (a naturally occurring toxin produced by moulds) on growth of five
lactic acid bacteria strains (Lactobacillus buchnerii KKP 907 p, L. fermentum
N KKP 2020, L. plantarum C KKP 788 p, L. plantarum K KKP 593 p and
L. plantarum S KKP 880). The length of lag phase was determined using an
automated microbial detection system BacT/ALERT® and a LYM medium
(Biomerieux). Media contained ochratoxin A (OTA) in concentration: 50,
75, 100 ppb, except for the control medium, which did not contain OTA.
To determine an impact of OTA on log phase the number of bacteria counts
was estimated after 48 h. As for the presence of 100 ppb of ochratoxin A no
impact on both growth phases was found. There was proved that five lactic
acid bacteria strains were not sensitive to examined concentration of OTA.
Key words: Lactobacillus, BacT/ALERT®, ochratoxin A
499
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
Wstęp
Ochrona środowiska naturalnego wiąże się z produkcją pasz bezpiecznych dla zdrowia zwierząt, a zatem stosowania odpowiednich
metod ich zabezpieczania przed rozwojem grzybów strzępkowych
wytwarzających toksyczne metabolity drugorzędowe – mikotoksyny,
w tym kancerogenną ochratoksynę A (OTA). OTA została uznana
za powszechnie występującą mikotoksynę w surowcach roślinnych
w Polsce, a zatem poszukiwanie metod dekontaminacji skażonych surowców jest istotnym problemem badawczym [Kluczek i Kojder 2000].
Istnieją nieliczne doniesienia naukowe traktujące zagadnienia
mikrobiologicznej degradacji ochratoksyny A. Wśród drobnoustrojów zdolnych do eliminacji OTA są bakterie fermentacji mlekowej,
interesujące z punktu widzenia bezpieczeństwa ich stosowania,
a szczególnie szczepy z rodzaju Lactobacillus (m. in. L. salivarius,
L. delbrueckii, L. acidophilus, L. helvetius, L. casei, L. lactis subsp. lactis,
L. plantarum, L. sanfranciscensis, L. brevis i L. rhamnosus). Większość
z nich obniża zawartość ochratoksyny A tylko o około kilkanaście procent. Wrażliwość szczepów bakterii na obecność tej mikotoksyny w środowisku nie jest zależna od zdolności do jej degradacji
[Piotrowska i Żakowska 2000, 2005, Fuchs i in. 2008]. Ważnym
zatem problemem badawczym jest ocena wrażliwości na obecność
ochratoksyny A szczepów bakterii, wchodzących w skład kultur
starterowych, o zdolności do obniżania poziomu ochratoksyny
A. Szczepy charakteryzujące się niską wrażliwością na obecność OTA
oraz jednoczesną zdolnością do obniżania jej poziomu w środowisku
mogą znaleźć zastosowanie w biologicznej dekontaminacji fermentowanych produktów pochodzenia roślinnego.
Celem niniejszej pracy była ocena wpływu ochratoksyny A na
wzrost pięciu szczepów bakterii fermentacji mlekowej z rodzaju
Lactobacillus. Wszystkie badane szczepy cechowały się zdolnością do
obniżania zawartości OTA średnio o co najmniej 20 % w warunkach
in vitro [Kapturowska i in., 2010].
Materiały i metody
Badania prowadzono z udziałem następujących szczepów bakterii
fermentacji mlekowej, należących do Kolekcji Kultur Drobnoustrojów
Przemysłowych Instytutu Biotechnologii Przemysłu Rolno500
Wpływ obecności ochratoksyny a na wzrost szczepów...
Spożywczego: Lactobacillus buchneri KKP 907 p, L. fermentum
N KKP 2020 p, L. plantarum K KKP 593 p, L. plantarum C KKP 788
p, L. plantarum S KKP 880. Inokulum bakteryjne przygotowywano
w płynnym podłożu MRS [de Man i in., 1960]. Bakterie hodowano
przez 48 h w temperaturze 30 oC. Długość trwania fazy adaptacyjnej szczepów bakterii w czasie hodowli w podłożu LYM badano za
pomocą zautomatyzowanego analizatora mikrobiologicznego BACT/
ALERT® firmy Biomerieux według instrukcji producenta oraz wyników prac Kunickiej [2006] i Sokołowskiej [2008]. Zasada pomiaru
w analizatorze polega na kolorymetrycznym pomiarze ilości metabolitów wydzielanych zewnątrzkomórkowo do podłoża, co pozwala na
określenie czasu detekcji w aparacie, a tym samym pośrednio ocenę
długości lag fazy (fazy adaptacyjnej wzrostu komórek). Liczbę j.t.k.
bakterii po 48 h hodowli oznaczono metodą posiewów na podłożu
stałym MRS. Płytki inkubowano przez 72 h w temperaturze 30 oC.
Wyniki przeprowadzonych badań analizowano metodami
statystycznymi przy pomocy oprogramowania STATISTICA 8.0
(Statsoft, Polska). Wszystkie doświadczenia wykonywano w trzech
powtórzeniach. W celu weryfikacji hipotezy statystycznej o normalności rozkładu danych doświadczalnych stosowano test ShapiroWilka, zaś hipotezę o jednorodności wariancji weryfikowano za pomocą dwóch testów: testu Levene’a oraz testu Browna-Forsythe’a.
Do oceny istotności różnic zastosowano test F analizy wariancji.
We wszystkich analizach statystycznych ustalono poziom istotności
a=0,05. Zaufanie do uzyskanych wniosków wynosi 95 %.
Wyniki i dyskusja
Ocenę czasu trwania fazy adaptacyjnej wykonano z użyciem analizatora BACT/ALERT®, a liczba bakterii fermentacji mlekowej oznaczona po 48 h hodowli pozwoliła na określenie wpływu ochratoksyny
A na przebieg faz wzrostu logarytmicznego pięciu szczepów z rodzaju Lactobacillus. W zależności od stężenie OTA w podłożu czas detekcji dla szczepu Lactobacillus plantarum S KKP 880 wynosił od 20 do
25 h (tab. 1), a liczba komórek bakterii po 48 h hodowli wahała się
od 8,05 (dla próby kontrolnej, kiedy w podłożu nie znajdowała się
OTA) do 7,51 j.t.k./cm3 (dla podłoża z 100 ppb OTA). Dłuższe czasy
detekcji odnotowano dla szczepu L. plantarum K KKP/593/p od 23
do 30 h w zależności od inokulum, którym szczepiono podłoża, ale
501
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
liczba komórek bakterii po 48 h hodowli wynosiła od 8,04 do 7,05
j.t.k./cm3. Szczep L. plantarum K KKP/593/p okazał się nieco bardziej
wrażliwy na obecność OTA przy stężeniu 100 ppb (tab. 1).
Tab. 1. Wpływ stężenia ochratoksyny A na liczbę j.t.k bakterii z rodzaju
Lactobacillus po 48 h hodowli oraz czas detekcji w analizatorze BACT/
ALERT® w dwóch niezależnych hodowlach.
stężenie
OTA [ppb]
Hodowla nr 1
log jtk/cm
3
czas detekcji [h]
Hodowla nr 2
log jtk/cm3 czas detekcji [h]
Lactobacillus plantarum S KKP 880
0
50
75
100
0
50
75
100
7,76
21
8,05
7,75
20
7,51
7,82
20
7,89
7,65
20
7,88
Lactobacillus plantarum K KKP 593 p
8,04
23
7,86
7,69
23
7,95
7,37
22
7,88
7,58
22
7,05
25
23
24
24
29
29
30
30
Lactobacillus fermentum N KKP 2020 p
0
50
75
100
0
50
75
100
0
50
75
100
502
8,57
32
7,36
8,20
34
7,10
7,63
35
6,16
8,30
37
7,15
Lactobacillus plantarum C KKP 788 p
7,79
30
6,85
7,38
25
6,45
7,57
26
6,75
7,68
27
6,05
Lactobacillus buchnerii KKP 907 p
7,00
10
6,95
7,08
10
6,65
7,01
10
6,75
6,77
11
6,35
10
10
11
11
10
10
10
11
25
27
26
29
Wpływ obecności ochratoksyny a na wzrost szczepów...
Dużą zmiennością w obrębie rejestrowanego czasu detekcji odznaczały się pozostałe trzy szczepy: L. fermentum N KKP 2020 p,
L. plantarum C KKP 788 p L. buchnerii KKP 907 p, który w zależności
od kondycji komórek bakterii w inokulum wynosił od 10–11 h do
nawet 32–37 h (tab. 1). Liczba komórek bakterii po 48 h hodowli wahała się od 8,57 do 7,63 oraz od 7,36 do 6,16 j.t.k./cm3 dla szczepu
L. fermentum N KKP 2020 p, od 7,79 do 7,38 oraz od 6,85 do 6,05
j.t.k./cm3 dla szczepu L. plantarum C KKP 788 p i od 7,08 do 6,35
j.t.k./cm3 dla szczepu L. buchnerii KKP 907 p.
Przeprowadzono analizę statystyczną uzyskanych danych, która
wskazała, że na czas detekcji danego szczepu w analizatorze BACT/
ALERT® nie ma wpływu ani zawartość OTA w podłożu w zakresie do
100 ppb (p-value=0,996587) ani także rodzaj szczepu (spośród pięciu
badanych w ramach pracy, p-value=0,634664). Z kolei intensywność
rozwoju bakterii wyrażona liczbą komórek bakterii po 48 h hodowli
w podłożu LYM zależała od rodzaju szczepu (p-value=0,009542).
Najsłabszą dynamiką wzrostu odznaczył się szczep Lactobacillus buchneri KKP 907 p, który cechował się istotnie niższą liczbą j.t.k/cm3
po 48 h hodowli w podłożu LYM w stosunku do szczepu L. plantarum
S KKP 880.
Istnieje niewielka ilość doniesień naukowych traktujących zagadnienie wrażliwości bakterii na obecność ochratoksyny A. Według
Fuchs i in. [2008] większość szczepów bakterii fermentacji mlekowej,
zdolnych do eliminacji ochratoksyny A, jest także niewrażliwa na
obecność OTA w przedziale stężeń od 5 ppb do 500 ppb. Autorzy
wskazują także na fakt, że szczepy, które cechują się podobną
wrażliwością w stosunku do mikotoksyny, mogą znacznie różnić
się stopniem jej degradacji [Fuchs i in. 2008]. Z kolei Heller i in.
[1975] donoszą, że obecność OTA w stężeniu 1 mg/cm3 nie wywołała
efektu letalnego u badanych gatunków bakterii: Bacillus subtilis,
Staphylococcus pyogenes var. aureus i Streptococcus faecalis, jednak
jej obecność wpłynęła na wydłużenie logarytmicznej fazy wzrostu
oraz obniżenie dynamiki wzrostu bakterii.
Wnioski
1. Obecność ochratoksyny A w ilości do 100 ppb nie wpływała istotnie na długość fazy adaptacyjnej oraz liczbę komórek badanych szcze503
Anna Kapczyńska, Joanna Morys-Orządała, Karolina Wietnik
pów z rodzaju Lactobacillus po 48 h hodowli w warunkach laboratoryjnych.
2. Liczba j.t.k badanych szczepów bakterii w podłożu kontrolnym oraz w podłożu zawierającym OTA nie różniła się istotnie
statystycznie.
3. Wszystkie badane szczepy bakterii spełniają kryteria małej
wrażliwości na obecność OTA oraz mogą być potencjalnie zastosowane w kulturach starterowych mających na celu dekontaminację
skażonego surowca roślinnego.
Literatura
De Man J. C., Rogosa M., Sharpe M. E. 1960. A medium for the cultivation of
lactobacilli. J. Appl. Bact., 23 (1): 130–135.
Fuchs S., Sontag G., Stidl R., Ehrlich V., Kundi M., Knasmüller S. 2008.
Detoxification of patulin and ochratoxin A, two abundant mycotoxins, by
lactic acid bacteria. Food Chem. Toxicol., 46: 1398–1407.
Heller K., Schultz C., Löser R., Röschenthaler R. 1975. The inhibition of bacterial growth by ochratoxin A. Can. J. Microbiol., 21(7): 972–979.
Kapturowska A., Stecka K., Zielińska K., Kupryś M. 2010. Ocena zdolności
szczepów z rodzaju Lactobacillus do obniżania zawartości ochratoksyny
A w warunkach modelowych. Monografia „Wielokierunkowość Badań
w Rolnictwie i Leśnictwie”, red. Barbara Wiśniowska-Kielian, Wyd. UR
w Krakowie, t. 1: 107–112.
Kluczek J. P., Kojder A. 2000. Mikotoksyny w zarysie. Wydawnictwo Uczelniane
Akademii Techniczno–Rolniczej w Bydgoszczy, Bydgoszcz, 19–39, 90–103.
Kunicka A. 2006. Wykorzystanie aparatu BacT/ALERT do badania produktów
spożywczych, Aktualności Biomerieux, PASSA Zakład Poligraficzny,
Konstancin-Jeziorna, 1: 10–13.
Piotrowska M., Żakowska Z. 2000: The biodegradation of ochratoxin A in food
products by lactic acid bacteria and baker’s yeast. Progr. Biotechnol., Food
Biotechnol. 17: 307–310.
Piotrowska M., Żakowska Z. (2005): Elimination of ochratoxin A by lactic acid
bacteria. Pol. J. Microbiol. 54: 279–286.
Sokołowska B. 2008. System BacT/ALERT w monitorowaniu jakości i bezpieczeństwa żywności, Aktualności Biomerieux, PASSA Zakład Poligraficzny,
Konstancin-Jeziorna, 6: 8–13.
504
Wpływ obecności ochratoksyny a na wzrost szczepów...
mgr inż. Agata Fabiszewska
dr inż. Krystyna Zielińska
Instytut Biotechnologii Przemysłu Rolno-Spożywczego
im. prof. Wacława Dąbrowskiego
Zakład Technologii Fermentacji
ul. Rakowiecka 36, 02–532 Warszawa,
e-mail: [email protected]
505

Podobne dokumenty